WO2021187670A1 - 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물 - Google Patents

랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물 Download PDF

Info

Publication number
WO2021187670A1
WO2021187670A1 PCT/KR2020/007263 KR2020007263W WO2021187670A1 WO 2021187670 A1 WO2021187670 A1 WO 2021187670A1 KR 2020007263 W KR2020007263 W KR 2020007263W WO 2021187670 A1 WO2021187670 A1 WO 2021187670A1
Authority
WO
WIPO (PCT)
Prior art keywords
raloxifene
coronavirus
cov
hcov
composition
Prior art date
Application number
PCT/KR2020/007263
Other languages
English (en)
French (fr)
Inventor
정귀완
김판수
박선미
김승택
장소영
김진희
민지영
이주연
김경창
김령의
Original Assignee
재단법인 경기도경제과학진흥원
대한민국(관리부서 질병관리본부장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 경기도경제과학진흥원, 대한민국(관리부서 질병관리본부장) filed Critical 재단법인 경기도경제과학진흥원
Publication of WO2021187670A1 publication Critical patent/WO2021187670A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4535—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a heterocyclic ring having sulfur as a ring hetero atom, e.g. pizotifen
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • the present invention relates to a composition for improving coronavirus infection using raloxifene.
  • Raloxifene is structurally similar to estrogen and is a selective estrogen receptor modulating drug that acts on the estrogen receptor to antagonize or enhance estrogen.
  • raloxifene is used for the prevention and treatment of osteoporosis, which is increasing in postmenopausal women, clinical studies show that raloxifene not only prevents osteoporosis, but also reduces the risk of vertebral fractures (treatment of osteoporosis), lowering cholesterol levels, and the development of cardiovascular disease and breast cancer. It offers encouraging results such as reduction.
  • coronavirus is a single-stranded, positive RNA virus with an envelope, with a gene size of 25 to 32 kb, which is a relatively large virus among RNA viruses. It has a crown (Corona in Latin) structure because the club-shaped spike protein is expressed in the outer skin. Coronaviruses, first discovered in chickens in 1937 and then found in various animals including cattle, pigs, cats, birds, bats, and mice, are divided into four genera (alpha, beta, gamma, and delta coronaviruses). Alpha and beta coronaviruses infect mammals, gamma and delta coronaviruses infect birds, and are known to cause gastrointestinal and respiratory diseases in animals.
  • SARS-CoV coronavirus that causes Severe Acute Respiratory Syndrome (SARS)
  • MERS-CoV Middle East Respiratory Syndrome (MERS, MERS) 7 species have been reported, including HCoV-229E, HCoV-OC43, and SARS-CoV-2 [the virus that causes coronavirus infection-19 (COVID-19)].
  • the present invention discloses antiviral activity of raloxifene against coronaviruses such as SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, and SARS-CoV-2.
  • An object of the present invention is to provide a composition for improving coronavirus infection caused by SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, SARS-CoV-2, etc. using raloxifene.
  • raloxifene improves the survival rate of infected cells of the coronaviruses SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, and SARS-CoV-2 or the coronavirus. It was completed by confirming that it inhibits intracellular proliferation.
  • the present invention provides SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43 and SARS-CoV-2 containing raloxifene of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. It can be identified as a composition for improving the selected coronavirus infection.
  • Raloxifene (CAS ID: 84449-90-1) is a known licensed drug, and the chemical formula can be found below.
  • coronavirus infection refers to a human infection of a coronavirus, proliferation in the human body after infection, and symptoms caused by the infection and/or proliferation.
  • improving coronavirus infection means preventing, treating or alleviating symptoms of coronavirus infection.
  • active ingredient refers to a component capable of exhibiting the desired activity alone or in combination with a carrier that has no activity by itself.
  • the raloxifene compound of ⁇ Formula 1> of the present invention may be used in the form of a pharmaceutically acceptable salt, and as the salt, an acid addition salt formed by a pharmaceutically acceptable free acid may be used.
  • Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes.
  • non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids, and organic acids such as acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, and fumaric acid.
  • Such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, ioda.
  • the acid addition salt in the present invention is prepared by a conventional method, for example, by dissolving the raloxifene compound of ⁇ Formula 1> in an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, etc. and adding an organic or inorganic acid. It can be prepared by filtering and drying the precipitate, or it can be prepared by drying or crystallizing in an organic solvent after distilling the solvent and excess acid under reduced pressure.
  • the acid addition salt of raloxifene is preferably raloxifene hydrochloride.
  • the raloxifene compound of ⁇ Formula 1> of the present invention may be prepared as a pharmaceutically acceptable metal salt using a base.
  • the alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate.
  • it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt.
  • the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg, silver nitrate).
  • the raloxifene compound of ⁇ Formula 1> of the present invention may be used not only as a pharmaceutically acceptable salt thereof, but also in the form of possible solvates, hydrates, stereoisomers, and the like, which may be prepared therefrom.
  • the active ingredient may be included in any amount (effective amount) depending on the specific use, formulation, etc. as long as it can exhibit antiviral activity, and a typical effective amount is 0.0001 weight based on the total weight of the composition. % to 20.0% by weight.
  • the term "effective amount" refers to the intended medical treatment, such as the treatment, prevention, and symptom relief effect of coronavirus infection, when the composition of the present invention is administered to a mammal, preferably a human subject, during the administration period as suggested by a medical professional.
  • ⁇ refers to the amount of the active ingredient contained in the composition of the present invention, which can exhibit a pharmacological effect. Such effective amounts can be determined empirically within the ordinary ability of one of ordinary skill in the art.
  • composition of the present invention may be identified as a pharmaceutical composition in another specific embodiment.
  • the pharmaceutical composition of the present invention may be prepared as an oral dosage form or a parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient.
  • pharmaceutically acceptable means that it does not inhibit the activity of the active ingredient and does not have toxicity beyond which the application (prescription) target is adaptable.
  • composition of the present invention is prepared as an oral dosage form, powders, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers, together with a suitable carrier according to methods known in the art.
  • suitable pharmaceutically acceptable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, Cellulose such as sodium carboxymethylcellulose and hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable and oil.
  • sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol
  • starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, Cellulose such as sodium carboxymethylcellulose and hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxy
  • the formulation may be formulated by including a diluent and/or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant, if necessary.
  • a diluent and/or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant, if necessary.
  • the pharmaceutical composition of the present invention When the pharmaceutical composition of the present invention is prepared for parenteral use, it may be formulated in the form of injections, transdermal administrations, nasal inhalants and suppositories together with suitable carriers according to methods known in the art.
  • a suitable carrier may be sterile water, ethanol, polyol such as glycerol or propylene glycol, or a mixture thereof, preferably Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine, or sterilized for injection. Water, an isotonic solution such as 5% dextrose, etc. may be used.
  • formulated for transdermal administration When formulated for transdermal administration, it can be formulated in the form of ointments, creams, lotions, gels, external solutions, pasta agents, liniment agents, air rolls, and the like.
  • a nasal inhalant it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, and the like.
  • tween 61 polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like can be used.
  • a preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, patient's severity, and administration route. It can be in the range /kg. Administration may be performed once or divided into several times a day. Such dosages should not be construed as limiting the scope of the invention in any respect.
  • composition of this invention can be grasped
  • the food composition of the present invention may be prepared in any form, for example, beverages such as tea, juice, carbonated beverages, and ionic beverages, processed oils such as milk and yogurt, gums, rice cakes, Korean sweets, bread, confectionery, noodles, etc. of foods, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, bars and the like health functional food preparations.
  • the food composition of the present invention may have any product classification in terms of legal and functional classification as long as it conforms to the enforcement laws at the time of manufacture and distribution. For example, it is a health functional food according to the “Health Functional Food Act” of Korea, or confectionery, beans, tea, beverage, It may be a special purpose food or the like.
  • the food composition of the present invention may contain food additives in addition to the active ingredients thereof.
  • Food additives can be generally understood as substances that are added to and mixed with or infiltrated into food in manufacturing, processing, or preserving food.
  • Food additives with guaranteed safety are limited in terms of ingredients or functions in the Food Additives Ordinance in accordance with the laws of each country that regulates the manufacture and distribution of food (the "Food Sanitation Act” in Korea).
  • Food Additives Code Korean Food Additives Code (Ministry of Food and Drug Safety Notice “Food Additive Standards and Specifications)
  • food additives are classified into chemically synthetic products, natural additives and mixed preparations in terms of ingredients. , preservatives, emulsifiers, acidulants, thickeners, etc.
  • the sweetener is used to impart appropriate sweetness to food, and both natural and synthetic ones may be used in the food composition of the present invention.
  • a natural sweetener is used.
  • sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.
  • Flavoring agents may be used to improve taste or aroma, and both natural and synthetic ones may be used. Preferably, it is a case where a natural thing is used. In the case of using a natural one, the purpose of nutritional enhancement in addition to flavor may be concurrently used.
  • the natural flavoring agent may be obtained from apples, lemons, tangerines, grapes, strawberries, peaches, or the like, or obtained from green tea leaves, horseradish leaves, bamboo leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, ginkgo biloba, etc. can be used.
  • the natural flavoring agent may be a liquid concentrate or a solid extract.
  • a synthetic flavoring agent may be used, and the synthetic flavoring agent may include esters, alcohols, aldehydes, terpenes, and the like.
  • calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), etc. can be used, and as an emulsifier, acacia gum, carboxymethylcellulose, xanthan gum, and pectin can be used.
  • acidulant, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid and the like may be used as acidulants. Acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing the taste.
  • a suspending agent a suspending agent, a settling agent, a gel-forming agent, a bulking agent, and the like can be used.
  • the food composition of the present invention may contain, in addition to the food additives as described above, physiologically active substances or minerals known in the art for the purpose of supplementing and reinforcing functionality and nutrition and guaranteed stability as food additives.
  • physiologically active substances examples include catechins contained in green tea and the like, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoylthiamine, and the like.
  • vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12
  • tocopherol dibenzoylthiamine, and the like.
  • Magnesium preparations such as iron preparations, such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, etc. are mentioned.
  • the food additives as described above may be included in an appropriate amount to achieve the purpose of the addition according to the type of product.
  • composition of the present invention may be commercialized as a food or drug.
  • 1 and 2 show the results of the MERS-CoV and SARS-CoV coronavirus proliferation inhibition experiments of raloxifene by immunofluorescence staining, respectively.
  • FIG. 4 shows the results of an experiment for inhibiting proliferation of raloxifene against HCoV-OC43 coronavirus by CPE assay.
  • 5 and 6 show the results of experiments for inhibiting proliferation of raloxifene against HCoV-229E and HCoV-OC43 coronaviruses by qRT-PCR, respectively.
  • FIG. 7 and 8 show the cell viability test results of SARS-CoV-2 coronavirus-infected cells using the WST assay, and the SARS-CoV-2 coronavirus proliferation inhibition test results of raloxifene by qRT-PCR and plaque test methods, respectively. it has been shown
  • Vero (CCL-81) cells were purchased from ATCC (Manassas, VA, USA), 5% CO 2 , Opti-PRO added with 4 mM L-glutamine and an antibiotic/antifungal mixture in a wet incubator maintained at 37° C. TM SFM (#12309019, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) medium.
  • MERS coronavirus (passage 4, MERS-CoV/KOR/KNIH/002_05_2015; GenBank accession No. KT029139.1) was isolated from a domestic patient in Korea was purchased from the Institut Pasteur Hong Kong and used under strict control at the Institut Pasteur Korea Biosafety Level 3 (BSL-3) research facility.
  • MERS coronavirus and SARS coronavirus were propagated in Vero cells, and virus titers were measured using a plaque assay.
  • Raloxifene used in the experiment was purchased in powder form from Cayman Chemical (Ann Arbor, MI, USA) and dissolved in DMSO solvent.
  • test compound raloxifene
  • the test compound, raloxifene was serially diluted by 1/2 from the highest concentration of 50 ⁇ M to the minimum of 0.0977 ⁇ M, and treated to 10 concentrations, and the DMSO concentration was maintained below 0.5%.
  • MERS coronavirus and SARS coronavirus were infected with a multiplicity of infection (MOI) of 0.0625 and 0.05, respectively, and after 24 hours, cells were treated with 4% paraformaldehyde. After fixing, immunofluorescence staining was performed.
  • MOI multiplicity of infection
  • MERS coronavirus and SARS coronavirus were detected with a primary antibody and anti-SARS-CoV spike S1 antibody (Sino Biological Inc., Beijing, China) against MERS coronavirus spike isolated from rabbits, respectively, and then AlexFluor TM 488 Infection was observed by attaching a fluorescent secondary antibody (#A-11008 Invitrogen, Thermo Fisher Scientific Inc., Waltham, MA, USA), and cell viability was evaluated by staining with Hoechst 33342 (#H3570, Invitrogen).
  • the Z' factor which is the criterion for evaluating the effectiveness of the assay, was 0.97, and a dose-response curve was prepared using two compounds (Chloroquine diphosphate and Lopinavir) known to have antiviral activity against MERS coronavirus. Validation was verified.
  • the percentage infection (PI) is calculated by the formula below.
  • INtest is the infection rate of the test group treated with raloxifene and infected with the virus
  • ⁇ INmock is the infection rate of the negative control treated with DMSO but not infected with the virus
  • ⁇ INvehicle is the infection rate of the infected control group treated with DMSO and infected with the virus.
  • the infection survival rate (PV) is calculated by the formula below.
  • CNtest and ⁇ CNmock are the average cell numbers of the test group treated with raloxifene and infected with the virus and the negative control group treated with DMSO and not infected, respectively.
  • IC 50 the concentration of raloxifene that inhibits virus replication by 50%
  • CC 50 the concentration of raloxifene that inhibits host cell death by 50%
  • FIGS. 1 and 2 The results are shown in FIGS. 1 and 2 for MERS coronavirus and SARS coronavirus, respectively. 1 and 2, the IC 50 of raloxifene against the MERS coronavirus was 6.38 ⁇ M, the CC 50 was 44.22 ⁇ M or more, and the SI was 6.93 or more, and the IC 50 of raloxifene against the SARS coronavirus was 8.90 ⁇ M, CC 50 was 50 ⁇ M or more, and SI was 5.62 or more (in FIGS. 1 and 2, the gray line is the virus proliferation rate, and the black line is the cell viability).
  • RNA of infected cells was detected and quantitatively analyzed for RNA of MERS coronavirus by applying multiplex RT-PCR (multiplex real-time reverse-transcription polymerase chain reaction).
  • the amount of upstream of E gene (upE) was measured using TOPscript TM One-step RT-PCR DryMIX kit (Enzynomics, #RT412). For each 25 ul reaction , 1 ⁇ l of total RNA, upE gene expression was confirmed in the reagent mixture tube provided in the TOPscript TM One-step RT-PCR DryMIX kit (Corman VM et al. Detection of a novel human coronavirus by real).
  • upE-Fwd GCAACGCGCGATTCAGTT
  • upE-Rev GCCTCTACACGGGACCCATA
  • primer pair primer pair and upE at a concentration of 400 nM used in -time reverse-transcription polymerase chain reaction.
  • -Prb 6-carboxyfluorescein [FAM]-CTCTTCACATAATCGCCCCGAGCTCG-6-carboxy-N,N,N,N'-tetramethylrhodamine [TAMRA] probe (probe sequence: SEQ ID NO: 3) was added and reacted.
  • GAPDH-Fwd (GAAGGTGAAGGTCGGAGTCAAC) (SEQ ID NO: 4), GAPDH-Rev (CAGAGTTAAAAGCAGCCCTGGT) (SEQ ID NO: 5) primer pair and GAPDH-Prb (6-carboxy-4') at a concentration of 400 nM to measure GAPDH gene expression as an internal control ,5'-dichloro-2',7'-dimethoxyfluorescein[JOE]-TTTGGTCGTATTGGGCGCT-6-carboxy-N,N,N,N ⁇ -tetramethylrhodamine[TAMRA]) Probe (probe sequence: SEQ ID NO: 6) was added reacted.
  • Reverse transcription reaction and gene amplification were performed using ViiA TM 7 Real-Time PCR System (Thermo Scientific) at 50°C for 30 minutes, 95°C for 3 minutes, (95°C for 30 seconds, 58°C for 1 minute) ⁇ 40 cycles. did.
  • the measured MERS coronavirus upE gene expression level was analyzed by Comparative CT Method ( ⁇ CT Method) by correcting the amount of GAPDH.
  • ⁇ CT Method Comparative CT Method
  • the E gene is an envelope protein gene, and the expression level of the E gene upstream of the E gene can be used as an index showing the degree of virus proliferation (Corman VM et al. Detection of a novel human coronavirus by real -time reverse-transcription polymerase chain reaction ( Eurosurveillance 2012; 17:20285).
  • FIG. 3 The results are shown in FIG. 3 .
  • raloxifene suppresses the expression of the upper region of the E gene in a concentration-dependent manner.
  • MRC-5 cells (ATCC ® CCL-171) were purchased from ATCC (Manassas, VA, USA) and Eagle's Minimum Essential Medium (EMEM) (ATCC ® 30-2003) supplemented with 4 mM L-glutamine and an antibiotic/antifungal mixture.
  • TM cultured in medium.
  • HCoV-229E (ATCC ® VR-740 TM ) virus and HcoV-OC43 (ATCC ® VR-1558 TM ) were purchased from ATCC (Manassas, VA, USA) at Gyeonggi Bio Center Biosafety Level 2 (BSL-2) research facility used under strict control. Both coronaviruses were propagated in MRC-5 cells and virus titers were measured using a plaque assay.
  • CPE assay Cytopathic effect assay
  • RNA from coronavirus-infected or uninfected MRC-5 cells was treated with TRIZOL reagent (Invitrogen, Carlsbad, CA). was used to separate 20 ng RNA was added to 20 ⁇ l of the reaction mixture, and cDNA was synthesized according to the manufacturer's protocol using One Step RT-PCR MasterMix kit (MERK, Germany) and SYBR Green reagent (MGmed, Seoul, Korea) and quantitative RT- PCR was performed using a LightCycler® 480 device (Roche Life Science, Germany) at 50° C. for 30 minutes, 95° C. for 10 minutes, (95° C. for 5 seconds, 60° C. for 30 seconds) ⁇ 40 cycles.
  • TRIZOL reagent Invitrogen, Carlsbad, CA
  • Vero E6 cells ATCC CRL-1586 was purchased from ATCC (Manassas, USA), 5% CO 2 , and inactivated 10% FBS (Fetal bovine serum, Gibco, USA) and 1% penicillin/streptomycin (Gibco, USA) in an incubator at 37° C. It was cultured in the added Dulbecco Modified Eagle Medium (DMEM, Gibco, USA) medium.
  • DMEM Dulbecco Modified Eagle Medium
  • SARS-CoV-2 passedage 4, betaCoV/Korea/KCDC03/20 was isolated from a Korean patient and was used under strict control at the Center for Disease Control and Prevention's Biosafety Level 3 (BSL-3) research facility.
  • the CC 50 of raloxifene is 46.92 ⁇ g (99.1 ⁇ M).
  • the cell viability of the treated group compared to the raloxifene untreated group was indicated by a solid square line.
  • Viruses were inoculated for 1 hour at an MOI of 0.05 in a biosafety level 3 laboratory. After removing the inoculum, it was washed with PBS to remove uninfected virus, and a medium containing 1 ml of raloxifene was added. The final concentrations of raloxifene are 80, 20, 5, 1.25, 0.3125 ⁇ g/ml. After 48 hours, 100 ⁇ l of the cell culture medium was collected and dissolved in ACL buffer (QIAGEN, Germany) containing proteinase K (proteinase K).
  • ACL buffer QIAGEN, Germany
  • RNA in the cell culture medium was detected and quantitatively analyzed for SARS-CoV-2 RNA by applying qRT-PCR.
  • the amount of E gene in 5 ⁇ l of RNA was measured according to the manufacturer's manual.
  • the SARS-CoV-2 genome of known concentration was diluted to a certain concentration, and then qRT-PCR was performed to determine the reference curve.
  • IC 50 concentration of a compound that inhibits virus concentration by 50%
  • SI selectivity index
  • FIG. 7 The results are shown in FIG. 7 .
  • raloxifene inhibits the expression of the E gene of SARS-CoV-2 in a concentration-dependent manner.
  • IC 50 of raloxifene against SARS-CoV-2 was 1.47 ⁇ g
  • CC 50 was 46.92 ⁇ g or higher
  • SI was 31.9.
  • the genome copy reduction rate (circular solid line) and cell viability (square solid line) of the treated group are indicated.
  • Viruses were inoculated for 1 hour at an MOI of 0.05 in a biosafety level 3 laboratory. After removing the inoculum, it was washed with PBS to remove uninfected virus, and a medium containing raloxifene was added. The final concentrations of raloxifene were 80, 20, 5, 1.25, and 0.3125 ⁇ g/ml. After 48 hours, 1 ml of the cell culture medium was harvested and stored in a cryogenic freezer at -70° C. until the plaque test was performed.
  • FIG. 8 it is shown that raloxifene inhibits SARS-CoV-2 proliferation in a concentration-dependent manner.
  • the IC 50 of raloxifene against SARS-CoV-2 was 1.76 ⁇ g (3.7 ⁇ M)
  • the CC 50 of raloxifene was 46.92 ⁇ g (99.1 ⁇ M) or higher
  • the SI was 26.7.
  • the plaque reduction rate (circular solid line) and cell viability (square solid line) of the treated group are indicated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Communicable Diseases (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 코로나바이러스인 SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, SARS-CoV-2의 감염세포 생존율을 향상시키거나 그 코로나바이러스 세포 내 증식을 억제하는 활성을 가진 랄록시펜을 코로나바이러스 감염증 개선용 조성물을 개시한다.

