WO2021187895A1 - 심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물 - Google Patents

심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2021187895A1
WO2021187895A1 PCT/KR2021/003310 KR2021003310W WO2021187895A1 WO 2021187895 A1 WO2021187895 A1 WO 2021187895A1 KR 2021003310 W KR2021003310 W KR 2021003310W WO 2021187895 A1 WO2021187895 A1 WO 2021187895A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
cardiac stem
angiogenesis
hif
gene
Prior art date
Application number
PCT/KR2021/003310
Other languages
English (en)
French (fr)
Inventor
이승진
김희정
신지영
전정화
서채원
Original Assignee
주식회사 히에라바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 히에라바이오 filed Critical 주식회사 히에라바이오
Priority to US17/912,229 priority Critical patent/US20240058389A1/en
Priority to EP21771577.0A priority patent/EP4123017A4/en
Priority claimed from KR1020210034721A external-priority patent/KR20210116350A/ko
Publication of WO2021187895A1 publication Critical patent/WO2021187895A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/34—Muscles; Smooth muscle cells; Heart; Cardiac stem cells; Myoblasts; Myocytes; Cardiomyocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1825—Fibroblast growth factor [FGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1833—Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1858—Platelet-derived growth factor [PDGF]
    • A61K38/1866—Vascular endothelial growth factor [VEGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/195—Chemokines, e.g. RANTES
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A61K38/4833—Thrombin (3.4.21.5)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to cardiac stem cells, cardiac stem cells with increased angiogenesis, their culture medium and uses thereof, and more particularly, cardiac stem cells, or genes such as HIF-1 ⁇ , VEGF, PDGF, HGF, FGF, etc. It relates to the introduced cardiac stem cells and their uses.
  • Angiogenesis is a phenomenon in which endothelial cells of existing blood vessels decompose, migrate, divide, and differentiate the extracellular matrix to form new capillaries, and appear in physiological processes such as growth, reproduction, and wound healing.
  • angiogenesis is also associated with pathological conditions such as tumor growth, arthritis, and diabetes.
  • Angiogenesis requires a complex series of processes such as growth, migration, differentiation, and capillary formation of endothelial cells, and many angiogenesis promoters and angiogenesis inhibitors involved in these processes have been discovered.
  • Angiogenesis inhibitors are activated against the activity of angiogenesis promoters required for angiogenesis. Since the angiogenesis inhibitors naturally present in the body have low toxicity, they can be used to inhibit pathological angiogenesis, so many related drugs are being developed.
  • Angiogenesis can be said to be an essential phenomenon for wound healing or tissue regeneration.
  • an underdeveloped placenta with angiogenesis is an important cause of abortion, and in the case of necrosis, ulceration and ischemia due to non-vascularization, tissue or organ damage is caused. It may cause malfunction or cause death.
  • diseases such as arteriosclerosis, myocardial infarction, and angina pectoris are also caused by poor blood supply.
  • angiogenesis must be accompanied by an essential wound healing process for the wounded skin tissue to regenerate.
  • an inflammatory reaction occurs due to cell necrosis and destruction of blood vessels. It goes through a series of processes in which the same biological mediator is formed.
  • a therapeutic agent that can effectively promote angiogenesis is developed, it is expected to be applied to the treatment of various diseases such as wounds, chronic ulcers, ischemic stroke, myocardial infarction, angina, and cerebrovascular dementia.
  • the present invention has been devised to solve the problems of the prior art as described above, and cardiac stem cells with increased angiogenesis ability by introducing genes such as cardiac stem cells, HIF-1 ⁇ , VEGF, PDGF, HGF, FGF, or these
  • An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of angiogenesis-dependent diseases comprising a culture medium of the active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating angiogenesis-dependent diseases, comprising cardiac stem cells or a culture medium thereof as an active ingredient.
  • the cardiac stem cells are preferably hypoxia-inducible factor 1-alpha (HIF-1 ⁇ ), vascular endothelial growth factor (VEGF), platelet-derived growth factor (platelet-derived growth factor) factor; PDGF), hepatocyte growth factor (HGF), fibroblast growth factor (FGF), such as a gene encoding one or more growth factors are introduced, that is, transformed, the gene is overexpressed
  • the hypoxia inducing factor 1-alpha may be one in which amino acid sequences 392 to 520 are removed, proline at amino acid 567 is converted to threonine, and proline at amino acid 658 is converted to glutamine.
  • the cardiac stem cells with increased angiogenic ability or a culture medium thereof is hypoxia-inducing factor 1-alpha, vascular endothelial growth factor, platelet-derived growth factor, hepatocyte growth factor, fibroblast growth factor, etc. It may contain arguments.
  • the angiogenesis-dependent disease refers to all diseases in which symptoms can be alleviated, improved, or treated by promoting angiogenesis, preferably, wounds, chronic ulcers, peripheral arterial disease, severe It may be lower extremity ischemia, diabetic foot ulcer, ischemic stroke, myocardial infarction, angina pectoris, cerebrovascular dementia, etc., and more preferably myocardial infarction, angina pectoris, etc.
  • the pharmaceutical composition may further comprise a hydrogel, and the hydrogel is preferably collagen, gelatin, chondroitin, hyaluronic acid, alginic acid, MatrigelTM, chitosan, peptide, fibrin, polyglycolic acid (PGA), polylactic acid (PLA), PEG It may be a hydrogel made of (polyethylene glycol), polyacrylamide, or the like.
  • the present invention is cardiac stem cells, hypoxia-inducible factor 1-alpha (Hypoxia-inducible factor 1-alpha; HIF-1 ⁇ ), vascular endothelial growth factor (vascular endothelial growth factor; VEGF), platelet-derived growth factor (platelet-derived growth factor) factor; PDGF), hepatocyte growth factor (HGF), and fibroblast growth factor (FGF) transformed with a gene encoding any one or more growth factors selected from the group consisting of cardiac stem cells, or It provides a method for preventing or treating angiogenesis-dependent diseases, comprising administering to an individual a composition comprising a culture medium thereof as an active ingredient.
  • hypoxia-inducible factor 1-alpha Hypoxia-inducible factor 1-alpha; HIF-1 ⁇
  • VEGF vascular endothelial growth factor
  • platelet-derived growth factor platelet-derived growth factor (platelet-derived growth factor) factor
  • PDGF hepatocyte growth factor
  • FGF fibroblast growth factor
  • the present invention is cardiac stem cells, hypoxia-inducible factor 1-alpha (Hypoxia-inducible factor 1-alpha; HIF-1 ⁇ ), vascular endothelial growth factor (vascular endothelial growth factor; VEGF), platelet-derived growth factor (platelet-derived growth factor) factor; PDGF), hepatocyte growth factor (HGF), and fibroblast growth factor (FGF) transformed with a gene encoding any one or more growth factors selected from the group consisting of cardiac stem cells, or Provided is a preventive or therapeutic use of a composition comprising a culture medium thereof as an active ingredient for angiogenesis-dependent diseases.
  • hypoxia-inducible factor 1-alpha Hypoxia-inducible factor 1-alpha; HIF-1 ⁇
  • VEGF vascular endothelial growth factor
  • platelet-derived growth factor platelet-derived growth factor
  • HGF hepatocyte growth factor
  • FGF fibroblast growth factor
  • the present invention is cardiac stem cells, hypoxia-inducible factor 1-alpha (Hypoxia-inducible factor 1-alpha; HIF-1 ⁇ ), vascular endothelial growth factor (vascular endothelial growth factor; VEGF), platelet-derived growth factor (platelet-derived growth factor) factor; PDGF), hepatocyte growth factor (HGF), and fibroblast growth factor (FGF) transformed with a gene encoding any one or more growth factors selected from the group consisting of cardiac stem cells, or Provided is a use for producing a medicament for use in angiogenesis-dependent diseases of these cultures.
  • hypoxia-inducible factor 1-alpha Hypoxia-inducible factor 1-alpha; HIF-1 ⁇
  • VEGF vascular endothelial growth factor
  • platelet-derived growth factor platelet-derived growth factor
  • HGF hepatocyte growth factor
  • FGF fibroblast growth factor
  • Cardiac stem cells with increased angiogenesis or their culture media activate angiogenic genes such as VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF, etc., and at the same time IGF, TGF-
  • angiogenic genes such as VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF, etc.
  • the cardiac stem cells with increased angiogenesis may relieve, improve, or treat symptoms by promoting angiogenesis, such as wounds, chronic ulcers, ischemic stroke, myocardial infarction, angina, cerebrovascular dementia, etc. It is expected to be widely applied to all possible diseases.
  • FIG. 1 is a view showing the results of confirming the expression level of angiogenesis-related genes in cardiac stem cells and bone marrow-derived stem cells according to an embodiment of the present invention using qRT-PCR.
  • FIG. 2 is a view showing the results of confirming the effect of hypoxic conditions on the expression level of VEGF in cardiac stem cells according to an embodiment of the present invention using ELISA.
  • FIG. 3 is a view showing the results of confirming the effect of hypoxic conditions on the expression of angiogenesis-related genes in cardiac stem cells using qRT-PCR according to an embodiment of the present invention.
  • FIG. 4 is a view showing the results of confirming the effect of hypoxic conditions on the expression level of HIF-1 ⁇ in cardiac stem cells using Western blotting according to an embodiment of the present invention.
  • FIG. 5 is a diagram schematically illustrating a vector map for eGFP or HIF-1 ⁇ gene expression according to an embodiment of the present invention.
  • FIG. 6 is a view showing the result of confirming the HIF-1 ⁇ gene expression level in cardiac stem cells transformed with the HIF-1 ⁇ gene expression vector according to an embodiment of the present invention by Western blotting.
  • FIG. 7 is a view showing the results of confirming the effect of the HIF-1 ⁇ gene on the survival rate of cells according to an embodiment of the present invention using CCK-8 assay.
  • FIG. 8 is a view showing the results of confirming the effect of the HIF-1 ⁇ gene on cell migration according to an embodiment of the present invention by a wound healing scratch assay.
  • FIG. 9 is a view showing the results of confirming the effect of the HIF-1 ⁇ gene on tube formation according to an embodiment of the present invention by a tube formation assay.
  • FIG. 10 is a view showing the results of confirming the effect of the HIF-1 ⁇ gene on the differentiation into vascular endothelial cells according to an embodiment of the present invention.
  • FIG. 11 is a view showing the results of measuring blood flow to determine the effect of the HIF-1 ⁇ gene on the recovery of vascular damage in vivo according to an embodiment of the present invention.
  • FIG. 12 is a view showing the results of confirming the in vivo muscle damage and fibrosis inhibitory effect of the HIF-1 ⁇ gene according to an embodiment of the present invention.
  • FIG. 13 is a view showing the result of confirming the expression level of HIF-1 ⁇ gene in cardiac stem cells transformed with the vector for expression of constitutively active HIF-1 ⁇ gene according to an embodiment of the present invention by Western blotting.
  • FIG. 14 shows the results of confirming the effect on the expression of angiogenesis-related genes in cardiac stem cells transformed by the vector for expression of constitutively active HIF-1 ⁇ gene according to an embodiment of the present invention using qRT-PCR. It is a drawing.
  • FIG. 15 is a view showing the results of confirming the effect of the constitutively active HIF-1 ⁇ gene on cell migration according to an embodiment of the present invention by a wound healing scratch assay.
  • FIG. 16 is a view showing the results of confirming the effect of the constitutively active HIF-1 ⁇ gene on tube formation according to an embodiment of the present invention by a tube formation assay.
  • 17 is a view showing the results of confirming the effect of the constitutively active HIF-1 ⁇ gene on differentiation into vascular endothelial cells according to an embodiment of the present invention.
  • a and B are the results of confirming the cell viability inside the fibrin gel
  • C is the result of confirming the degree of cell proliferation in the fibrin gel
  • D is the result of confirming the degree of dissolving the fibrin gel by the cardiac stem cells.
  • FIG. 20 is a view showing the results of confirming the damaged leg recovery ability of cardiac stem cells into which the constitutively active HIF-1 ⁇ gene is introduced according to an embodiment of the present invention.
  • 21 is a result of confirming the angiogenic effect of cardiac stem cells into which the constitutively active HIF-1 ⁇ gene is introduced according to an embodiment of the present invention, wherein 21a indicates CD31-positive cells, 21b indicates ⁇ -SMA-positive cells indicates.
  • FIG. 22 is a view showing the results of confirming the in vivo muscle damage and fibrosis inhibitory effect of the constitutively active HIF-1 ⁇ gene according to an embodiment of the present invention.
  • FIG. 23 is a diagram schematically illustrating a process for preparing a cardiac stem cell culture medium according to an embodiment of the present invention.
  • FIG. 24 is a view showing the result of confirming the amount of VEGF contained in the cardiac stem cell culture medium according to an embodiment of the present invention using ELISA.
  • 25 is a view showing the results of confirming the effect of the cardiac stem cell culture medium on cell migration according to an embodiment of the present invention by a wound healing scratch assay.
  • 26 is a view showing the results of confirming the effect of the cardiac stem cell culture medium on tube formation according to an embodiment of the present invention by a tube formation assay.
  • FIG. 27 is a diagram schematically illustrating the mechanism of cardiac stem cells having increased angiogenesis capacity according to an embodiment of the present invention.
  • the cardiac stem cells of the present invention activate angiogenic genes such as VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF, etc., and at the same time, the survival and proliferation ability of cells such as IGF, TGF- ⁇ , TGF- ⁇ , NOS2, etc.
  • angiogenic genes such as VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF, etc.
  • stem cell refers to a broad concept that collectively refers to undifferentiated cells having the ability to differentiate into various types of body tissue cells, that is, stemness. Such stem cells can be largely divided into embryonic stem cells, adult stem cells, gamete, cancer stem cells, etc. that can be manufactured using embryos. . Dual cardiac stem cells (cardiac stem cells) are stem cells existing in the heart and refer to stem cells having a multifunctional ability to differentiate into all cells constituting the heart.
  • prevention refers to any action that inhibits angiogenesis-dependent disease or delays the onset of angiogenesis-dependent diseases by administration of the composition according to the present invention.
