WO2021178933A2 - Class ii, type v crispr systems - Google Patents
Class ii, type v crispr systems Download PDFInfo
- Publication number
- WO2021178933A2 WO2021178933A2 PCT/US2021/021259 US2021021259W WO2021178933A2 WO 2021178933 A2 WO2021178933 A2 WO 2021178933A2 US 2021021259 W US2021021259 W US 2021021259W WO 2021178933 A2 WO2021178933 A2 WO 2021178933A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- endonuclease
- engineered
- guide rna
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1068—Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- Cas enzymes along with their associated Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) guide ribonucleic acids (RNAs) appear to be a pervasive (-45% of bacteria, -84% of archaea) component of prokaryotic immune systems, serving to protect such microorganisms against non-self nucleic acids, such as infectious viruses and plasmids by CRISPR-RNA guided nucleic acid cleavage.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- CRISPR-associated proteins are highly diverse, containing a wide variety of nucleic acid interacting domains. While CRISPR DNA elements have been observed as early as 1987, the programmable endonuclease cleavage ability of CRISPR/Cas complexes has only been recognized relatively recently, leading to the use of recombinant CRISPR/Cas systems in diverse DNA manipulation and gene editing applications.
- an engineered nuclease system comprising: (a) an endonuclease comprising a RuvC domain, wherein the endonuclease is derived from an uncultivated microorganism, and wherein the endonuclease is a Casl2a endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence.
- the Casl2a endonuclease comprises the sequence GWxxxK.
- the engineered guide RNA comprises UCUAC[N3-5]GUAGAU (N4). In some embodiments, the engineered guide RNA comprises CCUGC[N4]GCAGG (N3-4). In some aspects, the present disclosure provides for an engineered nuclease system comprising: (a) an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470 or a variant thereof; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence.
- the endonuclease comprises a RuvCI, II, or III domain.
- the endonuclease has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to a RuvCI, II, or III domain of any one of SEQ ID NOs: 1-3470 or a variant thereof.
- the RuvCI domain comprises a D catalytic residue. In some embodiments the RuvCII domain comprises an E catalytic residue. In some embodiments the RuvCIII domain comprises a D catalytic residue. In some embodiments, said RuvC domain does not have nuclease activity.
- said endonuclease further comprises a WED II domain having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to a WED II domain of any one of SEQ ID NOs: 1-3470 or a variant thereof.
- an engineered nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 3862-3913, wherein the endonuclease is a class 2, type V Cas endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence.
- the endonuclease further comprises a zinc finger-like domain.
- the guide RNA comprises a sequence with at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3551-3559, 3608-3609, 3612,
- an engineered nuclease system comprising: (a) an engineered guide RNA comprising a sequence with at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637,
- the guide RNA comprises a sequence complementary to a eukaryotic, fungal, plant, mammalian, or human genomic polynucleotide sequence. In some embodiments, the guide RNA is 30-250 nucleotides in length.
- the endonuclease comprises one or more nuclear localization sequences
- NLSs proximal to an N- or C-terminus of the endonuclease.
- the NLS comprises a sequence at least 80% identical to a sequence from the group consisting of SEQ ID
- the endonuclease comprises at least one of the following mutations: S168R, E172R, N577R, or Y170R when a sequence of the endonuclease is optimally aligned to SEQ ID NO: 215. In some embodiments, the endonuclease comprises the mutations
- the endonuclease comprises the mutations N577R or Y170R when a sequence of the endonuclease is optimally aligned to SEQ ID NO: 215. In some embodiments, the endonuclease comprises the mutation S168R when a sequence of the endonuclease is optimally aligned to SEQ ID NO: 215. In some embodiments, the endonuclease does not comprise a mutation of E172, N577, or Y170. In some embodiments, the engineered nuclease system further comprises
- a single- or double-stranded DNA repair template comprising from 5' to 3': a first homology arm comprising a sequence of at least 20 nucleotides 5' to the target deoxyribonucleic acid sequence, a synthetic DNA sequence of at least 10 nucleotides, and a second homology arm comprising a sequence of at least 20 nucleotides 3' to the target sequence.
- the first or second homology arm comprises a sequence of at least 40, 80, 120, 150, 200, 300, 500, or 1,000 nucleotides.
- the first and second homology arms are homologous to a genomic sequence of a prokaryote, bacteria, fungus, or eukaryote.
- the single- or double-stranded DNA repair template comprises a transgene donor.
- the engineered nuclease system further comprises a DNA repair template comprising a double-stranded DNA segment flanked by one or two single-stranded DNA segments.
- single-stranded DNA segments are conjugated to the 5' ends of the double-stranded DNA segment.
- the single stranded DNA segments are conjugated to the 3' ends of the double-stranded DNA segment.
- the single-stranded DNA segments have a length from 4 to 10 nucleotide bases.
- the single-stranded DNA segments have a nucleotide sequence complementary to a sequence within the spacer sequence.
- the double-stranded DNA sequence comprises a barcode, an open reading frame, an enhancer, a promoter, a protein-coding sequence, a miRNA coding sequence, an RNA coding sequence, or a transgene.
- the double-stranded DNA sequence is flanked by a nuclease cut site.
- the nuclease cut site comprises a spacer and a PAM sequence.
- the system further comprises a source of Mg 2+ .
- the guide RNA comprises a hairpin comprising at least 8, at least 10, or at least 12 base-paired ribonucleotides. In some embodiments, the hairpin comprises 10 base-paired ribonucleotides. In some embodiments: (a) the endonuclease comprises a sequence at least 75%, 80%, or 90% identical to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof; and (b) the guide RNA structure comprises a sequence at least 80%, or 90% identical to the non degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.
- the endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 3863-3913. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 3871. In some embodiments, the sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT algorithm, or a CLUSTALW algorithm with the Smith-Waterman homology search algorithm parameters.
- sequence identity is determined by the BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment.
- an engineered guide RNA comprising: (a) a DNA-targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule; and (b) a protein-binding segment comprising two complementary stretches of nucleotides that hybridize to form a double-stranded RNA (dsRNA) duplex, wherein the two complementary stretches of nucleotides are covalently linked to one another with intervening nucleotides, and wherein the engineered guide ribonucleic acid polynucleotide is capable of forming a complex with an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, and targeting the complex to the target sequence of the target DNA molecule.
- the DNA-targeting segment is positioned 3' of both of the two complementary stretches of nucleotides.
- the protein binding segment comprises a sequence having at least 70%
- the double-stranded RNA (dsRNA) duplex comprises at least 5, at least 8, at least
- the present disclosure provides for a deoxyribonucleic acid polynucleotide encoding the engineered guide ribonucleic acid polynucleotide described herein.
- the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a class 2, type V Cas endonuclease, and wherein the endonuclease is derived from an uncultivated microorganism, wherein the organism is not the uncultivated organism.
- the endonuclease comprises a variant having at least 70% or at least 80% sequence identity to any one of SEQ ID NOs: 1-3470.
- the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C- terminus of the endonuclease.
- NLS nuclear localization sequences
- the NLS comprises a sequence selected from SEQ ID NOs: 3938-3953. In some embodiments, the NLS comprises SEQ ID NO: 3939.
- the NLS is proximal to the N-terminus of the endonuclease. In some embodiments, the NLS comprises SEQ ID NO: 3938. In some embodiments, the NLS is proximal to the C-terminus of the endonuclease. In some embodiments, the organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
- the present disclosure provides for an engineered vector comprising a nucleic acid sequence encoding a class 2, type V Cas endonuclease or a Cas 12a endonuclease, wherein the endonuclease is derived from an uncultivated microorganism.
- the present disclosure provides for an engineered vector comprising a nucleic acid described herein.
- the present disclosure provides for an engineered vector comprising a deoxyribonucleic acid polynucleotide described herein.
- the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, a lentivirus, or an adenovirus.
- AAV adeno-associated virus
- the present disclosure provides for a cell comprising a vector described herein.
- the present disclosure provides for a method of manufacturing an endonuclease, comprising cultivating any of the host cells described herein.
- the present disclosure provides for a method for binding, cleaving, marking, or modifying a double-stranded deoxyribonucleic acid polynucleotide, comprising: (a) contacting the double-stranded deoxyribonucleic acid polynucleotide with a class 2, type V Cas endonuclease in complex with an engineered guide RNA configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; (b) wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and (c) wherein the PAM comprises a sequence comprising any one of SEQ ID NOs: 3863-3913.
- PAM protospacer adjacent motif
- the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide RNA and a second strand comprising the PAM.
- the PAM is directly adjacent to the 5' end of the sequence complementary to the sequence of the engineered guide RNA.
- the PAM comprises SEQ ID NO: 3871.
- the class 2, type V Cas endonuclease is derived from an uncultivated microorganism.
- the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
- the method comprising delivering to the target nucleic acid locus the engineered nuclease system of any one of claims [0004]-0, wherein the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure, and wherein the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies the target nucleic acid locus.
- modifying the target nucleic acid locus comprises binding, nicking, cleaving, or marking the target nucleic acid locus.
- the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
- the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA.
- the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is within a cell.
- the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, a human cell, or a primary cell.
- the cell is a primary cell.
- the primary cell is a T cell.
- the primary cell is a hematopoietic stem cell (HSC).
- HSC hematopoietic stem cell
- delivering the engineered nuclease system to the target nucleic acid locus comprises delivering the nucleic acid of any of claims [0007]-[0008] or the vector of any of claims [0008]-[0011]
- delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease.
- the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked.
- delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide RNA operably linked to a ribonucleic acid (RNA) pol III promoter.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the endonuclease induces a single-stranded break or a double-stranded break at or proximal to the target locus. In some embodiments, the endonuclease induces a staggered single stranded break within or 3' to the target locus.
- the present disclosure provides for a method of editing a TRAC locus in a cell, comprising contacting to the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA comprises a targeting sequence having at least 85% identity at least 18 consecutive nucleotides of any one of SEQ ID NOs: 4316-4369.
- the RNA-guided nuclease is a Cas endonuclease.
- the Cas endonuclease is a class 2, type V Cas endonuclease.
- the class 2, type V Cas endonuclease comprises a RuvC domain comprising a RuvCI subdomain, a RuvCII subdomain, and a RuvCIII subdomain.
- the class 2, type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470 or a variant thereof.
- the engineered guide RNA further comprises a sequence with at least 80% sequence identity to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652- 3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734- 3735, and 3851-3857 .
- the endonuclease comprises a sequence at least 75%, 80%, or 90% identical to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof.
- the guide RNA structure comprises a sequence at least 80%, or at least 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.
- the method further comprises contacting to the cell or introducing to the cell a donor nucleic acid comprising a cargo sequence flanked on a 3’ or 5’ end by sequence having at least 80% identity to any one of SEQ ID NOs: 4424 or 4425.
- the cell is a peripheral blood mononuclear cell (PBMC).
- PBMC peripheral blood mononuclear cell
- the cell is a T-cell or a precursor thereof or a hematopoietic stem cell
- the cargo sequence comprises a sequence encoding a T-cell receptor polypeptide, a CAR-T polypeptide, or a fragment or derivative thereof.
- the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs:4370-4423.
- the engineered guide RNA comprises the nucleotide sequence of sgRNAs 1-54 from Table 5A comprising the corresponding chemical modifications listed in Table 5A.
- the engineered guide RNA comprises a targeting sequence having at least 80% sequence identity to any one of SEQ ID NOs:
- the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 4388, 4404, or 4378. In some embodiments, the engineered guide RNA comprises the nucleotide sequence of sgRNAs 9, 35, or
- an engineered nuclease system comprising: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid sequence, wherein the engineered guide RNA comprises at least one of the following modifications :(i) a 2’-0 methyl or a 2’-fluoro base modification of at least one nucleotide within the first 4 bases of the 5’ end of the engineered guide RNA or the last 4 bases of a 3’ end of the engineered guide RNA; (ii) a thiophosphate (PS) linkage between at least 2 of the first five bases of a 5’ end of the engineered guide RNA, or a thiophosphate linkage between at least two of the last five bases of a 3’ end of the
- the engineered guide RNA comprises a 2’-0 methyl or a 2’-fluoro base modification of at least one nucleotide within the first 5 bases of a 5’ end of the engineered guide RNA or the last 5 bases of a 3’ end of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a 2’-0 methyl or a 2’-fluoro base modification at a 5’ end of the engineered guide RNA or a 3’ end of the engineered guide RNA.
- the engineered guide RNA comprises a thiophosphate (PS) linkage between at least 2 of the first five bases of a 5’ end of the engineered guide RNA, or a thiophosphate linkage between at least two of the last five bases of a 3 ’ end of the engineered guide RNA.
- the engineered guide RNA comprises a thiophosphate linkage within a 3’ stem or a 5’ stem of the engineered guide RNA.
- the engineered guide RNA comprises a 2'-0 methyl base modification within a 3’ stem or a 5’ stem of the engineered guide RNA.
- the engineered guide RNA comprises a 2’-fluoro base modification of at least 7 bases of a spacer region of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a thiophosphate linkage within a loop region of the engineered guide RNA.
- the engineered guide RNA comprises at least three 2’-0 methyl or 2’-fluoro bases at the 5’ end of the engineered guide RNA, two thiophosphate linkages between the first 3 bases of the 5’ end of the engineered guide RNA, at least 42’-0 methyl or 2’-fluoro bases at the 4’ end of the engineered guide RNA, and three thiophosphate linkages between the last three bases of the 3’ end of the engineered guide RNA.
- the engineered guide RNA comprises at least two 2’-0-methyl bases and at least two thiophosphate linkages at a 5’ end of the engineered guide RNA and at least one T -O-methyl bases and at least one thiophosphate linkage at a 3’ end of the engineered guide RNA.
- the engineered guide RNA comprises at least one 2’-0-methyl base in both the 3’ stem or the 5’ stem region of the engineered guide RNA.
- the engineered guide RNA comprises at least one to at least fourteen 2’-fluoro bases in the spacer region excluding a seed region of the engineered guide RNA.
- the engineered guide RNA comprises at least one 2’-0- methyl base in the 5’ stem region of the engineered guide RNA and at least one to at least fourteen 2’-fluoro bases in the spacer region excluding a seed region of the guide RNA.
- the guide RNA comprises a spacer sequence targeting a VEGF-A gene.
- the guide RNA comprises a spacer sequence having at least 80% identity to SEQ ID NO: 3985.
- the guide RNA comprises the nucleotides of guide RNAs 1-7 from Table 7 comprising the chemical modifications listed in Table 7.
- the RNA-guided nuclease is a Cas endonuclease.
- the Cas endonuclease is a class 2, type V Cas endonuclease
- the class 2, type V Cas endonuclease comprises a RuvC domain comprising a RuvCI subdomain, a RuvCII subdomain, and a RuvCIII subdomain.
- the class 2, type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470 or a variant thereof.
- the class 2, type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof.
- the engineered guide RNA comprises a sequence with at least 80% sequence identity to the non degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857.
- the engineered guide RNA comprises a sequence with at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3608 -3609, 3853, or
- the present disclosure provides for a host cell comprising an open reading frame encoding a heterologous endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470 or a variant thereof.
- the endonuclease has at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof.
- the host cell is an E. coli cell or a mammalian cell.
- the host cell is an E. coli cell, wherein the E. coli cell is a l ⁇ E3 lysogen or the E. coli cell is a BL21(DE3) strain. In some embodiments, the E. coli cell has an ompT Ion genotype.
- the open reading frame is operably linked to a T7 promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an a raP BAD promoter, a strong leftward promoter from phage lambda (pL promoter), or any combination thereof.
- the open reading frame comprises a sequence encoding an affinity tag linked in-frame to a sequence encoding the endonuclease.
- the affinity tag is an immobilized metal affinity chromatography (IMAC) tag.
- the IMAC tag is a polyhistidine tag.
- the affinity tag is a myc tag, a human influenza hemagglutinin (HA) tag, a maltose binding protein (MBP) tag, a glutathione S-transferase (GST) tag, a streptavidin tag, a FLAG tag, or any combination thereof.
- the affinity tag is linked in- frame to the sequence encoding the endonuclease via a linker sequence encoding a protease cleavage site.
- the protease cleavage site is a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a Thrombin cleavage site, a Factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof.
- the open reading frame is codon-optimized for expression in the host cell.
- the open reading frame is provided on a vector.
- the open reading frame is integrated into a genome of the host cell.
- the present disclosure provides for a culture comprising any of the host cells described herein in compatible liquid medium.
- the present disclosure provides for a method of producing an endonuclease, comprising cultivating any of the host cells described herein in compatible growth medium.
- the method further comprises inducing expression of the endonuclease.
- the inducing expression of the nuclease is by addition of an additional chemical agent or an increased amount of a nutrient, or by temperature increase or decrease.
- an additional chemical agent or an increased amount of a nutrient comprises Isopropyl b-D-l-thiogalactopyranoside (IPTG) or additional amounts of lactose
- the method further comprises isolating the host cell after the cultivation and lysing the host cell to produce a protein extract.
- the method further comprises isolating the endonuclease.
- the isolating comprises subjecting the protein extract to IMAC, ion-exchange chromatography, anion exchange chromatography, or cation exchange chromatography.
- the open reading frame comprises a sequence encoding an affinity tag linked in-frame to a sequence encoding the endonuclease.
- the affinity tag is linked in-frame to the sequence encoding the endonuclease via a linker sequence encoding protease cleavage site.
- the protease cleavage site comprises a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a Thrombin cleavage site, a Factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof.
- the method further comprises cleaving the affinity tag by contacting a protease corresponding to the protease cleavage site to the endonuclease.
- the affinity tag is an etch virus
- the method further comprises performing subtractive
- IMAC affinity chromatography to remove the affinity tag from a composition comprising the endonuclease.
- the present disclosure provides for a system comprising (a) a class 2, Type V-A Cas endonuclease configured to bind a 3- or 4-nucleotide PAM sequence, wherein the endonuclease has increased cleavage activity relative to sMbCasl2a; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the class 2, Type V-A Cas endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid comprising a target nucleic acid sequence.
- the cleavage activity is measured in vitro by introducing the endonucleases alongside compatible guide RNAs to cells comprising the target nucleic acid and detecting cleavage of the target nucleic acid sequence in the cells.
- the class 2, Type V-A Cas endonuclease comprises a sequence having at least 75% identity to any one of 215-225 or a variant thereof.
- the engineered guide RNA comprises a sequence having at least 80% identity to the non-degenerate nucleotides of SEQ ID NO: 3609.
- the target nucleic acid further comprises a YYN PAM sequence proximal to the target nucleic acid sequence.
- the class 2, Type V-A Cas endonuclease has at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 200%, or more increased activity relative to sMbCasl2a.
- the present disclosure provides for a system comprising: (a) a class 2,
- Type V-A’ Cas endonuclease; and (b) an engineered guide RNA, wherein the engineered guide
- RNA comprises a sequence having at least 80% identity to about 19 to about 25 or about 19 to about 31 consecutive nucleotides of a natural effector repeat sequence of a class 2, Type V Cas endonuclease.
- the natural effector repeat sequence is any one of SEQ ID NO: 1
- the class 2, Type V-A’ Cas endonuclease has at least
- the present disclosure provides for a system comprising: (a) a class 2, Type V-L endonuclease, and (b) an engineered guide RNA, wherein the engineered guide RNA comprises a sequence having at least 80% identity to about 19 to about 25 or about 19 to about 31 consecutive nucleotides of a natural effector repeat sequence of a class 2, Type V Cas endonuclease.
- the class 2, Type V-L endonuclease has at least 75% sequence identity to any one of SEQ ID NOs: 793-1163.
- the present disclosure provides for a method of disrupting the VEGF-A locus in a cell, comprising introducing to the cell: (a) a class 2, type V Cas endonuclease; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the VEGF-A locus, wherein the engineered guide RNA comprises a targeting sequence having at least 80% identity to SEQ ID NO: 3985; or wherein the engineered guide RNA comprises the nucleotide sequence of any one of guide RNAs 1-7 from Table 7
- the class 2, type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470 or a variant thereof.
- the class 2, type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof.
- the engineered guide RNA comprises a sequence with at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3471,
- the engineered guide RNA comprises a sequence with at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3608 - 3609, 3853, or 3851-3857.
- the present disclosure provides for a method of disrupting a locus in a cell, comprising contacting to the cell a composition comprising: (a) a class 2, type V Cas endonuclease having at least 75% identity to any one of SEQ ID NOs: 215-225 or a variant thereof; and (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the locus, wherein the class 2, type V Cas endonuclease has at least equivalent cleavage activity to spCas9 in the cell.
- the cleavage activity is measured in vitro by introducing the endonucleases alongside compatible guide RNAs to cells comprising the target nucleic acid and detecting cleavage of the target nucleic acid sequence in the cells.
- the composition comprises 20 pmoles or less of the class 2, type V Cas endonuclease. In some embodiments, the composition comprises 1 pmol or less of the class 2, type V Cas endonuclease.
- FIG. 1 depicts typical organizations of CRISPR/Cas loci of different classes and types that were previously described before this disclosure.
- FIG. 2 depicts environmental distribution of MG nucleases described herein. Protein length is shown for representatives of the MG29 protein family. Shades of circle indicates the environment or environment type from which each protein was identified (dark gray circle indicates high temperature environment source; light gray circle indicates non-high temperature environment source). N/A denotes the type of environment the sample was collected from is unknown.