Description

랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물
본 발명은 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물에 관한 것이다.
랄록시펜(Raloxifene)은 에스트로겐과 구조적으로 유사하여 에스트로겐 수용체에 작용하여 에스트로겐을 길항하거나 항진하는 선택적 에스트로겐 수용체 조절 계열의 약물이다.
랄록시펜은 폐경기 여성에서 증가하는 골다공증의 예방 및 치료에 사용되지만, 임상 연구들은 랄록시펜이 골다공증 예방 뿐 아니라 척추골절 발생 위험의 감소 효과(골다공증 치료), 콜레스테롤치를 낮추는 효과, 그리고 심혈관계 질환과 유방암 발생을 줄이는 등의 고무적인 결과를 제시하고 있다.
한편 코로나바이러스는 외피가 있는 단일가닥의 양성 RNA 바이러스이며 유전자 크기는 25~32kb로, RNA 바이러스 중 비교적 큰 바이러스이다. 외피에 곤봉 모양의 스파이크(spike) 단백질이 발현되어 있어 왕관(라틴어로 Corona) 모양 구조를 가지고 있다. 1937년 닭에서 처음으로 발견된 후 소, 돼지, 고양이, 새, 박쥐, 쥐 등 다양한 동물에서 발견된 코로나바이러스는 4개의 속(알파, 베타, 감마, 델타 코로나바이러스)으로 나뉜다. 알파와 베타 코로나바이러스는 포유류, 감마와 델타코로나바이러스는 조류에 감염되며, 동물에서 위장 질환 및 호흡기 질환을 일으키는 것으로 알려져 있다. 사람에 감염되는 코로나바이러스 현재까지 SARS-CoV[중증급성호흡기증후군(Severe Acute Respiratory Syndrome, SARS, 사스)을 일으키는 코로나바이러스], MERS-CoV[중동호흡기증후군(Middle East Respiratory Syndrome, MERS, 메르스)을 일으키는 코로나바이러스] HCoV-229E, HCoV-OC43, SARS-CoV-2[코로나바이러스감염증-19(COVID-19)을 일으키는 바이러스] 등을 포함하여 7종이 보고되어 있다.
클로프로마진(Chlorpromazine), 트리플루프로마진(Triflupromazine), 이마티닙 메실레이트(Imatinib mesylate), 다사티닙(Dasatinib), 젬시타빈(Gemcitabine), 토레미펜(Toremifene), 클로로퀸(Chloroquine), 로피나비르(Lopinavir)와 같은 기존의 저분자 약물이 세포 수준에서 메르스 코로나바이러스를 저해하는 활성이 보고되었다. 최근에는 스파이크에 대한 단클론항체, 세포막 융합을 억제하는 펩타이드 또한 개발 진행 중에 있다.
본 발명은 랄록시펜의 SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, SARS-CoV-2 등의 코로나바이러스에 대한 항바이러스 활성을 개시한다.
본 발명의 목적은 랄록시펜을 이용한 SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, SARS-CoV-2 등에 의한 코로나바이러스 감염증의 개선용 조성물을 제공하는 데 있다.
본 발명의 다른 목적이나 구체적인 목적은 이하에서 제시될 것이다.
본 발명자들은 아래의 실시예에서 확인되는 바와 같이, 랄록시펜이 코로나바이러스인 SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, SARS-CoV-2의 감염세포 생존율을 향상시키거나 그 코로나바이러스 세포 내 증식을 억제함을 확인함으로써 완성된 것이다.
전술한 바를 고려할 때, 본 발명은 아래 화학식 1의 랄록시펜 또는 그의 약제학적으로 허용 가능한 염을 유효성분으로 하는, SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43 및 SARS-CoV-2 중에서 선택된 코로나바이러스 감염증 개선용 조성물로 파악할 수 있다.
랄록시펜(CAS ID: 84449-90-1)은 공지의 허가된 약물로서, 그 화학식은 아래에서 확인할 수 있다.
<화학식 1>
Figure PCTKR2020007263-appb-I000001
본 명세서에서, "코로나바이러스 감염증"이란 코로나바이러스의 인체 감염, 감염 후의 인체 내 증식, 그 감염 및/또는 증식에 의한 증상을 의미한다.
또 본 명세서에서, "코로나바이러스 감염증 개선"은 코로나바이러스 감염증 예방, 치료 또는 증상 경감을 의미한다.
또 본 명세서에서 "유효성분"이란 단독으로 목적하는 활성을 나타내거나 또는 그 자체는 활성이 없는 담체와 함께 활성을 나타낼 수 있는 성분을 의미한다.
본 발명의 <화학식 1>의 랄록시펜 화합물은 약학적으로 허용 가능한 염의 형태로 사용될 수 있으며, 염으로는 약학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염을 사용될 수 있다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산, 아세트산, 안식향산, 구연산, 젖산, 말레인산, 글루콘산, 메탄설폰산, 4-톨루엔설폰산, 주석산, 푸마르산과 같은 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함하나, 이에 제한되는 것은 아니다. 본 발명에서의 산 부가염은 통상의 방법, 예를 들면, <화학식 1>의 랄록시펜 화합물을 유기용매, 예를 들면 메탄올, 에탄올, 아세톤, 메틸렌클로라이드, 아세토니트릴 등에 녹이고 유기산 또는 무기산을 가하여 생성된 침전물을 여과, 건조하여 제조되거나, 용매와 과량의 산을 감압 증류한 후 건조하거나 유기용매 하에서 결정화시켜셔 제조할 수 있다. 특히 랄록시펜의 산 부가염은 랄록시펜 염산염(raloxifene hydrochloride)이 바람직하다.
또한, 본 발명의 <화학식 1>의 랄록시펜 화합물은 염기를 사용하여 약학적으로 허용 가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속 염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 음염(예, 질산은)과 반응시켜 얻는다.
또한, 본 발명의 상기 <화학식 1>의 랄록시펜 화합물은 이의 약학적으로 허용되는 염뿐만 아니라, 이로부터 제조될 수 있는 가능한 용매화물, 수화물, 입체이성질체 등의 형태로도 사용될 수 있다.
본 발명의 조성물에서 그 유효성분은 항바이러스 활성을 나타낼 수 있는 한, 그 구체적 용도, 제형 등에 따라 임의의 양(유효량)으로 포함될 수 있는데, 통상적인 유효량은 조성물 전체 중량을 기준으로 할 때 0.0001 중량 % 내지 20.0 중량 % 범위 내에서 결정될 것이다. 여기서 "유효량"이란 그 적용 대상인 포유동물 바람직하게는 사람에게 의료 전문가 등의 제언에 의한 투여 기간 동안 본 발명의 조성물이 투여될 때, 코로나바이러스 감염증의 치료, 예방, 증상 경감 효과 등 의도한 의료적·약리학적 효과를 나타낼 수 있는, 본 발명의 조성물에 포함되는 유효성분의 양을 말한다. 이러한 유효량은 당업자의 통상의 능력 범위 내에서 실험적으로 결정될 수 있다.
본 발명의 조성물은 다른 구체적인 양태에 있어서는 약제학적 조성물로 파악될 수 있다.
본 발명의 약제학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함하여 당업계에 공지된 통상의 방법으로 투여 경로에 따라 경구용 제형 또는 비경구용 제형으로 제조될 수 있다. 여기서 "약제학적으로 허용되는" 의미는 유효성분의 활성을 억제하지 않으면서 적용(처방) 대상이 적응 가능한 이상의 독성을 지니지 않는다는 의미이다.