  • treatment refers to any action in which the symptoms of angiogenesis-dependent disease are improved or advantageously changed by administration of the composition according to the present invention.
  • the term “individual” refers to a subject to which the composition of the present invention can be administered, and the subject is not limited.
  • the term “pharmaceutical composition” may be characterized in the form of capsules, tablets, granules, injections, ointments, powders, or beverages, and the pharmaceutical composition is intended for humans.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, and pain-free agents A topical agent, solubilizer, isotonic agent, stabilizer, etc.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like can be used.
  • fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be used.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral or parenteral administration is preferred, for example, oral, intravenous, intramuscular, intraarticular, intrasynovial, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, intradermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, rectal, intrasternal, intralesional, intracranial, and the like.
  • the dosage of the pharmaceutical composition of the present invention may vary depending on the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. It may vary depending on factors, and may be appropriately selected by those skilled in the art although it varies depending on the patient's condition, weight, degree of disease, drug form, administration route and period, and 0.0001 to 500 mg/kg or 0.001 to 0.001 to 1 day It can be administered at 500 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • CSCs cardiac stem cells
  • SD rats Sprague-Dawley rats
  • fibrin gel prepared using 2.5 mg/mL of fibrinogen and 0.5 U/mL of thrombin.
  • cardiac stem cells grown by moving from myocardial sections to fibrin gel using urokinase were separated, and the separated cardiac stem cells were cultured in cardiac stem cell culture medium (DMEM and F- mixed at 1:1 volume%).
  • BMSC bone marrow mesenchymal stem cells
  • Example 2 Comparison of expression of angiogenesis-related genes in cardiac stem cells and bone marrow-derived stem cells
  • each stem cell was inoculated into a 6-well plate at a concentration of 2 X 10 5 cells/well, and cardiac It was cultured in a stem cell culture medium. Thereafter, the medium was changed to DMEM to which 1% calf serum was added, and then cultured for 24 hours. And the expression level of angiogenesis-related genes, vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), and hepatocyte growth factor (HGF), qRT- It was confirmed using quantitative real-time PCR (PCR). In more detail, total RNA was isolated using TRIzol reagent, and the amount of RNA was measured using NanoDrop2000.
  • VEGF vascular endothelial growth factor
  • PDGF platelet-derived growth factor
  • HGF hepatocyte growth factor
  • cDNA was synthesized using the iScript TM cDNA systhesis kit, and amplified using the CFX96 TM Real-Time PCR system.
  • the primers used in the experiment are shown in Table 1.
  • the expression level of the gene was measured using the 2- ⁇ Ct method, and ⁇ -actin was used as an internal control. After that, all experiments were repeated at least three times, and the results were expressed as mean ⁇ standard deviation. Statistical significance was confirmed between two groups by Student's t-test, and between three or more groups using one-way ANOVA. If P ⁇ 0.05, it was judged to be statistically significant, * means P ⁇ 0.05, ** means P ⁇ 0.01, and *** means P ⁇ 0.001. The results are shown in FIG. 1 .
  • VEGF forward primer GGAGTACCCCGATGAGATAGAGT One VEGF reverse primer CTATTGTGCTGGCTTTGGTGAG 2 PDGF-B forward primer TGGAGTCGAGTCGGAAAGCT 3 PDGF-B reverse primer GAAGTTGGCATTGGTGCGAT 4 bFGF forward primer GCGACCCACACGTCAAACTA 5 bFGF reverse primer CAGCCGTCCATCTTCCTTCA 6 Ang-1 forward primer CTCGCTGCCATTCTGACTACAC 7 Ang-1 reverse primer GACAGTTGCCATCGTGTTCTG 8 ⁇ -actin forward primer AGATCAAGATCATTGCTCCTCCT 9 ⁇ -actin reverse primer ACGCAGCTCAGTAACAGTCC 10
  • cardiac stem cells were inoculated into a 24-well plate at a concentration of 2 X 10 4 cells/well, and cultured in cardiac stem cell culture medium for 24 hours. Thereafter, the medium was changed to DMEM with 1% calf serum added, and after culturing for 24 hours, normal oxygen conditions or hypoxic conditions: 1% O 2 , 5 % CO 2 , and 94% N 2 ) for further incubation for 5 days. The medium was replaced with a new medium every 2 days, and on days 1, 3, and 5, the supernatant of each medium was collected, and the amount of VEGF contained in the medium was measured by centrifugation at 4° C. and 1,500 rpm for 10 minutes. Measurements were made using an ELISA kit. The results are shown in FIG. 2 .
  • the amount of VEGF was significantly increased under hypoxic conditions, and it was confirmed that the secretion amount of VEGF was further increased as the culture time increased.
  • VEGF vascular endothelial growth factor
  • PDGF-B vascular endothelial growth factor
  • bFGF vascular endothelial growth factor
  • Ang-1 genes known to be related to angiogenesis
  • VEGF and PDGF-B were continuously increased under hypoxic conditions, and bFGF showed high expression levels under normal oxygen conditions on the third day of culture, but expressed under hypoxic conditions with time. It was confirmed that the amount increased. It was confirmed that the expression level of Ang-1 was significantly higher under normal oxygen conditions.
  • cardiac stem cells were treated with 2 X 10 5 cells/well. The concentration was inoculated in a 6-well plate, and cultured in cardiac stem cell culture medium for 24 hours. Thereafter, the medium was changed to DMEM with 1% calf serum added, and after culturing for 24 hours, normal oxygen conditions (normoxic condition), hypoxic conditions (hypoxic condition: 1% O 2 , 5) % CO 2 , and 94% N 2 ), or 200 ⁇ M CoCl 2 ), and further cultured for 5 days.
  • CoCl 2 serves to stabilize HIF-1 ⁇ , and was used as a positive control.
  • cardiac stem cells were lysed using cold RIPA buffer containing 1% protease inhibitor cocktail, and then the cell lysates were centrifuged at 4° C., 14,000 rpm for 10 minutes. Then, the protein contained in the supernatant was mixed with 2X laemmli sample buffer, and then heated at 95° C. for 5 minutes to prepare a protein sample.
  • the prepared protein sample was electrophoresed using 10% (w/v) SDS-PAGE, followed by Western blotting according to a general method.
  • HIF-1 ⁇ antibody Novus Biologicals
  • ⁇ -actin antibody Novus Biologicals
  • Millipore anti-mouse peroxidase-conjugated secondary antibody
  • the transfected cardiac stem cells were inoculated in a 96-well plate at a concentration of 5 X 10 3 cells/well, and cultured in a cardiac stem cell culture medium for 24 hours. Thereafter, the medium was replaced with DMEM supplemented with 1% calf serum, 50 ⁇ g/mL ascorbic acid, and 0.1 ⁇ M dexamethasone, and the cells were cultured under normal oxygenation conditions (N) or hypoxia conditions (H). And the survival rate was confirmed using the CCK-8 assay. The results are shown in FIG. 7 .
  • cardiac stem cells transfected in the same manner as in Example 4 were inoculated into a 6-well plate at a concentration of 3 X 10 5 cells/well. and cultured in cardiac stem cell culture medium for 24 hours. Thereafter, the medium was changed to DMEM to which 1% calf serum was added, and after re-cultivation for 24 hours, cardiac stem cells were removed using a 200 ⁇ L tip. Then, the cells were washed three times with phosphate buffered saline (PBS) to remove all detached cells, and cultured for 48 hours. Then, the cells were observed using an optical microscope, and the space filled with the cells was measured using ImageJ software.
  • PBS phosphate buffered saline
  • the cardiac stem cells into which the HIF-1 ⁇ gene was introduced had a higher wound closure rate as compared to the cardiac stem cells into which the eGFP gene was introduced. From the above results, it was confirmed that overexpression of the HIF-1 ⁇ gene promotes the migration of cardiac stem cells.
  • the eGFP-introduced cardiac stem cells also form tubes under both normal and hypoxic conditions, but are scattered throughout the matrix under hypoxic conditions.
  • the tube formation rate was increased, and in particular, it was confirmed that the stem cells were not dispersed under hypoxic conditions, but formed a normal tubular structure. From the above results, it was confirmed that overexpression of HIF-1 ⁇ promotes the formation of a tube structure under hypoxic conditions.
  • HIF-1 ⁇ gene-introduced cardiac stem cells 50 ng/mL of VEGF and 10 ng/mL of cardiac stem cells or HIF-1 ⁇ -transduced cardiac stem cells were used. It was cultured in EGM-2 medium supplemented with mL of bFGF. The medium was replaced with a fresh medium every 3 days, and each cardiac stem cell was obtained on the 3rd, 6th, and 9th days and confirmed using a vascular endothelial cell marker.
  • HLI ischemia/reperfusion injury
  • Injections were made at two sites into the gastrocnemius muscle of the injured leg and at one site into the adductor muscle. And blood flow was observed using a laser Doppler perfusion imager at the time of preparing the animal model, and 7 days and 21 days after cardiac stem cell injection. A control group was injected with the same amount of PBS, and the gel was a control group injected with the same amount of fibrin gel. The results are shown in FIG. 11 .
  • H&E stain Abcam
  • MT Masson's trichrome stain
  • Example 7 Cardiac stem cells into which the constitutively active HIF-1 ⁇ gene was introduced
  • constitutively active HIF-1 ⁇ was overexpressed in the transfected cardiac stem cells, and the expression level of the mutated HIF-1 ⁇ gene (CA-HIF-CSC) was increased compared to the wild type HIF-1 ⁇ gene. confirmed that it has been Through the above results, it was confirmed that the constitutively active HIF-1 ⁇ vector was normally transfected.
  • wound healing scratch assay was performed in the same manner as in Example 5.1. The results are shown in FIG. 15 .
  • cardiac stem cells into which the constitutively active HIF-1 ⁇ gene has been introduced have not only increased tube formation under both normal and hypoxic conditions, but also have a normal tube structure. confirmed that. From the above results, it was confirmed that overexpression of the constitutively active HIF-1 ⁇ gene promotes the formation of tube structures.
  • the cardiac stems contained in the fibrin gel are primarily using the Live/Dead® viability/cytotoxicity assay kit (Invitrogen). Cell viability was checked. The results are shown in Figures 18A and 18B.
  • cardiac stem cells introduced with the constitutively active HIF-1 ⁇ gene form new blood vessels in vivo
  • cardiac stem cells were transplanted into ischemia/reperfusion injury animal models in the same manner as in Example 6, and after 21 days CD31 positive and ⁇ -SMA positive cells were identified in the injured leg tissue. The results are shown in Figures 21a and 21b.
  • FIGS. 21A and 21B it was confirmed that the number of CD31-positive and ⁇ -SMA-positive cells was significantly increased when cardiac stem cells into which the constitutively active HIF-1 ⁇ gene was introduced were encapsulated in fibrin gel and injected.
  • H&E stain and MT stain were performed in the same manner as in Example 6. The results are shown in FIG. 22 .
  • the cardiac stem cells introduced with the constitutively active HIF-1 ⁇ gene of the present invention can not only normalize blood flow by restoring damaged blood vessels, but also effectively suppress inflammatory reactions and cell necrosis. .
  • a cardiac stem cell culture medium After culturing for 48 hours in cardiac stem cell culture medium, the cardiac stem cells or normal cardiac stem cells into which the constitutively active HIF-1 ⁇ gene has been introduced, prepared in the same manner as in Example 7.1, The medium was replaced with EBM-2 supplemented with 1% FBS and cultured for 72 hours under normal or hypoxic conditions for 72 hours. Then, only the supernatant containing no cells was obtained by centrifugation. The preparation process of the cardiac stem cell culture medium is briefly shown in FIG. 23 .
  • the cardiac stem cell culture medium obtained by culturing cardiac stem cells into which the constitutively active HIF-1 ⁇ gene was introduced under normal oxygen conditions Thereafter, the cardiac stem cell culture medium into which the constitutively active HIF-1 ⁇ gene was introduced was used as a culture medium obtained by culturing under normal oxygen conditions.
  • vascular endothelial cells were cultured instead of cardiac stem cells and treated with mitomycin C to inhibit cell proliferation. Thereafter, after removing a part of the cells using a 200 ⁇ L tip, a cardiac stem cell culture medium was added and cultured, and the degree of filling the area from which the cells were removed was confirmed. The results are shown in FIG. 25 .
  • the migration of vascular endothelial cells was increased under hypoxic conditions, and in particular, it was confirmed that the wound closure rate was high when the culture medium of cardiac stem cells introduced with the constitutively active HIF-1 ⁇ gene was treated.
  • a tube formation assay was performed in the same manner as in Example 5.2. More specifically, instead of cardiac stem cells, vascular endothelial cells were cultured in Matrigel and treated with cardiac stem cell culture medium, and then the degree of tube formation was confirmed. The results are shown in FIG. 26 .
  • the HIF-1 ⁇ gene is introduced, that is, the HIF-1 ⁇ gene overexpressed cardiac stem cells or their culture medium are VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, It is involved in the differentiation, survival, proliferation, angiogenesis, migration, etc. of stem cells by activating angiogenic genes such as SCF and simultaneously activating genes related to cell survival and proliferative capacity such as IGF, TGF- ⁇ , TGF- ⁇ , NOS2, etc. Thus, it can promote angiogenesis of cardiac stem cells. The mechanism for this is briefly shown in FIG. 27 .
  • the cardiac stem cells into which the gene is introduced not only promote angiogenesis, but also effectively restore damaged blood vessels.
  • the cardiac stem cells into which the gene is introduced not only promote angiogenesis, but also effectively restore damaged blood vessels.
  • the cardiac stem cells into which the gene is introduced not only promote angiogenesis, but also effectively restore damaged blood vessels.
  • the cardiac stem cells into which the gene is introduced not only promote angiogenesis, but also effectively restore damaged blood vessels.
  • the cardiac stem cells into which the gene is introduced not only promote angiogenesis, but also effectively restore damaged blood vessels.
  • genes such as VEGF, FGF, PDGF, and HGF whose expression is increased by HIF-1 ⁇ are introduced into cardiac stem cells, similar to HIF-1 ⁇ , the angiogenic ability of cardiac stem cells is expected to be enhanced. .
  • Cardiac stem cells with increased angiogenic ability of the present invention or a culture medium thereof not only promotes angiogenesis, but also can effectively restore damaged blood vessels through the wound, chronic ulcer, ischemic stroke, myocardial infarction, angina pectoris, cerebrovascular disease. It is expected that it can be effectively used in various diseases that can show therapeutic effects due to the promotion of various angiogenesis, such as dementia.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Vascular Medicine (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cardiology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Inorganic Chemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 혈관 신생능이 증가된 심장줄기세포 또는 이의 배양액을 유효성분으로 포함하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물 등에 관한 것이다.