- FIG. 3 depicts the number of predicted catalytic residues present in MG nucleases detected from sample types described herein (e.g. FIG. 2). Protein length is shown for representatives of the MG29 protein family. The number of catalytic residues that were predicted for each protein are indicated in the figure legend (3.0 residues). The first, second and third catalytic residues are located in the RuvCI domain, the RuvCII domain and the RuvCIII domain, respectively.
- FIG. 4 shows the diversity of CRISPR Type V-A effectors.
- FIG. 4A depicts per family distribution of taxonomic classification of contigs encoding the novel Type V-A effectors.
- FIG. 4B depicts the phylogenetic gene tree inferred from an alignment of 119 novel and 89 reference Type V effector sequences.
- MG families are denoted in parentheses.
- PAM requirements for active nucleases are outlined with boxes associated with the family.
- Non-Type V-A reference sequences were used to root the tree (*MG61 family requires a crRNA with an alternative stem- loop sequence).
- FIG. 5 provides various characteristic information about nucleases described herein.
- FIG. 5A depicts the per family distribution of effector protein length and the type of sample;
- FIG. 5B shows the presence of RuvC catalytic residues.
- FIG. 5C shows the number of CRISPR arrays having various repeat motifs.
- FIG. 5D depicts the per family distribution of repeat motifs.
- FIG. 6 depicts multiple sequence alignment of catalytic and PAM interacting regions in Type V-A sequences.
- Francisella novicida Casl2a (FnCasl2) is a reference sequence.
- Other reference sequences are Acidaminococcus sp. fAsCas l 2a), Moraxella bovoculi (MbCasl2a), and Lachnospiraceae bacterium ND2006 (LbCasl2a).
- FIG. 6A shows blocks of conservation around the DED catalytic residues in RuvC-I (left), RuvC-II (middle), and RuvC-III (right) regions.
- FIG. 6B shows WED-II and PAM interacting regions containing residues involved in PAM recognition and interaction.
- the grey boxes underneath the FnCasl2a sequence identify the domains. Darker boxes in the alignments indicate increased sequence identity. Black boxes over the FnCasl2a sequence indicate catalytic residues (and positions) of the reference sequence.
- Grey boxes indicate domains in the reference sequence at the top of the alignment (FnCasl2a). Black boxes indicate catalytic residues (and positions) of the reference sequence.
- FIG. 7 depicts Type V-A and associated V-A’ effectors.
- FIG. 7A shows Type V-A (MG26-1) and V-A’ (MG26-2) indicated by arrows pointing in the direction of transcription.
- the CRISPR array is indicated by a gray bar.
- Predicted domains for each protein in the contig are indicated by boxes.
- FIG. 7B shows sequence alignments of Type V-A’ MG26-2 and AsCasl2a reference sequence.
- Middle region containing the RuvC-I and RuvC-II catalytic residues.
- Bottom region containing the RuvC-III catalytic residue. Catalytic residues are indicated by squares.
- FIG. 8 depicts a schematic representation of the structure of a sgRNA and a target DNA in a ternary complex with AacC2Cl (see Yang, Hui, Pu Gao, Kanagalaghatta R. Rajashankar, and Dinshaw J. Patel. 2016. “P AM-Dependent Target DNA Recognition and Cleavage by C2cl
- FIG. 9 depicts the effects of mutations or truncations in the R-AR domains of an sgRNA on AacC2cl -mediated cleavage of linear plasmid DNA; WT, wild-type sgRNA.
- the mutant nucleotides within sgRNA (lanes 1-5) are highlighted in the left panel.
- D12: 12 nt have been removed from the sgRNA J2/4 R-AR 1 region (see Liu, Liang, Peng Chen, Min Wang, Xueyan Li, Jiuyu Wang, Maolu Yin, and Yanli Wang. 2017. “C2cl-sgRNA Complex Structure Reveals RNA-Guided DNA Cleavage Mechanism.” Molecular Cell 65 (2): 310-22 which is incorporated by reference herein in its entirety).
- FIG. 10 depicts the CRISPR RNA (crRNA) structure is conserved among Type V-A systems.
- FIG. 10A shows the fold structure of the reference crRNA sequence in the LbCpfl system.
- FIG. 10B shows multiple sequence alignment of CRISPR repeats associated with novel Type V-A systems. The LbCpfl processing site is indicated with a black bar.
- FIG. IOC shows the fold structure of MG61-2 putative crRNA with an alternative stem-loop motif CCUGCPN- 4]GCAGG.
- FIG. lOD shows multiple sequence alignment of CRISPR repeats with the alternative repeat motif sequence. The processing sites and loop are indicated.
- FIG. 11 depicts a predicted structure of a guide RNA utilized herein (SEQ ID NO: 3608).
- FIG. 12 depicts predicted structures of corresponding sgRNAs of MG enzymes described herein (clockwise, SEQ ID NOs: 3636, 3637, 3641, 3640).
- FIG. 13 depicts predicted structures of corresponding sgRNAs of MG enzymes described herein (clockwise, SEQ ID NOs: 3644, 3645, 3649, 3648).
- FIG. 14 depicts predicted structures of corresponding sgRNAs of MG enzymes described herein (clockwise, SEQ ID NOs: 3652, 3653, 3657, 3656).
- FIG. 15 depicts predicted structures of corresponding sgRNAs of MG enzymes described herein (clockwise, SEQ ID NOs: 3660, 3661, 3665, 3664).
- FIG. 16 depicts predicted structures of corresponding sgRNAs of MG enzymes described herein (clockwise, SEQ ID NOs: 3666, 3667, 3672, 3671).
- FIG. 17 depicts an agarose gel showing the results of PAM vector library cleavage in the presence of TXTL extracts containing various MG family nucleases and their corresponding tracrRNA or sgRNAs (as described in Example 12).
- FIG. 17A shows lane 1: ladder.
- the bands are, from top to bottom, 766, 500, 350, 300, 350, 200, 150, 100, 75, 50;
- lane 2 28-1 +MGcrRNA spacerl (SEQ ID NOs: 141 + 3860); lane 3: 29-1 +MGcrRNA spacerl (SEQ ID NOs: 215 + 3860);
- lane 4 30-1 +MGcrRNA spacerl (SEQ ID NOs:226 + 3860); lane 5: 31-1 +MGcrRNA spacerl(SEQ ID NOs: 229 + 3860);
- lane 6 32-1 +MGcrRNA spacerl (SEQ ID NOs: 261 + 3860);
- lane 7 ladder.
- FIG. 17B shows lane 1: ladder; lane 2: LbaCasl2a + LbaCasl2a crRNA spacer2; lane 3: LbaCasl2a + MGcrRNA spacer2;
- lane 5 28-1 +MGcrRNA spacer2 (SEQ ID NOs: 141 + 3861); lane 6: 29-1 +
- MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MG
- lane 8 31-1 + MGcrRNA spacer2 (SEQ ID NOs: 229 + 3861); lane 9: 32-1 +
- MGcrRNA spacer2 (SEQ ID NOs: 261 +3861)
- FIG. 18 shows Type V-A effectors described herein are active nucleases.
- FIG. 17A shows lane 1: ladder.
- the bands are, from top to bottom, 766, 500, 350, 300, 350, 200, 150, 100, 75, 50;
- lane 2 28-1 +MGcrRNA spacerl (SEQ ID NOs: 141 + 3860); lane 3: 29-1 +MGcrRNA spacerl (SEQ ID NOs: 215 + 3860); lane 4: 30-1 +MGcrRNA spacerl (SEQ ID NOs:226 + 3860); lane 5: 31-1 +MGcrRNA spacerl(SEQ ID NOs: 229 + 3860); lane 6: 32-1 +MGcrRNA spacerl (SEQ ID NOs: 261 + 3860); lane 7: ladder.
- 17B shows lane 1: ladder; lane 2: LbaCasl2a + LbaCasl2a crRNA spacer2; lane 3: LbaCasl2a + MGcrRNA spacer2; lane 4: Apo 13-1; lane 5: 28-1 +MGcrRNA spacer2 (SEQ ID NOs: 141 + 3861); lane 6: 29-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 226 + 3861); lane 8: 31-1 + MGcrRNA spacer2 (SEQ ID NOs: 229 + 3861); lane 9: 32-1 + MGcrRNA spacer2 (SEQ ID NOs: 261 +3861)
- FIG. 18A depicts seqLogo representations of PAM sequences determined for 6 nucleases described herein.
- FIG. 17A shows lane 1: ladder.
- the bands are, from top to bottom, 766, 500, 350, 300, 350, 200, 150, 100, 75, 50;
- lane 2 28-1 +MGcrRNA spacerl (SEQ ID NOs: 141 + 3860); lane 3: 29-1 +MGcrRNA spacerl (SEQ ID NOs: 215 + 3860); lane 4: 30-1 +MGcrRNA spacerl (SEQ ID NOs:226 + 3860); lane 5: 31-1 +MGcrRNA spacerl(SEQ ID NOs: 229 + 3860); lane 6: 32-1 +MGcrRNA spacerl (SEQ ID NOs: 261 + 3860); lane 7: ladder.
- 17B shows lane 1: ladder; lane 2: LbaCasl2a + LbaCasl2a crRNA spacer2; lane 3: LbaCasl2a + MGcrRNA spacer2; lane 4: Apo 13-1; lane 5: 28-1 +MGcrRNA spacer2 (SEQ ID NOs: 141 + 3861); lane 6: 29-1 + MGcrRNA spacer2 (SEQ ID NOs: 215 + 3861); lane 7: 30-1 + MGcrRNA spacer2 (SEQ ID NOs: 226 + 3861); lane 8: 31-1 + MGcrRNA spacer2 (SEQ ID NOs: 229 + 3861); lane 9: 32-1 + MGcrRNA spacer2 (SEQ ID NOs: 261 +3861)
- FIG. 18B shows a boxplot of plasmid transfection activity assays inferred from frequency of indel edits for active nucleases.
- the boundaries of the boxplots indicate first and third quartile values. The mean is indicated with an “x” and the median is represented by the midline within each box.
- FIG. 18C shows plasmid transfection editing frequencies at four target sites for MG29-1 and AsCasl2a. One side-by-side experiment with AsCasl2a was done.
- FIG. 18D shows plasmid and RNP editing activity for nuclease MG29-1 at 14 target loci with either TTN or CCN PAMs.
- FIG. 18E shows the editing profile of nuclease MG29-1 from RNP transfection assays.
- FIG. 18C and FIG. 18D show mean editing frequency with one standard deviation error bar.
- FIG. 19 depicts in cell indel formation generated by transfection of HEK cells with MG29-1 constructs described in Example 12 alongside their corresponding sgRNAs containing various different targeting sequences targeting various locations in the human genome.
- FIG. 20 depicts seqLogo representations of PAM sequences of specific MG family enzymes derived viaNGS as described herein (as described in Example 13).
- FIG. 21 depict seqLogo representations of PAM sequences of specific MG family enzymes derived viaNGS as described herein (top to bottom, SEQ ID NOs: 3865, 3867, 3872).
- FIG. 22 depict seqLogo representations of PAM sequences derived via NGS as described herein (top to bottom, SEQ ID NOs: 3878, 3879, 3880, 3881).
- FIG. 23 depict seqLogo representations of PAM sequences derived via NGS as described herein (top to bottom, SEQ ID NOs: 3883, 3884, 3885) .
- FIG. 24 depict seqLogo representations of PAM sequences derived via NGS as described herein (SEQ ID NO: 3882).
- FIG. 25 depicts in cell indel formation generated by transfection of HEK cells with MG31-1 constructs described in Example 14 alongside their corresponding sgRNAs containing various different targeting sequences targeting various locations in the human genome.
- FIG. 26 shows the biochemical characterization of Type V-A nucleases.
- FIG. 26A shows PCR of cleavage products with adaptors ligated to their ends shows activity of nucleases described herein and Cpfl (positive control) when bound to a universal crRNA. Expected cleavage product band labeled with an arrow.
- FIG. 26B shows PCR of cleavage products with adaptors ligated to their ends show activity of nucleases described herein when bound to their native crRNA . Cleavage product band indicated with an arrow.
- FIG. 26C shows analysis of the NGS cut sites shows cleavage on the target strand at position 22, sometimes with less frequent cleavage after 21 or 23 nt.
- FIG. 27 depicts multiple sequence alignments of Type V-L nucleases described herein, showing (A) an example locus organization for a Type V-L nuclease, and (B) a multiple sequence alignment. Regions containing putative RuvC-III domains are shown as light grey rectangles. Putative RuvC catalytic residues are shown as small dark grey rectangles above each sequence. Putative single-guide RNA binding sequences are small white rectangles, putative scissile phosphate binding sites are indicated by black rectangles above sequences, and residues predicted to disrupt base stacking near the scissile phosphate in the target sequence are indicated by small medium-grey rectangles above sequences.
- FIG. 28 shows a Type V-L candidate labeled MG60 as an example locus organization alongside an effector repeat structure and a phylogenetic tree showing the location of the enzyme in the Type V families.
- FIG. 29 shows examples of smaller Type V effectors one of which may be labeled as MG70.
- FIG. 30 shows characteristic information of MG70 as described herein. Depicted is an example locus organization alongside a phylogenetic tree illustrating the location of these enzymes in the Type V family.
- FIG. 31 shows another example of a small Type V effector MG81 as described herein. Depicted is an example locus organization alongside a phylogenetic tree illustrating the location of these enzymes in the Type V family.
- FIG. 32 shows that the activity individual enzymes of Type V effector families identified herein (e.g. MG20, MG60, MG70, other) is maintained over a variety of different enzyme lengths (e.g. 400-1200 AA). Light dots (True) indicate active enzymes while dark dots (unknown) indicate untested enzymes.
- FIG. 33 depicts sequence conservation of MG nucleases described herein.
- the black bars indicate putative RuvC catalytic residues.
- FIG. 34 and FIG. 35 depicts an enlarged version of multiple sequence alignments in FIG. 33 of regions of the MG nucleases described herein containing putative RuvC catalytic residues (dark-grey rectangles), scissile phosphate-binding residues (black rectangles), and residues predicted to disrupt base stacking adjacent to the scissile phosphate (light-grey rectangles).
- FIG. 36 depicts the regions of the MG nucleases described herein containing putative RuvC-III domain & catalytic residues.
- FIG. 37 depicts regions of the MG nucleases containing putative single-guide RNA- binding residues (white rectangles above sequences).
- FIG. 38 depicts multiple protein sequence alignment of representatives from several MG type V Families. Shown are conserved regions containing portions of the RuvC domain predicted to be involved in nuclease activity. Predicted catalytic residues are highlighted.
- FIG. 39 shows a screen of the TRAC locus for MG29-1 gene editing.
- a bar graph shows indel creation resulting from transfection of MG29-1 with 54 separate guide RNAs targeting the TRAC locus in primary human T cells.
- the corresponding guide RNAs depicted in the figure are identified in SEQ ID NOs: 4316-4423.
- FIG. 40 depicts the optimization of MG29-1 editing at TRAC.
- a bar graph shows indel creation resulting from transfection of MG29-1 (at the indicated concentrations) with the four best 22 nt guide RNAs from FIG. 39 (9, 19, 25, and 35), .
- MG29-1 9 is MG29-1 effector (SEQ ID NO: 215) and Guide 9 (SEQ ID NO: 4378), MG29-1 19 is MG29-1 effector
- MG29-1 25 is MG29-1 effector (SEQ ID NO: 215) and Guide 19 (SEQ ID NO: 4388).
- MG29-1 35 is MG29-1 effector (SEQ ID NO:
- FIG. 41 depicts the optimization of dose and guide length for MG29-1 editing at TRAC.
- Line graphs show the indel creation resulting from transfection of MG29-1 and either guide RNA #19 (SEQ ID NO: 4388) or guide RNA #35 (SEQ ID NO: 4404).
- Three different doses of nuclease/guide RNA were used.
- six different guide lengths were tested, successive one-nucleotide 3’ truncations of SEQ ID NOs: 4388 and 4404.
- the guides used in FIG. 39 and FIG. 40 are the 22nt-long spacer-containing guides in this case.
- FIG. 42 shows a correlation of indel generation at TRAC and loss of the T cell receptor expression in the Experiment of Example 22.
- FIG. 43 depicts targeted transgene integration at TRAC stimulated by MG29-1 cleavage.
- Cells receiving only the transgene donor by AAV infection retain TCR expression and lack CAR expression; cells transfected with MG29-1 RNPs and infected with 100,000 vg (vector genomes) of a CAR transgene donor lose TCR expression and gain CAR expression.
- AAV AAV containing the CAR-T-containing donor sequence with MG29-1 enzyme and sgRNA 19
- AAV+MG29-1-35-22 comprising a 22 nucleotide spacer
- FIG. 44 shows MG29-1 gene editing at TRAC in hematopoietic stem cells.
- a bar graph shows the extent of indel creation at TRAC after transfection with MG29-1-9-22 (“MG29-1 9”; MG29-1 plus guide RNA #19) and MG29-1-35-22 (“MG29-1 35”; MG29-1 plus guide RNA #35) compared to mock-transfected cells.
- FIG. 45 shows the refinement of the MG29-1 PAM based on analysis of gene editing outcomes in cells.
- Guide RNAs were designed using a 5’-NTTN-3’ PAM sequence and then sorted according to the gene editing activity observed. The identity of the underlined base (the 5’- proximal N) is shown for each bin. All of the guides with activity greater than 10% had a T at this position in the genomic DNA indicating that the MG29-1 PAM may be best described as 5’- TTTN-3’. The statistical significance of the over-representation of T at this position is shown for each bin.
- FIG. 46 depicts the analysis of gene editing activity versus the base composition of
- FIG. 47 depicts MG29-1 guide RNA chemical modifications.
- the bar graph shows the consequences of modifications from Table 7 on VEGF-A editing activity relative to an unmodified guide RNA (sample #1).
- FIG. 48 depicts a dose titration of a variously chemically modified MG29-1 RNA.
- the bar graphs show indel generation after transfection of RNPs with guides using modification patterns 1, 4, 5, 7, and 8.
- RNPs doses were 126 pmol MG29-1 and 160 pmol guide RNA or as indicated.
- FIG. 49 depicts a plasmid map of pMG450 (MG29-1 nuclease protein in lac inducible tac promoter A. coli BL21 expression vector.
- FIG. 50 depicts the indel profile of MG29-lwith spacer mALb29-l-8 (SEQ ID NO:
- FIG. 51 is a representative indel profile of MG29-1 with a guide targeting mouse albumin intron 1 determined by next generation sequencing (approximately 15,000 total reads analyzed) as in Example 29.
- FIG. 52 shows the editing efficiency of MG29-1 compared to spCas9 in mouse liver cell line Hepal-6 nucleofected with RNP as in Example 29.
- FIG. 53 shows the editing efficiencies in mammalian cells of MG29-1 variants with single and double amino acid substitutions compared to wild type MG29-1.
- FIG. 53A depicts editing efficiency in Hepa 1-6 cells transfected with plasmids codifying for MG29-1 WT or mutant versions.
- FIG. 53B depicts Editing efficiency in Hepa 1-6 cells transfected with mRNA encoding WT or S168R at various concentrations.
- FIG. 53C depicts the editing efficiency in Hepa 1-6 cells transfected with mRNA codifying versions of MG29-1 with single or double amino acid substitutions.
- FIG. 53A depicts editing efficiency in Hepa 1-6 cells transfected with plasmids codifying for MG29-1 WT or mutant versions.
- FIG. 53B depicts Editing efficiency in Hepa 1-6 cells transfected with mRNA encoding WT or S168R at various concentrations.
- FIG. 53C depicts the editing efficiency in Hepa 1-6
- 53D depicts the editing efficiency in Hepa 1-6 and HEK293T cells transfected with MG29-1 WT vs S168R in combination with 13 guides. 12 guides correspond to guides in Table 7. Guide “35 (TRAC)” is a guide targeting the human locus TRAC.
- FIG. 54 shows the predicted secondary structure of the MG29-1 guide mAlb29-l-8.
- FIG. 55 shows the impact of chemical modifications of the MG29-1 sgRNA sequence upon the stability of the sgRNA in whole cell extracts of mammalian cells.
- FIG. 56 shows the use of sequencing to identify the cut site on the target strand in an in vitro reaction performed with MG29-1 protein, a guide RNA and an appropriate template.
- FIG. 56A shows the distance of the cut position from the PAM in nucleotides as determined by next generation sequencing.
- FIG. 56B shows the use of Sanger Sequencing to define the MG29-1 cut site on the target strand.
- FIG. 56C shows the use of Sanger Sequencing to define the MG29-1 cut site on the non-target strand. Run-off Sanger sequencing was performed on in vitro reactions containing MG29-1, a guide and an appropriate template to evaluate the cleavage of both strands.
- the cleavage site on the target strand is position 23 which is consistent with the NGS data in
- FIG. 56A which shows cleavage at 21-23 bases.
- the “A” peak at the end of the sequence is due to polymerase run off and is expected.
- the cleavage site on the non-target strand can be seen in the reverse read in which the expected terminating base is “T”.
- the marked spot (line) shows cleavage at position 17 from the PAM and then the terminal T.
- there is a mixed T signal at positions 18, 19, and 20 from the PAM suggesting variable cleavage on this strand at positions 17, 18, and 19.
- SEQ ID NOs: 1-37 show the full-length peptide sequences of MG11 nucleases.
- SEQ ID NO: 3471 shows a crRNA 5’ direct repeats designed to function with an MG11 nuclease.
- SEQ ID NOs: 3472-3538 show effector repeat motifs of MG11 nucleases.
- SEQ ID NOs: 38-118 show the full-length peptide sequences of MG13 nucleases.
- SEQ ID NO: 3540-3550 show effector repeat motifs of MG13 nucleases.