본 발명의 약제학적 조성물이 경구용 제형으로 제조될 경우, 적합한 담체와 함께 당업계에 공지된 방법에 따라 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 현탁액, 웨이퍼 등의 제형으로 제조될 수 있다. 이때 약제학적으로 허용되는 적합한 담체의 예로서는 락토스, 글루코스, 슈크로스, 덱스트로스, 솔비톨, 만니톨, 자일리톨 등의 당류, 옥수수 전분, 감자 전분, 밀 전분 등의 전분류, 셀룰로오스, 메틸셀룰로오스, 에틸셀룰로오스, 나트륨 카르복시메틸셀룰로오스, 하이드록시프로필메틸셀룰로오스 등의 셀룰로오스류, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 마그네슘 스테아레이트, 광물유, 맥아, 젤라틴, 탈크, 폴리올, 식물성유 등을 들 수 있다. 제제화활 경우 필요에 따라 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 및/또는 부형제를 포함하여 제제화할 수 있다.
본 발명의 약제학적 조성물이 비경구용 제형으로 제조될 경우, 적합한 담체와 함께 당업계에 공지된 방법에 따라 주사제, 경피 투여제, 비강 흡입제 및 좌제의 형태로 제제화될 수 있다. 주사제로 제제화할 경우 적합한 담체로서는 멸균수, 에탄올, 글리세롤이나 프로필렌 글리콜 등의 폴리올 또는 이들의 혼합물을 사용할 수 있으며, 바람직하게는 링거 용액, 트리에탄올 아민이 함유된 PBS(phosphate buffered saline)나 주사용 멸균수, 5% 덱스트로스 같은 등장 용액 등을 사용할 수 있다. 경피 투여제로 제제화할 경우 연고제, 크림제, 로션제, 겔제, 외용액제, 파스타제, 리니멘트제, 에어롤제 등의 형태로 제제화할 수 있다. 비강 흡입제의 경우 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 등의 적합한 추진제를 사용하여 에어로졸 스프레이 형태로 제제화할 수 있으며, 좌제로 제제화할 경우 그 기제로는 위텝솔(witepsol), 트윈(tween) 61, 폴리에틸렌글리콜류, 카카오지, 라우린지, 폴리옥시에틸렌 소르비탄 지방산 에스테르류, 폴리옥시에틸렌 스테아레이트류, 소르비탄 지방산 에스테르류 등을 사용할 수 있다.
약제학적 조성물의 제제화와 관련하여서는 당업계에 공지되어 있으며, 구체적으로 문헌[Remington's Pharmaceutical Sciences(19th ed., 1995)] 등을 참조할 수 있다. 상기 문헌은 본 명세서의 일부로서 간주 된다.
본 발명의 약제학적 조성물의 바람직한 투여량은 환자의 상태, 체중, 성별, 연령, 환자의 중증도, 투여 경로에 따라 1일 0.001mg/kg ~ 10g/kg 범위, 바람직하게는 0.001mg/kg ~ 1g/kg 범위일 수 있다. 투여는 1일 1회 또는 수회로 나누어 이루어질 수 있다. 이러한 투여량은 어떠한 측면으로든 본 발명의 범위를 제한하는 것으로 해석되어서는 아니 된다.
본 발명의 조성물은 구체적인 양태에 있어서, 식품 조성물로서 파악할 수 있다.
본 발명의 식품 조성물은 어떠한 형태로도 제조될 수 있으며, 예컨대 차, 쥬스, 탄산음료, 이온음료 등의 음료류, 우유, 요구루트 등의 가공 유류, 껌류, 떡, 한과, 빵, 과자, 면 등의 식품류, 정제, 캡슐, 환, 과립, 액상, 분말, 편상, 페이스트상, 시럽, 겔, 젤리, 바 등의 건강기능식품 제제류 등으로 제조될 수 있다. 또 본 발명의 식품 조성물은 법률상·기능상의 구분에 있어서 제조·유통 시점의 시행 법규에 부합하는 한 임의의 제품 구분을 띨 수 있다. 예컨대 한국 "건강기능식품에관한법률"에 따른 건강기능식품이거나, 한국 "식품위생법"의 식품공전(식약처 고시, 식품의 기준 및 규격)상 각 식품유형에 따른 과자류, 두류, 다류, 음료류, 특수용도식품 등일 수 있다.
본 발명의 식품 조성물에는 그 유효성분 이외에 식품첨가물이 포함될 수 있다. 식품첨가물은 일반적으로 식품을 제조, 가공 또는 보존함에 있어 식품에 첨가되어 혼합되거나 침윤되는 물질로서 이해될 수 있는데, 식품과 함께 매일 그리고 장기간 섭취되므로 그 안전성이 보장되어야 한다. 식품의 제조·유통을 규율하는 각국 법률(한국에서는 "식품위생법"임)에 따른 식품첨가물공전에는 안전성이 보장된 식품첨가물이 성분 면에서 또는 기능 면에서 한정적으로 규정되어 있다. 한국 식품첨가물공전(식약처 고시 "식품첨가물 기준 및 규격)에서는 식품첨가물이 성분 면에서 화학적 합성품, 천연 첨가물 및 혼합 제제류로 구분되어 규정되어 있는데, 이러한 식품첨가물은 기능 면에 있어서는 감미제, 풍미제, 보존제, 유화제, 산미료, 점증제 등으로 구분된다.
감미제는 식품에 적당한 단맛을 부여하기 위하여 사용되는 것으로, 천연의 것이거나 합성된 것 모두 본 발명의 식품 조성물에 사용할 수 있다. 바람직하게는 천연 감미제를 사용하는 경우인데, 천연 감미제로서는 옥수수 시럽 고형물, 꿀, 수크로오스, 프룩토오스, 락토오스, 말토오스 등의 당 감미제를 들 수 있다.
풍미제는 맛이나 향을 좋게 하기 위하여 사용될 수 있는데, 천연의 것과 합성된 것 모두 사용될 수 있다. 바람직하게는 천연의 것을 사용하는 경우이다. 천연의 것을 사용할 경우에 풍미 이외에 영양 강화의 목적도 병행할 수 있다. 천연 풍미제로서는 사과, 레몬, 감귤, 포도, 딸기, 복숭아 등에서 얻어진 것이거나 녹차잎, 둥굴레, 대잎, 계피, 국화 잎, 자스민 등에서 얻어진 것일 수 있다. 또 인삼(홍삼), 죽순, 알로에 베라, 은행 등에서 얻어진 것을 사용할 수 있다. 천연 풍미제는 액상의 농축액이나 고형상의 추출물일 수 있다. 경우에 따라서 합성 풍미제가 사용될 수 있는데, 합성 풍미제로서는 에스테르, 알콜, 알데하이드, 테르펜 등이 이용될 수 있다.
보존제로서는 소르브산칼슘, 소르브산나트륨, 소르브산칼륨, 벤조산칼슘, 벤조산나트륨, 벤조산칼륨, EDTA(에틸렌디아민테트라아세트산) 등이 사용될 수 있고, 또 유화제로서는 아카시아검, 카르복시메틸셀룰로스, 잔탄검, 펙틴 등이 사용될 수 있으며, 산미료로서는 연산, 말산, 푸마르산, 아디프산, 인산, 글루콘산, 타르타르산, 아스코르브산, 아세트산, 인산 등이 사용될 수 있다. 산미료는 맛을 증진시키는 목적 이외에 미생물의 증식을 억제할 목적으로 식품 조성물이 적정 산도로 되도록 첨가될 수 있다.
점증제로서는 현탁화 구현제, 침강제, 겔형성제, 팽화제 등이 사용될 수 있다.
본 발명의 식품 조성물은 전술한 바의 식품첨가물 이외에, 기능성과 영양성을 보충, 보강할 목적으로 당업계에 공지되고 식품첨가물로서 안정성이 보장된 생리활성 물질이나 미네랄류를 포함할 수 있다.
그러한 생리활성 물질로서는 녹차 등에 포함된 카테킨류, 비타민 B1, 비타민 C, 비타민 E, 비타민 B12 등의 비타민류, 토코페롤, 디벤조일티아민 등을 들 수 있으며, 미네랄류로서는 구연산칼슘 등의 칼슘 제제, 스테아린산마그네슘 등의 마그네슘 제제, 구연산철 등의 철 제제, 염화크롬, 요오드칼륨, 셀레늄, 게르마늄, 바나듐, 아연 등을 들 수 있다.
본 발명의 식품 조성물에는 전술한 바의 식품첨가물이 제품 유형에 따라 그 첨가 목적을 달성할 수 있는 적량으로 포함될 수 있다.
본 발명의 식품 조성물에 포함될 수 있는 기타의 식품첨가물과 관련하여서는 식품위생법에 따른 식품공전이나 식품첨가물 공전을 참조할 수 있다.
전술한 바와 같이, 본 발명에 따르면 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물을 제공할 수 있다. 본 발명의 조성물은 식품 또는 약품으로 제품화될 수 있다.