Description

심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물
본 발명은 심장줄기세포, 혈관 신생능이 증가된 심장줄기세포, 이들의 배양액 및 이들의 용도 등에 관한 것으로, 보다 자세하게는, 심장줄기세포, 또는 HIF-1α, VEGF, PDGF, HGF, FGF 등의 유전자가 도입된 심장줄기세포 및 이들의 용도 등에 관한 것이다.
신생혈관형성(angiogenesis)은 기존 혈관의 내피세포가 세포외 기질을 분해하고, 이동, 분열, 및 분화하여 새로운 모세혈관을 형성하는 현상으로, 성장과 생식, 상처치유 등의 생리적 과정에서 나타난다. 또한, 신생혈관형성은 종양의 성장, 관절염, 당뇨병 등의 병리적 상태와도 연관이 있다. 혈관형성은 혈관내피세포의 성장, 이동, 분화, 모세혈관 형성 등의 복잡한 일련의 과정이 필요하며, 이러한 과정에 관여하는 많은 혈관신생 촉진인자와 혈관신생 억제인자들이 발견되었다. 혈관신생 억제인자들은 혈관신생이 생성될 때 필요한 혈관신생 촉진인자들의 활성에 반대하여 활성화된다. 체내에 자연적으로 존재하는 혈관신생 억제제들은 독성이 적어 병리적인 혈관신생 억제에 사용될 수 있으므로 이와 관련된 많은 약물들이 개발 중에 있다.
과다한 혈관 형성은 질병 악화의 주원인이 되기도 하지만, 혈관의 미형성 또한 심각한 질병의 원인이 되고 있다. 혈관 신생은 상처 치유나 조직 재생에 필수적인 현상이라고 할 수 있는데, 예를 들어 혈관 형성이 미발달된 태반은 유산의 중요한 원인이 되며, 혈관의 미형성으로 인한 괴사, 궤양 및 허혈의 경우 조직이나 기관의 기능 이상을 유발하거나, 사망의 원인이 될 수 있다. 또한, 동맥경화증, 심근경색, 및 협심증과 같은 질병도 원활하지 못한 혈액공급이 원인이 되고 있다. 따라서, 혈관의 미형성으로 인한 저산소 상태 또는 저영양 상태의 유발로 인한 조직 손상을 감소시키고, 원활한 조직 재생을 위해 새로운 혈관 혈성을 유도하거나 촉진시키고자 하는 치료법 개발이 필요하다(대한민국공개특허 2009-0010662).
특히, 혈관신생은 상처받은 피부 조직이 재생되기 위한 필수적인 상처 회복 과정에 반드시 수반되어야 한다. 상처의 초기 단계에는 세포의 괴사와 혈관의 파괴로 인한 염증반응이 일어나게 되고, 이 염증 반응 이후에 혈액 성분의 탈혈관 현상, 혈소판의 활성화 및 혈액응고와 함께, 칼리크레인, 트롬빈, 및 플라스민 등과 같은 생물학적 매개물질이 형성되는 일련의 과정을 거치게 된다.
따라서, 혈관 신생을 효과적으로 촉진시킬 수 있는 치료제가 개발된다면 상처, 만성궤양, 허혈성뇌졸중, 심근경색, 협심증, 뇌혈관성 치매 등 다양한 질환의 치료에 적용할 수 있을 것으로 기대된다.
본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로, 심장줄기세포, HIF-1α, VEGF, PDGF, HGF, FGF 등의 유전자를 도입함으로써 혈관 신생능이 증가된 심장줄기세포, 또는 이들의 배양액을 유효성분으로 포함하는 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것을 그 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명은 심장줄기세포 또는 이의 배양액을 유효성분으로 포함하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물을 제공한다. 상기 심장줄기세포는 바람직하게는 저산소유도인자 1-알파(Hypoxia-inducible factor 1-alpha; HIF-1α), 혈관내피성장인자(vascular endothelial growth factor; VEGF), 혈소판유래성장인자(platelet-derived growth factor; PDGF), 간세포증식인자(hepatocyte growth factor; HGF), 섬유아세포 성장인자(fibroblast growth factor; FGF) 등의 성장인자를 하나 이상 코딩하는 유전자가 도입된, 즉, 형질전환되어 상기 유전자가 과발현되는 심장줄기세포로서, 상기 유전자가 도입된 심장줄기세포는 혈관 신생능이 증가된 것을 특징으로 한다. 상기 저산소유도인자 1-알파는 아미노산 서열 중 392번 내지 520번의 아미노산 서열이 제거되고, 567번째 아미노산인 프롤린이 트레오닌으로 전환되고, 658번째 아미노산인 프롤린이 글루타민으로 전환된 것일 수도 있다.
본 발명의 일 구체예에 있어서, 상기 혈관 신생능이 증가된 심장줄기세포 또는 이의 배양액은 저산소유도인자 1-알파, 혈관내피성장인자, 혈소판유래성장인자, 간세포증식인자, 섬유아세포 성장인자 등 다양한 성장인자를 포함하고 있을 수 있다.
본 발명의 다른 구체예에 있어서, 상기 혈관 신생 의존성 질환은 혈관 신생이 촉진됨으로써 증상이 완화, 개선 또는 치료될 수 있는 모든 질환을 총칭하며, 바람직하게는, 상처, 만성궤양, 말초동맥질환, 중증하지허혈, 당뇨병성 족부궤양, 허혈성뇌졸중, 심근경색, 협심증, 뇌혈관성 치매 등일 수 있으며, 더욱 바람직하게는 심근경색, 협심증 등일 수 있으나, 혈관 신생이 촉진됨으로써 치료될 수 있는 질환이라면 제한이 없다.
본 발명의 또 다른 구체예에 있어서, 상기 약학적 조성물은 하이드로젤(hydrogel)을 추가로 포함할 수 있으며, 상기 하이드로젤은 바람직하게는 콜라겐(collagen), 젤라틴(gelatin), 콘드로이틴(chondroitin), 하알루로닉산(hyaluronic acid), 알지닌(alginic acid), 메트리젤(MatrigelTM), 키토산(chitosan), 펩티드(peptide), 피브린(fibrin), PGA(polyglycolic acid), PLA(polylactic acid), PEG(polyethylene glycol), 폴리아크릴아미드(polyacrylamide) 등으로 제조된 하이드로젤일 수 있다.
또한 본 발명은 심장줄기세포, 저산소유도인자 1-알파(Hypoxia-inducible factor 1-alpha; HIF-1α), 혈관내피성장인자(vascular endothelial growth factor; VEGF), 혈소판유래성장인자(platelet-derived growth factor; PDGF), 간세포증식인자(hepatocyte growth factor; HGF), 및 섬유아세포 성장인자(fibroblast growth factor; FGF)로 이루어진 군으로부터 선택된 어느 하나 이상의 성장인자를 코딩하는 유전자로 형질전환된 심장줄기세포 또는 이들의 배양액을 유효성분으로 포함하는 조성물을 개체에 투여하는 단계를 포함하는 혈관 신생 의존성 질환의 예방 또는 치료방법을 제공한다.
또한 본 발명은 심장줄기세포, 저산소유도인자 1-알파(Hypoxia-inducible factor 1-alpha; HIF-1α), 혈관내피성장인자(vascular endothelial growth factor; VEGF), 혈소판유래성장인자(platelet-derived growth factor; PDGF), 간세포증식인자(hepatocyte growth factor; HGF), 및 섬유아세포 성장인자(fibroblast growth factor; FGF)로 이루어진 군으로부터 선택된 어느 하나 이상의 성장인자를 코딩하는 유전자로 형질전환된 심장줄기세포 또는 이들의 배양액을 유효성분으로 포함하는 조성물의 혈관 신생 의존성 질환의 예방 또는 치료 용도를 제공한다.
또한 본 발명은 심장줄기세포, 저산소유도인자 1-알파(Hypoxia-inducible factor 1-alpha; HIF-1α), 혈관내피성장인자(vascular endothelial growth factor; VEGF), 혈소판유래성장인자(platelet-derived growth factor; PDGF), 간세포증식인자(hepatocyte growth factor; HGF), 및 섬유아세포 성장인자(fibroblast growth factor; FGF)로 이루어진 군으로부터 선택된 어느 하나 이상의 성장인자를 코딩하는 유전자로 형질전환된 심장줄기세포 또는 이들의 배양액의 혈관 신생 의존성 질환에 이용되는 약제를 생산하기 위한 용도를 제공한다.
본 발명에 따른 심장줄기세포, 혈관 신생능이 증가된 심장줄기세포 또는 이들의 배양액은 VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF 등과 같은 혈관 신생 유전자를 활성화시키고, 동시에 IGF, TGF-α, TGF-β, NOS2 등과 같은 세포의 생존 및 증식능과 관련된 유전자를 활성화시킴으로써 줄기세포의 분화, 생존, 증식, 혈관 신생, 이동 등에 관여하여 심장줄기세포의 혈관 신생을 현저히 촉진시킬 수 있다. 따라서, 본 발명에 따른 혈관 신생능이 증가된 심장줄기세포 또는 이의 배양액은 상처, 만성궤양, 허혈성뇌졸중, 심근경색, 협심증, 뇌혈관성 치매 등, 혈관 신생을 촉진시킴으로써 증상이 완화, 개선, 또는 치료될 수 있는 모든 질환에 폭넓게 적용될 수 있을 것으로 기대된다.
도 1은 본 발명의 일 실시예에 따른 심장줄기세포와 골수 유래 줄기세포에서의 혈관 신생 관련 유전자의 발현 정도를 qRT-PCR을 이용하여 확인한 결과를 나타낸 도면이다.
도 2는 본 발명의 일 실시예에 따른 저산소 조건이 심장줄기세포의 VEGF의 발현량에 미치는 영향을 ELISA를 이용하여 확인한 결과를 나타낸 도면이다.
도 3은 본 발명의 일 실시예에 따른 저산소 조건이 심장줄기세포의 혈관 신생 관련 유전자의 발현에 미치는 영향을 qRT-PCR을 이용하여 확인한 결과를 나타낸 도면이다.
도 4는 본 발명의 일 실시예에 따른 저산소 조건이 심장줄기세포의 HIF-1α의 발현량에 미치는 영향을 웨스턴 블롯팅을 이용하여 확인한 결과를 나타낸 도면이다.
도 5는 본 발명의 일 실시예에 따른 eGFP 또는 HIF-1α 유전자 발현용 벡터맵을 간략히 나타낸 도면이다.
도 6은 본 발명의 일 실시예에 따른 HIF-1α 유전자 발현용 벡터에 의하여 형질전환된 심장줄기세포에서의 HIF-1α 유전자 발현량을 웨스턴 블롯팅으로 확인한 결과를 나타낸 도면이다.
도 7은 본 발명의 일 실시예에 따른 HIF-1α 유전자가 세포의 생존률에 미치는 영향을 CCK-8 assay를 이용하여 확인한 결과를 나타낸 도면이다.
도 8은 본 발명의 일 실시예에 따른 HIF-1α 유전자가 세포 이동에 미치는 영향을 wound healing scratch assay로 확인한 결과를 나타낸 도면이다.
도 9는 본 발명의 일 실시예에 따른 HIF-1α 유전자가 튜브 형성에 미치는 영향을 tube formation assay로 확인한 결과를 나타낸 도면이다.
도 10은 본 발명의 일 실시예에 따른 HIF-1α 유전자가 혈관 내피 세포로의 분화에 미치는 영향을 확인한 결과를 나타낸 도면이다.
도 11은 본 발명의 일 실시예에 따른 HIF-1α 유전자가 in vivo에서 혈관 손상의 회복에 미치는 영향을 혈류를 측정하여 확인한 결과를 나타낸 도면이다.
도 12는 본 발명의 일 실시예에 따른 HIF-1α 유전자의 in vivo에서 근육 손상 및 섬유화 억제 효과를 확인한 결과를 나타낸 도면이다.
도 13은 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자 발현용 벡터에 의하여 형질전환된 심장줄기세포에서의 HIF-1α 유전자 발현량을 웨스턴 블롯팅으로 확인한 결과를 나타낸 도면이다.
도 14는 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자 발현용 벡터에 의하여 형질전환된 심장줄기세포의 혈관 신생 관련 유전자의 발현에 미치는 영향을 qRT-PCR을 이용하여 확인한 결과를 나타낸 도면이다.
도 15는 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자가 세포 이동에 미치는 영향을 wound healing scratch assay로 확인한 결과를 나타낸 도면이다.
도 16은 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자가 튜브 형성에 미치는 영향을 tube formation assay로 확인한 결과를 나타낸 도면이다.
도 17은 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자가 혈관 내피 세포로의 분화에 미치는 영향을 확인한 결과를 나타낸 도면이다.
도 18은 본 발명의 일 실시예에 따른 피브린 겔에 내포된 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 특성을 확인한 결과이다. A 및 B는 피브린 겔 내부에서의 세포 생존률을 확인한 결과이고, C는 피브린 겔 내부에서 세포가 확산된 정도를 확인한 결과이며, D는 심장줄기세포가 피브린 겔을 용해한 정도를 확인한 결과이다.
도 19는 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 혈류 회복 정도를 확인한 결과이다.