- SEQ ID NOs: 119-124 show the full-length peptide sequences of MG19 nucleases.
- SEQ ID NOs: 3551-3558 show the nucleotide sequences of sgRNAs engineered to function with a MG19 nuclease.
- SEQ ID NOs: 3863-3866 show PAM sequences compatible with MG19 nucleases.
- SEQ ID NO: 125 shows the full-length peptide sequence of a MG20 nuclease.
- SEQ ID NO: 3559 shows the nucleotide sequence of a sgRNA engineered to function with a MG20 nuclease.
- SEQ ID NO: 3867 shows a PAM sequence compatible with an MG20 nuclease.
- SEQ ID NOs: 126-140 show the full-length peptide sequences of MG26 nucleases.
- SEQ ID NOs: 3560-3572 show effector repeat motifs of MG26 nucleases.
- SEQ ID NOs: 141-214 show the full-length peptide sequences of MG28 nucleases.
- SEQ ID NOs: 3573-3607 show effector repeat motifs of MG28 nucleases.
- SEQ ID NOs: 3608-3609 show crRNA 5' direct repeats designed to function with an MG28 nuclease.
- SEQ ID NOs: 3868-3869 shows a PAM sequence compatible with an MG28 nuclease.
- SEQ ID NOs: 215-225 show the full-length peptide sequences of MG29 nucleases.
- SEQ ID NOs: 3610-3611 show effector repeat motifs of MG29 nucleases.
- SEQ ID NO: 3612 shows the nucleotide sequence of a sgRNA engineered to function with a MG29 nuclease.
- SEQ ID NOs: 3870-3872 show PAM sequences compatible with an MG29 nuclease.
- SEQ ID NOs: 226-228 show the full-length peptide sequences of MG30 nucleases.
- SEQ ID NOs: 3613-3615 show effector repeat motifs of MG30 nucleases.
- SEQ ID NO: 3873 shows a PAM sequence compatible with an MG30 nuclease.
- SEQ ID NOs: 229-260 show the full-length peptide sequences of MG31 nucleases.
- SEQ ID NOs: 3616-3632 show effector repeat motifs of MG31 nucleases.
- SEQ ID NOs: 3874-3876 show PAM sequences compatible with a MG31 nuclease.
- SEQ ID NO: 261 shows the full-length peptide sequence of a MG32 nuclease.
- SEQ ID NO: 3633-3634 show effector repeat motifs of MG32 nucleases.
- SEQ ID NO: 3876 shows a PAM sequence compatible with a MG32 nuclease.
- SEQ ID NOs: 262-426 show the full-length peptide sequences of MG37 nucleases.
- SEQ ID NO: 3635 shows an effector repeat motif of MG37 nucleases.
- SEQ ID NOs: 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, and 3660-3661 show the nucleotide sequence of sgRNA engineered to function with an MG37 nuclease.
- SEQ ID NOs: 3638, 3642, 3646, 3650, 3654, 3658, and 3662 show the nucleotide sequences of MG37 tracrRNAs derived from the same loci as MG37 nucleases above.
- SEQ ID NO: 3639, 3643, 3647, 3651, 3655, and 3659 show 5' direct repeat sequences derived from native MG37 loci that serve as crRNAs when placed 5' to a 3' targeting or spacer sequence.
- SEQ ID NOs: 427-428 show the full-length peptide sequences of MG53 nucleases.
- SEQ ID NO: 3663 shows a 5' direct repeat sequence derived from native MG53 loci that serve as a crRNA when placed 5' to a 3' targeting or spacer sequence.
- SEQ ID NOs: 3664-3667 show the nucleotide sequence of sgRNAs engineered to function with an MG53 nuclease.
- SEQ ID NOs: 3668-3669 show the nucleotide sequences of MG53 tracrRNAs derived from the same loci as MG53 nucleases above.
- SEQ ID NOs: 429-430 show the full-length peptide sequences of MG54 nucleases.
- SEQ ID NO: 3670 shows a 5' direct repeat sequence derived from native MG54 loci that serve as a crRNA when placed 5' to a 3' targeting or spacer sequence.
- SEQ ID NOs: 3671-3672 show the nucleotide sequence of sgRNA engineered to function with an MG54 nuclease.
- SEQ ID NOs: 3673-3676 show the nucleotide sequences of MG54 tracrRNAs derived from the same loci as MG54 nucleases above.
- SEQ ID NOs: 431-688 show the full-length peptide sequences of MG55 nucleases.
- SEQ ID NOs: 689-690 show the full-length peptide sequences of MG56 nucleases.
- SEQ ID NO: 3678 shows a crRNA 5’ direct repeats designed to function with an MG56 nuclease.
- SEQ ID NOs: 3679-3680 show effector repeat motifs of MG56 nucleases.
- SEQ ID NOs: 691-721 show the full-length peptide sequences of MG57 nucleases.
- SEQ ID NOs: 3681-3694 show effector repeat motifs of MG57 nucleases.
- SEQ ID NOs: 3695-3696 show the nucleotide sequences of sgRNAs engineered to function with an MG57 nuclease.
- SEQ ID NOs: 3879-3880 shows PAM sequences compatible with MG57 nucleases.
- SEQ ID NOs: 722-779 show the full-length peptide sequences of MG58 nucleases.
- SEQ ID NOs: 3697-3711 show effector repeat motifs of MG58 nucleases. MG59
- SEQ ID NOs: 780-792 show the full-length peptide sequences of MG59 nucleases.
- SEQ ID NOs: 3712-3728 show effector repeat motifs of MG59 nucleases.
- SEQ ID NOs: 3729-3730 show the nucleotide sequences of sgRNAs engineered to function with an MG59 nuclease.
- SEQ ID NOs: 3881-3882 shows PAM sequences compatible with MG59 nucleases.
- SEQ ID NOs: 793-1163 show the full-length peptide sequences of MG60 nucleases.
- SEQ ID NOs: 3731-3733 show effector repeat motifs of MG60 nucleases.
- SEQ ID NOs: 1164-1469 show the full-length peptide sequences of MG61 nucleases.
- SEQ ID NOs: 3734-3735 show crRNA 5’ direct repeats designed to function with MG61 nucleases.
- SEQ ID NOs: 3736-3847 show effector repeat motifs of MG61 nucleases.
- SEQ ID NOs: 1470-1472 show the full-length peptide sequences of MG62 nucleases.
- SEQ ID NOs: 3848-3850 show effector repeat motifs of MG62 nucleases.
- SEQ ID NOs: 1473-1514 show the full-length peptide sequences of MG70 nucleases. MG75
- SEQ ID NOs: 1515-1710 show the full-length peptide sequences of MG75 nucleases. MG77
- SEQ ID NOs: 1711-1712 show the full-length peptide sequences of MG77 nucleases.
- SEQ ID NOs: 3851-3852 show the nucleotide sequences of sgRNAs engineered to function with an MG77 nuclease.
- SEQ ID NOs: 3883-3884 show PAM sequences compatible with MG77 nucleases.
- SEQ ID NOs: 1713-1717 show the full-length peptide sequences of MG78 nucleases.
- SEQ ID NO: 3853 shows the nucleotide sequence of a sgRNA engineered to function with an MG78 nuclease.
- SEQ ID NO: 3885 shows a PAM sequence compatible with a MG78 nuclease.
- SEQ ID NOs: 1718-1722 show the full-length peptide sequences of MG79 nucleases.
- SEQ ID NOs: 3854-3857 shows the nucleotide sequences of sgRNAs engineered to function with an MG79 nuclease.
- SEQ ID NOs: 3886-3889 show the PAM sequences compatible with MG79 nucleases.
- SEQ ID NO: 1723 shows the full-length peptide sequence of a MG80 nuclease.
- SEQ ID NOs: 1724-2654 show the full-length peptide sequences of MG81 nucleases.
- SEQ ID NOs: 2655-2657 show the full-length peptide sequences of MG82 nucleases.
- SEQ ID NOs: 2658-2659 show the full-length peptide sequences of MG83 nucleases.
- SEQ ID NOs: 2660-2677 show the full-length peptide sequences of MG84 nucleases.
- SEQ ID NOs: 2678-2680 show the full-length peptide sequences of MG85 nucleases.
- SEQ ID NOs: 2681-2809 show the full-length peptide sequences of MG90 nucleases.
- SEQ ID NOs: 2810-3470 show the full-length peptide sequences of MG91 nucleases.
- SEQ ID Nos: 3858-3861 show the nucleotide sequences of spacer segments.
- SEQ ID NOs: 3938-3953 show the sequences of example nuclear localization sequences (NLSs) that can be appended to nucleases according to the disclosure.
- the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within one or more than one standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value.
- a “cell” generally refers to a biological cell.
- a cell may be the basic structural, functional and/or biological unit of a living organism.
- a cell may originate from any organism having one or more cells.
- Some non-limiting examples include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant (e.g., cells from plant crops, fruits, vegetables, grains, soy bean, com, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkin, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, ferns, clubmosses, hornworts, liverworts, mosses), an algal cell, (e.g., Botryococcus braunii , Chlamydomonas reinhardtii , Nannochloropsis
- seaweeds e.g., kelp
- a fungal cell e.g.,, a yeast cell, a cell from a mushroom
- an animal cell e.g., a cell from an invertebrate animal (e.g., fruit fly, cnidarian, echinoderm, nematode, etc.)
- a cell from a vertebrate animal e.g., fish, amphibian, reptile, bird, mammal
- a cell from a mammal e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a non-human primate, a human, etc.
- a cell is not originating from a natural organism (e.g., a cell can be a synthetically made, sometimes termed an artificial cell).
- nucleotide generally refers to a base-sugar-phosphate combination.
- a nucleotide may comprise a synthetic nucleotide.
- a nucleotide may comprise a synthetic nucleotide analog.
- Nucleotides may be monomeric units of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)).
- nucleotide may include ribonucleoside triphosphates adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof.
- Such derivatives may include, for example, [aSJdATP, 7-deaza-dGTP and 7-deaza-dATP, and nucleotide derivatives that confer nuclease resistance on the nucleic acid molecule containing them.
- nucleotide as used herein may refer to dideoxyribonucleoside triphosphates
- ddNTPs dideoxyribonucleoside triphosphates
- a nucleotide may be unlabeled or detectably labeled, such as using moieties comprising optically detectable moieties (e.g., fluorophores). Labeling may also be carried out with quantum dots.
- Detectable labels may include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
- Fluorescent labels of nucleotides may include but are not limited fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6- carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6- carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo) benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, Cyanine and 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS).
- fluorescently labeled nucleotides can include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP,
- [TAMRA]dCTP [JOE]ddATP, [R6G] ddATP, [FAM] ddCTP, [R110]ddCTP, [TAMRA]ddGTP,
- Blue-7-UTP Cascade Blue-7-dUTP, fluorescein- 12-UTP, fluorescein- 12-dUTP, Oregon Green
- Nucleotides can also be labeled or marked by chemical modification.
- a chemically-modified single nucleotide can be biotin-dNTP.
- biotinylated dNTPs can include, biotin-dATP (e.g., bio-N6- ddATP, biotin- 14-dATP), biotin-dCTP (e.g., biotin- 11-dCTP, biotin- 14-dCTP), and biotin-dUTP
- biotin-dATP e.g., bio-N6- ddATP, biotin- 14-dATP
- biotin-dCTP e.g., biotin- 11-dCTP, biotin- 14-dCTP
- biotin-dUTP biotin-dUTP
- biotin- 11-dUTP e.g., biotin- 11-dUTP, biotin- 16-dUTP, biotin-20-dUTP.
- polynucleotide oligonucleotide
- nucleic acid a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, either in single-, double-, or multi- stranded form.
- a polynucleotide may be exogenous or endogenous to a cell.
- a polynucleotide may exist in a cell-free environment.
- a polynucleotide may be a gene or fragment thereof.
- a polynucleotide may be DNA.
- a polynucleotide may be RNA.
- a polynucleotide may have any three-dimensional structure and may perform any function.
- a polynucleotide may comprise one or more analogs (e.g., altered backbone, sugar, or nucleobase). If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
- analogs include: 5-bromouracil, peptide nucleic acid, xeno nucleic acid, morpholinos, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein linked to the sugar), thiol-containing nucleotides, biotin-linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queuosine, and wyosine.
- fluorophores e.g., rhodamine or fluorescein linked to the sugar
- thiol-containing nucleotides biotin-linked nucleotides, fluorescent base analogs, CpG islands, methyl
- Non-limiting examples of polynucleotides include coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-
- RNA Ribonucleic acid probes, and primers.
- the sequence of nucleotides may be interrupted by non-nucleotide components.
- transfection or “transfected” generally refer to introduction of a nucleic acid into a cell by non-viral or viral-based methods.
- the nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof. See, e.g., Sambrook et ah, 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88 (which is entirely incorporated by reference herein).
- peptide “polypeptide,” and “protein” are used interchangeably herein to generally refer to a polymer of at least two amino acid residues joined by peptide bond(s). This term does not connote a specific length of polymer, nor is it intended to imply or distinguish whether the peptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers comprising at least one modified amino acid. In some cases, the polymer may be interrupted by non-amino acids. The terms include amino acid chains of any length, including full length proteins, and proteins with or without secondary and/or tertiary structure (e.g., domains).
- the terms also encompass an amino acid polymer that has been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other manipulation such as conjugation with a labeling component.
- the terms also encompass an amino acid polymer that has been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other manipulation such as conjugation with a labeling component.
- amino acid and amino acids generally refer to natural and non-natural amino acids, including, but not limited to, modified amino acids and amino acid analogues.
- Modified amino acids may include natural amino acids and non-natural amino acids, which have been chemically modified to include a group or a chemical moiety not naturally present on the amino acid.
- Amino acid analogues may refer to amino acid derivatives.
- amino acid includes both D-amino acids and L-amino acids.
- non-native can generally refer to a nucleic acid or polypeptide sequence that is not found in a native nucleic acid or protein.
- Non-native may refer to affinity tags.
- Non-native may refer to fusions.
- Non-native may refer to a naturally occurring nucleic acid or polypeptide sequence that comprises mutations, insertions and/or deletions.
- a non-native sequence may exhibit and/or encode for an activity (e.g., enzymatic activity, methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitinating activity, etc.) that may also be exhibited by the nucleic acid and/or polypeptide sequence to which the non-native sequence is fused.
- a non-native nucleic acid or polypeptide sequence may be linked to a naturally-occurring nucleic acid or polypeptide sequence (or a variant thereof) by genetic engineering to generate a chimeric nucleic acid and/or polypeptide sequence encoding a chimeric nucleic acid and/or polypeptide.
- promoter generally refers to the regulatory DNA region which controls transcription or expression of a gene and which may be located adjacent to or overlapping a nucleotide or region of nucleotides at which RNA transcription is initiated.
- a promoter may contain specific DNA sequences which bind protein factors, often referred to as transcription factors, which facilitate binding of RNA polymerase to the DNA leading to gene transcription.
- a ‘basal promoter’ also referred to as a ‘core promoter’, may generally refer to a promoter that contains all the basic necessary elements to promote transcriptional expression of an operably linked polynucleotide.
- Eukaryotic basal promoters typically, though not necessarily, contain a TATA-box and/or a CAAT box.
- expression generally refers to the process by which a nucleic acid sequence or a polynucleotide is transcribed from a DNA template (such as into mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
- operably linked As used herein, “operably linked”, “operable linkage”, “operatively linked”, or grammatical equivalents thereof generally refer to juxtaposition of genetic elements, e.g., a promoter, an enhancer, a polyadenylation sequence, etc., wherein the elements are in a relationship permitting them to operate in the expected manner.
- a regulatory element which may comprise promoter and/or enhancer sequences, is operatively linked to a coding region if the regulatory element helps initiate transcription of the coding sequence. There may be intervening residues between the regulatory element and coding region so long as this functional relationship is maintained.
- a “vector” as used herein generally refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which may be used to mediate delivery of the polynucleotide to a cell.
- vectors include plasmids, viral vectors, liposomes, and other gene delivery vehicles.
- the vector generally comprises genetic elements, e.g., regulatory elements, operatively linked to a gene to facilitate expression of the gene in a target.
- an expression cassette and “a nucleic acid cassette” are used interchangeably generally to refer to a combination of nucleic acid sequences or elements that are expressed together or are operably linked for expression.
- an expression cassette refers to the combination of regulatory elements and a gene or genes to which they are operably linked for expression.
- a “functional fragment” of a DNA or protein sequence generally refers to a fragment that retains a biological activity (either functional or structural) that is substantially similar to a biological activity of the full-length DNA or protein sequence.
- a biological activity of a DNA sequence may be its ability to influence expression in a manner known to be attributed to the full- length sequence.
- an “engineered” object generally indicates that the object has been modified by human intervention.
- a nucleic acid may be modified by changing its sequence to a sequence that does not occur in nature; a nucleic acid may be modified by ligating it to a nucleic acid that it does not associate with in nature such that the ligated product possesses a function not present in the original nucleic acid; an engineered nucleic acid may synthesized in vitro with a sequence that does not exist in nature; a protein may be modified by changing its amino acid sequence to a sequence that does not exist in nature; an engineered protein may acquire a new function or property.
- An “engineered” system comprises at least one engineered component.
- synthetic and “artificial” can generally be used interchangeably to refer to a protein or a domain thereof that has low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) to a naturally occurring human protein.
- sequence identity e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity
- VPR and VP64 domains are synthetic transactivation domains.
- Casl2a generally refers to a family of Cas endonucleases that are class 2, Type V-A Cas endonucleases and that (a) use a relatively small guide RNA (about 42-44 nucleotides) that is processed by the nuclease itself following transcription from the CRISPR array, and (b) cleave DNA to leave staggered cut sites. Further features of this family of enzymes can be found, e.g. in Zetsche B, Heidenreich M, Mohanraju P, et al. Nat Biotechnol 2017;35:31-34, and Zetsche B, Gootenberg JS, Abudayyeh 00, et al. Cell 2015;163:759-771, which are incorporated by reference herein.
- a “guide nucleic acid” can generally refer to a nucleic acid that may hybridize to another nucleic acid.
- a guide nucleic acid may be RNA.
- a guide nucleic acid may be DNA.
- the guide nucleic acid may be programmed to bind to a sequence of nucleic acid site- specifically.
- the nucleic acid to be targeted, or the target nucleic acid may comprise nucleotides.
- the guide nucleic acid may comprise nucleotides.
- a portion of the target nucleic acid may be complementary to a portion of the guide nucleic acid.
- the strand of a double-stranded target polynucleotide that is complementary to and hybridizes with the guide nucleic acid may be called the complementary strand.
- a guide nucleic acid may comprise a polynucleotide chain and can be called a “single guide nucleic acid.”
- a guide nucleic acid may comprise two polynucleotide chains and may be called a “double guide nucleic acid.” If not otherwise specified, the term “guide nucleic acid” may be inclusive, referring to both single guide nucleic acids and double guide nucleic acids.
- a guide nucleic acid may comprise a segment that can be referred to as a “nucleic acid-targeting segment” or a “nucleic acid-targeting sequence” or “spacer sequence.”
- a nucleic acid-targeting segment may comprise a sub-segment that may be referred to as a “protein binding segment” or “protein binding sequence” or “Cas protein binding segment”.
- sequence identity or “percent identity” in the context of two or more nucleic acids or polypeptide sequences, generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a local or global comparison window, as measured using a sequence comparison algorithm.
- Suitable sequence comparison algorithms for polypeptide sequences include, e.g., BLASTP using parameters of a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment for polypeptide sequences longer than 30 residues; BLASTP using parameters of a wordlength (W) of 2, an expectation (E) of
- MUSCLE with default parameters
- MAFFT with parameters of a retree of 2 and max iterations of 1000
- Novafold with default parameters
- HMMER hmmalign with default parameters.
- optically aligned in the context of two or more nucleic acids or polypeptide sequences, generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that have been aligned to maximal correspondence of amino acids residues or nucleotides, for example, as determined by the alignment producing a highest or
- variants of any of the enzymes described herein with one or more conservative amino acid substitutions can be made in the amino acid sequence of a polypeptide without disrupting the three-dimensional structure or function of the polypeptide.
- Conservative substitutions can be accomplished by substituting amino acids with similar hydrophobicity, polarity, and R chain length for one another. Additionally, or alternatively, by comparing aligned sequences of homologous proteins from different species, conservative substitutions can be identified by locating amino acid residues that have been mutated between species (e.g., non-conserved residues) without altering the basic functions of the encoded proteins.
- Such conservatively substituted variants may include variants with at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of the endonuclease protein sequences described herein (e.g.
- such conservatively substituted variants are functional variants.
- Such functional variants can encompass sequences with substitutions such that the activity of one or more critical active site residues or guide RNA binding residues of the endonuclease are not disrupted.
- a functional variant of any of the proteins described herein lacks substitution of at least one of the conserved or functional residues called out in FIGURES 17, 18, 10, 20, or
- a functional variant of any of the proteins described herein lacks substitution of all of the conserved or functional residues called out in FIGURES 17, 18, 10, 20, or 25 or a residue described in Table IB.
- a decreased activity variant as a protein described herein comprises a disrupting substitution of at least one, at least two, or all three catalytic residues identified in Table IB.
- Metagenomic sequencing from natural environmental niches containing large numbers of microbial species may offer the potential to drastically increase the number of new CRISPR/Cas systems known and speed the discovery of new oligonucleotide editing functionalities.
- a recent example of the fruitfulness of such an approach is demonstrated by the 2016 discovery of CasX/CasY CRISPR systems from metagenomic analysis of natural microbial communities.