도 1과 도 2는 각각 면역 형광 염색 분석법에 의한 랄록시펜의 MERS-CoV 및 SARS-CoV 코로나바이러스 증식 억제 실험 결과를 나타낸 것이다.
도 3은 qRT-PCR에 의한 랄록시펜의 MERS-CoV 코로나바이러스 증식 억제 실험 결과를 나타낸 것이다.
도 4는 CPE assay에 의한 랄록시펜의 HCoV-OC43 코로나바이러스에 대한 증식 억제 실험 결과를 나타낸 것이다.
도 5 및 도 6은 각각 qRT-PCR에 의한 랄록시펜의 HCoV-229E 및 HCoV-OC43 코로나바이러스에 대한 증식 억제 실험 결과를 나타낸 것이다.
도 7 및 도 8은 WST assay를 이용한 SARS-CoV-2 코로나바이러스 감염 세포의 세포생존율 실험 결과와 함께, 각각 qRT-PCR 및 플라크 실험법에 의한 랄록시펜의 SARS-CoV-2 코로나바이러스 증식 억제 실험 결과를 나타낸 것이다.
이하 본 발명을 실시예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.
<실시예> 랄록시펜의 항바이러스 활성 실험
<실시예 1> MERS-CoV 및 SARS-CoV 코로나바이러스에 대한 항바이러스 활성 실험
1.1 재료의 준비
Vero (CCL-81)세포는 ATCC (Manassas, VA, USA)에서 구입하였고, 5% CO2, 37℃ 온도가 유지되는 습식 배양기 안에서 4 mM L-글루타민과 항생제/항진균제 혼합액을 첨가한 Opti-PRO™ SFM (#12309019, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) 배지에서 배양하였다. 메르스 코로나바이러스 (passage 4, MERS-CoV/KOR/KNIH/002_05_2015; GenBank accession No. KT029139.1)는 대한민국 국내 환자에서 분리된 것으로 질병관리본부(한국)로부터 분양받았고, 사스 코로나바이러스(HKU39849)는 홍콩파스퇴르연구소에서 분양받아 한국파스퇴르연구소 생물 안전 3등급 (BSL-3) 연구 시설에서 엄격한 관리 하에 사용되었다. 메르스 코로나바이러스와 사스 코로나바이러스는 Vero 세포에서 증식되었고, 플라크 어세이를 이용하여 바이러스 역가를 측정하였다. 실험에 쓰인 랄록시펜은 Cayman Chemical (Ann Arbor, MI, USA)에서 파우더 형태로 구매하여 DMSO 용매에 녹여서 사용하였다.
1.2 면역 형광 염색 분석법에 의한 바이러스 증식 억제 실험
실험 24시간 전에 384-well black μClear plate의 각 well에 Vero 세포를 1.2 × 104개씩 넣어주었다. 시험 화합물인 랄록시펜은 최고 50 μM 농도에서부터 최소 0.0977 μM로 1/2씩 연속적으로 희석하여 10개의 농도로 처리하였으며, DMSO 농도는 0.5% 이하로 유지되었다.
세포와 랄록시펜이 담긴 플레이트를 생물안전 3등급 실험구역으로 옮긴 후, 메르스 코로나바이러스와 사스 코로나바이러스는 각각 0.0625, 0.05의 MOI(multiplicity of infection)로 감염시키고 24시간 후에 4% 파라포름알데히드로 세포를 고정시킨 다음, 면역 형광 염색을 수행하였다. 메르스 코로나바이러스와 사스 코로나바이러스는 각각 토끼에서 분리된 메르스 코로나바이러스 spike에 대한 1차 항체 및 anti-SARS-CoV spike S1 항체 (Sino Biological Inc., Beijing, China)로 탐지한 후 AlexFluorTM 488 형광 2차 항체 (#A-11008 Invitrogen, Thermo Fisher Scientific Inc., Waltham, MA, USA)를 붙여 감염을 관찰하였고, Hoechst　 33342 (#H3570, Invitrogen) 염색을 통해 세포 생존율을 평가하였다. OperettaTM High-Content Imaging System (PerkinElmer, Waltham, MA, USA)으로 20배 확대 이미지를 수집하여 한국파스퇴르연구소에서 자체 개발한 Image Mining 3.0 (IM 3.0) 플러그인 소프트웨어로 분석하였다. 2회 반복수행하여 얻은 실험 결과로부터 GraphPad Prism 6 프로그램 (GraphPad Prism Software Inc., La Jolla, USA)을 이용하여, 바이러스 복제를 50% 저해시키는 랄록시펜의 농도인 IC50 값 및 숙주세포의 사멸을 50% 저해시키는 랄록시펜의 농도인 CC50 값을 산출하였다. 해당 분석법의 유효성을 평가하는 기준인 Z' factor는 0.97로 나타났으며 메르스 코로나바이러스에 대해 항바이러스 활성을 가지고 있다고 알려진 2개의 화합물 (Chloroquine diphosphate과 Lopinavir)을 사용하여 용량-반응 곡선을 제작하여 유효성을 검증하였다.
감염 백분율(PI)은 아래의 수식으로 계산된다.
감염 백분율 (PI) = [1-(INtest - μINmock) / (μINvehicle - μINmock)] × 100%
INtest는 랄록시펜을 처리하고 바이러스를 감염시킨 시험군의 감염율, μINmock은 DMSO를 처리하고 바이러스를 감염시키지 않은 음성 대조군의 감염율, μINvehicle은 DMSO를 처리하고 바이러스를 감염시킨 감염 대조군의 감염율이다.
감염 생존율 (PV)은 아래의 수식으로 계산된다.
감염 생존율 (PV) = (CNtest / μCNmock)] × 100%
CNtest 와 μCNmock 는 각각 랄록시펜을 처리하고 바이러스를 감염시킨 시험군과 DMSO를 처리하고 감염시키지 않은 음성 대조군의 평균 세포수이다. 수치를 표준화한 다음, 바이러스 복제를 50% 저해시키는 랄록시펜의 농도인 IC50와 숙주세포의 사멸을 50% 저해시키는 랄록시펜의 농도인 CC50값을 GraphPad Prism 6 프로그램 (GraphPad Software)로 분석하였고, CC50값을 IC50값으로 나누어 선택성 지수 (SI)를 구하였다.
결과를 메르스 코로나바이러스와 사스 코로나바이러스에 대해서 각각 도 1과 도 2에 나타내었다. 도 1과 도 2를 참조하여 보면, 랄록시펜의 메르스 코로나바이러스에 대한 IC50는 6.38 μM, CC50는 44.22 μM 이상, SI는 6.93 이상으로 나타났으며, 랄록시펜의 사스 코로나바이러스에 대한 IC50는 8.90 μM, CC50는 50 μM 이상, SI는 5.62 이상으로 나타났다(도 1과 2에서 회색선은 바이러스 증식율, 검은색 선은 세포 생존율이다).
1.3 qRT-PCR에 의한 메르스 코로나바이러스 증식 억제 실험
1.3.1 바이러스 감염 및 화합물 처리
실험 24시간 전 24-well plate (Corning® Costar®, NY, USA)의 각 well 에 Vero 세포를 3.0 x 105개 씩 넣어 배양하였다. 랄록시펜을 메르스 코로나바이러스 감염 직전에 각 well 에 첨가하였다. 랄록시펜의 최종 농도는 1, 3, 10, 30 μM 이며, DMSO 농도는 0.5% 이하로 유지되었다. 세포와 랄록시펜이 담긴 플레이트를 생물안전 3등급 실험구역으로 옮긴 후, 바이러스를 0.0625의 MOI 로 감염시켰다. 24시간 후에 세포와 랄록시펜을 PBS로 세척하고 1% beta-mercaptoethanol (Sigma-Aldrich)이 첨가된 RLT buffer (#79216, QIAGEN GmbH, Germany) 를 넣어 세포를 용해하였다.
1.3.2 RNA 추출