도 20은 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 손상된 다리 회복능을 확인한 결과를 나타낸 도면이다.
도 21은 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포에 의한 혈관 신생 효과를 확인한 결과로서, 21a는 CD31 양성 세포를 나타내고, 21b는 α-SMA 양성 세포를 나타낸다.
도 22는 본 발명의 일 실시예에 따른 구성적 활성 HIF-1α 유전자의 in vivo에서 근육 손상 및 섬유화 억제 효과를 확인한 결과를 나타낸 도면이다.
도 23은 본 발명의 일 실시예에 따른 심장줄기세포 배양액을 준비하는 과정을 간략히 나타낸 도면이다.
도 24는 본 발명의 일 실시예에 따른 심장줄기세포 배양액 내에 포함되어 있는 VEGF의 양을 ELISA를 이용하여 확인한 결과를 나타낸 도면이다.
도 25는 본 발명의 일 실시예에 따른 심장줄기세포 배양액이 세포 이동에 미치는 영향을 wound healing scratch assay로 확인한 결과를 나타낸 도면이다.
도 26은 본 발명의 일 실시예에 따른 심장줄기세포 배양액이 튜브 형성에 미치는 영향을 tube formation assay로 확인한 결과를 나타낸 도면이다.
도 27은 본 발명의 일 실시예에 따른 혈관 신생능이 증가된 심장줄기세포의 기작을 간략히 나타낸 도면이다.
본 발명의 심장줄기세포는 VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF 등과 같은 혈관 신생 유전자를 활성화시키고, 동시에 IGF, TGF-α, TGF-β, NOS2 등과 같은 세포의 생존 및 증식능과 관련된 유전자를 활성화시킴으로써 줄기세포의 분화, 생존, 증식, 혈관 신생, 이동 등에 관여하여 심장줄기세포의 혈관 신생을 효과적으로 촉진시킬 수 있다. 따라서, 혈관 신생을 촉진시킴으로써 증상이 완화, 개선, 또는 치료될 수 있는 모든 질환에 폭넓게 적용할 수 있다.
본 명세서에 있어서, "줄기세포(stem cell)"란 여러 종류의 신체 조직 세포로 분화할 수 있는 능력, 즉, 줄기세포성(stemness)을 가진 미분화 세포를 총칭하는 광의의 개념을 말한다. 이러한 줄기세포는 크게 배아를 이용하여 제조할 수 있는 배아줄기세포(embryonic stem cell), 성체줄기세포(adult stem cell), 생식세포(gamete), 암 줄기세포(cancer stem cell) 등으로 나뉠 수 있다. 이중 심장 줄기 세포(cardiac stem cell)은 심장 내에 존재하는 줄기세포로서 심장을 구성하는 모든 세포로 분화할 수 있는 다기능성을 지닌 줄기세포를 지칭한다.
본 명세서에 있어서, “예방(prevention)”이란 본 발명에 따른 조성물의 투여에 의해 혈관 신생 의존성 질환을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 명세서에 있어서, “치료(treatment)”란 본 발명에 따른 조성물의 투여에 의해 혈관 신생 의존성 질환의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 명세서에 있어서, “개체(individual)”란 본 발명의 조성물이 투여될 수 있는 대상을 말하며, 그 대상에는 제한이 없다.
본 명세서에 있어서, “약학적 조성물(pharmaceutical composition)”이란 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용가능한 담체는 경구투여시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용가능한 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 당의정, 겔, 환제, 산제, 과립제, 좌제, 외용제, 용액, 현탁액, 서방형 제제, 슬러리 등으로 제형화하여 사용할 수도 있다. 한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 경구 또는 비경구 투여가 바람직하며, 예를 들어, 구강, 정맥내, 근육내, 관절내, 활액낭내, 동맥내, 골수내, 경막내, 심장내, 경피, 피내, 피하, 복강내, 비강내, 장관, 국소, 설하, 직장, 흉골내, 병소내, 두개골내 등이 포함된다.
본 발명의 약학적 조성물의 투여량은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 500 mg/kg 또는 0.001 내지 500 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1: 심장줄기세포의 분리
모든 동물의 취급 및 절차는 이화여자대학교의 동물 관리 및 사용위원회의 승인을 얻은 연구 프로토콜에 따라 수행하였다. 심장줄기세포(cardiac stem cells; CSCs)를 분리하기 위하여, 일차적으로 Sprague-Dawley(SD) 랫트의 심장 조직으로부터 심근 절편을 획득하였다. 그리고 획득된 심근 절편을 2.5 mg/mL의 피브리노겐과 0.5 U/mL의 트롬빈을 이용하여 제조한 피브린 겔(fibrin gel)에서 14일 동안 배양하였다. 배양 후에, 유로키나제(urokinase)를 이용하여 심근 절편에서 피브린 겔로 이동해서 성장한 심장줄기세포들을 분리하고, 분리된 심장줄기세포들은 심장줄기세포 배양 배지(1 : 1의 볼륨%로 혼합된 DMEM 및 F-12 배지에 10% 우태아혈청(fetal bovine serum; FBS), 1% 항생-항진균제(Gibco), 10 ng/mL의 EGF, 2 ng/mL의 bFGF, 및 10 ng/mL의 IGF-1 첨가)에서 배양하였다. 이후, 모든 실험에서는 9 내지 13 계대 배양된 심장줄기세포들을 이용하여 실험하였다. 대조군으로는 인제대학교에서 받은 랫트의 골수 유래 줄기세포(bone marrow mesenchymal stem cell; BMSC)를 사용하였으며, 골수 유래 줄기세포는 6 계대 배양된 줄기세포를 사용하였다.
실시예 2: 심장줄기세포와 골수 유래 줄기세포의 혈관 신생 관련 유전자의 발현 비교
심장줄기세포와 골수 유래 줄기세포에서 혈관 신생(proangiogenic) 관련 유전자들의 발현 정도를 비교하기 위하여, 각각의 줄기세포들을 2 X 10 5 cells/well의 농도로 6웰 플레이트에 접종하고, 24 시간 동안 심장줄기세포 배양 배지에서 배양하였다. 이후, 배지를 1%의 송아지 혈청(calf serum)이 첨가되어 있는 DMEM으로 바꿔준 후, 24시간 동안 배양하였다. 그리고 혈관 신생 관련 유전자인 혈관내피성장인자(vascular endothelial growth factor; VEGF), 혈소판유래성장인자(platelet-derived growth factor; PDGF), 및 간세포증식인자(hepatocyte growth factor; HGF)의 발현 정도를 qRT-PCR(quantitative real-time PCR)을 이용하여 확인하였다. 보다 자세하게는, 총 RNA를 TRIzol reagent를 이용하여 분리하고, NanoDrop2000을 이용하여 RNA의 양을 측정하였다. 그리고 분리된 1 μg의 RNA를 주형(template)으로 하여 iScript TM cDNA systhesis kit를 이용하여 cDNA를 합성하고, CFX96 TM Real-Time PCR system을 이용하여 증폭하였다. 실험에 사용한 프라이머는 표 1에 나타내었다. 유전자의 발현 정도는 2 -ΔΔCt method를 이용하여 측정하였고, internal control로는 β-actin을 사용하였다. 이후 모든 실험은 최소 세 번 이상 반복하였으며, 결과는 평균값 ± 표준편차로 나타내었다. 통계적 유의성은 두 개의 그룹 간에는 Student's t-test로 확인하였고, 세 개 이상의 그룹 간에는 one-way ANOVA를 이용하여 확인하였다. P < 0.05이면, 통계적으로 유의성이 있다고 판단하였으며, *는 P < 0.05를 의미하며, **는 P < 0.01을 의미하며, ***는 P < 0.001을 의미한다. 그 결과는 도 1에 나타내었다.
Gene name 서열 (5' -> 3') 서열번호
VEGF forward primer GGAGTACCCCGATGAGATAGAGT 1
VEGF reverse primer CTATGTGCTGGCTTTGGTGAG 2
PDGF-B forward primer TGGAGTCGAGTCGGAAAGCT 3
PDGF-B reverse primer GAAGTTGGCATTGGTGCGAT 4
bFGF forward primer GCGACCCACACGTCAAACTA 5
bFGF reverse primer CAGCCGTCCATCTTCCTTCA 6
Ang-1 forward primer CTCGCTGCCATTCTGACTACAC 7
Ang-1 reverse primer GACAGTTGCCATCGTGTTCTG 8
β-actin forward primer AGATCAAGATCATTGCTCCTCCT 9
β-actin reverse primer ACGCAGCTCAGTAACAGTCC 10
도 1에 나타난 바와 같이, 골수 유래 줄기세포와 비교하여, 심장줄기세포에서는 HGF 유전자는 약 3.2배, VEGF 유전자는 약 2.9배, 그리고 PDGF-B 유전자는 약 8.7배 발현량이 증가되어 있는 것을 확인하였다. HGF와 VEGF는 모두 혈관 형성 및 세포 보호 효과를 나타내어 새로운 혈관 형성을 촉진시킨다는 것이 알려져 있으며, PDGF-B 또한, 혈관 형성에서 중요한 역할을 하는 것으로 알려져 있다. 이를 통하여, 심장줄기세포가 골수 유래 줄기세포와 비교하여, 혈관 신생능이 높은 것을 확인할 수 있었다.
실시예 3: 저산소 조건이 심장줄기세포의 혈관 신생에 미치는 영향 확인
저산소 조건이 심장줄기세포의 혈관 신생에 미치는 영향을 확인하기 위하여, 심장줄기세포를 2 X 10 4 cells/well의 농도로 24웰 플레이트에 접종하고, 24 시간 동안 심장줄기세포 배양 배지에서 배양하였다. 이후, 배지를 1%의 송아지 혈청(calf serum)이 첨가되어 있는 DMEM으로 바꿔준 후, 24시간 동안 배양해준 후에, 정상적인 산소 조건(normoxic condition) 또는 저산소 조건(hypoxic condition: 1% O 2, 5% CO 2, 및 94%의 N 2)에서 5일 동안 추가 배양하였다. 배지는 2일마다 새로운 배지로 교체해주었으며, 1, 3, 및 5일째에는 각각의 배지 상층액을 수거한 후, 4℃, 1,500 rpm에서 10분 동안 원심분리하여 배지 내에 포함되어 있는 VEGF의 양을 ELISA kit를 이용하여 측정하였다. 그 결과는 도 2에 나타내었다.
도 2에 나타난 바와 같이, 저산소 조건에서 VEGF의 양이 유의성있게 증가되었으며, 배양 시간이 길어짐에 따라 VEGF의 분비량은 더욱 증가되는 것을 확인하였다.
또한, 혈관 신생과 관련이 있는 것으로 알려져 있는 유전자인 VEGF, PDGF-B, bFGF, 및 Ang-1 유전자의 발현량을 실시예 2와 동일한 방법으로 qRT-PCR을 실시하여 확인하였다. 그 결과는 도 3에 나타내었다.
도 3에 나타난 바와 같이, 저산소 조건에서 VEGF 및 PDGF-B의 발현량은 지속적으로 증가되었으며, bFGF는 배양 3일째에는 정상적인 산소 조건에서 높은 발현량을 보였으나, 시간이 흐름에 따라 저산소 조건에서 발현량이 높아지는 것을 확인하였다. Ang-1은 정상적인 산소 조건에서 발현량이 유의성 있게 높은 것을 확인하였다.
또한, 저산소 조건이 심장줄기세포의 저산소유도인자 1-알파(Hypoxia-inducible factor 1-alpha; HIF-1α)의 발현에 미치는 영향을 확인하기 위하여, 심장줄기세포를 2 X 10 5 cells/well의 농도로 6웰 플레이트에 접종하고, 24 시간 동안 심장줄기세포 배양 배지에서 배양하였다. 이후, 배지를 1%의 송아지 혈청(calf serum)이 첨가되어 있는 DMEM으로 바꿔준 후, 24시간 동안 배양해준 후에, 정상적인 산소 조건(normoxic condition), 저산소 조건(hypoxic condition: 1% O 2, 5% CO 2, 및 94%의 N 2), 또는 200 μM의 CoCl 2가 처리된 배지에서 5일 동안 추가 배양하였다. CoCl 2는 HIF-1α를 안정화시켜주는 역할로서, 양성 대조군으로 사용하였다. 5일 동안 배양해준 후에, 심장줄기세포를 1% protease inhibitor cocktail이 첨가된 차가운 RIPA buffer를 이용하여 용해시킨 후에, 세포 용해물(cell lysates)을 4℃, 14,000 rpm에서 10분 동안 원심분리하였다. 그리고 상층액에 포함되어 있는 단백질을 2X laemmli sample buffer와 혼합하여준 후에 95℃에서 5분 동안 가열하여 단백질 시료를 준비하였다. 준비된 단백질 시료는 10%(w/v) SDS-PAGE를 이용하여 전기영동한 후에, 일반적인 방법에 따라 웨스턴 블롯팅을 실시하였다. 일차 항체로는 HIF-1α 항체(Novus Biologicals)와 β-actin 항체(Novus Biologicals)를 이용하였으며, 2차 항체로는 anti-mouse peroxidase-conjugated secondary antibody(Millipore)를 이용하였다. 그 결과는 도 4에 나타내었다.