- CRISPR/Cas systems are RNA-directed nuclease complexes that have been described to function as an adaptive immune system in microbes.
- CRISPR/Cas systems occur in CRISPR (clustered regularly interspaced short palindromic repeats) operons or loci, which generally comprise two parts: (i) an array of short repetitive sequences (30-40bp) separated by equally short spacer sequences, which encode the RNA-based targeting element; and (ii) ORFs encoding the Cas encoding the nuclease polypeptide directed by the RNA-based targeting element alongside accessory proteins/enzymes.
- Efficient nuclease targeting of a particular target nucleic acid sequence generally requires both (i) complementary hybridization between the first 6-8 nucleic acids of the target (the target seed) and the crRNA guide; and (ii) the presence of a protospacer-adjacent motif (PAM) sequence within a defined vicinity of the target seed (the PAM usually being a sequence not commonly represented within the host genome).
- PAM protospacer-adjacent motif
- CRISPR-Cas systems are commonly organized into 2 classes, 5 types and 16 subtypes based on shared functional characteristics and evolutionary similarity (see FIG. 1).
- Class I CRISPR-Cas systems have large, multi-subunit effector complexes, and comprise Types I, III, and IV.
- Class II CRISPR-Cas systems generally have single-polypeptide multidomain nuclease effectors, and comprise Types II, V and VI.
- Type II CRISPR-Cas systems are considered the simplest in terms of components.
- the processing of the CRISPR array into mature crRNAs does not require the presence of a special endonuclease subunit, but rather a small trans-encoded crRNA (tracrRNA) with a region complementary to the array repeat sequence; the tracrRNA interacts with both its corresponding effector nuclease (e.g. Cas9) and the repeat sequence to form a precursor dsRNA structure, which is cleaved by endogenous RNAse III to generate a mature effector enzyme loaded with both tracrRNA and crRNA.
- Cas II nucleases are known as DNA nucleases.
- Type 2 effectors generally exhibit a structure consisting of a RuvC-like endonuclease domain that adopts the RNase H fold with an unrelated HNH nuclease domain inserted within the folds of the RuvC-like nuclease domain.
- the RuvC-like domain is responsible for the cleavage of the target (e.g., crRNA complementary) DNA strand, while the HNH domain is responsible for cleavage of the displaced DNA strand.
- Type V CRISPR-Cas systems are characterized by a nuclease effector (e.g. Cas 12) structure similar to that of Type II effectors, comprising a RuvC-like domain. Similar to Type II, most (but not all) Type V CRISPR systems use a tracrRNA to process pre-crRNAs into mature crRNAs; however, unlike Type II systems which requires RNAse III to cleave the pre-crRNA into multiple crRNAs, type V systems are capable of using the effector nuclease itself to cleave pre-crRNAs. Like Type-II CRISPR-Cas systems, Type V CRISPR-Cas systems are again known as DNA nucleases.
- Cas 12 nuclease effector
- Type V enzymes e.g., Casl2a
- Casl2a some Type V enzymes appear to have a robust single-stranded nonspecific deoxyribonuclease activity that is activated by the first crRNA directed cleavage of a double-stranded target sequence.
- CRISPR-Cas systems have emerged in recent years as the gene editing technology of choice due to their targetability and ease of use.
- the most commonly used systems are the Class
- the Type V-A systems in particular are becoming more widely used since their reported specificity in cells is higher than other nucleases, with fewer or no off-target effects.
- the V-A systems are also advantageous in that the guide RNA is small (42-44 nucleotides compared with approximately 100 nt for SpCas9) and is processed by the nuclease itself following transcription from the CRISPR array, simplifying multiplexed applications with multiple gene edits.
- the V-A systems have staggered cut sites, which may facilitate directed repair pathways, such as microhomology- dependent targeted integration (MITI).
- MITI microhomology- dependent targeted integration
- Type V-A enzymes require a 5’ protospacer adjacent motif (PAM) next to the chosen target site: 5’-TTTV-3’ for Lachnospiraceae bacterium ND2006 LbCasl2a and Acidaminococcus sp. AsCasl2a; and 5’-TTV-3’ for Francisellanovicida FnCasl2a.
- PAM protospacer adjacent motif
- Recent exploration of orthologs has revealed proteins with less restrictive PAM sequences that are also active in mammalian cell culture, for example YTV, YYN or TTN.
- these enzymes do not fully encompass V-A biodiversity and targetability, and may not represent all possible activities and PAM sequence requirements.
- thousands of genomic fragments were mined from numerous metagenomes for Type V-A nucleases.
- the known diversity of V-A enzymes may have been expanded and novel systems may have been developed into highly targetable, compact, and precise gene editing agents.
- Type V-A CRISPR systems are quickly being adopted for use in a variety of genome editing applications. These programmable nucleases are part of adaptive microbial immune systems, the natural diversity of which has been largely unexplored. Novel families of Type V-A CRISPR enzymes were identified through a large-scale analysis of metagenomes collected from a variety of complex environments, and developed representatives of these systems into gene editing platforms. The nucleases are phylogenetically diverse (see FIG. 4A) and recognize a single guide RNA with specific motifs. The majority of these systems come from uncultivated organisms, some of which encode a divergent Type V effector within the same CRISPR operon. Biochemical analysis uncovered unexpected PAM diversity (see FIG. 4B), indicating that these systems will facilitate a variety of genome engineering applications. The simplicity of guide sequences and activity in human cell lines suggest utility in gene and cell therapies.
- the present disclosure provides for novel Type V-L candidates (see
- Type V-L may be a novel subtype and some sub-families may have been identified.
- Type V-L may be found in the same CRISPR locus as Type V-A effectors. RuvC catalytic residues may have been identified for
- Type V-L candidates and these Type V-L candidates may not require tracrRNA.
- One example of a Type V-L are the MG60 nucleases described herein (see FIG. 28 and FIG. 32).
- the present disclosure provides for smaller Type V effectors (see FIG.
- Such effectors may be small putative effectors. These effectors may simplify delivery and may extend therapeutic applications.
- MG70 as described herein (see FIG. 29).
- MG70 may be an ultra-small enzyme of about 373 amino acids in length.
- MG 70 may have a single transposase domain at the N- terminus and may have a predicted tracrRNA (see FIG. 30 and FIG. 32).
- the present disclosure provides for a smaller Type V effector (see FIG.
- Such an effector may be MG81 described herein.
- MG81 may be about 500-700 amino acids in length and may contain RuvC, and HTH DNA binding domains.
- the present disclosure provides for an engineered nuclease system discovered through metagenomic sequencing.
- the metagenomic sequencing is conducted on samples.
- the samples may be collected from a variety of environments.
- Such environments may be a human microbiome, an animal microbiome, environments with high temperatures, environments with low temperatures.
- environments may include sediment.
- An example of the types of such environments of the engineered nuclease systems described herein may be found in FIG. 2.
- an engineered nuclease system comprising (a) an endonuclease.
- the endonuclease is a Cas endonuclease.
- the endonuclease is a class 2, type V Cas endonuclease.
- the endonuclease is a class 2, type V-A Cas endonuclease.
- the endonuclease is derived from an uncultivated microorganism.
- the endonuclease may comprise a RuvC domain.
- the engineered nuclease system comprises (b) an engineered guide RNA.
- the engineered guide RNA is configured to form a complex with the endonuclease. In some cases, the engineered guide RNA comprises a spacer sequence. In some cases, the spacer sequence is configured to hybridize to a target nucleic acid sequence.
- the present disclosure provides for an engineered nuclease system comprising (a) an endonuclease.
- the endonuclease has at least about 70% sequence identity to any one of SEQ ID NOs: 1-3470.
- the endonuclease has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 1-3470.
- the endonuclease comprises a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 1-3470.
- the endonuclease may be substantially identical to any one of SEQ ID NOs: 1- 3470.
- the engineered nuclease system comprises an engineered guide RNA.
- the engineered guide RNA is configured to form a complex with the endonuclease.
- the engineered guide RNA comprises a spacer sequence.
- the spacer sequence is configured to hybridize to a target nucleic acid sequence.
- the present disclosure provides an engineered nuclease system comprising (a) an endonuclease.
- the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence.
- PAM protospacer adjacent motif
- the PAM sequence is substantially identical to any one of SEQ ID NOs: 3863-3913.
- the PAM sequence any one of SEQ ID NOs: 3863-3913.
- the endonuclease is a Cas endonuclease.
- the endonuclease is a class 2 Cas endonuclease.
- the endonuclease is a class 2, type V Cas endonuclease. In some cases, the endonuclease is a class 2, type V-A Cas endonuclease.
- the engineered nuclease system comprises (b) an engineered guide RNA. In some cases, the engineered guide RNA is configured to form a complex with the endonuclease. In some cases, the engineered guide RNA comprises a spacer sequence. In some cases, the spacer sequence is configured to hybridize to a target nucleic acid sequence.
- the endonuclease is not a Cpfl or Cmsl endonuclease. In some cases, the endonuclease further comprises a zinc finger-like domain.
- the guide RNA comprises a sequence with at least 80% sequence identity to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551- 3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657,
- the guide RNA comprises a sequence with at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about
- the guide RNA comprises a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-
- the guide RNA comprises a sequence which is substantially identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857.
- the guide RNA comprises a sequence with at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636- 3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671- 36
- the endonuclease is configured to bind to the engineered guide RNA.
- the Cas endonuclease is configured to bind to the engineered guide RNA.
- the class 2 Cas endonuclease is configured to bind to the engineered guide RNA.
- V Cas endonuclease is configured to bind to the engineered guide RNA. .In some cases, the class
- type V-A Cas endonuclease is configured to bind to the engineered guide RNA.
- the endonuclease is configured to bind to a protospacer adjacent motif
- PAM sequence comprising any one of SEQ ID NOs: 3863-3913.
- the guide RNA comprises a sequence complementary to a eukaryotic, fungal, plant, mammalian, or human genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a eukaryotic genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a fungal genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a plant genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a mammalian genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a human genomic polynucleotide sequence.
- the guide RNA is 30-250 nucleotides in length. In some cases, the guide RNA is 42-44 nucleotides in length. In some cases, the guide RNA is 42 nucleotides in length. In some cases, the guide RNA is 43 nucleotides in length. In some cases, the guide RNA is 44 nucleotides in length. In some cases, the guide RNA is 85-245 nucleotides in length. In some cases, the guide RNA is more than 90 nucleotides in length. In some cases, the guide RNA is less than 245 nucleotides in length.
- the endonuclease may comprise a variant having one or more nuclear localization sequences (NLSs).
- the NLS may be proximal to the N- or C-terminus of the endonuclease.
- the NLS may be appended N-terminal or C-terminal to any one of SEQ ID NOs: 3938-3953, or to a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 3938-3953.
- the NLS may comprise a sequence substantially identical to any one of SEQ ID NOs: 3938-3953.
- Table 1 Example NLS Sequences that may be used with Cas Effectors according to the disclosure.
- the engineered nuclease system further comprises a single- or double stranded DNA repair template. In some cases, the engineered nuclease system further comprises a single-stranded DNA repair template. In some cases, the engineered nuclease system further comprises a double-stranded DNA repair template. In some cases, the single- or double-stranded DNA repair template may comprise from 5’ to 3’: a first homology arm comprising a sequence of at least 20 nucleotides 5' to said target deoxyribonucleic acid sequence, a synthetic DNA sequence of at least 10 nucleotides, and a second homology arm comprising a sequence of at least 20 nucleotides 3' to said target sequence.
- the first homology arm comprises a sequence of at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 175, at least 200, at least 250, at least 300, at least 400, at least
- the second homology arm comprises a sequence of at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 175, at least
- nucleotides 200, at least 250, at least 300, at least 400, at least 500, at least 750, or at least 1000 nucleotides.
- the first and second homology arms are homologous to a genomic sequence of a prokaryote. In some cases, the first and second homology arms are homologous to a genomic sequence of a bacteria. In some cases, the first and second homology arms are homologous to a genomic sequence of a fungus. In some cases, the first and second homology arms are homologous to a genomic sequence of a eukaryote.
- the engineered nuclease system further comprises a DNA repair template.
- the DNA repair template may comprise a double-stranded DNA segment.
- the double- stranded DNA segment may be flanked by one single-stranded DNA segment.
- the double- stranded DNA segment may be flanked by two single-stranded DNA segments.
- the single-stranded DNA segments are conjugated to the 5’ ends of the double-stranded DNA segment.
- the single stranded DNA segments are conjugated to the 3’ ends of the double-stranded DNA segment.
- the single-stranded DNA segments have a length from 1 to 15 nucleotide bases. In some cases, the single-stranded DNA segments have a length from 4 to 10 nucleotide bases. In some cases, the single-stranded DNA segments have a length of 4 nucleotide bases. In some cases, the single-stranded DNA segments have a length of 5 nucleotide bases. In some cases, the single-stranded DNA segments have a length of 6 nucleotide bases. In some cases, the single-stranded DNA segments have a length of 7 nucleotide bases. In some cases, the single- stranded DNA segments have a length of 8 nucleotide bases. In some cases, the single-stranded DNA segments have a length of 9 nucleotide bases. In some cases, the single-stranded DNA segments have a length of 10 nucleotide bases.
- the single-stranded DNA segments have a nucleotide sequence complementary to a sequence within the spacer sequence.
- the double-stranded DNA sequence comprises a barcode, an open reading frame, an enhancer, a promoter, a protein coding sequence, a miRNA coding sequence, an RNA coding sequence, or a transgene.
- the engineered nuclease system further comprises a source of Mg 2+ .
- the guide RNA comprises a hairpin comprising at least 8 base-paired ribonucleotides. In some cases, the guide RNA comprises a hairpin comprising at least 9 base- paired ribonucleotides. In some cases, the guide RNA comprises a hairpin comprising at least 10 base-paired ribonucleotides. In some cases, the guide RNA comprises a hairpin comprising at least 11 base-paired ribonucleotides. In some cases, the guide RNA comprises a hairpin comprising at least 12 base-paired ribonucleotides.
- the endonuclease comprises a sequence at least 70% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof 141, 215, 229, 261, or 1711-1721 or a variant thereof . In some cases, the endonuclease comprises a sequence at least 75% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof .
- the endonuclease comprises a sequence at least 80% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof . In some cases, the endonuclease comprises a sequence at least 85% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof . In some cases, the endonuclease comprises a sequence at least 90% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721 or a variant thereof . In some cases, the endonuclease comprises a sequence at least 95% identical to a variant of any one of SEQ ID NOs: 141, 215,
- the guide RNA structure comprises a sequence of at least 70% identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence of at least 75% identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence of at least 80% identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608.
- the guide RNA structure comprises a sequence of at least 85% identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence of at least 90% identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence of at least 95% identical to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 3863-3913.
- sequence may be determined by a BLASTP, CLUSTALW, MUSCLE, or MAFFT algorithm, or a CLUSTALW algorithm with the Smith-Waterman homology search algorithm parameters.
- the sequence identity may be determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment.
- the present disclosure provides an engineered guide RNA comprising (a) a DNA-targeting segment.
- the DNA-targeting segment comprises a nucleotide sequence that is complementary to a target sequence.
- the target sequence is in a target DNA molecule.
- the engineered guide RNA comprises (b) a protein-binding segment.
- the protein-binding segment comprises two complementary stretches of nucleotides.
- the two complementary stretches of nucleotides hybridize to form a double-stranded RNA (dsRNA) duplex.
- the two complementary stretches of nucleotides are covalently linked to one another with intervening nucleotides.
- the engineered guide ribonucleic acid polynucleotide is capable of forming a complex with an endonuclease.
- the endonuclease has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 1-3470.
- the complex targets the target sequence of the target DNA molecule.
- the DNA-targeting segment is positioned 3’ of both of the two complementary stretches of nucleotides.
- the protein binding segment comprising a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the first 19 nucleotides or the non-degenerate nucleotides of SEQ ID NO: 3608.
- the double-stranded RNA (dsRNA) duplex comprises at least 8 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 9 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 10 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 11 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 12 ribonucleotides.
- the deoxyribonucleic acid polynucleotide encodes the engineered guide ribonucleic acid polynucleotide.
- the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence.
- the engineered nucleic acid sequence is optimized for expression in an organism.
- the nucleic acid encodes an endonuclease.
- the endonuclease is a Cas endonuclease.
- the endonuclease is a class 2 endonuclease.
- the endonuclease is a class2, type V Cas endonuclease.
- the endonuclease is a class2, type V-A Cas endonuclease.
- the endonuclease is derived from an uncultivated microorganism. In some cases, the organism is not the uncultivated organism.
- the endonuclease comprises a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 1-3470.
- the endonuclease may comprise a variant having one or more nuclear localization sequences (NLSs).
- the NLS may be proximal to the N- or C-terminus of the endonuclease.
- the NLS may be appended N-terminal or C-terminal to any one of SEQ ID NOs:
- 3938-3953 or to a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 3938-3953.
- the organism is prokaryotic. In some cases, the organism is bacterial. In some cases, the organism is eukaryotic. In some cases, the organism is fungal. In some cases, the organism is a plant. In some cases, the organism is mammalian. In some cases, the organism is a rodent. In some cases, the organism is human.
- the present disclosure provides an engineered vector.
- the engineered vector comprises a nucleic acid sequence encoding an endonuclease.
- the endonuclease is a Cas endonuclease.
- the endonuclease is a class 2 Cas endonuclease.
- the endonuclease is a class 2, type V Cas endonuclease.
- the endonuclease is a class2, type V-A Cas endonuclease.
- the endonuclease is derived from an uncultivated microorganism.
- the engineered vector comprises a nucleic acid described herein.
- the nucleic acid described herein is a deoxyribonucleic acid polynucleotide described herein.
- the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
- AAV adeno-associated virus
- the present disclosure provides a cell comprising a vector described herein.
- the present disclosure provides a method of manufacturing an endonuclease. In some cases, the method comprises cultivating the cell.
- the present disclosure provides a method for binding, cleaving, marking, or modifying a double-stranded deoxyribonucleic acid polynucleotide.
- the method may comprise contacting the double-stranded deoxyribonucleic acid polynucleotide with an endonuclease.
- the endonuclease is a Cas endonuclease.
- the endonuclease is a class 2 Cas endonuclease.
- the endonuclease is a class 2, type V Cas endonuclease.
- the endonuclease is a class2, type V-A Cas endonuclease.
- the endonuclease is in complex with an engineered guide RNA.
- the engineered guide RNA is configured to bind to the endonuclease.
- the engineered guide RNA is configured to bind to the double-stranded deoxyribonucleic acid polynucleotide.
- the engineered guide RNA is configured to bind to the endonuclease and to the double-stranded deoxyribonucleic acid polynucleotide.
- the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM).
- PAM comprises a sequence comprising any one of SEQ ID NOs: 3863-3913.
- the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide RNA and a second strand comprising the PAM.
- the PAM is directly adjacent to the 5' end of the sequence complementary to the sequence of the engineered guide RNA.
- the endonuclease is not a Cpfl endonuclease or a Cmsl endonuclease. In some cases, the endonuclease is derived from an uncultivated microorganism.
- the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
- the PAM comprises any one of SEQ ID NOs: 3863-3913.
- the present disclosure provides a method of modifying a target nucleic acid locus.
- the method may comprise delivering to the target nucleic acid locus the engineered nuclease system described herein.
- the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure.
- the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies the target nucleic acid locus.
- modifying the target nucleic acid locus comprises binding, nicking, cleaving, or marking said target nucleic acid locus.
- the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
- the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA.
- the target nucleic acid locus is in vitro. In some cases, the target nucleic acid locus is within a cell.
- the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell.
- delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering the nucleic acid described herein or the vector described herein. In some cases, delivery of engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. In some cases, the nucleic acid comprises a promoter. In some cases, the open reading frame encoding the endonuclease is operably linked to the promoter.
- delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease. In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide RNA operably linked to a ribonucleic acid (RNA) pol III promoter.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the endonuclease induces a single-stranded break or a double-stranded break at or proximal to the target locus. In some cases, the endonuclease induces a staggered single stranded break within or 3' to said target locus.
- effector repeat motifs are used to inform guide design of MG nucleases.
- the processed gRNA in Type V-A systems consists of the last 20-22 nucleotides of a CRISPR repeat. This sequence may be synthesized into a crRNA (along with a spacer) and tested in vitro , along with the synthesized nucleases, for cleavage on a library of possible targets. Using this method, the PAM may be determined.
- Type V-A enzymes may use a “universal” gRNA. In some cases, Type V enzymes may need a unique gRNA.
- Systems of the present disclosure may be used for various applications, such as, for example, nucleic acid editing (e.g., gene editing), binding to a nucleic acid molecule (e.g., sequence-specific binding).
- nucleic acid editing e.g., gene editing
- binding to a nucleic acid molecule e.g., sequence-specific binding
- Such systems may be used, for example, for addressing (e.g., removing or replacing) a genetically inherited mutation that may cause a disease in a subject, inactivating a gene in order to ascertain its function in a cell, as a diagnostic tool to detect disease-causing genetic elements (e.g.
- RNA or an amplified DNA sequence encoding a disease-causing mutation via cleavage of reverse-transcribed viral RNA or an amplified DNA sequence encoding a disease-causing mutation), as deactivated enzymes in combination with a probe to target and detect a specific nucleotide sequence (e.g. sequence encoding antibiotic resistance int bacteria), to render viruses inactive or incapable of infecting host cells by targeting viral genomes, to add genes or amend metabolic pathways to engineer organisms to produce valuable small molecules, macromolecules, or secondary metabolites, to establish a gene drive element for evolutionary selection, to detect cell perturbations by foreign small molecules and nucleotides as a biosensor.