총 RNA는 위에서 얻어낸 세포 용해액으로부터 RNeasyⓡ mini Kit (#74106, QIAGEN GmbH, Germany)와 제조사 매뉴얼을 이용하여 Diethyl pyrocarbonate (DEPC) 처리한 물에 50μl 부피로 추출하였다. 추출된 RNA 농도는 NanoDropTM One spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA)를 이용하여 측정하였다.
1.3.3 qRT-PCR
감염된 세포의 총 RNA는 multiplex RT-PCR (multiplex real-time reverse-transcription polymerase chain reaction) 실험법을 적용하여 메르스 코로나바이러스의 RNA를 탐지하고, 정량분석 하였다. TOPscriptTM One-step RT-PCR DryMIX kit (Enzynomics, #RT412)을 사용하여 upstream of E gene (upE)양을 측정하였다. 각 25 ul 반응은, TOPscriptTM One-step RT-PCR DryMIX kit에서 제공된 시약 혼합액 튜브에 1 μl의 총 RNA, upE 유전자 발현을 확인하기 위해 논문(Corman VM et al. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Eurosurveillance 2012; 17:20285)에 사용된 400 nM 농도의 upE-Fwd (GCAACGCGCGATTCAGTT)(서열번호 1), upE-Rev (GCCTCTACACGGGACCCATA)(서열번호 2) 프라이머쌍과 upE-Prb (6-carboxyfluorescein [FAM]- CTCTTCACATAATCGCCCCGAGCTCG-6-carboxy-N,N,N,N´-tetramethylrhodamine [TAMRA]) 프로브(프로브 염기서열: 서열번호 3)를 첨가하여 반응시켰다. 내부 대조군으로서 GAPDH 유전자 발현양 측정을 위하여 400 nM 농도의 GAPDH-Fwd (GAAGGTGAAGGTCGGAGTCAAC)(서열번호 4), GAPDH-Rev (CAGAGTTAAAAGCAGCCCTGGT)(서열번호 5) 프라이머쌍과 GAPDH-Prb (6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein[JOE]-TTTGGTCGTATTGGGCGCT-6-carboxy-N,N,N,N´-tetramethylrhodamine[TAMRA]) 프로브(프로브 염기서열: 서열번호 6)를 첨가하여 반응시켰다. 역전사 반응과 유전자 증폭은 ViiATM 7 Real-Time PCR System (Thermo Scientific)을 이용하여 50℃에 30분, 95℃에 3분, (95℃에 30초, 58℃에 1분)×40사이클로 진행하였다. 측정된 메르스 코로나바이러스의 upE 유전자 발현양은 GAPDH 양으로 보정하여 Comparative CT Method (ΔΔCT Method)로 분석하였다. 참고로 E 유전자는 외피단백질 유전자로, E 유전자의 상위 영역(upstream of E gene)의 발현 정도는 바이러스의 증식 정도를 보여주는 지표로 사용될 수 있다(Corman VM et al. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Eurosurveillance 2012; 17:20285).
1.3.4 결과
결과를 도 3에 나타내었다. 도 3을 참조하여 보면 랄록시펜은 농도 의존적으로 E 유전자의 상위 영역의 발현을 억제함을 보여준다.
<실시예 2> HCoV-229E와 HCoV-OC43 코로나바이러스 증식 억제 실험
2.1 재료의 준비
MRC-5 세포 (ATCC® CCL-171)는 ATCC (Manassas, VA, USA)에서 구입하였고, 4 mM L-글루타민과 항생제/항진균제 혼합액을 첨가한 Eagle’s Minimum Essential Medium (EMEM) (ATCC® 30-2003™) 배지에서 배양하였다. HCoV-229E (ATCC® VR-740™) 바이러스와 HcoV-OC43 (ATCC® VR-1558™)은 ATCC (Manassas, VA, USA)에서 분양받아 경기바이오센터 생물 안전 2등급 (BSL-2) 연구 시설에서 엄격한 관리 하에 사용되었다. 두 코로나바이러스는 MRC-5 세포에서 증식되었고, 플라크 어세이를 이용하여 바이러스 역가를 측정하였다.
2.2 HCoV-229E 코로나바이러스 감염세포의 생존율 측정 실험 - Cytopathic effect assay
HCoV-229E 코로나바이러스 감염세포의 생존율을 Cytopathic effect assay(CPE assay)로 측정하였다. 먼저 실험 24 시간 전에 384 웰 플레이트(white 384-well opaque plate)의 각 웰에 MRC-5 세포를 2 × 103 cells 넣어주었다. 랄록시펜을 DMSO를 이용하여 연속적으로 희석하여 처리하고, 2시간 후에 HCoV-229E를 5 MOI로 감염시켰다. 48 시간 배양 후에 CellTiter-glo® 시약(Promega, USA)를 1% TX-100과 함께 첨가하고 20분 후에 EnVision® multilabel plate reader(PerkinElmer, USA)를 사용하여 세포 생존율을 측정하였다. EC50(바이러스에 감염된 세포의 생존율을 50% 증가시키는 시료의 농도)은 GraphPad Prism 6 프로그램 (GraphPad Prism Software Inc., La Jolla, USA)을 이용하여 비선형 회귀 분석으로 산출하였다.
결과를 도 4에 나타내었는데, 랄록시펜의 HCoV-OC43 코로나바이러스에 대한 EC50는 4.5 μM, CC50는 18.5 μM로 나타났다(도 4에서 막대는 바이러스를 감염시킨 세포에 랄록시펜을 처리하였을 때의 세포생존율로 EC50를 계산하는데 사용하였고, 실선은 바이러스에 감염시키지 않은 세포에 랄록시펜을 처리하였을 때의 세포생존율로 CC50를 계산하는데 사용하였다).
2.3 qRT-PCR에 의한 HCoV-229E 코로나바이러스와 HCoV-OC43 코로나바이러스의 증식 억제 실험
랄록시펜의 qRT-PCR에 의한 HCoV-229E 코로나바이러스와 HCoV-OC43 코로나바이러스의 증식 억제 효과를 측정하기 위하여, 코로나바이러스 감염 또는 비감염 MRC-5 세포로부터 총 RNA를 TRIZOL 시약(Invitrogen, Carlsbad, CA)을 사용하여 분리하였다. 20㎕의 반응 혼합물에 20ng RNA를 첨가하고, One Step RT-PCR MasterMix 키트(MERK, Germany)와 SYBR Green 시약(MGmed, Seoul, Korea)을 사용하여 제조사의 프로토콜에 따라 cDNA를 합성하고 정량 RT-PCR를, LightCycler® 480 장치(Roche Life Science, Germany)를 이용하여 50℃에 30분, 95℃에 10분, (95℃에 5초, 60℃에 30초)×40 사이클로 진행하였다.
HCoV-229E 코로나바이러스 표적 유전자(Virol J. 2017; 14: 55)와 HCoV-OC43 코로나바이러스 표적 유전자(Emerg Infect Dis. 2008 Mar; 14(3): 484-486)의 RT-PCR에 사용된 프라이머와 대조군 유전자(GAPDH)의 프라이머는 아래의 표와 같다.
프라이머 서열
Primer 5’-Sequence-3’ References
HCoV-229E F F: CGCAAGAATTCAGAACCAGAG (서열번호 7) Virol J. 2017; 14: 55
HCoV-229E R R: GGCAGTCAGGTTCTTCAACAA (서열번호 8)
HCoV-OC43 F F: ACTCAAATGAATTTGAAATATGC (서열번호 9) Emerg Infect Dis. 2008 Mar; 14(3):484-486