도 4에 나타난 바와 같이, 저산소 조건에서 HIF-1α의 발현량은 CoCl 2 처리 조건에서는 약 1.7배 증가하였으며, 저산소 조건에서는 약 3.0배 이상 증가된 것을 확인하였다.
상기 결과들을 통하여, 심장줄기세포는 저산소 조건에서 HIF-1α, VEGF, PDGF-B, bFGF 등 혈관 신생과 관계되어 있는 유전자들의 발현이 현저히 증가되는 것을 확인할 수 있었다.
실시예 4: HIF-1α 유전자가 심장줄기세포에 미치는 영향 확인
HIF-1α 유전자가 심장줄기세포에 미치는 영향을 확인하기 위하여, eGFP 또는 HIF-1α 유전자(Genebank: NM_024359.1, 서열번호 11)를 발현하는 벡터를 DetaiBio Co., Ltd에 의뢰하여 제작하였다(도 5). 그리고 제작된 벡터는 Neon transfection system을 이용하여 심장줄기세포에 형질감염시켰다. 형질감염된 심장줄기세포가 HIF-1α 유전자를 과발현시키는지 확인하기 위하여, 실시예 3과 동일한 방법으로 웨스턴 블롯팅을 실시하였다. 웨스턴 블롯팅 결과는 ImageJ software를 이용하여 정량하였다. 그 결과는 도 6에 나타내었다.
도 6에 나타난 바와 같이, 형질감염된 심장줄기세포에서 HIF-1α 유전자가 과발현되는 것을 확인하였다. 상기 결과를 통하여, HIF-1α 벡터가 정상적으로 형질감염된 것을 확인할 수 있었다.
이후, 형질감염된 심장줄기세포의 생존 능력을 확인하기 위하여, 형질감염된 심장줄기세포를 5 X 10 3 cells/well의 농도로 96웰 플레이트에 접종하고, 24 시간 동안 심장줄기세포 배양 배지에서 배양하였다. 이후, 배지를 1%의 송아지 혈청 및 50 μg/mL의 ascorbic acid, 및 0.1 μM의 dexamethasone이 첨가된 DMEM으로 교체해준 후, 세포를 정상적인 산소 조건(N) 또는 저산소 조건(H)에서 배양하였다. 그리고 생존률을 CCK-8 assay를 이용하여 확인하였다. 그 결과는 도 7에 나타내었다.
도 7에 나타난 바와 같이, 정상적인 산소 조건에서는 eGFP 유전자가 과발현되는 심장줄기세포나 HIF-1α 유전자가 과발현되는 심장줄기세포나 생존률에는 영향을 미치지 않았으나, 저산소 조건에서는 eGFP 유전자가 과발현되는 심장줄기세포의 경우에는 생존률이 급감하는 것을 확인하였다. 반면, HIF-1α 유전자가 과발현되는 심장줄기세포의 경우에는 정상적인 산소 조건과 마찬가지로 생존률이 유지되는 것을 확인하였다. 상기 결과를 통하여, HIF-1α 유전자의 과발현은 저산소 조건으로 인해 유도되는 성장 중지, 세포자멸사(apoptosis) 등을 방지하여 세포의 생존능을 증가시키는 것을 확인할 수 있었다.
실시예 5: HIF-1α 유전자가 도입된 심장줄기세포의 in vitro 상에서의 치료 효과 확인
5.1. Wound healing scratch assay
HIF-1α 유전자가 도입된 심장줄기세포가 상처 회복에 미치는 영향을 확인하기 위하여, 실시예 4와 동일한 방법으로 형질감염시킨 심장줄기세포를 3 X 10 5 cells/well의 농도로 6웰 플레이트에 접종하고, 24 시간 동안 심장줄기세포 배양 배지에서 배양하였다. 이후, 배지를 1%의 송아지 혈청(calf serum)이 첨가되어 있는 DMEM으로 바꿔준 후, 24시간 동안 다시 배양한 후에 200 μL 팁을 이용하여 심장줄기세포를 제거하였다. 그리고 인산염완충용액(phosphate buffered saline; PBS)으로 3회 세척하여 떨어진 세포를 모두 제거하고, 48시간 동안 배양하였다. 이후, 광학현미경을 이용하여 세포를 관찰하고, ImageJ software를 이용하여 세포가 다시 채워진 공간을 측정하였다. 그리고 “Wound closure rate(%) = 100 X (A 0 - A 24)/A 0” 식에 대입하여 정량하였다. 상기 식에서 A 0는 0시간에 세포가 비어있는 공간의 넓이를 의미하며, A 24는 24시간 후에 세포가 비어있는 공간의 넓이를 의미한다. 그 결과는 도 8에 나타내었다.
도 8에 나타난 바와 같이, HIF-1α 유전자가 도입된 심장줄기세포는 eGFP 유전자가 도입된 심장줄기세포와 비교하여, wound closure rate가 높은 것을 확인하였다. 상기 결과를 통하여, HIF-1α 유전자의 과발현은 심장줄기세포의 이동(migration)을 촉진시킨다는 것을 확인할 수 있었다.
5.2. Tube formation assay
HIF-1α 유전자가 도입된 심장줄기세포가 혈관 신생에 미치는 영향을 확인하기 위하여, In Vitro Angiogenesis assay kit(Trevigen, Inc.)를 이용하여 실험을 진행하였다. 보다 자세하게는, 50 μL의 Basement Membrane Extract(BME) solution을 96웰 플레이트의 각 웰에 첨가한 후, 37℃에서 30 분간 반응시켜 겔화시켰다. 그리고 실시예 4와 동일한 방법으로 형질감염시킨 심장줄기세포를 2 μM의 calcein-AM solution을 이용하여 염색시킨 후에, BME가 코팅된 웰에 1 X 10 4 cells/well의 농도로 접종하고, 5시간 동안 배양하였다. 그리고 형광 현미경을 이용하여 튜브 생성 정도를 확인하고, ImageJ software를 이용하여 현미경 이미지를 분석하였다. 그 결과는 도 9에 나타내었다.
도 9에 나타난 바와 같이, eGFP가 도입된 심장줄기세포의 경우에도 정상적인 산소 조건과 저산소 조건에서 모두 튜브를 형성하나, 저산소 조건에서는 매트릭스의 곳곳에 흩어진 형태인 것을 확인하였다. 반면, HIF-1α가 도입된 심장줄기세포의 경우에는 튜브 형성률이 증가되었으며, 특별히, 저산소 조건에서는 줄기세포가 흩어진 상태가 아니라, 정상적인 튜브 구조(tubular structure)를 이루고 있는 것을 확인하였다. 상기 결과를 통하여, HIF-1α의 과발현은 저산소 조건에서 튜브 구조의 형성을 촉진시킨다는 것을 확인할 수 있었다.
5.3. HIF-1α 유전자가 혈관 내피 세포의 분화 효율에 미치는 영향 확인
HIF-1α 유전자가 도입된 심장줄기세포가 혈관 내피 세포의 분화 효율에 미치는 영향을 확인하기 위하여, 심장줄기세포 또는 HIF-1α 유전자가 도입된 심장줄기세포를 50 ng/mL의 VEGF 및 10 ng/mL의 bFGF가 첨가된 EGM-2 배지에서 배양하였다. 배지는 3일마다 새로운 배지로 교체하였으며, 3, 6, 및 9일 차에 각각의 심장줄기세포를 획득하여 혈관 내피 세포 마커를 이용하여 확인하였다. 보다 자세하게는, 1 X 10 6 cells를 FACS buffer(10% FBS in PBS)에 첨가한 후, APC가 결합되어 있는 CD31 항체(Miltenyi Biotec) 또는 FITC가 결합되어 있는 VE-cadherin 항체(Novus)을 이용하여 1시간 동안 반응시켜준 후에, PBS를 이용하여 2회 세척하여 결합되지 않은 항체를 모두 제거하였다. 그리고 FACSCalibur cell analyzer를 이용하여 형광을 측정하고, FlowJo software를 이용하여 형광 정도를 정량하였다. 그 결과는 도 10에 나타내었다.
도 10에 나타난 바와 같이, 저산소 조건에서 HIF-1α 유전자가 도입된 심장줄기세포는 심장줄기세포와 비교하여 VE-cadherin 양성/CD31 양성 세포의 비율이 현저히 높은 것을 확인하였다. 상기 결과를 통하여, 저산소 조건에서 HIF-1α 유전자의 과발현은 혈관 내피 세포로의 분화를 촉진시킨다는 것을 확인할 수 있었다.
실시예 6: HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 치료 효과 확인
허혈/재관류 손상(hind limb ischemia; HLI) 동물 모델을 제작하기 위하여, 우선 9주령의 BALB/c 암컷 마우스를 90 mg/kg의 1% pentobarbital sodium을 이용하여 마취시켰다. 그리고 혈관과 신경으로부터 대퇴동맥(femoral artery)을 분리한 후 결찰(ligation)시키고, 대퇴동맥 가지의 근위 시작점부터 복재 동맥(saphenous artery) 가지의 말단 부위까지 제거하여 HLI 동물 모델을 제작하였다. 그리고 1일 후에 2 X 10 6개의 eGFP 또는 HIF-1α가 도입된 심장줄기세포를 50 μL의 PBS 또는 50 μL의 피브린 겔에 혼합하여 근육 내에 주사하였다. 주사는 손상된 다리의 비장근(gastrocnemius muscle)에 두 군데, 그리고 폐각근(adductor muscle)에는 한 군데에 주사하였다. 그리고 동물 모델을 제작한 시점, 그리고 심장줄기세포를 주사한 후 7일 후 및 21일 후에 laser Doppler perfusion imager를 이용하여 혈류를 관찰하였다. 대조군(control)은 PBS를 동량 주사하였고, Gel은 피브린 겔을 동량 주사한 대조군이다. 그 결과는 도 11에 나타내었다.
도 11에 나타난 바와 같이, 21일 후에 관찰한 결과를 보면, HIF-1α 유전자가 도입된 심장줄기세포(HIF-CSC)의 경우에는 eGFP 유전자가 도입된 심장줄기세포(GFP-CSC)와 비교하여 혈류의 흐름이 증가되었으며, 피브린 겔을 이용하여 함께 주사한 HIF-1α 유전자가 도입된 심장줄기세포(HIF-CSC-Gel)의 경우에는 97.57 ± 4.29%로 거의 정상 마우스와 유사한 혈류 흐름을 보여주는 것을 확인하였다.
또한, 근육 조직의 회복 정도를 확인하기 위하여, 심장줄기세포를 주사하고 21일 후에 마우스를 안락사시키고 근육 조직을 획득하여 조직학적 변화를 확인하였다. Hematoxylin-eosin(H&E) stain(Abcam)을 이용하여 근육 조직의 용해(degradation) 정도를 확인하고, Masson's trichrome(MT) stain(Polysciences)를 이용하여 섬유화 정도를 확인하였다. 그리고 ImageJ를 이용하여 정량하였다. 그 결과는 도 12에 나타내었다.
도 12에 나타난 바와 같이, PBS(Control) 또는 피브린 겔(Gel)을 주사한 대조군의 경우에는 근육의 용해와 염증 반응이 증가된 것을 확인하였으며, 이는 혈관 폐색으로 인하여 영양소, 산소 등이 공급되지 않아서인 것을 확인할 수 있었다. PBS를 이용하여 주사한 심장줄기세포의 경우, eGFP 유전자가 도입된 심장줄기세포(GFP-CSC)와 비교하여, HIF-1α 유전자가 도입된 심장줄기세포(HIF-CSC)가 근육의 손상 정도와 섬유화 정도가 감소되었으며, 피브린 겔을 이용한 경우(HIF-CSC-Gel)에는 거의 정상 마우스와 유사한 정도를 나타내는 것을 확인하였다.
상기 결과들을 통하여, HIF-1α 유전자의 과발현이 손상된 혈관을 효과적으로 회복시켜, 근육의 손상, 섬유화, 염증 반응 등을 효과적으로 억제할 수 있다는 것을 확인할 수 있었다.
실시예 7: 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포
7.1. 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 제작
구성적 활성(constitutively active) HIF-1α 유전자, 즉, 환경 조건에 관계없이 HIF-1α 유전자의 발현이 안정적으로 유지될 수 있는 심장줄기세포를 제작하기 위하여, HIF-1α 단백질의 392번 내지 520번의 아미노산 서열이 제거되고, two missense(Pro567Thr 및 Pro658Gln)가 발생된 돌연변이(서열번호 12)를 발현하는 벡터를 DetaiBio Co., Ltd에 의뢰하여 제작하였다. 그리고 제작된 벡터는 Neon transfection system을 이용하여 심장줄기세포에 형질감염시켰다. 형질감염된 심장줄기세포가 HIF-1α 유전자를 과발현시키는지 확인하기 위하여, 실시예 3과 동일한 방법으로 웨스턴 블롯팅을 실시하였다. 웨스턴 블롯팅 결과는 ImageJ software를 이용하여 정량하였다. 그 결과는 도 13에 나타내었다.
도 13에 나타난 바와 같이, 형질감염된 심장줄기세포에서 구성적 활성 HIF-1α가 과발현되며, wild type의 HIF-1α 유전자와 비교하여 돌연변이된 HIF-1α 유전자(CA-HIF-CSC)의 발현량이 증가된 것을 확인하였다. 상기 결과를 통하여, 구성적 활성 HIF-1α 벡터가 정상적으로 형질감염된 것을 확인할 수 있었다.
7.2. 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 혈관 신생 관련 유전자의 발현량 확인