- a specific nucleotide sequence e.g. sequence encoding antibiotic resistance int bacteria
- Example 1 A method of metagenomic analysis for new proteins
- Metagenomic samples were collected from sediment, soil and animals.
- Deoxyribonucleic acid (DNA) was extracted with a Zymobiomics DNA mini-prep kit and sequenced on an Illumina HiSeq ® 2500. Samples were collected with consent of property owners.
- Metagenomic sequence data was searched using Hidden Markov Models generated based on known Cas protein sequences including class II type V Cas effector proteins to identify new Cas effectors (see FIG. 2, which shows distribution of proteins detected in one family, MG29, identified from sample types such as high-temperature samples). Novel effector proteins identified by the search were aligned to known proteins to identify potential active sites (see e.g.
- FIG. 3 which shows that all MG29 family effectors identified from various samples have three catalytic residues from RuvCI, RuvCII, and RuvCIII catalytic domains and are predicted to be active).
- Putative spacer sequences were identified by their location adjacent to the genomic loci encoding the effector proteins.
- Example 2 A method of metagenomic analysis for new proteins [00257] Thirteen animal microbiome, high temperature biofilm and sediment samples were collected and stored on ice or in Zymo DNA/RNA Shield after collection. DNA was extracted from samples using either the Qiagen DNeasy PowerSoil Kit or the ZymoBIOMICS DNA Miniprep Kit. DNA sequencing libraries were constructed and sequenced on an Illumina HiSeq 4000 or on a Novaseq machine at the Vincent J. Coates Genomics Sequencing Laboratory at UC Berkeley, with paired 150 bp reads with a 400-800 bp target insert size (10 GB of sequencing was targeted per sample). Publicly available metagenomic sequencing data were downloaded from the NCBI SRA.
- Type V effector proteins were aligned with MAFFT and a phylogenetic tree was inferred using FasTree2.
- Novel families were delineated by identifying clades composed of sequences recovered from this study. From within families, candidates were selected if they contained the necessary components for laboratory analysis (i.e., they were found on a well-assembled and annotated contig with a CRISPR array) in a manner that sampled as much phylogenetic diversity as possible. Priority was given to small effectors from diverse families (that is, families with representatives sharing a wider range of protein sequences).
- CRISPR array repeats were searched for a motif associated with Type V-A systems, TCTAC-N-GTAGA (containing between one and eight N residues). From this analysis, families were putatively classified as V-A if representative CRISPR arrays contained one of these motif sequences. This dataset was used to identify HMM profiles associated with V-A families, which were in turn used to classify additional families (see FIG. 33-FIG. 37). Although the convention is to name novel
- Casl2 nucleases on the basis of the organism that encodes them, it is not possible to do so for the nucleases described herein. Therefore, in order to best adhere to the convention, the systems described herein are named with the prefix MG to indicate they are derived from assembled metagenomic fragments.
- Type V-A effectors were classified into 14 novel families sharing less than 30% average pairwise amino acid identity between each other, and with reference sequences (e.g., LbCasl2a, AsCasl2a, FnCasl2a).
- effectors contained RuvC and alpha- helical recognition domains, as well as conserved DED nuclease catalytic residues from the RuvCI/CII/CIII domains (identified in multiple sequence alignments, see e.g. Table 1 A below), suggesting that these effectors were active nucleases (FIG. 5-FIG. 7).
- the novel Type V-A nucleases range in size from ⁇ 800 to 1,400 amino acids in length (see FIG. 5A) and their taxonomic classification spanned a diverse array of phyla (see FIG. 4A) suggesting possible horizontal transfer.
- Type V-A prime V-A prime
- Type V-A MG26- 2
- MG26-2 which shared only 16.6% amino acid identity with the Type V-A MG26-1, was encoded in the same CRISPR Cas operon, and may share the same crRNA with MG26-1 (FIG. 7B).
- MG26-2 contained three RuvC catalytic residues identified from multiple sequence alignments (FIG. 7B).
- Example 3 PAM Sequence identification/confirmation [00261] PAM sequences that could be cleaved in vitro by a CRISPR effector were identified by incubating an effector with a crRNA and a plasmid library having 8 randomized nucleotides located adjacent to the 5’ end of a sequence complementary to the spacer of the crRNA. If the 8 randomized nucleotides formed a functional PAM sequence, the plasmid would be cleaved. Functional PAM sequences were then identified by ligating adapters to the ends of cleaved plasmids and then sequencing DNA fragments comprising the adapters. Putative endonucleases were expressed in an E. coli lysate-based expression system (myTXTL, Arbor Biosciences). An
- E. coli codon optimized nucleotide sequence encoding the putative nuclease was transcribed and translated in vitro from a PCR fragment under control of a T7 promoter.
- a second PCR fragment with a minimal CRISPR array composed of a T7 promoter followed by a repeat-spacer-repeat sequence was transcribed in the same reaction.
- Successful expression of the endonuclease and repeat-spacer-repeat sequence followed by CRISPR array processing provided active in vitro
- a library of target plasmids containing a spacer sequence matching that in the minimal array preceded by 8N (degenerate) bases (potential PAM sequences) was incubated with the output of the TXTL reaction. After 1-3 hours, the reaction was stopped and the DNA was recovered via a DNA clean-up kit, e.g., Zymo DCC, AMPure XP beads, QiaQuick etc. Adapter sequences were blunt-end ligated to DNA fragments with active PAM sequences that had been cleaved by the endonuclease, whereas DNA that had not been cleaved was inaccessible for ligation.
- a DNA clean-up kit e.g., Zymo DCC, AMPure XP beads, QiaQuick etc.
- DNA segments comprising active PAM sequences were then amplified by PCR with primers specific to the library and the adapter sequence.
- the PCR amplification products were resolved on a gel to identify amplicons that corresponded to cleavage events.
- the amplified segments of the cleavage reaction were also used as templates for preparation of an NGS library or as a substrate for Sanger sequencing. Sequencing this resulting library, which was a subset of the starting 8N library, revealed sequences with PAM activity compatible with the CRISPR complex.
- PAM testing with a processed RNA construct the same procedure was repeated except that an in vitro transcribed RNA was added along with the plasmid library and the minimal CRISPR array template was omitted.
- Example 4 PAM Sequence identification/confirmation for endonucleases described herein [00263] PAM requirements were determined via an E. coli lysate-based expression system (myTXTL, Arbor Biosciences), with modifications. Briefly, the A. coli codon optimized effector protein sequences were expressed under control of a T7 promoter at 29°C for 16 hours. This crude protein stock was then used in an in vitro digest reaction at a concentration of 20% of the final reaction volume.
- the reaction was incubated for 3 hours at 37°C with 5 nM of a plasmid library consisting of a constant target sequence preceded by 8N mixed bases, and 50 nM of in vitro transcribed crRNA derived from the same CRISPR locus as the effector linked to a sequence complementary to the target sequence in NEB buffer 2.1 (New England Biolabs; NEB buffer 2.1 was selected in order to compare candidates with commercially available proteins).
- Protein concentration was not normalized in PAM discovery assays (PCR amplification signal provides high sensitivity for low expression or activity).
- the cleavage products from the TXTL reactions were recovered via clean up with AMPure SPRI beads (Beckman Coulter).
- the DNA was blunted via addition of K1 enow fragments and dNTPs (New England Biolabs). Blunt-end products were ligated with a 100-fold excess of double stranded adapter sequences and used as template for the preparation of an NGS library, from which PAM requirements were determined from sequence analysis.
- Raw NGS reads were filtered by Phred quality score > 20.
- the 28 bp representing the known DNA sequence from the backbone adjacent to the PAM was used as a reference to find the P AM-proximal region and the 8 bp adjacent were identified as the putative PAM.
- the distance between the PAM and the ligated adapter was also measured for each read. Reads that did not have an exact match to the reference sequence or adapter sequence were excluded.
- PAM sequences were filtered by cut site frequency such that only PAMs with the most frequent cut site ⁇ 2 bp were included in the analysis. This correction removed low levels of background cleavage that may occur at random positions due to the use of crude E. coli lysate.
- This filtering step can remove between 2% and 40% of the reads depending on the signal to noise ratio of the candidate protein, where less active proteins have more background signal.
- 2% of reads were filtered out at this step.
- the filtered list of PAMs was used to generate a sequence logo using Logomaker. These sequence logo depictions of PAMs are presented in FIGs. 20-24.
- R-AR duplex 1 and R-AR duplex 2 The crystal structure of a ternary complex of AacC2cl (Casl2b) bound to a sgRNA and a target DNA reveals two separate repeat-anti-repeat (R-AR) motifs in the bound sgRNA, denoted R-AR duplex 1 and R-AR duplex 2 (see FIG. 8 and FIG. 9 herein and Yang, Hui, Pu Gao, Kanagalaghatta R. Rajashankar, and Dinshaw J. Patel. 2016.
- Putative tracrRNA sequences for the CRISPR effectors disclosed herein were identified by searching for anti-repeat sequences in the surrounding genomic context of native CRISPR arrays, where the R-AR duplex 2 anti-repeat sequence occurs ⁇ 20 - 90 nucleotides upstream of (closer to the 5’ end of the tracrRNA than) the R-AR duplex 1 anti -repeat sequence.
- two guide sequences were designed for each enzyme. The first included both R-AR duplexes 1 & 2 (see for example SEQ ID NOs: 3636,
- this region may not be essential for cleavage.
- RNA folding of RNA sequences at 37°C was computed using the method of Andronescu 2007 (which is entirely incorporated by reference herein).
- Endonucleases are expressed as His-tagged fusion proteins from an inducible T7 promoter in a protease deficient A. coli B strain.
- Cells expressing the His-tagged proteins are lysed by sonication and the His-tagged proteins purified by Ni-NTA affinity chromatography on a HisTrap FF column (GE Lifescience) on an AKTA Avant FPLC (GE Lifescience).
- the eluate is resolved by SDS-PAGE on acrylamide gels (Bio-Rad) and stained with InstantBlue Ultrafast coomassie (Sigma-Aldrich). Purity is determined using densitometry of the protein band with
- Target DNAs containing spacer sequences and PAM sequences are constructed by DNA synthesis.
- a single representative sequence of spacer sequences and PAM sequences are constructed by DNA synthesis.
- the target DNAs are comprised of 2200 bp of linear DNA derived from a plasmid via PCR amplification with a PAM and spacer located 700 bp from one end. Successful cleavage results in fragments of 700 and 1500 bp.
- the target DNA, in vitro transcribed single RNA, and purified recombinant protein are combined in cleavage buffer (10 mM Tris, 100 mM NaCl, 10 mM MgCh) with an excess of protein and RNA and are incubated for 5 minutes to 3 hours, usually 1 hr. The reaction is stopped via addition of
- RNAse A and incubation at 60 minutes. The reaction is then resolved on a 1.2% TAE agarose gel and the fraction of cleaved target DNA is quantified in ImageLab software.
- E. coli lacks the capacity to efficiently repair double-stranded DNA breaks. Thus, cleavage of genomic DNA can be a lethal event. Exploiting this phenomenon, endonuclease activity is tested in E. coli by recombinantly expressing an endonuclease and a guide RNA (determined for example as in Example 6) in a target strain with spacer/target and PAM sequences integrated into its genomic DNA (determined for example as in Example 4) integrated into their genomic DNA are transformed with DNA encoding the endonuclease.
- Transformants are then made chemocompetent and are transformed with 50 ng of guide RNAs (e.g., crRNAs) either specific to the target sequence (“on target”), or non-specific to the target (“non target”). After heat shock, transformations were recovered in SOC for 2 hours at 37 °C. Nuclease efficiency is then determined by a 5-fold dilution series grown on induction media. Colonies are quantified from the dilution series in triplicate. A reduction in the number of colonies transformed with an on-target guide RNA compared to the number of colonies transformed with an off-target guide RNA indicates specific genome cleavage by the endonuclease.
- guide RNAs e.g., crRNAs
- the MG Cas effector is fused to a C-terminal SV40 NLS and a viral 2A consensus cleavable peptide sequence linked to a GFP tag (the 2A-GFP tag to monitor expression of the protein).
- the MG Cas effector is fused to two SV40 NLS sequences, one on the N-terminus and the other on the C-terminus.
- the NLS sequences comprise any of the NLS sequences described herein (for example SEQ ID NOs: 3938-3953).
- nucleotide sequences encoding the endonucleases are codon-optimized for expression in mammalian cells.
- a single guide RNA with a crRNA sequence fused to a sequence complementary to a mammalian target DNA is cloned into a second mammalian expression vector.
- the two plasmids are co-transfected into HEK293T cells.
- 72 hours after co-transfection DNA is extracted from the transformed HEK293T cells and used for the preparation of an NGS-library.
- Percent NHEJ is measured by quantifying indels at the target site to demonstrate the targeting efficiency of the enzyme in mammalian cells. At least 10 different target sites are chosen to test each protein’s activity.
- the MG Cas effector protein sequences were cloned into a mammalian expression vector with flanking N and C- terminal SV40 NLS sequences, a C-terminal His tag, and a 2A-GFP (e.g. a viral 2A consensus cleavable peptide sequence linked to a GFP) tag at the C terminus after the His tag (Backbone 1).
- nucleotide sequences encoding the endonucleases were the native sequence, codon-optimized for expression in E. coli cells or codon-optimized for expression in mammalian cells.
- the single guide RNA sequence (sgRNA) with a gene target of interest was also cloned into a mammalian expression vector.
- the two plasmids are co-transfected into HEK293T cells.
- Example 12 Characterization of MG29 family PAM Specificity, tracrRNA/sgRNA Validation
- the targeted endonuclease activity of MG29 family endonuclease systems was confirmed using the myTXTL system described in Example 3 and Example 8.
- PCR amplification of cleaved target plasmids yields a product that migrates at approximately 170 bp in the gel, as shown in FIG. 17.
- Amplification products were observed for MG29-1 with crRNA corresponding to SEQ ID NO: 3609 (see FIG. 17A, lane 7). Sequencing the PCR products revealed active PAM sequences for these enzymes as shown in [00276] Table 2 below.
- MG29-1 target loci were chosen to test locations in the genome with the PAM YYn (SEQ ID NO: 3871).
- the spacers corresponding to the chosen target sites were cloned into the sgRNA scaffold in the mammalian vector system backbone 1 described in Example 9. The sites are listed in
- Type V endonucleases e.g. MG28, MG29, MG30, MG31 endonucleases
- E coli lysate-based expression in the myTXTL kit as described in Example 3 and Example 8.
- a crRNA and a plasmid library containing a spacer sequencing matching the crRNA preceded by 8 degenerated (“N”) bases a 5’ PAM library
- the subset of the plasmid library with a functional PAM was cleaved. Ligation to this cut site and PCR amplification provided evidence of activity, demonstrated by the bands observed in the gel at 170 bp (FIG. 17B).
- Gel 1 (top panel, A) lanes are as follows: 1 (ladder; darkest band corresponds to 200 bp); 2: positive control (previously verified library); 3 (n/a); 4 (n/a); 5 (MG28-1); 6 (MG29-1); 7 (MG30-1); 8 (MG31-1); 9 (MG32-1); and 10 (Ladder).
- Gel 2 (bottom panel, B) lanes are as follows: 1 (ladder; darkest band corresponds to 200 bp); 2 (LbCpfl positive control); 3 (LbCpfl positive control); 4 (negative control); 5 (n/a); 6 (n/a); 7 (MG28-1); 8 (MG29-1); 9 (MG30-1); 10 (MG31-1); 11 (MG32-1).
- the PCR products were further subjected to NGS sequencing and the PAMs were collated into seqLogo (see e.g., Huber et al. Nat Methods. 2015 Feb; 12(2): 115-21) representations (FIG. 20).
- the seqLogo representation shows the 8 bp which are upstream (5') of the spacer labeled as positions 0-7.
- the PAMs are pyrimidine rich (C and T), with most sequence requirements 2-4 bp upstream of the spacer (positions 4-6 in the SeqLogo).
- the position immediately adjacent to the spacer may have a weaker preference, e.g. for “m” or “v” instead of “n”.
- Example 14 Targeted endonuclease activity in mammalian cells with MG31 nucleases
- MG31-1 target loci were chosen to test locations in the genome with the PAM TTTR (SEQ ID NO: 3875).
- the spacers corresponding to the chosen target sites were cloned into the sgRNA scaffold in the mammalian vector system backbone 1 described in [00286] Example 11.
- the sites are listed in Table 5 below.
- the activity of MG31-1 at various target sites is shown in Table 5 and FIG. 25.
- MG26-1 PAM YYn
- MG29-1 PAM YYn
- novel proteins described herein were tested in HEK293T cells for gene targeting activity. All candidates showed activity of over 5% NHEJ (background corrected) on at least one of ten tested target loci. MG29-1 showed the highest overall activity in NHEJ modification outcomes (FIG. 18B) and was active on the highest number of targets. Thus, this nuclease was selected for purified ribonucleoprotein complex (RNP) testing in HEK293 cells. RNP transfection of MG29-1 holoenzyme showed higher editing levels with RNP than plasmid-based transfection on 4 out of 9 targets, in some cases over 80% editing efficiency (FIG. 18C).
- RNP ribonucleoprotein complex
- Type V-A CRISPR were identified from metagenomes collected from a variety of complex environments and arranged into families. These novel Type V-A nucleases had diverse sequences and phylogenetic origins within and across families and cleaved targets with diverse PAM sites. Similar to other Type V-A nucleases (e.g. LbCasl2a, AsCasl2a, and FnCasl2a), the effectors described herein utilized a single guide CRISPR RNA (sgRNA) to target staggered double stranded cleavage of DNA, simplifying guide design and synthesis, which will facilitate multiplexed editing.
- sgRNA single guide CRISPR RNA
- Type V-A effectors described herein have a 4-nt loop guide more frequently than shorter or longer loops.
- the sgRNA motif of LbCpfl has a less common 5-nt, although the 4-nt loop was also observed previously for 16 Cpfl orthologs.
- An unusual stem- loop CRISPR repeat motif sequence, CCUGC[N3-4]GCAGG was identified for the MG61 family of Type V-A effectors.
- the high degree of conservation of the sgRNA with variable loop lengths in Type V-A may afford flexible levels of activity, as shown for proteins described herein. Taken together, these effectors are not close homologs to previously studied enzymes, and greatly expand the diversity of Type V-A-like sgRNA nucleases.
- Type V-A prime effectors V-A
- Both Type V-A and these Type V-A’ systems may share a CRISPR sgRNA but the Type V-A’ systems are divergent from Casl2a (FIG. 4).
- the CRISPR repeat associated with these prime effectors also folded into single guide crRNA with the UCUAC[N3-5]GUAGAU motif.
- Type V cmsl effector encoded next to a Type V-A nuclease, which required a single guide crRNA for cleavage activity in plant cells.
- Different CRISPR arrays were reported for each effector, while the Type V-A’ system described herein suggested that both Type V-A and V-A’ may require the same crRNA for DNA targeting and cleavage.
- both Type V-A and V-A’ effectors are distantly related based on sequence homology and phylogenetic analysis.
- Type V-A classification the prime effectors do not belong within the Type V-A classification, and warrant a separate Type V sub-classification
- PAMs determined for active Type V-A nucleases were generally thymine-rich, similar to previously described PAMs described for other Type V-A nucleases.
- MG29-1 requires a shorter YYN PAM sequence, which increases target flexibility compared to the four nucleotide TTTV PAM of LbCpfl.
- RNPs containing MG29-1 had higher activity in HEK293 cells compared to sMbCasl2a, which has a three-nucleotide PAM. .
- MG29-1 When testing the novel nucleases for in-vitro editing activity, MG29-1 exhibited comparable or better activity to other reported enzymes of the class. Reports of plasmid transfection editing efficiencies in mammalian cells using Casl2a orthologs indicate between 21% and 26% indel frequencies for guides with T-rich PAMs, and one out of 18 guides with CCN PAMs showed -10% activity in Mb3Casl2a ( Moraxella bovoculi AAX11_00205 Casl2a, see e.g. Wang et al. Journal of Cell Science 2020 133: jcs240705).
- MG29-1 activity in plasmid transfections appears greater than that reported for Mb3Casl2a for targets with TTN and CCN PAMs (see e.g. FIG. 18). Because the target sites for plasmid transfections have the same
- MG29-1 editing as RNP is much more efficient than via plasmid and is more efficient than AsCasl2a on two of seven target loci. Therefore,
- MG29-1 may be a highly active and efficient gene editing nuclease.
- Example 18 - MG29-1 induced editing of TRAC locus in T-cells [00296] The three exons of the T cell receptor alpha chain constant region (TRACA) were scanned for sequences matching an initial predicted 5’-TTN-3’ PAM preference of MG29-1 and single-guide RNAs with proprietary Alt-R modifications were ordered from IDT. All guide spacer sequences were 22 nt long. Guides (80 pmol) were mixed with purified MG29-1 protein (63 pmol), incubated for 15 minutes at room temperature.
- TRACA T cell receptor alpha chain constant region
- T cells were purified from PBMCs by negative selection using (Stemcell Technologies Human T cell Isolation Kit #17951) and activated by CD2/3/28 beads (Miltenyi T cell Activation/Expansion Kit #130-091-441). After four days of cell growth, each MG29-l/guide RNA mixture was electroporated into 200,000 T cells with a Lonza 4-D Nucleofector, using program EO-115 and P3 buffer. The cells were harvested seventy-two hours post-transfection, genomic DNA was isolated, and PCR amplified for analysis using high-throughput DNA sequencing using primers targeting the TRACA locus. The creation of insertions and deletions typical of NHEJ-based gene editing was quantified using a proprietary Python script (see FIG. 39).