HCoV-OC43 R R: TCACACTTAGGATAATCCCA (서열번호 10)
GAPDH F: GTCGGAGTCAACGGATT (서열번호 11) 　
GAPDH R: AAGCTTCCCGTTCTCAG (서열번호 12)
결과를 도 5 및 도 6에 나타내었다. 도 5 및 도 6에서 확인되는 바와 같이, HCoV-229E 코로나바이러스 표적 유전자와 HCoV-OC43 코로나바이러스의 표적 유전자는 랄록시펜의 처리 농도에 비례하여 그 발현이 감소하였다.<실시예 3> SARS-CoV-2 코로나바이러스에 대한 항바이러스 활성 실험
3.1. 재료의 준비
Vero E6 세포는(ATCC　 CRL-1586) ATCC (Manassas, USA)에서 구입하였고, 5% CO2, 37℃ 배양기에서 불활성화된 10% FBS (Fetal bovine serum, Gibco, USA)와 1% penicillin/streptomycin (Gibco, USA)이 첨가된 Dulbecco Modified Eagle Medium (DMEM, Gibco, USA) 배지에서 배양하였다. SARS-CoV-2 (passage 4, betaCoV/Korea/KCDC03/20)는 대한민국 국내 환자로부터 분리된 것으로 질병관리본부 생물안전 3등급(BSL-3) 연구시설에서 엄격한 관리 하에 사용되었다. SARS-CoV-2는 Vero E6 세포에서 증식하였고 플라크 실험법을 이용하여 역가를 측정하였다. 실험에 쓰인 랄록시펜은 전문의약품인 에비스타정(Evista tab, Eil Lilly, USA)을 3차 증류수(DW)에 녹여서 사용하였다.
3.2. SARS-CoV-2 바이러스에 의한 감염세포의 생존율 측정 실험 - WST assay
실험 24시간 전 24 well plate (Eppendorf, Germany)의 각 well에 Vero E6 세포를 1.5 x 105개 씩 분주하여 배양하였다. 각 well에 연속 희석된 랄록시펜이 포함된 배지를 첨가하고 37℃ CO2 배양기에서 48시간 동안 배양하였다. 랄록시펜의 최종농도는 80, 20, 5, 1.25, 0.3125 μg/ml이다. Cell debris를 제거하기 위해 PBS로 세척하였다. 여기에 WST substrate (EZ-cytox, Dogen, Korea)가 포함된 배지를 첨가하여 배양기에서 30분 동안 배양하고 450nm에서 흡광도를 측정하였다. CC50(50% 세포독성을 나타내는 농도)는 GraphPad Prism5 프로그램을 이용하여 비선형 회귀분석으로 산출하였다.
결과를 도 7과 도 8에 나타내었다. 도 7 및 도 8을 참조하여 보면 랄록시펜의 CC50은 46.92 μg (99.1 μM)이다. 랄록시펜 비처리군 대비, 처리군의 세포생존율을 사각형실선으로 표시하였다.
3.3. qRT-PCR에 의한 SARS-CoV-2 바이러스 증식 억제 실험
3.3.1 바이러스 감염 및 화합물 처리
실험 24시간 전 24 well plate의 각 well 에 Vero E6 세포를 1.5 x 105개 씩 분주하여 배양하였다. 생물안전 3등급 실험실에서 바이러스를 0.05 MOI로 1시간 동안 접종시켰다. 접종액을 제거한 후 감염되지 않은 바이러스를 제거하기 위해 PBS로 세척하고 1ml의 랄록시펜이 포함된 배지를 첨가하였다. 랄록시펜의 최종농도는 80, 20, 5, 1.25, 0.3125 μg/ml이다. 48시간 후 100μl의 세포 배양액을 수거하여 프로테인나아제 K(proteinase K)가 첨가된 ACL buffer (QIAGEN, Germany)를 넣어 용해시켰다.
3.3.2 RNA 추출
총 RNA는 세포배양액 용해액으로부터 QIAamp 96 virus QIAcube HT kit (QIAGEN, Germany)와 QIAcube HT system을 이용하여 제조사 매뉴얼에 따라 AVE buffer 100μl 부피로 추출하였다.
3.3.3 qRT-PCR
세포 배양액의 총 RNA는 qRT-PCR 실험법을 적용하여 SARS-CoV-2 RNA를 탐지하고, 정량 분석하였다. PowerChek 2019-nCoV real-time PCR kit (Kogen biotech, Korea)를 사용하여 제조사의 메뉴얼에 따라 5μl의 RNA에서의 E 유전자(E gene) 양을 측정하였다. Genome copy를 측정하기 위해 농도를 알고 있는 SARS-CoV-2 genome을 일정 농도로 희석시킨 후, qRT-PCR 수행하여 기준곡선을 정하였다. IC50(바이러스 농도를 50% 저해하는 화합물의 농도)는 GraphPad Prism5 프로그램을 이용하여 비선형 회귀분석으로 산출하였고 CC50값을 IC50값으로 나누어 선택성 지수 (selectivity index, SI)를 구하였다.
3.3.4 결과
결과를 도 7에 나타내었다. 도 7을 참조하여 보면, 랄록시펜은 농도 의존적으로 SARS-CoV-2의 E 유전자 발현을 억제함을 보여준다. 랄록시펜의 SARS-CoV-2에 대한 IC50는 1.47 μg, CC50는 46.92 μg 이상, SI는 31.9 로 나타났다. 랄록시펜 비처리군 대비, 처리군의 genome copy 감소율(원형 실선)과 세포생존율(사각형 실선)을 표시하였다.
3.4. 플라크 실험법에 의한 SARS-CoV-2 바이러스 증식 억제 실험
3.4.1 바이러스 감염 및 화합물 처리
실험 24시간 전 24 well plate의 각 well 에 Vero E6 세포를 1.5 x 105개 씩 분주하여 배양하였다. 생물안전 3등급 실험실에서 바이러스를 0.05의 MOI로 1시간 동안 접종시켰다. 접종액을 제거한 후 감염되지 않은 바이러스를 제거하기 위해 PBS로 세척하고 랄록시펜이 포함된 배지를 첨가하였다. 랄록시펜의 최종농도는 80, 20, 5, 1.25, 0.3125 μg/ml이었다 48시간 후 1ml의 세포배양액을 harvest하여 플라크 실험 수행하기 전까지 -70℃ 초저온냉동고에 보관하였다.
3.4.2 플라크 실험
실험 24시간 전 24 well palte의 각 well에 Vero E6 세포를 2.0 x 105개씩 넣어 배양하였다. 바이러스를 10배 연속 희석 한 후 배양 세포 단층에 접종하고, 1시간 동안 37℃, CO2 배양기에서 흡착시켰다. 접종액을 제거하고 감염되지 않은 바이러스를 제거하기 위해 PBS로 세척하였다. 이후 plaque assay를 통해 plaque forming unit (PFU)를 산출하였다. IC50(바이러스 농도를 50% 저해하는 화합물의 농도)는 GraphPad Prism5 프로그램을 이용하여 비선형 회귀분석으로 산출하였고 CC50값을 IC50값으로 나누어 선택성 지수 (selectivity index, SI)를 구하였다.
3.4.3 결과
결과를 도 8에 나타내었다. 도 8을 참조하여 보면 랄록시펜은 농도 의존적으로 SARS-CoV-2 증식을 억제함을 보여준다. 랄록시펜의 SARS-CoV-2에 대한 IC50는 1.76 μg (3.7 μM)으로 나타났고, 랄록시펜의 CC50는 46.92 μg (99.1 μM) 이상, SI는 26.7 로 나타났다. 랄록시펜 비처리군 대비, 처리군의 플라크 감소율(원형 실선)과 세포생존율(사각형 실선)을 표시하였다.
통계분석
실험군 간에 통계적 유의성 검증을 위하여 일원변량분석(one-way ANOVA)을 실싱하였고, 사후 검증을 위해서 Duncan 다중 범위 검증(Duncan's multiple comparison test)를 실시하였다. 통계적 유의성 검증은 p<0.05 수준에서 이루어졌다. 통계분석에는 Prism® 5 소프트웨어를 사용하였다.