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 혈관 신생 관련 유전자들의 발현 정도를 확인하기 위하여, 실시예 2와 동일한 방법으로 qRT-PCR을 실시하였다. 그 결과는 도 14에 나타내었다.
도 14에 나타난 바와 같이, 심장줄기세포와 비교하여, VEGF, bFGF, Ang-1, 및 PDGF-B 유전자의 발현이 모두 증가된 것을 확인하였다. 상기 결과를 통하여, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포는 혈관 신생능이 증가된 것을 확인할 수 있었다.
7.3. Wound healing scratch assay
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포가 상처 회복에 미치는 영향을 확인하기 위하여, 실시예 5.1과 동일한 방법으로 wound healing scratch assay를 실시하였다. 그 결과는 도 15에 나타내었다.
도 15에 나타난 바와 같이, 심장줄기세포와 비교하여 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 wound closure rate가 높은 것을 확인하였다. 상기 결과를 통하여, 구성적 활성 HIF-1α 유전자의 과발현은 심장줄기세포의 이동(migration)을 촉진시킨다는 것을 확인할 수 있었다.
7.4. Tube formation assay
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포가 혈관 신생에 미치는 영향을 확인하기 위하여, 실시예 5.2와 동일한 방법으로 tube formation assay를 실시하였다. 그 결과는 도 16에 나타내었다.
도 16에 나타난 바와 같이, 심장줄기세포와 비교하여, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포는 정상적인 산소 조건과 저산소 조건 모두에서 튜브 형성이 증가되었을 뿐만 아니라, 정상적인 튜브 구조를 이루고 있는 것을 확인하였다. 상기 결과를 통하여, 구성적 활성 HIF-1α 유전자의 과발현은 튜브 구조의 형성을 촉진시킨다는 것을 확인할 수 있었다.
7.5. 구성적 활성 HIF-1α 유전자가 혈관 내피 세포의 분화 효율에 미치는 영향 확인
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포가 혈관 내피 세포의 분화 효율에 미치는 영향을 확인하기 위하여, 실시예 5.3과 동일한 방법으로 VE-cadherin 양성/CD31 양성 세포의 비율을 측정하였다. 그 결과는 도 17에 나타내었다.
도 17에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포는 일반 심장줄기세포와 비교하여 VE-cadherin 양성/CD31 양성 세포의 비율이 현저히 높은 것을 확인하였다. 상기 결과를 통하여, 구성적 활성 HIF-1α 유전자의 과발현은 혈관 내피 세포로의 분화를 촉진시킨다는 것을 확인할 수 있었다.
7.6. 피브린 겔에 내포된 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 특성 확인
피브린 겔에 내포된 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 특성을 확인하기 위하여, 일차적으로 Live/Dead®viability/cytotoxicity assay kit(Invitrogen)를 이용하여 피브린 겔 내에 포함되어 있는 심장줄기세포의 생존 여부를 확인하였다. 그 결과는 도 18A 및 18B에 나타내었다.
도 18A 및 18B에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 경우에는 일반적인 심장줄기세포와 비교하여 생존률이 유의성있게 높은 것을 확인하였다.
또한, 피브린 겔 내에 확산된 정도를 형광 이미지를 이용하여 확인하였다. 그 결과는 도 18C에 나타내었다.
도 18C에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포가 피브린 겔 내에 더 많이 확산되어 있는 것을 확인하였다.
피브린 겔에 내포된 심장줄기세포가 피브린 겔을 용해시킬 수 있는지 확인하기 위하여, 5 X 10 4 cells/mL의 심장줄기세포를 2.5 mg/mL의 피브리노겐 용액과 0.5 U/mL의 트롬빈을 혼합하여 피브린 겔을 제작하였다. 그리고 배양 후 0, 24, 48, 및 72시간에 배지를 제거하고 PBS를 이용하여 3회 세척하였다. 그리고 남아있는 피브린 겔을 동결건조시킨 후에, 세포 없이 배양한 0시간의 피브린 겔의 건조 무게와 비교하여 피브린 겔이 용해된 정도를 확인하였다. 그 결과는 도 18D에 나타내었다.
도 18D에 나타난 바와 같이, 일반적인 심장줄기세포와 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포 모두 동일하게 피브린 겔을 분해하는 것을 확인하였다.
7.7. 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 혈류 회복 효과 확인
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 손상된 혈관을 치료하여 혈류를 회복시키는지 확인하기 위하여, 실시예 6과 동일한 방법으로 허혈/재관류 손상 동물모델에서 혈류의 회복 정도를 확인하였다. 그 결과는 도 19에 나타내었다.
도 19에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포를 피브린 겔에 내포시켜 주입한 경우(CA-HIF-CSC/Gel) 혈류가 정상과 유사할 정도로 회복되는 것을 확인하였다.
또한, 손상된 다리의 손실 정도, 발의 괴사 정도, 다리의 회복 정도를 마우스의 수로 측정하여 백분율로 나타내었다. 그 결과는 도 20에 나타내었다.
도 20에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포를 피브린 겔에 내포시켜 주입한 경우에 가장 높은 회복률을 보여주는 것을 확인하였다.
7.8. 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 혈관 신생 효과 확인
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포가 in vivo 상에서 새로운 혈관을 형성하는지 확인하기 위하여, 실시예 6과 동일한 방법으로 허혈/재관류 손상 동물모델에 심장줄기세포를 이식하고, 21일 후에 손상된 다리 조직에서 CD31 양성 및 α-SMA 양성 세포를 확인하였다. 그 결과는 도 21a 및 21b에 나타내었다.
도 21a 및 21b에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포를 피브린 겔에 내포시켜 주입한 경우에 CD31 양성과 α-SMA 양성 세포의 수가 현저히 증가되는 것을 확인하였다.
7.9. 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 치료 효과 확인
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 in vivo 상에서의 치료 효과를 확인하기 위하여, 실시예 6과 동일한 방법으로 H&E stain과 MT stain을 실시하였다. 그 결과는 도 22에 나타내었다.
도 22에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포를 피브린 겔에 내포시켜 주입한 경우에 정상 대조군(sham)과 유사한 형태의 조직을 보여주는 것을 확인하였다.
상기 결과들을 통하여, 본 발명의 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포는 손상된 혈관을 회복시켜 혈류를 정상화할 뿐만 아니라, 염증반응, 세포 괴사 등을 효과적으로 억제할 수 있다는 것을 확인할 수 있었다.
실시예 8: 심장줄기세포의 파라크린 효과 확인
8.1. 심장줄기세포 배양액의 준비
심장줄기세포 배양액을 준비하기 위하여, 실시예 7.1과 동일한 방법으로 제작된 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포 또는 일반 심장줄기세포를 심장줄기세포 배양 배지에서 48 시간 동안 배양한 후에, 배지를 1%의 FBS가 첨가된 EBM-2로 교체하고 72시간 동안 정상적인 산소 조건 또는 저산소 조건에서 72시간 동안 배양하였다. 그리고 원심분리하여 세포가 포함되어 있지 않은 상층액만을 획득하였다. 심장줄기세포 배양액의 준비 과정은 도 23에 간략히 나타내었다.
8.2. 심장줄기세포 배양액 내의 VEGF 측정
심장줄기세포 배양액 내에 포함되어 있는 VEGF의 양을 측정하기 위하여, 실시예 3과 동일한 방법으로 ELISA를 실시하였다. 그 결과는 도 24에 나타내었다.
도 24에 나타난 바와 같이, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포를 정상적인 산소 조건에서 배양하여 획득한 심장줄기세포 배양액 내에 VEGF의 양이 가장 많은 것을 확인하였다. 이후, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포 배양액은 정상적인 산소 조건에서 배양하여 획득한 배양액을 사용하였다.
8.3. Wound healing scratch assay
HIF-1α 유전자가 도입된 심장줄기세포의 배양액이 혈관내피세포(Human umbilical vein endothelial cells; HUVECs)의 이동에 미치는 영향을 확인하기 위하여, 실시예 5.1과 동일한 방법으로 wound healing scratch assay를 실시하였다. 보다 자세하게는, 심장줄기세포 대신에 혈관내피세포를 배양하고, mitomycin C를 처리하여, 세포의 증식을 억제시켰다. 이 후, 200 μL 팁을 이용하여 세포 일부분을 제거한 후에, 심장줄기세포 배양액을 첨가하고 배양하며, 세포가 제거된 부위가 채워지는 정도를 확인하였다. 그 결과는 도 25에 나타내었다.
도 25에 나타난 바와 같이, 저산소 조건에서 혈관내피세포의 이동이 증가되었으며, 특별히, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 배양액을 처리한 경우에 wound closure rate가 높은 것을 확인하였다.
8.4. Tube formation assay
구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 배양액이 혈관 신생에 미치는 영향을 확인하기 위하여, 실시예 5.2와 동일한 방법으로 tube formation assay를 실시하였다. 보다 자세하게는, 심장줄기세포 대신에 혈관내피세포를 마트리겔에서 배양하고 심장줄기세포 배양액을 처리한 후에, 튜브의 생성 정도를 확인하였다. 그 결과는 도 26에 나타내었다.
도 26에 나타난 바와 같이, 정상적인 산소 조건에서는 심장줄기세포 배양액과 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 배양액의 차이가 별로 없으나, 저산소 조건에서는 심장줄기세포 배양액을 처리한 경우에는 튜브 생성이 유도되지 않으나, 구성적 활성 HIF-1α 유전자가 도입된 심장줄기세포의 배양액을 처리한 경우에는 튜브 형성이 촉진되는 것을 확인하였다.
상기 결과들을 통하여, 본 발명의 심장줄기세포, HIF-1α 유전자가 도입된, 즉, HIF-1α 유전자가 과발현되는 심장줄기세포 또는 이의 배양액은 VEGF, Angiopoietins, FGF, PLGF, PDGF, SDF-1, SCF 등과 같은 혈관 신생 유전자를 활성화시키고, 동시에 IGF, TGF-α, TGF-β, NOS2 등과 같은 세포의 생존 및 증식능과 관련된 유전자를 활성화시킴으로써 줄기세포의 분화, 생존, 증식, 혈관 신생, 이동 등에 관여하여 심장줄기세포의 혈관 신생을 촉진시킬 수 있다. 이에 대한 기작은 도 27에 간략히 나타내었다. 이를 통하여, HIF-1α 유전자 또는 이의 구성적 활성 유전자를 심장줄기세포에 도입함으로써 상기 유전자가 도입된 심장줄기세포는 혈관 신생능이 촉진될 뿐만 아니라, 이를 통하여 손상된 혈관을 효과적으로 회복시킬 수 있다는 것을 확인할 수 있었다. 그리고 HIF-1α 뿐만이 아니라 HIF-1α에 의하여 발현이 증가되는 VEGF, FGF, PDGF, HGF 등의 유전자를 심장줄기세포에 도입하면 HIF-1α와 유사하게 심장줄기세포의 혈관신생능이 강화될 것으로 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 혈관 신생능이 증가된 심장줄기세포는 또는 이의 배양액은 혈관 신생능이 촉진될 뿐만 아니라, 이를 통하여 손상된 혈관을 효과적으로 회복시킬 수 있기 때문에 상처, 만성궤양, 허혈성뇌졸중, 심근경색, 협심증, 뇌혈관성 치매 등 다양한 혈관 신생 촉진으로 인하여 치료 효과를 나타낼 수 있는 다양한 질환에 효과적으로 사용될 수 있을 것으로 기대된다.