- T cells were purified from PBMCs by negative selection using (Stemcell Technologies Human T cell Isolation Kit #17951) and activated by CD2/3/28 beads (Miltenyi T cell Activation/Expansion Kit #130-091-441). After four days of cell growth, each MG29-l/guide RNA mixture was electroporated into 200,000 T cells with a Lonza 4-D Nucleofector, using program EO-115 and P3 buffer. Seventy -two hours post-transfection, genomic DNA was harvested, and PCR amplified for analysis using high-throughput DNA sequencing. The creation of insertions and deletions typical of NHEJ-based gene editing was quantified using a proprietary Python script (see FIG. 40). Example 20 - Testing length of guide spacer for MG29-1
- T cells were purified from PBMCs by negative selection using (Stemcell Technologies Human T cell Isolation Kit #17951) and activated by CD2/3/28 beads (Miltenyi T cell Activation/Expansion Kit #130-091-441). After four days of cell growth, each MG29- 1/guide RNA mixture was electroporated into 200,000 T cells with a Lonza 4-D Nucleofector, using program EO-115 and P3 buffer. Seventy -two hours post-transfection, genomic DNA was harvested, and PCR amplified for analysis using high-throughput DNA sequencing. The creation of insertions and deletions typical of NHEJ-based gene editing was quantified using a proprietary Python script. The results are shown in FIG. 41, which demonstrates that guide spacer lengths of 20-24 nt work well, with a dropoff at 19 nt.
- Example 21 Determination of MG29-1 indel generation versus TCR expression
- Cells from FIG. 41 were analyzed for TCR expression by flow cytometry using the APC-labeled anti-human TCRa/b Ab (Biolegend #306718, clone IP26) and an Attune NxT flow cytometer (Thermo Fisher). Indel data are taken from FIG. 41.
- T cell receptor alpha chain constant region The three exons of the T cell receptor alpha chain constant region were scanned for sequences matching 5’-TTN-3’ and single-guide RNAs ordered from IDT using IDT’s proprietary Alt-R modifications. Guides (80 pmol) were mixed with purified MG29-1 protein (63 pmol), incubated for 15 minutes at room temperature. T cells were purified from PBMCs by negative selection using (Stemcell Technologies Human T cell Isolation Kit #17951) and activated by CD2/3/28 beads (Miltenyi T cell Activation/Expansion Kit #130-091-441).
- each MG29-l/guide RNA mixture was electroporated into 200,000 T cells with a Lonza 4-D Nucleofector, using program EO-115 and P3 buffer.
- 100,000 vector genomes of a serotype 6 adeno-associated virus (AAV-6) containing the coding sequence for a customized chimeric antigen receptor flanked by 5’ and 3’ homology arms (5’ arm SEQ ID NO: 4424 being about 500 nt in length and 3’ arm SEQ ID NO: 4425 being about 500 nt in length) targeting the TRAC gene were added to the cells immediately following transfection. Replicates were analyzed for TCR expression versus TRAC indels (FIG.
- AAV+MG29-1-35-22 The sgRNA 35 (SEQ ID NO: 4404) was somewhat more effective in inducing integration of the CAR than sgRNA 19 (SEQ ID NO: 4388). One possible explanation for the difference is that the predicted nuclease cut site for Guide 19 is -160 bp away from the end of the right homology arm.
- Hematopoietic stem cells were purchased from Allcells and thawed per the supplier’s instructions, washed in DMEM + 10% FBS, and resuspended in Stemspan II medium plus CC110 cytokines. One million cells were cultured for 72 hours in a 6-well dish in 4 mL medium. MG29-1 RNPs were made, transfected, and gene editing analyzed as in Example 18 except for use of the EO-100 nucleofection program. The results are shown in FIG. 56, which shows gene editing at TRAC in hematopoietic stem cells using the #19 (SEQ ID NO:4388) and #35 (SEQ ID NO: 4404) sgRNAs in Table 5B below. The results again indicate that the #35 sgRNA is highly effective at targeting the TRAC locus. Table 5C: Guide RNAs used in Example 23
- Example 24 Further analysis of PAM specificity associated with MG29-1
- Guide RNAs were designed using a 5’-NTTN-3’ PAM sequence and then sorted according to the gene editing activity observed (FIG. 45, in which the identity of the underlined base— the 5’-proximal N is shown for each bin). All of the guides with activity greater than 10% had a T at this position in the genomic DNA indicating that the MG29-1 PAM may be better described as 5’-TTTN-3 ⁇ The statistical significance of the over-representation of T at this position is shown for each bin. In FIG. 45, the various bins (High, medium, low, >1%, ⁇ 1%) signify:
- Example 25 Determining MG29-1 indel induction ability vs spacer base composition
- Example 27 Titration of modified MG29-1 guides from Example 26 [00305]
- a further experiment was performed to determine the dose dependence of the activity of the modified guides used in Example 26 to identify possible dose-dependent toxicity effects.
- the experiment was performed as in Example 26 but with l/4th (B), l/8th (C), l/16th (D), and l/32nd (E) of the starting dose (A, 126 pmol MG29-1 and 160 pmol guide RNA). The results are presented in FIG. 48).
- MG29-1 from the pMG450 vector depicted in FIG. 49 is tested while varying the following conditions: host strain, expression media, inducer, induction time, and temperature.
- Total soluble protein extracted from E. coli cell paste is analyzed by SDS-PAGE for all conditions.
- Immobilized metal affinity chromatography (IMAC) pull-down followed by SDS- PAGE is performed on the top three expression conditions to estimate yield and purity and to identify the optimal expression condition.
- a scaled-up method is developed for lysis. Critical parameters are identified for purification by IMAC and subtractive IMAC (including tobacco etch virus protease (TEV) cleavage). Column fractions are tested using SDS-PAGE. Elution pools are tested using SDS- PAGE and photometric absorbance at 280 nm (A280).
- a method for buffer exchange and concentration by tangential flow filtration (TFF) is developed.
- An additional chromatography step is developed to achieve >90% purity, if necessary.
- One chromatography mode is tested (e.g., ceramic hydroxyapatite chromatography). Up to 8 unique conditions are tested (e.g., 2-6 resins each with 2-3 buffer systems). Column fractions are tested using SDS-PAGE. Elution pools are tested using SDS- PAGE and A280. One condition is selected, and a three-condition load study is performed. Column fractions and elution pools are analyzed as described above. A method for buffer exchange may be developed and concentration by TFF.
- Transform E. coli prepare culture in shake flasks and induce using materials and methods according to the optimal expression conditions identified during the expression screen. Harvest cell paste and verify expression by SDS-PAGE. Report results and use cell paste as starting material for purification. Cell culture volume is limited to 20L. Purify up to 1 gram of protein using methods developed during downstream method development. Formulate into final storage buffer and perform the following QC tests: Yield and concentration by A280 and purity by SDS-PAGE.
- a formulation study is conducted to determine the optimal storage conditions for the purified protein. Study may explore concentration, storage buffer, storage temperature, maximum freeze/thaw cycles, storage time, or other conditions.
- Example 29 Demonstration of the ability of nucleases described herein to edit an intronic region in cultured mouse liver cells
- Intronic regions of expressed genes are attractive genomic targets to integrate a coding sequence of a therapeutic protein of interest with the goal of expressing that protein to treat or cure a disease.
- Integration of a protein coding sequence may be accomplished by creating a double strand break within the intron using a sequence specific nuclease in the presence of an exogenously supplied donor template.
- the donor template may be integrated into the double strand break via one of two main cellular repair pathways called homology directed repair (HDR) and non-homologous end joining (NHEJ) resulting in targeted integration of the donor template.
- HDR homology directed repair
- NHEJ non-homologous end joining
- the NHEJ pathway is dominant in non-dividing cells while the HDR pathway is primarily active only in dividing cells.
- the liver is a particularly attractive tissue for targeted integration of a protein coding sequence due to the availability of in vivo delivery systems and the ability of the liver to express and secrete proteins with high efficiency.
- sgRNA Single guide RNA
- KTTG SEQ ID NO: 3870
- the spacer sequences of these 112 guides were searched against the mouse genome and a specificity score was assigned by the software based on the alignment to additional sites in the genome. Spacer sequences with 4 or more contiguous bases of the same base were excluded due to concerns about specificity. A total of 12 spacers with the highest specificity scores were selected for testing.
- To create the sgRNA the backbone sequence of “TAATTTCTACTGTTGTAGAT” was added to the 3’ end of the spacer sequence.
- the sgRNA was chemically synthesized incorporating chemically modified bases known to improve the performance of sgRNA for cpfl guides (AltRl/AltR2 chemistry available from Integrated DNA Technologies). The spacer sequences of these guides are listed in Table 8 below.
- Hepal-6 cells a transformed mouse liver cell line, were cultured under standard conditions (DMEM media with 10% FBS in 5% C02 incubator) and nucleofected with ribonuclear proteins formed by mixing the sgRNA and purified MG29-1 protein in PBS buffer.
- Hepal-6 cells (lxlO 5 ) in suspension in complete SF nucleofection reagent (Lonza) were nucleofected using a 4D nucleofection device (Lonza) with RNP formed by mixing 50 pmol of MG29-1 protein and 100 pmol of sgRNA. After nucleofection the cells were plated in 24 well plates in DMEM plus 10% FBS and incubated in a 5% C02 incubator for 48 to 72 h.
- Genomic DNA was then extracted from the cells using a column-based purification kit (Purelink genomic DNA mini kit, ThermoFisher Scientific) and quantified by absorbance at 260 nm.
- the albumin intron 1 region was PCR amplified from 50 ng of the genomic DNA in a reaction containing 0.5 micro molar each of the primers mAlb90F (CTCCTCTTCGTCTCCGGC) (SEQ ID NO: 4031) and mAlbl073R (CTGCCACATTGCTCAGCAC) (SEQ ID NO: 4032) and 1 x Pfusion Flash PCR Master Mix.
- the resulting 984 bp PCR product which spans the entire intron 1 of mouse albumin was purified using a column-based purification kit (DNA Clean and Concentrator, Zymo Research) and sequenced using primers located within 150 to 350 bp of the predicted target site for each sgRNA.
- a PCR product generated using primers mAlb90F (SEQ ID NO: 4031) and mAlbl073R (SEQ ID NO: 4032) from un-transfected Hepal-6 cells was sequenced in parallel as a control.
- a nuclease creates a double strand break (DSB) in DNA inside a living cell the DSB is repaired by the cellular DNA repair machinery.
- this repair occurs by the NHEJ pathway.
- the NHEJ pathway is an error prone process that introduces insertions or deletions of bases at the site of the double strand break (Lieber, M.R, Annu Rev
- insertions and deletions are therefore a hallmark of a double strand break that occurred and was subsequently repaired, is widely used as a readout of the editing or cutting efficiency of the nuclease.
- the profile of insertions and deletions depends on the characteristics of the nuclease that created the double strand break but also upon the sequence context at the cleavage site. Based on in vitro assays, the MG29-1 nuclease creates a staggered cut located 3’ of the PAM. Staggered cuts will often lead to larger deletions due to the trimming of the single stranded ends prior to end-joining.
- Table 8 lists the total INDEL frequency generated by each of the 19 sgRNA targeting mouse albumin intron 1 that were tested in Hepal-6 cells. Eleven of the 18 sgRNA resulted in detectable INDELS at the target site with 5 sgRNA resulting in INDEL frequencies greater than 50% and 4 sgRNA resulted in indel frequencies greater than 75%. These data demonstrate that the MG29-1 nuclease can edit the genome of cultured mouse liver cells at the predicted target site for the sgRNA with efficiencies greater than
- the editing efficiencies of the same set of sgRNA were evaluated by co-transfection of the sgRNA and a mRNA encoding the MG29-1 nuclease using a commercial lipid-based transfection reagent (Lipofectamine MessengerMAX, Invitrogen).
- the mRNA encoding MG29-1 was generated by in vitro transcription using T7 polymerase from a plasmid in which the coding sequence of MG29-1 was cloned.
- the MG29-1 coding sequence was codon optimized using human codon usage tables and flanked by nuclear localization signals derived from SV40 at the N-terminus and from Nucleoplasmin at the C-terminus.
- a UTR was included at the 3’ end of the coding sequence to improve translation.
- a 3’ UTR followed by an approximately 90 to 110 nucleotide poly A tract was included at the 3’ end of the coding sequence to improve mRNA stability in vivo (see e.g. SEQ D NO: 4426 for wild-type MG29-1 and SEQ D NO: 3327 for the S168R variant).
- the in vitro transcription reaction included the Clean Cap® capping reagent (Trilink BioTechnologies) and the resulting RNA was purified using the MEGAClearTM Transcription Clean-Up kit (Invitrogen) and purity was evaluated using the TapeStation (Agilent) and found to be composed of >90% full length RNA. As seen in
- FIG. 50 is a representative example of the indel profile of MG29-1 as determined by ICE analysis using mALb29-l-8 as the guide (SEQ ID NO: 3999) and demonstrates that deletion of 4 bases was the most frequent event (25% of total sequences) and deletions of 1, 5, 6, or 7 bases each accounting for about 10 to 15% of the sequences. Longer deletions of up to 13 bases were also detected, but insertions were undetectable. By contrast, spCas9 with a guide targeting mouse albumin intron 1 generated primarily 1 base insertions or deletions. [00319] FIG.
- NGS next generation sequencing
- NGS deletion of 4 bases was the most frequent indel (about 20% of total) with deletions of 1, 5, 6 and 7 bases each accounting for about 10% of the indels. Larger deletions of up to 19bp were also detected.
- the profile observed by NGS analysis matches closely that measured by ICE.
- Example 30 Demonstration of the ability of a nuclease described herein to target an intronic region in cultured human liver cells (HepG2)
- the intron 1 of human serum albumin was selected as the target locus.
- Single guide RNA sgRNA with a spacer length of 22 nt targeted to human albumin intron 1 were identified using the guide finding algorithm in the Geneious Prime nucleic acid analysis software (https://www.geneious.com/prime/).
- PAM of KTTG SEQ ID NO: 3870 located 5’ to the spacer, a total of 90 potential sgRNA were identified within human albumin intron 1. Guides that spanned the intron/exon boundaries were excluded.
- the spacer sequences of these guides were searched against the mouse genome and a specificity score was assigned by the software based on the alignment to additional sites in the genome. Spacer sequences with 4 or more contiguous bases of the same base were excluded due to concerns about specificity. A total of 23 spacers with the highest specificity scores were selected for testing.
- To create the sgRNA the backbone sequence of “TAATTTCTACTGTTGTAGAT” was added to the 3’ end of the spacer sequence.
- the sgRNA was chemically synthesized incorporating chemically modified bases known to improve the performance of sgRNA for cpfl guides (AltRl/AltR2 chemistry available from Integrated DNA Technologies). The spacer sequences of these guides are listed in [00321] Table 9.
- HepG2 cells a transformed human liver cell line, were cultured under standard conditions (MEM media with 10% FBS in 5% C02 incubator) and nucleofected with ribonuclear proteins formed by mixing the sgRNA and purified MG29-1 protein in PBS buffer.
- a total of 1 e5 HepG2 cells in suspension in complete SF nucleofection reagent (Lonza) were nucleofected using a 4D nucleofection device (Lonza) with RNP formed by mixing 80 pmol of MG29-1 protein and 160 pmol of sgRNA. After nucleofection the cells were plated in 24 well plates in DMEM plus 10% FBS and incubated in a 5% CO2 incubator for 48 to 72 h.
- Genomic DNA was then extracted from the cells using a column-based purification kit (Purelink genomic DNA mini kit, ThermoFisher Scientific) and quantified by absorbance at 260 nm.
- the albumin intron 1 region was PCR amplified from 50 ng of the genomic DNA in a reaction containing 0.5 micro molar each of the primers hAlb 1 IF (TCTTCTGTCAACCCCACACGCC) (SEQ ID NO: 4079) and hAlb 834R (CTTGTCTGGGCAAGGGAAGA) (SEQ ID NO: 4080) and 1 x Pfusion Flash PCR Master Mix.
- the resulting 826 bp PCR product which spans the entire intron 1 of mouse albumin was purified using a column-based purification kit (DNA Clean and Concentrator, Zymo Research) and sequenced using primers located within 150 to 350 bp of the predicted target site for the sgRNA.
- INDEL profile When a nuclease creates a double strand break (DSB) in DNA inside a living cell the DSB is repaired by the cellular DNA repair machinery. In actively dividing cells such as transformed mammalian cells in culture, and in the absence of a repair template, this repair occurs by the NHEJ pathway.
- the NHEJ pathway is an error prone process that introduces insertions or deletions of bases at the site of the double strand break (Lieber, M.R, Annu Rev
- insertions and deletions are therefore a hallmark of a double strand break that occurred and was subsequently repaired, and is widely used as a readout of the editing or cutting efficiency of the nuclease.
- the profile of insertions and deletions depends on the characteristics of the nuclease that created the double strand break but also upon the sequence context at the cleavage site.
- the MG29-1 nuclease cleaves the target strand at 22 nucleotides from the PAM (less frequently at 21 nucleotides from the PAM) and cleaves the non target strand at 18 nucleotides from the PAM which therefore creates 4 nucleotide staggered end located 3’ of the PAM. Staggered cuts will often lead to larger deletions due to the trimming of the single stranded ends prior to end-joining.
- Table 9 lists the total indel frequency generated by each of the 23 sgRNA targeting human albumin intron 1 that were tested in HepG2 cells. Sixteen of the 23 sgRNA resulted in detectable indel at the target site with 8 sgRNA resulting in INDELS greater than 50% and 5 sgRNA resulted in indel frequencies than 90%. These data demonstrate that the MG29-1 nuclease can edit the genome of a cultured human liver cell line at the predicted target site for the sgRNA with efficiencies greater than 90%.
- Example 31 Demonstration of the ability of nucleases described herein to edit exonic regions in cultured mouse liver cells
- Sequence specific nucleases can be used to disrupt the coding sequences of genes and thereby create a functional knockout of a protein of interest. This can be of therapeutic use when the knockdown of a specific protein has a beneficial effect in a particular disease.
- One way to disrupt the coding sequence of a gene is to make a double strand break within the exonic regions of the gene using a sequence specific nuclease. These double strand breaks will be repaired via error prone repair pathways to generate insertions or deletions which can result in either frameshift mutations or changes to the amino acid sequence which disrupt the function of the protein.
- sgRNA Single guide RNA
- the first 4 exons of the hao-1 gene comprise approximately the N-terminal 50% of the hao-1 coding sequence.
- the first 4 exons were chosen because INDELS created towards the N-terminus of the coding sequence of a gene are more likely to create a frameshift or missense mutation that disrupts the activity of the protein.
- a PAM of KTTG SEQ ID NO: 3870 located 5’ to the spacer, a total of 45 potential sgRNAs were identified within mouse hao-1 exons 1 through 4. Guides that spanned the intron/exon boundaries were included because such guides may create INDELS that interfere with splicing.
- the spacer sequences of these 45 guides were searched against the mouse genome and a specificity score was assigned by the software based on the alignment to additional sites in the mouse genome. Spacer sequences with 4 or more contiguous bases of the same base were excluded due to concerns about specificity. A total of 45 spacers with the highest specificity scores were selected for testing.
- TAATTTCTACTGTTGTAGAT was added to the 3’ end of the spacer sequence.
- the sgRNA was chemically synthesized incorporating chemically modified bases known to improve the performance of sgRNA for cpfl guides (AltRl/AltR2 chemistry available from Integrated DNA Technologies).
- the spacer sequences of these guides are listed in Table 10.
- Hepal-6 cells a transformed mouse liver cell line, were cultured under standard conditions (DMEM media with 10% FBS in 5% CO2 incubator) and nucleofected with ribonuclear proteins formed by mixing the sgRNA and purified MG29-1 protein in PBS buffer.
- a total of 1 e 5 Hepal-6 cells in suspension in complete SF nucleofection reagent (Lonza) were nucleofected using a 4D nucleofection device (Lonza) with RNP formed by mixing 50 pmol of MG29-1 protein and 100 pmol of sgRNA. After nucleofection the cells were plated in 24 well plates in DMEM plus 10% FBS and incubated in a 5% C02 incubator for 48 to 72 h.
- Genomic DNA was then extracted from the cells using a column-based purification kit (Purelink genomic DNA mini kit, ThermoFisher Scientific) and quantified by absorbance at 260 nm.
- Exons 1 through 4 of the mouse hao-1 gene 1 were PCR amplified from 40 ng of the genomic DNA in a reaction containing 0.5 micro molar pairs of the primers specific for each exon.
- the PCR primers used for exon 1 were PCR_mHEl_F_+233 (GTGACCAACCCTACCCGTTT) (SEQ ID NO:
- PCR mHE 1 _R_-553 (GCAAGCACCTACTGTCTCGT) (SEQ ID NO: 4172).
- the PCR primers used for exon 2 were HA01 E2 F5721 (CAACGAAGGTTCCCTCCAGG) (SEQ ID NO: 4172).
- HA01 E2 R6271 (GGAAGGGTGTTCGAGAAGGA) (SEQ ID NO: 4174).