Claims (4)

  1. 랄록시펜 또는 그의 약제학적으로 허용 가능한 염을 유효성분으로 하는, SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43 및 SARS-CoV-2 중에서 선택된 코로나바이러스 감염증 개선용 조성물.
  2. 제1항에 있어서,
    상기 랄록시펜의 약제학적으로 허용 가능한 염은 랄록시펜 염산염(raloxifene hydrochloride)인 것을 특징으로 하는 조성물.
  3. 제1항 또는 제2항에 있어서,
    상기 조성물은 약제학적 조성물인 것을 특징으로 하는 조성물.
  4. 제1항 또는 제2항에 있어서,
    상기 조성물은 식품 조성물인 것을 특징으로 하는 조성물.
PCT/KR2020/007263 2020-03-18 2020-06-04 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물 WO2021187670A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200033407 2020-03-18
KR10-2020-0033407 2020-03-18
KR20200062195 2020-05-25
KR10-2020-0062195 2020-05-25

Publications (1)

Publication Number Publication Date
WO2021187670A1 true WO2021187670A1 (ko) 2021-09-23

Family

ID=77771088

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/007263 WO2021187670A1 (ko) 2020-03-18 2020-06-04 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물

Country Status (2)

Country Link
KR (1) KR20230038130A (ko)
WO (1) WO2021187670A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4129287A1 (en) * 2021-08-04 2023-02-08 Dompe' Farmaceutici S.P.A. Raloxifene for use in the treatment of sars-cov-2 variants infections

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007068894A2 (en) * 2005-12-15 2007-06-21 Astrazeneca Ab Substituted diphenylethers, -amines, -sulfides and -methanes for the treatment of respiratory disease
KR20180106599A (ko) * 2017-03-21 2018-10-01 한국화학연구원 코로나 바이러스 감염으로 인한 질환 치료용 화합물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007068894A2 (en) * 2005-12-15 2007-06-21 Astrazeneca Ab Substituted diphenylethers, -amines, -sulfides and -methanes for the treatment of respiratory disease
KR20180106599A (ko) * 2017-03-21 2018-10-01 한국화학연구원 코로나 바이러스 감염으로 인한 질환 치료용 화합물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Coronavirus: Using European supercomputing, EU-funded research project announces promising results for potential treatment", ONLINE WEBSITE. AN OFFICIAL EU WEBSITE, 7 March 2020 (2020-03-07), XP055851101, Retrieved from the Internet <URL:https://cdn2.euraxess.org/worldwide/asean/coronavirus-using-european-supercomputing-eu-funded-research-project-announces> *
DUARTE RODRIGO R. R., COPERTINO JR. DENNIS C., IÑIGUEZ LUIS P., MARSTON JEZ L., NIXON DOUGLAS F., POWELL TIMOTHY R.: "Repurposing FDA-Approved Drugs for COVID-19 Using a Data-Driven Approach", 21 April 2020 (2020-04-21), XP055825398, Retrieved from the Internet <URL:https://www.researchgate.net/publication/340823299_Repurposing_FDA-Approved_Drugs_for_COVID-19_Using_a_Data-Driven_Approach> DOI: 10.26434/chemrxiv.12148764 *
JULIE DYALL, ROBIN GROSS, JASON KINDRACHUK, REED F. JOHNSON, GENE G. OLINGER, LISA E. HENSLEY, MATTHEW B. FRIEMAN, PETER B. JAHRLI: "Middle East Respiratory Syndrome and Severe Acute Respiratory Syndrome: Current Therapeutic Options and Potential Targets for Novel Therapies", DRUGS, ADIS INTERNATIONAL LTD., NZ, vol. 77, no. 18, 1 December 2017 (2017-12-01), NZ, pages 1935 - 1966, XP055731800, ISSN: 0012-6667, DOI: 10.1007/s40265-017-0830-1 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4129287A1 (en) * 2021-08-04 2023-02-08 Dompe' Farmaceutici S.P.A. Raloxifene for use in the treatment of sars-cov-2 variants infections
WO2023012233A1 (en) * 2021-08-04 2023-02-09 Dompe' Farmaceutici Spa Raloxifene for use in the treatment of sars-cov-2 variants infections

Also Published As

Publication number Publication date
KR20230038130A (ko) 2023-03-17

Similar Documents

Publication Publication Date Title
CN116236580B (zh) 金诺芬等老药及其组合物在抗单正链rna病毒中的应用
Min et al. A flavonoid compound library screen revealed potent antiviral activity of plant-derived flavonoids on human enterovirus A71 replication
US11642387B2 (en) Composition for preventing or inhibiting influenza virus infection, containing ginseng berry polysaccharides
WO2021187670A1 (ko) 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물
CN113855654B (zh) 一种预防和治疗冠状病毒感染的组合物
KR101708833B1 (ko) 커큐민을 포함하는 항바이러스 조성물
WO2022005204A1 (ko) 상피세포 성장인자 수용체 억제제를 유효성분으로 포함하는 항바이러스용 조성물
KR102541320B1 (ko) 랄록시펜을 이용한 코로나바이러스 감염증 개선용 조성물
WO2022124800A1 (ko) 푸코실락토스를 유효성분으로 함유하는 항바이러스 조성물
KR20230040961A (ko) 테트란드린 또는 이의 유사체를 포함하는 코로나바이러스 감염 예방 또는 치료용 조성물
KR102497163B1 (ko) 리코린 클로라이드를 포함하는 코로나바이러스 감염 예방 또는 치료용 조성물
KR102135106B1 (ko) 중동호흡기증후군 코로나바이러스에 대한 항바이러스 조성물
KR102135116B1 (ko) 클로록신 또는 그 유사 화합물을 이용한 중동호흡기증후군 코로나바이러스에 대한 항바이러스 조성물
KR101666155B1 (ko) 황매목 추출물을 함유하는 항바이러스용 조성물
KR101961193B1 (ko) 방향성 정유를 함유하는 레몬그라스 추출물을 유효성분으로 포함하는 항바이러스용 조성물
KR102528545B1 (ko) 항바이러스용 조성물
US20220204501A1 (en) Enterovirus inhibitor
CN112891343B (zh) 3-吲哚乙腈在制备抑制新型冠状病毒SARS-CoV-2药物中的应用
CN113197894B (zh) 奥巴托克在制备广谱抗冠状病毒药物中的应用
CN112675211B (zh) 一种青钱柳提取物及其在制备抗冠状病毒的药物中的用途
CN111214472B (zh) 依诺沙星在制备预防和/或治疗黄病毒感染的药物中的应用
KR102641011B1 (ko) St034307을 유효성분으로 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학 조성물
KR102576731B1 (ko) 항바이러스용 조성물
WO2023128680A1 (ko) 구아이아콜과 4&#39;,6,7-트리메톡시이소플라본을 이용한 폐섬유화증 개선용 조성물
KR20240045092A (ko) miR-191-5p 억제제를 유효성분으로 포함하는 장 누수 증후군 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20926110

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20926110

Country of ref document: EP

Kind code of ref document: A1