Claims (8)

  1. 심장줄기세포 또는 이의 배양액을 유효성분으로 포함하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  2. 제 1 항에 있어서,
    상기 심장줄기세포는 저산소유도인자 1-알파(Hypoxia-inducible factor 1-alpha; HIF-1α), 혈관내피성장인자(vascular endothelial growth factor; VEGF), 혈소판유래성장인자(platelet-derived growth factor; PDGF), 간세포증식인자(hepatocyte growth factor; HGF), 및 섬유아세포 성장인자(fibroblast growth factor; FGF)로 이루어진 군으로부터 선택된 어느 하나 이상의 성장인자를 코딩하는 유전자로 형질전환된 것을 특징으로 하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  3. 제 2 항에 있어서,
    상기 저산소유도인자 1-알파는 서열번호 12로 표시되는 아미노산을 포함하는 것을 특징으로 하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  4. 제 1 항에 있어서,
    상기 혈관 신생 의존성 질환은 상처, 만성궤양, 허혈성뇌졸중, 심근경색, 협심증, 말초동맥질환, 중증하지허혈, 당뇨병성 족부궤양, 및 뇌혈관성 치매로 이루어진 군으로부터 선택되는 어느 하나 이상의 질환인 것을 특징으로 하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  5. 제 1 항에 있어서,
    상기 약학적 조성물은 하이드로젤(hydrogel)을 추가로 포함하는 것을 특징으로 하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  6. 제 5 항에 있어서,
    상기 하이드로젤은 콜라겐(collagen), 젤라틴(gelatin), 콘드로이틴(chondroitin), 하알루로닉산(hyaluronic acid), 알지닌(alginic acid), 메트리젤(MatrigelTM), 키토산(chitosan), 펩티드(peptide), 피브린(fibrin), PGA(polyglycolic acid), PLA(polylactic acid), PEG(polyethylene glycol) 및 폴리아크릴아미드(polyacrylamide)로 이루어진 군으로부터 선택된 어느 하나 이상인 것을 특징으로 하는, 혈관 신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  7. 심장줄기세포 또는 이의 배양액을 유효성분으로 포함하는 조성물을 개체에 투여하는 단계를 포함하는, 혈관 신생 의존성 질환의 예방 또는 치료 방법.
  8. 심장줄기세포 또는 이의 배양액을 유효성분으로 포함하는 조성물의 혈관 신생 의존성 질환의 예방 또는 치료 용도.
PCT/KR2021/003310 2020-03-17 2021-03-17 심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물 WO2021187895A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/912,229 US20240058389A1 (en) 2020-03-17 2021-03-17 Composition for preventing or treating ischemic diseases, comprising cardiac stem cells
EP21771577.0A EP4123017A4 (en) 2020-03-17 2021-03-17 COMPOSITION FOR THE PREVENTION OR TREATMENT OF ISCHEMIC DISEASES COMPRISING CARDIAC STEM CELLS