- PCR primers used for exon 3 were HA01 E3 F23198 (TGCCCTAGACAAGCTGACAC) (SEQ ID NO: 1
- HA01 E3 R23879 (CAGATTCTGGAAGTGGCCCA) (SEQ ID NO: 4176).
- PCR primers used for exon 4 were HA01 E4 F31087 (CCTGTAGGTGGCTGAGTACG) (SEQ ID NO: 1
- HAO1 E4 R31650 AGGTTTGGTTCCCCTCACCT (SEQ ID NO: 4178).
- PCR Master Mix (Thermo Fisher).
- the resulting PCR products comprised single bands when analyzed on agarose gels demonstrating that the PCR reaction was specific, and were purified using a column-based purification kit (DNA Clean and Concentrator, Zymo Research).
- DNA Clean and Concentrator Zymo Research
- primers complementary to sequences at least lOOnt from each cut site were used.
- the primer to sequence Exon 1 was Seq_mHEl_F_+139
- the primer to sequence Exon 2 was 5938F Seq_HA01_E2 (CT AT GC A AGGA A A AGATTT GGC C) (SEQ ID NO: 4180).
- the primers to sequence Exon 3 were HA01 E3 F23476 (TCTTCCCCCTTGAATGAAACACT) (SEQ ID NO: 4181) and the reverse PCR primer, HA01 E3 R23879
- PCR products derived from Hepa-16 cells nucleofected with different RNP or untreated controls were sequenced using primers located within 100 to 350 bp of the predicted target site for each sgRNA.
- the Sanger sequencing chromatograms were analyzed using Inference of CRISPR Edits (ICE) that determines the frequency of INDELS as well as the INDEL profile (Hsiau et. al, Inference of CRISPR Edits from Sanger Trace Data. BioArxiv. 2018 https://www.biorxiv.org/content/early/2018/01/20/251082).
- ICE Inference of CRISPR Edits
- a nuclease creates a double strand break (DSB) in DNA inside a living cell the DSB is repaired by the cellular DNA repair machinery.
- this repair occurs by the NHEJ pathway.
- the NHEJ pathway is an error prone process that introduces insertions or deletions of bases at the site of the double strand break (Lieber, M.R, Annu Rev Biochem. 2010; 79: 181-211). These insertions and deletions are therefore a hallmark of a double strand break that occurred and was subsequently repaired, and is widely used in the art as a readout of the editing or cutting efficiency of the nuclease.
- 14 guides demonstrated detectable editing at their predicted target sites.
- Example 32 Design of further sgRNAs for disruption of Hao-1 gene
- Further sgRNAs were designed to target exonic parts of the hao-1 gene. These are designed to target the first 4 exons because these comprise approximately 50% of the coding sequence and indels created towards the N-terminus of the coding sequence of a gene are more likely to create a frameshift or missense mutation that disrupts the activity of the protein.
- PAM of KTTG SEQ ID NO: 3870
- Example 33 Comparison of the editing potency of nucleases described herein to that of spCas9 in mouse liver cells
- the CRISPR Cas9 nuclease from the bacterial species Streptococcus pyogenes is widely used for genome editing and is among the most active RNA guided nucleases identified.
- the relative potency of MG29-1 compared to spCas9 was evaluated by nucleofection of different doses of RNP in the mouse liver cell line Hepal-6.
- sgRNA targeting intron 1 of mouse albumin were used for both nucleases.
- MG29-1 the sgRNA mAlb29-l-8 identified in Example 29 was selected.
- Guide mAlb29-l-8 was chemically synthesized incorporating chemically modifications called AltRl/AltR2 (Integrated DNA Technologies) designed to improve the potency of guides for the Type V nuclease cpfl that has a similar sgRNA structure as MG29-1.
- AltRl/AltR2 Integrated DNA Technologies
- spCas9 a sgRNA that efficiently edited mouse albumin intron 1 was identified by testing 3 guides selected from an in-silico screen.
- the spCas9 protein used in these studies was obtained from a commercial supplier (Integrated DNA technologies AltR- sPCas9).
- the sgRNA mAlbRl spacer sequence TTAGTATAGCATGGTCGAGC
- the mAlbRl sgRNA generated INDELS at a frequency of 90% when RNP comprised of 20 pmol spCas9 protein/50 pmol of guide was nucleofected into Hepal-6 cells indicating that this is a highly active guide.
- RNP formed with a range of nuclease protein from 20 pmoles to 1 pmole and a constant ratio of protein to sgRNA of 1 :2.5 were nucleofected into Hepal-6 cells.
- INDELS at the target site in mouse albumin intron 1 were quantified using Sanger sequencing of the PCR amplified genomic DNA and ICE analysis.
- the results shown in FIG. 52 demonstrate that MG29-1 generated a higher percentage of INDELS than spCas9 at lower RNP doses when the editing was not saturating. These data indicate that MG29-1 is at least as active and potentially more active than spCas9 in liver-derived mammalian cells.
- Example 34 Engineering sequence variants of nucleases described herein and evaluation in mouse liver cells
- plasmid encoding the guide 400ng were mixed with Lipofectamine 3000, added to Hepal-6 cells and incubated for 3 days prior to genomic DNA isolation.
- Guide 35 TRAC was ordered with the same modifications as mentioned before. Genomic DNA and PCR amplification was performed as described in the previous example for MG29-1 editing of mouse albumin intron 1.
- the human TRAC locus was amplified with Primer F: TGCTTTGCTGGGCCTTTTTC (SEQ ID NO: 4269), Primer R: AC AGTCTGAGC AAAGGC AGG (SEQ ID NO: 4270).
- the resulting 957bp PCR product was purified as described previously. Editing was assessed by Sanger sequencing using primer ATCACGAGCAGCTGGTTTCT (SEQ ID NO: 4271).
- the single amino acid substitution S168R conferred higher editing efficiency across the different concentrations of mRNA tested with guide mAlb29- 1-8 (FIG. 53B).
- the double amino acid substitutions of S168R with E172R (substitution that did not impair activity alone as seen in FIG. 53A), or N577R (a substitution not tested in MG29-1 plasmid transfection but conferred higher editing efficiency of cpfl) and Y170R (which it was hypothesized might improve editing efficiency based on the predicted MG29-1 protein structure) were tested and compared to the single S168R mutant.
- RNA molecules are inherently unstable in biological systems due to their sensitivity to cleavage by nucleases. Modification of the native chemical structure of RNA has been widely used to improve the stability RNA molecules used for RNA interference (RNAi) in the context for therapeutic drug development (Corey, J Clin Invest. 2007 Dec 3; 117(12): 3615-3622, J.B. Bramsen, J. Kjems Frontiers in Genetics, 3 (2012), p. 154).
- RNAi RNA interference
- the MG29-1 nuclease is a novel nuclease with limited amino acid sequence similarity to known Type V CRISPR enzymes such as cpfl . While the sequence of the structural (backbone) component of the guide RNA identified for MG29-1 is similar to that of cpfl it was not known what chemical modifications to the MG29-1 guide will enable improved stability while retaining activity. A series of chemical modifications of the MG29-1 sgRNA were designed in order to evaluate their impact on sgRNA activity in mammalian cells and stability in the presence of mammalian cell protein extracts. [00344] We selected the sgRNA mAlb29-l-8 which was highly active in the mouse liver cell line
- IDT IDT
- T -O-Methyl in which the T hydroxyl group is replaced with a methyl group
- T - fuoro in which the T hydroxyl group is replaced with a fluorine.
- Both 2’-0-Methyl and 2’-fluoro modifications improve resistance to nucleases.
- the 2’-0-methyl modification is a naturally occurring post-transcriptional modification of RNA and improves the binding affinity of
- RNA:RNA duplexes but has little impact on RNA:DNA stability. 2’-fluoro modified bases have reduced immunostimulatory effects and increase the binding affinity of both RNA: RNA and
- RNA:DNA hybrids (Pallan et al Nucleic Acids Res 2011 Apr;39(8):3482-95, Chen et al
- PS linkages improve resistance to nucleases (Monia et al Nucleic Acids, Protein Synthesis, and Molecular Genetics
- FIG. 54 The predicted secondary structure of the MG29-1 sgRNA with the spacer targeting mouse albumin intron 1 (mAlb29-l-8) is shown in FIG. 54.
- the stem-loop in the backbone portion of the guide was presumed to be critical for interaction with the MG29-1 protein based on what is known about other CRISPR-cas systems. Based on the secondary structure a series of chemical modifications was designed in different structural and functional regions of the guide.
- the structural and functional regions were defined as follows.
- the 3’ end and 5’ end of the guide are targets for exonucleases and can be protected by various chemical modifications including T -O-methyl and PS linkages, an approach that has been used to improve the stability of guides for spCas9 (Hendel et al, Nat Biotechnol. 2015 Sep; 33(9): 985-989).
- the guide and the MG29-1 protein are pre- complexed in a tube and then delivered to the cell using nucleofection in which an electric current is applied to the cells’ suspension in the presence of the RNP.
- the electric current transiently opens pores in the cell membrane (and possibly the nuclear membrane as well) enabling cellular entry of the RNP driven by the charge on the RNP. Whether the RNP enters the nucleus via pores created by the electric current or via the nuclear localization signals engineered in the protein component of the RNP, or a combination of the two is unclear.
- lipid transfection reagent such as Messenger MAX
- the mixture of the two RNA forms a complex with the positively charged lipid and the complex enters the cells via endocytosis and eventually reaches the cytoplasm.
- the mRNA is translated into protein.
- an RNA guided nucleases such as MG29-1
- the resulting MG29-1 protein will presumably form a complex with the guide RNA in the cytoplasm before entering the nucleus in a process mediated by the nuclear localization signals that were engineered into the MG29-1 protein.
- lipid-based mRNA/sgRNA co-transfection may require a more stable guide than is the case for RNP nucleofection which may result in some guide chemistries being active as RNP but inactive when co transfected with mRNA using cationic lipid reagents.
- Guides mAlb298-l to mAlb298-5 contain chemical modifications only on the 5’ and 3’ ends of the sequence using a mixture of 2’ -O-methyl and 2’ fluoro bases plus PS linkages. In comparison to the sgRNA without chemical modifications these guides were 7 to 11 -fold more active when delivered via RNP demonstrating that end modifications to the guide improved guide activity, presumably through improved resistance to exonucleases. sgRNA mAlb298-l to mAlb298-5 exhibited 64 to 114% of the editing activity of the guide containing the commercial chemical modifications (AltRl/AltR2).
- Guide 4 which contains the largest number of chemical modifications, was the least active of the end modified guides but was still 7-fold more active than the un-modified guide.
- Guide mALB298-30 contains three 2’-0 methyl bases and 2 PS linkages at the 5’ end and 42’-0 methyl bases and 3 PS linkages at the 5’ end and also exhibited activity about 10-fold higher than the unmodified guide and similar or slightly improved in the case of RNA co-transfection compared to mAlb298-l.
- Guide mALb298-28 contains three 2'-fluoro bases and 2 PS linkages on the 5’ end and four 2’-fluoro bases and three PS linkages on the 3’ end.
- This end modified guide retained good editing activity similar to the guides with 2’-0 methyl and PS modifications on both ends demonstrating that 2’-fluoro can be used in place of 2’-0 methyl to improve guide stability and retain editing activity.
- the sgRNAs mALb298-6, mALb298-7, and mALb298-8 contain the same minimal chemical modifications on the both 5’ and 3’ ends present in mAlb298-l plus PS linkages in different regions of the stem.
- PS linkages in the 3’ stem (mALb298-6) and the 5’ stem (mALb298-7) reduced activity by about 30% compared to mAlb298-l in the RNP nucleofection assay, indicating that these modifications could be tolerated. Larger reductions in activity were observed by lipid-based transfection.
- the sgRNA mAlb298-9 contains the same minimal chemical modifications on the both 5’ and 3’ ends present in mAlb298-l plus PS linkages in the loop and exhibited similar activity as mAlb298-l indicating that PS linkages in the loop were well tolerated.
- the sgRNAs mAlb298-10, mAlb298-l 1, and mAlb298-12 contain the same minimal chemical modifications on the both 5’ and 3’ ends present in mAlb298-l plus 2’-0 methyl bases in different regions of the stem. Including 2’-0 methyl bases in either the 3’ stem (mAlb298-l 1) or the 5’ stem (mAlb298-12) or both halves of the stem (mAlb298-10) was generally well tolerated with only small reductions in activity compared to mAlb298-l with guide mAlb298-12 (5’ stem modified) being the most active.
- Guide mAlb298-14 contains the same minimal chemical modifications on the both 5’ and 3’ ends present in mAlb298-l plus a combination of 2’-0-methyl bases and PS linkages in both halves of the stem and had no editing activity by RNP nucleofection or by lipid-based RNA co-transfection. This confirms and extends the result with mAlb298-8 that contained only PS linkages in both stems had retained low levels of activity and shows that extensive chemical modification of both halves of the stem makes the guide inactive.
- the sgRNA mAlb298-13 contains the same minimal chemical modifications on the both 5’ and 3’ ends present in mAlb298-l plus PS linkages spaced every other base throughout the remainder of the backbone and spacer except for in the seed region of the spacer. These modifications resulted in a dramatic loss of editing activity to close to background levels. While the purity of this guide was only about 50% compared to >75% for most of the guides, this alone could not have caused the complete loss of editing activity. Thus, distributing PS linkages in an essentially random fashion throughout the guide is not an effective approach to improve guide stability while retaining editing activity.
- Guide mAlb298-19 contains the same chemical modifications in the spacer as mALb298-l but in the backbone region the 5’ end has additional 42O-methyl bases and an additional 14 PS linkages.
- the activity of mAlb298-19 was about 40% of that of mAlb298-l by RNP nucleofection but only 22% by RNA co-transfection demonstrating again that extensive chemical modifications in the backbone region of the guide are not well tolerated.
- Guides mAlb298-20, mAlb298-21, mAlb298-22, and mAlb298-23 have identical chemical modifications in the backbone region comprised of a single 2’-0 methyl and 2 PS linkages at the 5’ end which are the same 5’ end modifications as in mAlb298-l.
- the spacer regions of Guides mAlb298-20, mAlb298-21, mAlb298-22, and mAlb298-23 contain combinations of 2’-0-methyl and 2’-fluoro bases as well as PS linkages.
- mALb298-37 combines more extensive 3’ end modifications with 2’-0 methyl bases in the 5’ stem, PS linkages in the loop and 142’fluro bases and 3 PS linkages in the spacer (excluding the seed region) and still retained editing activity similar to that of the AltRl/R2 modifications and significantly improved compared to the unmodified guide.
- mALb298-37 thus represents a heavily modified MG29-1 guide that retains potent editing activity in mammalian cells.
- Guide mALb298-38 exhibited potent editing activity when delivered as a RNP but was completely inactive when delivered to cells by lipid-based RNA co-transfection suggesting that thus guide may have some unexpected sensitivity to nucleases.
- Guide mALb298-39 which is identical to guide mAlb298-37 except that it has 11 fewer 2’-fluro bases and 1 less PS linkage in the spacer had the highest editing activity when considering both RNP and mRNA transfection methods but has fewer chemical modifications than some of the other guide designs which might be detrimental in terms of performance in vivo. [00366] Additional combinations of chemical modifications were designed to create mAlb298-40 to mALb298-43 that might also retain good editing activity while having more extensive chemical modifications.
- mAlb298-41 which also incorporates some DNA bases only 6 of the bases are un-modified ribonucleotides.
- mAlb298-42 contains T - fluorogroups throughout the entire spacer and has 5 un-modified ribonucleotides.
- RNA stability assay using cell crude extracts was used. Crude cell extracts from mammalian cells were selected because they should contain the mixture of nucleases that a guide RNA will be exposed to when delivered to mammalian cells in vitro or in vivo. Hepa 1-6 cells were collected by adding 3ml of cold PBS per 15cm dish of confluent cells and releasing the cells from the surface of the dish using a cell scraper. The cells were pelleted at 200g for lOmin and frozen at -80°C for future use.
- Triton X-100 was added to a final concentration of 0.2% (v/v), cells were vortexed for 10 seconds, put on ice for 10 minutes and vortexed again for 10 seconds.
- Triton X-100 is a mild non-ionic detergent that disrupts cell membranes but does not inactivate or denature proteins at the concentration used.
- Stability reactions were set up on ice and consisted of 20 m ⁇ of cell crude extract with 100 fmoles of each guide (1 m ⁇ of a lOOnM stock). Six reactions were set up per guide consisting of: input, 15min, 30min, 60min, 240min and 540min (The time in minutes referring to the length of time each sample was incubated). Samples were incubated at 37°C from 15 minutes up to 540 min while the input control was left on ice for 5 minutes.
- Detection of the modified guide was performed using Taqman RT - qPCR using the Taqman miRNA Assay technology (Thermo Fisher) and primers and probes designed to specifically detect the sequence in the mAlb298 sgRNA which is the same for all of the guides. Data was plotted as a function of percentage of sgRNA remaining in relation to the input sample.
- the guide with no chemical modifications was the most rapidly eliminated when incubated with the cell extract (FIG. 55) with more than 90% of the guide degraded within 30 minutes.
- the guide with the AltRl/AltR2 (AltR in FIG. 55) chemical modifications was slightly more stable in the presence of cell extract than the un-modified guide with about 80% of the guide degraded in 30 minutes.
- Guide mAlb298-34 exhibited improved stability compared to guide mALb298-31.
- Guide mALb298-34 differs to guide mALb298-31 only in the chemical modifications within the spacer.
- mALb298-34 has 9 fewer 2’-Fluro bases in the spacer than mALb298-31 but contains 4 PS linkages in the spacer compared to 2 PS linkages in mALb298-31. Because 2’-fluro bases improve the stability of RNA this suggests that the additional PS linkages in the spacer were responsible for the improved stability of mALb298-34 compared to mALb298-31.
- Guide mALb298-37 was the most stable of all the guides tested and was significantly more stable than mALb298-34 with 80% of the guide remaining after 240 min (4 h) compared to
- mALb298-34 30% for mALb298-34.
- the chemical modifications of mALb298-37 differ from guide mALb298-34 in both the spacer and backbone regions.
- mALb298-37 has an additional two 2’-0- methyl groups and 2 additional PS linkages at the 5’ end.
- the loop region of mALb298-37 contains PS linkages and does not contain the 2’-0-methyl groups present in the second half of the stem in mALb298-34.
- the spacer of mALb298-37 contains 9 more
- a “G is used to separate bases with 2’-flourine modifications, m; 2’-0- methyl base (for example a A base with 2’-0-methyl modification is written as mA), i2F; internal 2’-flourine base (for example an internal C with 2’-flourine modification is written as /i2FC/), 52F; 2’-flourine base at the 5’ end of the sequence (for example a 5’ C with 2’-flourine modification is written as /52FC/), 32F; 2’-flourine base at the 3’ end of the sequence (for example a 3 ’ A base with 2’-flourine modification is written as /32FA /), r; native RNA linkage comprising the sugar ribose (fro example the ribose or RNA form of the A base is written rA), d; deoxyribose sugar (DNA) linkage (for example a deoxyribos
- Liver tissue is an example of a tissue that can be advantageously targeted using the gene editing compositions and systems described herein for in vivo gene editing, for example by introduction of indels that function to knock down expression of deleterious genes and/or that are used to replace defective genes.
- indels that function to knock down expression of deleterious genes and/or that are used to replace defective genes.
- AAV adeno-associated virus
- Lipid nanoparticles have also been shown to deliver nucleic acids and approved drugs for RNAi strategies.
- Liver tissue also includes appropriate cellular machinery for efficient secretion of proteins into the systemic circulation.
- Subjects having a condition in Table 13 or Table 14 are selected for gene editing therapy.
- a human or mouse model subject having hemophilia A is identified for treatment with gene replacement therapy using a gene editing platform.
- a gene editing platform comprising a lipid nanoparticle (LNP) encapsulating an sgRNA and an mRNA encoding an MG nuclease described herein and an AAV (e.g., AAV serotype 8) comprising a donor template nucleic acid encoding a therapeutic gene are introduced into the liver intravenously to the subject.
- LNP lipid nanoparticle
- AAV e.g., AAV serotype 8
- the subject having hemophilia A is treated with a gene replacement platform comprising LNPs containing mRNA encoding a MG29-1 nuclease described herein (SEQ ID NO: 214).
- LNPs also contain sgRNA specific for albumin I, which is highly expressed in the liver (e.g., albumin can be expressed at about 5 g/dL in the liver, whereas factor VIII can be expressed at about 10 pg/dL in the liver, or 1 million times less than albumin).
- AAV8 AAV serotype 8 viral particles comprising plasmids, which encode replacement template DNA encoding a replacement factor VIII nucleotide sequence, are delivered to the subject as well.
- the mRNA, sgRNA, and template DNA are transiently expressed.
- the MG29-1 nuclease targets the target locus of the host hepatocyte DNA using the sgRNA and then cleaves the host DNA.
- the donor template DNA transcribed from the plasmid delivered to the host hepatocyte in the AAV8 is spliced into the cell and stably integrated into the host DNA at the target site of the albumin I gene, and the inserted factor VIII DNA is expressed under the albumin promoter.
- the gene editing platform is also used in subjects selected for gene knockdown therapy. For instance, a subject presenting with familial ATTR amyloidosis is treated with LNPs containing mRNA encoding an MG29-1 nuclease described herein (SEQ ID NO: 214) and a sgRNA specific to a target site in the transthyretin gene.
- the MG29-1 nuclease and sgRNA are delivered to and expressed in hepatocytes of the subject.
- the sgRNA is targeted to a stop codon of the transthyretin gene, and the MG29-1 nuclease’s activity removes the endogenous stop codon, effectively knocking down the expression of the gene.