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200032823 2020-03-17
KR10-2020-0032823 2020-03-17
KR10-2021-0034721 2021-03-17
KR1020210034721A KR20210116350A (ko) 2020-03-17 2021-03-17 심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2021187895A1 true WO2021187895A1 (ko) 2021-09-23

Family

ID=77771812

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003310 WO2021187895A1 (ko) 2020-03-17 2021-03-17 심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물

Country Status (2)

Country Link
US (1) US20240058389A1 (ko)
WO (1) WO2021187895A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090010662A (ko) 2007-07-24 2009-01-30 부산대학교 산학협력단 비스파틴을 유효성분으로 함유하는 혈관신생 촉진제
WO2011067317A1 (en) * 2009-12-02 2011-06-09 Cardio3 Biosciences S.A. Pharmaceutical compositions for the stimulation of stem cells.
KR20180071665A (ko) * 2016-12-20 2018-06-28 인제대학교 산학협력단 심장줄기세포의 다층세포시트 및 이의 제조방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090010662A (ko) 2007-07-24 2009-01-30 부산대학교 산학협력단 비스파틴을 유효성분으로 함유하는 혈관신생 촉진제
WO2011067317A1 (en) * 2009-12-02 2011-06-09 Cardio3 Biosciences S.A. Pharmaceutical compositions for the stimulation of stem cells.
KR20180071665A (ko) * 2016-12-20 2018-06-28 인제대학교 산학협력단 심장줄기세포의 다층세포시트 및 이의 제조방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 22 July 2014 (2014-07-22), ANONYMOUS: "PREDICTED: hypoxia-inducible factor 1-alpha [Galeopterus variegatus]", XP055851042, retrieved from NCBI Database accession no. XP_008564341 *
HIRANMOY DAS, JON C. GEORGE, MATTHEW JOSEPH, MANJUSRI DAS, NASREEN ABDULHAMEED, ANNA BLITZ, MAHMOOD KHAN, RAMASAMY SAKTHIVEL, HAI-: "Stem Cell Therapy with Overexpressed VEGF and PDGF Genes Improves Cardiac Function in a Rat Infarct Model", PLOS ONE, vol. 4, no. 10, pages e7325, XP055092609, DOI: 10.1371/journal.pone.0007325 *
PEI XING, HEEJUNG KIM, MINJOO LEE, NANA WANG, JIYOUNG SHIN, SEUNGJIN LEE, MIYUN YOON, VICTOR C YANG, HUINING HE: "Local delivery of cardiac stem cells overexpressing HIF-1α promotes angiogenesis and muscular tissue repair in a hind limb ischemia model", JOURNAL OF CONTROLLED RELEASE, vol. 322, 16 March 2020 (2020-03-16), pages 610 - 621, XP055851037, DOI: 10.1016/j.jconrel.2020.03.017 *

Also Published As

Publication number Publication date
US20240058389A1 (en) 2024-02-22

Similar Documents

Publication Publication Date Title
WO2010041913A2 (ko) Grs 단백질 또는 이의 단편의 신규한 용도
US8158589B2 (en) Peptides with the capacity to bind to transforming growth factor β1 (TGF-β1)
WO2019004792A9 (ko) 인간 유래 심장 줄기세포 미세구의 제조 방법 및 용도
WO2018117573A1 (ko) 신경능선줄기세포의 다층세포시트 및 이의 제조방법
WO2021187895A1 (ko) 심장줄기세포를 포함하는 허혈성 질환의 예방 또는 치료용 조성물
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
KR20070113500A (ko) Ｄｋｋ2를 포함하는 혈관신생을 촉진시키는 방법
EP4123017A1 (en) Composition for preventing or treating ischemic diseases, comprising cardiac stem cells
WO2016122288A2 (ko) 베르베논 유도체 및 재관류 치료제를 포함하는 뇌혈관 질환, 동맥경화증 또는 심혈관 질환 치료 또는 예방용 병용 제제
WO2014112702A1 (ko) 혈관형성 촉진 활성을 갖는 돌연변이형 합토글로빈의 용도
KR100888889B1 (ko) 비스파틴을 유효성분으로 함유하는 혈관신생 촉진제
WO2015072708A1 (ko) 성체 섬유모세포를 형질전환(이형분화)시켜 혈관내피세포를 제조하는 방법 및 이의 용도
WO2021256751A1 (ko) 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물
WO2016018090A1 (ko) 혈관신생촉진용 펩타이드 및 이의 용도
CN113018424B (zh) Cst1在预防和/或治疗肝脏免疫失调疾病中的应用
WO2021006670A1 (ko) 혼합물 4f를 이용한 줄기세포 생물학적 활성 증가용 조성물
WO2017111388A1 (ko) 페리오스틴 유래 펩타이드를 유효성분으로 포함하는 혈관신생 촉진용 조성물
WO2020122666A1 (ko) 중간엽줄기세포가 포함된 생체 이식용 임플란트를 포함하는 간 질환의 예방 또는 치료용 약학적 조성물
WO2023033534A1 (ko) Kai1 폴리펩타이드를 포함하는 간 섬유화 억제용 약학 조성물 및 이의 용도
WO2018021771A1 (ko) TIF1γ의 발현 또는 활성 증강제를 유효성분으로 포함하는 간 섬유화 또는 간경화 예방 또는 치료용 조성물
WO2024106959A1 (ko) 줄기세포 스페로이드를 포함하는 조직 재생 촉진용 조성물
WO2012036412A9 (ko) 혈관신생 억제 활성을 갖는 펩타이드 및 이의 용도
WO2023191204A1 (ko) 신생혈관생성 활성을 지니는 펩타이드 조성물, 이를 이용한 약학 조성물 및 이를 이용한 화장품 조성물
WO2023096330A1 (ko) 티모신 베타 4의 융합 단백질을 포함하는 혈관 신생 촉진용 조성물
WO2024122726A1 (ko) 연골 재생용 펩타이드 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21771577

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021771577

Country of ref document: EP

Effective date: 20221017