- the gene knockdown platform comprises an AAV8 containing a plasmid encoding a polynucleotide comprising a stop codon.
- AAV8 When the AAV8 is delivered to the same cell that is expressing the nuclease and sgRNA, an exogenous stop codon is spliced into the tranthyretin gene, leading to knockdown of the gene’s expression as a result of premature truncation of proteins translated from RNA produced from the edited DNA.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Mycology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Saccharide Compounds (AREA)
- Amplifiers (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3174557A CA3174557A1 (en) | 2020-03-06 | 2021-03-06 | Class ii, type v crispr systems |
| KR1020247008129A KR20240036729A (ko) | 2020-03-06 | 2021-03-06 | 클래스 ii, 타입 v crispr 시스템 |
| GB2205584.2A GB2603704B (en) | 2020-03-06 | 2021-03-06 | Class II, type V Crispr systems |
| EP21763629.9A EP4114932A4 (en) | 2020-03-06 | 2021-03-06 | CLASS II TYPE V CRISPR SYSTEMS |
| MX2022011039A MX2022011039A (es) | 2020-03-06 | 2021-03-06 | Sistemas crispr clase ii tipo v. |
| KR1020227033789A KR102647766B1 (ko) | 2020-03-06 | 2021-03-06 | 클래스 ii, 타입 v crispr 시스템 |
| JP2022553203A JP7605852B2 (ja) | 2020-03-06 | 2021-03-06 | クラスiiのv型crispr系 |
| CN202180033688.1A CN116096876A (zh) | 2020-03-06 | 2021-03-06 | Ii类v型crispr系统 |
| AU2021231074A AU2021231074C1 (en) | 2020-03-06 | 2021-03-06 | Class II, type V CRISPR systems |
| US17/706,466 US11713471B2 (en) | 2020-03-06 | 2022-03-28 | Class II, type V CRISPR systems |
| US17/929,978 US20230227857A1 (en) | 2020-03-06 | 2022-09-06 | Class ii, type v crispr systems |
| US18/302,387 US12123014B2 (en) | 2020-03-06 | 2023-04-18 | Class II, type V CRISPR systems |
| AU2024200614A AU2024200614A1 (en) | 2020-03-06 | 2024-02-01 | Class II, type V CRISPR systems |
| US18/816,810 US20250059568A1 (en) | 2014-07-09 | 2024-08-27 | Class ii, type v crispr systems |
| JP2024216978A JP2025060673A (ja) | 2020-03-06 | 2024-12-11 | クラスiiのv型crispr系 |
Applications Claiming Priority (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202062986477P | 2020-03-06 | 2020-03-06 | |
| US62/986,477 | 2020-03-06 | ||
| US202063022276P | 2020-05-08 | 2020-05-08 | |
| US63/022,276 | 2020-05-08 | ||
| US202063045815P | 2020-06-29 | 2020-06-29 | |
| US63/045,815 | 2020-06-29 | ||
| US202063068316P | 2020-08-20 | 2020-08-20 | |
| US63/068,316 | 2020-08-20 | ||
| US202063069699P | 2020-08-24 | 2020-08-24 | |
| US63/069,699 | 2020-08-24 | ||
| US202063116157P | 2020-11-19 | 2020-11-19 | |
| US63/116,157 | 2020-11-19 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/706,466 Continuation US11713471B2 (en) | 2014-07-09 | 2022-03-28 | Class II, type V CRISPR systems |
| US17/929,978 Continuation US20230227857A1 (en) | 2020-03-06 | 2022-09-06 | Class ii, type v crispr systems |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2021178933A2 true WO2021178933A2 (en) | 2021-09-10 |
| WO2021178933A3 WO2021178933A3 (en) | 2021-12-23 |
Family
ID=77612848
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/021259 Ceased WO2021178933A2 (en) | 2014-07-09 | 2021-03-06 | Class ii, type v crispr systems |
Country Status (10)
| Country | Link |
|---|---|
| US (3) | US11713471B2 (https=) |
| EP (1) | EP4114932A4 (https=) |
| JP (2) | JP7605852B2 (https=) |
| KR (2) | KR102647766B1 (https=) |
| CN (1) | CN116096876A (https=) |
| AU (2) | AU2021231074C1 (https=) |
| CA (1) | CA3174557A1 (https=) |
| GB (2) | GB2617658B (https=) |
| MX (1) | MX2022011039A (https=) |
| WO (1) | WO2021178933A2 (https=) |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20220136050A1 (en) * | 2020-11-03 | 2022-05-05 | Caspr Biotech Corporation | Novel class 2 crispr-cas rna-guided endonucleases |
| WO2022094313A1 (en) * | 2020-10-30 | 2022-05-05 | Arbor Biotechnologies, Inc. | Compositions comprising an rna guide targeting trac and uses thereof |
| US11332742B1 (en) * | 2021-01-07 | 2022-05-17 | Inscripta, Inc. | Mad nucleases |
| WO2022256462A1 (en) * | 2021-06-02 | 2022-12-08 | Metagenomi, Inc. | Class ii, type v crispr systems |
| WO2023056291A1 (en) * | 2021-09-28 | 2023-04-06 | Acrigen Biosciences | Compositions and methods for nucleic acid modifications |
| WO2023092132A1 (en) * | 2021-11-22 | 2023-05-25 | Mammoth Biosciences, Inc. | Effector proteins and uses thereof |
| US11713471B2 (en) | 2020-03-06 | 2023-08-01 | Metagenomi, Inc. | Class II, type V CRISPR systems |
| US11761029B2 (en) | 2018-08-01 | 2023-09-19 | Mammoth Biosciences, Inc. | Programmable nuclease compositions and methods of use thereof |
| CN117050973A (zh) * | 2021-10-29 | 2023-11-14 | 山东舜丰生物科技有限公司 | 新型Cas酶和系统以及应用 |
| WO2023230579A3 (en) * | 2022-05-25 | 2024-01-04 | Metagenomi, Inc. | Supplementation of liver enzyme expression |
| WO2024042168A1 (en) * | 2022-08-26 | 2024-02-29 | UCB Biopharma SRL | Novel rna-guided nucleases and nucleic acid targeting systems comprising such rna-guided nucleases |
| WO2024020346A3 (en) * | 2022-07-18 | 2024-02-29 | Renagade Therapeutics Management Inc. | Gene editing components, systems, and methods of use |
| WO2024107665A1 (en) * | 2022-11-14 | 2024-05-23 | Mammoth Biosciences, Inc. | Effector proteins, compositions, systems and methods of use thereof |
| JP2024543186A (ja) * | 2021-11-30 | 2024-11-19 | 上海科技大学 | C2c9ヌクレアーゼに基づく新規なゲノム編集システムおよびその使用 |
| US12201699B2 (en) | 2014-10-10 | 2025-01-21 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| WO2025003358A3 (en) * | 2023-06-29 | 2025-02-20 | UCB Biopharma SRL | Novel nucleic acid targeting systems comprising rna-guided nucleases |
| US12264328B2 (en) | 2022-07-18 | 2025-04-01 | ReNAgade Therapeutics Management, Inc. | Gene editing components, systems, and methods of use |
| US20250179534A1 (en) * | 2023-09-04 | 2025-06-05 | China Agricultural University | Novel CRISPR-Cas sigma enzyme and system |
| EP4574975A1 (en) * | 2023-12-20 | 2025-06-25 | Bayer AG | Compositions and methods for delivering transgenes |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2023209457A1 (en) * | 2022-01-21 | 2024-08-08 | Mammoth Biosciences, Inc. | Effector proteins and methods of use |
| TW202440913A (zh) * | 2022-12-08 | 2024-10-16 | 香港商正基基因科技有限公司 | Cas12蛋白、CRISPR-Cas系統及其用途 |
| JP2026501682A (ja) * | 2023-01-03 | 2026-01-16 | エメンドバイオ・インコーポレイテッド | Omni xl1~22 crisprヌクレアーゼ |
| CN118773168B (zh) * | 2023-11-24 | 2025-07-25 | 华智生物技术有限公司 | CRISPR/Cas效应蛋白HT001及系统与应用 |
| WO2025201316A1 (zh) * | 2024-03-25 | 2025-10-02 | 深圳华大生命科学研究院 | 一种CRISPR-Cas系统 |
Family Cites Families (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2691101A2 (en) | 2011-03-31 | 2014-02-05 | Moderna Therapeutics, Inc. | Delivery and formulation of engineered nucleic acids |
| US9963689B2 (en) | 2013-12-31 | 2018-05-08 | The Regents Of The University Of California | Cas9 crystals and methods of use thereof |
| EP3889260A1 (en) | 2014-12-12 | 2021-10-06 | The Broad Institute, Inc. | Protected guide rnas (pgrnas) |
| US9790490B2 (en) * | 2015-06-18 | 2017-10-17 | The Broad Institute Inc. | CRISPR enzymes and systems |
| WO2017127807A1 (en) * | 2016-01-22 | 2017-07-27 | The Broad Institute Inc. | Crystal structure of crispr cpf1 |
| US20200263190A1 (en) * | 2016-04-19 | 2020-08-20 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| US20190161743A1 (en) | 2016-05-09 | 2019-05-30 | President And Fellows Of Harvard College | Self-Targeting Guide RNAs in CRISPR System |
| KR102758434B1 (ko) * | 2017-03-30 | 2025-01-21 | 고쿠리츠 다이가쿠 호진 교토 다이가쿠 | 게놈 편집에 의한 엑손 스키핑 유도 방법 |
| WO2018195545A2 (en) * | 2017-04-21 | 2018-10-25 | The General Hospital Corporation | Variants of cpf1 (cas12a) with altered pam specificity |
| CA3102054A1 (en) * | 2017-06-05 | 2018-12-13 | Fred Hutchinson Cancer Research Center | Genomic safe harbors for genetic therapies in human stem cells and engineered nanoparticles to provide targeted genetic therapies |
| US9982279B1 (en) * | 2017-06-23 | 2018-05-29 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| JP2020536502A (ja) | 2017-09-07 | 2020-12-17 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | 遺伝子操作のためのヌクレアーゼシステム |
| US20190247517A1 (en) | 2017-10-17 | 2019-08-15 | Casebia Therapeutics Limited Liability Partnership | Compositions and methods for gene editing for hemophilia a |
| US10253365B1 (en) | 2017-11-22 | 2019-04-09 | The Regents Of The University Of California | Type V CRISPR/Cas effector proteins for cleaving ssDNAs and detecting target DNAs |
| JP7575271B2 (ja) | 2018-03-29 | 2024-10-29 | フェイト セラピューティクス,インコーポレイテッド | 操作された免疫エフェクター細胞およびその使用 |
| CA3109083A1 (en) | 2018-08-09 | 2020-02-13 | G+Flas Life Sciences | Compositions and methods for genome engineering with cas12a proteins |
| US12365888B2 (en) | 2018-12-14 | 2025-07-22 | Pioneer Hi-Bred International, Inc. | CRISPR-Cas systems for genome editing |
| EP3931313A2 (en) * | 2019-01-04 | 2022-01-05 | Mammoth Biosciences, Inc. | Programmable nuclease improvements and compositions and methods for nucleic acid amplification and detection |
| US10913941B2 (en) | 2019-02-14 | 2021-02-09 | Metagenomi Ip Technologies, Llc | Enzymes with RuvC domains |
| AU2020223370B2 (en) | 2019-02-14 | 2023-04-20 | Metagenomi Therapeutics, Inc. | Enzymes with RuvC domains |
| CN110684823A (zh) | 2019-10-23 | 2020-01-14 | 海南大学 | 一种基于试纸条的Cas12a酶的微生物快速诊断技术 |
| CN110904239B (zh) | 2019-12-25 | 2020-11-10 | 武汉博杰生物医学科技有限公司 | 肺癌相关分子标志物基因突变的检测试剂盒与检测方法 |
| WO2021178934A1 (en) | 2020-03-06 | 2021-09-10 | Metagenomi Ip Technologies, Llc | Class ii, type v crispr systems |
| GB2617658B (en) * | 2020-03-06 | 2024-04-17 | Metagenomi Inc | Class II, type V CRISPR systems |
| KR20230021657A (ko) | 2020-05-08 | 2023-02-14 | 메타지노미, 인크. | Ruvc 도메인을 포함하는 효소 |
| CA3192224A1 (en) | 2020-09-11 | 2022-03-17 | Jyun-Liang LIN | Base editing enzymes |
| WO2022159742A1 (en) | 2021-01-22 | 2022-07-28 | Metagenomi, Inc | Novel engineered and chimeric nucleases |
| BR112023014719A2 (pt) | 2021-01-22 | 2023-12-05 | Metagenomi Inc | Novas nucleases quiméricas e manipuladas |
| EP4281567A4 (en) | 2021-01-25 | 2025-03-05 | The Broad Institute Inc. | REPROGRAMMABLE TNPB POLYPEPTIDES AND THEIR USE |
| BR112023018948A2 (pt) | 2021-03-19 | 2023-10-17 | Metagenomi Inc | Edição multiplex com enzimas cas |
| KR20240017367A (ko) | 2021-06-02 | 2024-02-07 | 메타지노미, 인크. | 클래스 ii, v형 crispr 시스템 |
| MX2024003007A (es) | 2021-09-08 | 2024-03-25 | Metagenomi Inc | Sistemas crispr de clase ii, tipo v. |
| EP4399290A4 (en) | 2021-09-08 | 2025-10-01 | Metagenomi Inc | CLASS II TYPE V CRISPR SYSTEMS |
-
2021
- 2021-03-06 GB GB2219438.5A patent/GB2617658B/en active Active
- 2021-03-06 KR KR1020227033789A patent/KR102647766B1/ko active Active
- 2021-03-06 AU AU2021231074A patent/AU2021231074C1/en active Active
- 2021-03-06 GB GB2205584.2A patent/GB2603704B/en active Active
- 2021-03-06 KR KR1020247008129A patent/KR20240036729A/ko active Pending
- 2021-03-06 MX MX2022011039A patent/MX2022011039A/es unknown
- 2021-03-06 JP JP2022553203A patent/JP7605852B2/ja active Active
- 2021-03-06 CN CN202180033688.1A patent/CN116096876A/zh active Pending
- 2021-03-06 WO PCT/US2021/021259 patent/WO2021178933A2/en not_active Ceased
- 2021-03-06 CA CA3174557A patent/CA3174557A1/en active Pending
- 2021-03-06 EP EP21763629.9A patent/EP4114932A4/en active Pending
-
2022
- 2022-03-28 US US17/706,466 patent/US11713471B2/en active Active
- 2022-09-06 US US17/929,978 patent/US20230227857A1/en active Pending
-
2023
- 2023-04-18 US US18/302,387 patent/US12123014B2/en active Active
-
2024
- 2024-02-01 AU AU2024200614A patent/AU2024200614A1/en active Pending
- 2024-12-11 JP JP2024216978A patent/JP2025060673A/ja active Pending
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12201699B2 (en) | 2014-10-10 | 2025-01-21 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| US11761029B2 (en) | 2018-08-01 | 2023-09-19 | Mammoth Biosciences, Inc. | Programmable nuclease compositions and methods of use thereof |
| US12123014B2 (en) | 2020-03-06 | 2024-10-22 | Metagenomi, Inc. | Class II, type V CRISPR systems |
| US11713471B2 (en) | 2020-03-06 | 2023-08-01 | Metagenomi, Inc. | Class II, type V CRISPR systems |
| WO2022094313A1 (en) * | 2020-10-30 | 2022-05-05 | Arbor Biotechnologies, Inc. | Compositions comprising an rna guide targeting trac and uses thereof |
| US20220136050A1 (en) * | 2020-11-03 | 2022-05-05 | Caspr Biotech Corporation | Novel class 2 crispr-cas rna-guided endonucleases |
| US11332742B1 (en) * | 2021-01-07 | 2022-05-17 | Inscripta, Inc. | Mad nucleases |
| WO2022256462A1 (en) * | 2021-06-02 | 2022-12-08 | Metagenomi, Inc. | Class ii, type v crispr systems |
| WO2023056291A1 (en) * | 2021-09-28 | 2023-04-06 | Acrigen Biosciences | Compositions and methods for nucleic acid modifications |
| US12385025B2 (en) | 2021-09-28 | 2025-08-12 | Acrigen Biosciences | Compositions and methods for nucleic acid modifications |
| CN117050973A (zh) * | 2021-10-29 | 2023-11-14 | 山东舜丰生物科技有限公司 | 新型Cas酶和系统以及应用 |
| WO2023092132A1 (en) * | 2021-11-22 | 2023-05-25 | Mammoth Biosciences, Inc. | Effector proteins and uses thereof |
| JP2024543186A (ja) * | 2021-11-30 | 2024-11-19 | 上海科技大学 | C2c9ヌクレアーゼに基づく新規なゲノム編集システムおよびその使用 |
| WO2023230579A3 (en) * | 2022-05-25 | 2024-01-04 | Metagenomi, Inc. | Supplementation of liver enzyme expression |
| US12533424B2 (en) | 2022-05-25 | 2026-01-27 | Metagenomi, Inc. | Supplementation of liver enzyme expression |
| WO2024020346A3 (en) * | 2022-07-18 | 2024-02-29 | Renagade Therapeutics Management Inc. | Gene editing components, systems, and methods of use |
| US12264328B2 (en) | 2022-07-18 | 2025-04-01 | ReNAgade Therapeutics Management, Inc. | Gene editing components, systems, and methods of use |
| WO2024042168A1 (en) * | 2022-08-26 | 2024-02-29 | UCB Biopharma SRL | Novel rna-guided nucleases and nucleic acid targeting systems comprising such rna-guided nucleases |
| WO2024107665A1 (en) * | 2022-11-14 | 2024-05-23 | Mammoth Biosciences, Inc. | Effector proteins, compositions, systems and methods of use thereof |
| WO2025003358A3 (en) * | 2023-06-29 | 2025-02-20 | UCB Biopharma SRL | Novel nucleic acid targeting systems comprising rna-guided nucleases |
| US20250179534A1 (en) * | 2023-09-04 | 2025-06-05 | China Agricultural University | Novel CRISPR-Cas sigma enzyme and system |
| EP4574975A1 (en) * | 2023-12-20 | 2025-06-25 | Bayer AG | Compositions and methods for delivering transgenes |
| WO2025132755A1 (en) * | 2023-12-20 | 2025-06-26 | Bayer Aktiengesellschaft | Compositions and methods for delivering transgenes |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2021231074A1 (en) | 2022-09-29 |
| US20220290187A1 (en) | 2022-09-15 |
| JP2025060673A (ja) | 2025-04-10 |
| KR20240036729A (ko) | 2024-03-20 |
| JP2023517041A (ja) | 2023-04-21 |
| US11713471B2 (en) | 2023-08-01 |
| MX2022011039A (es) | 2022-12-13 |
| US20230227857A1 (en) | 2023-07-20 |
| GB202219438D0 (en) | 2023-02-01 |
| EP4114932A2 (en) | 2023-01-11 |
| GB2617658B (en) | 2024-04-17 |
| GB2603704B (en) | 2023-02-15 |
| US12123014B2 (en) | 2024-10-22 |
| CA3174557A1 (en) | 2021-09-10 |
| EP4114932A4 (en) | 2024-03-13 |
| JP7605852B2 (ja) | 2024-12-24 |
| GB2603704A (en) | 2022-08-10 |
| AU2024200614A1 (en) | 2024-04-11 |
| KR102647766B1 (ko) | 2024-03-13 |
| GB202205584D0 (en) | 2022-06-01 |
| AU2021231074C1 (en) | 2024-06-27 |
| KR20220150329A (ko) | 2022-11-10 |
| WO2021178933A3 (en) | 2021-12-23 |
| US20240093239A1 (en) | 2024-03-21 |
| CN116096876A (zh) | 2023-05-09 |
| AU2021231074B2 (en) | 2023-11-02 |
| GB2617658A (en) | 2023-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12123014B2 (en) | Class II, type V CRISPR systems | |
| US20240336905A1 (en) | Class ii, type v crispr systems | |
| JP2023179468A (ja) | Ruvcドメインを有する酵素 | |
| US20230416710A1 (en) | Engineered and chimeric nucleases | |
| JP2025090617A (ja) | Ruvcドメインを有する酵素 | |
| WO2021178934A1 (en) | Class ii, type v crispr systems | |
| US20240218339A1 (en) | Class ii, type v crispr systems | |
| CN119452085A (zh) | 具有ruvc结构域的酶 | |
| AU2023314925A1 (en) | Class ii, type v crispr systems | |
| US20250002881A1 (en) | Class ii, type v crispr systems | |
| US20250059568A1 (en) | Class ii, type v crispr systems | |
| CN117693585A (zh) | Ii类v型crispr系统 | |
| KR20240145522A (ko) | 융합 단백질 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21763629 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 202205584 Country of ref document: GB Kind code of ref document: A Free format text: PCT FILING DATE = 20210306 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2205584.2 Country of ref document: GB |
|
| ENP | Entry into the national phase |
Ref document number: 3174557 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2022553203 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2021231074 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 20227033789 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2021231074 Country of ref document: AU Date of ref document: 20210306 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202217057075 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2021763629 Country of ref document: EP Effective date: 20221006 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 2219438.5 Country of ref document: GB Ref document number: 2205584.2 Country of ref document: GB |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2205584.2 Country of ref document: GB |
|
| WWP | Wipo information: published in national office |
Ref document number: 2205584.2 Country of ref document: GB |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2205584.2 Country of ref document: GB |