Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/0004—Oxidoreductases (1.)
  • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P33/00—Preparation of steroids
  • C12P33/06—Hydroxylating
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)

Definitions

• the present invention relates to agents and methods for the hydroxylation of steroids.
• 3,7,12-Trihydroxylated bile acids such as cholic acid (3a, 7a, 12a-trihydroxy-5ß-cholanic acid) or ursocholic acid (3a, 7ß, 12a-trihydroxy-5ß-cholanic acid) are industrially important Chemicals, including as raw materials for the production of ursodeoxycholic acid (UDCA).
• Ursodeoxycholic acid is used as a drug, among other things, to dissolve smaller x-ray-negative gallstones and to treat liver diseases, primarily ciliary cirrhosis and primarily sclerosing cholangitis.
• bile is an aqueous mixture of bile acids, lipids, cholesterol and other substances, the separation of the components in the production of bile acids is of particular importance.
• the bile acids also represent a mixture whose components differ in the number and position of the hydroxyl groups.
• bovine bile also contains a significant proportion of deoxycholic acid, which differs from cholic acid in the absence of the OH group at position 7 (3a, 12a-dihydroxy-5ß-cholanic acid).
• Deoxycholic acid has a significantly lower More commercial value than 3,7,12-trihydroxylated gallic acids. There is therefore an industrial interest in converting deoxycholic acid into a 3,7,12-trihydroxylated bile acid by the targeted introduction of a hydroxyl group at position 7.
• the object of the invention is achieved through the use of cytochrome P450 or a functional fragment thereof for the hydroxylation of a 7-deoxy steroid with the general formula (I) at position 7 to a steroid with the general formula (II)
• Xi and X2 independently of one another H, Ci, F, Br, I, CF 3 , a Ci to C 6 alkyl radical, OH, a Ci to C 6 alkoxy radical, CN, N0 2 , N (R 6 ) 2, an epoxy group, CHO or a C0 2 R 6 radical, where
• Ri and R 2 are independently H, OH, OR 7 or 0, where
• R 7 -C (0) H, -C (0) CH 3 , -C (0) CH 2 CH 3 , -C (0) (CH 2 ) 2 CH 3 , - C (0) CH (CH 3 ) 2, -C (0) (CH 2 ) 3 CH 3 , -C (0) CH (CH 3 ) CH 2 CH 3 , - C (0) CH 2 CH 2 (CH 3 ) 2 , -C (0) Is C (CH 3 ) 3 , -C (0) Ph, -C (0) CH 2 Ph, R.
• Ci to Cio alkyl radical a Ci to Cio alkenyl radical, -CHO, -C (0) (CH 3) , -C (0) (CH 2 OH), - CH (CH 3 ) Is C (0) CH 3 , -CH (CH 3) (( CH 2) 2 CO 2 R 9) or -CH (CH 3) (( CH 2) 2 CONHR 9) , where
• R4 is H, OH, or -OR10, where
• cytochrome P450 enzyme comprises an amino acid sequence, which is at least 80%, preferably at least 90%, in particular 100%, identical to the amino acid sequence SEQ ID No. 1 or 2, solved. It has surprisingly been found that cytochrome P450 and functional fragments thereof are able to hydroxylate steroids such as cholic acid or derivatives thereof with the formula (I) at position 7.
• Another aspect of the present invention relates to a process for the preparation of a steroid, preferably a cholic acid, or a derivative thereof having the general formula (II) as defined above, comprising the step of reacting a 7-deoxy steroid, preferably a 7-deoxycholic acid, or a derivative thereof with the general formula (I) with the cytochrome P450 according to the invention or a functional variant thereof.
• Cytochrome P450 and functional variants thereof are surprisingly able to selectively hydroxylate 7-deoxysteroids, such as 7-deoxycholic acid, and derivatives thereof at the 7-position.
• the cytochrome P450 enzyme comprises an amino acid sequence which is at least 80%, preferably at least 90%, in particular 100%, identical to the amino acid sequence SEQ ID No. 1 or 2.
• Cytochromes P450 catalyze monooxygenase reactions of a variety of endogenous and exogenous substrates. They are involved in the metabolism of steroids, eicosanoids, fatty acids and bile acids as well as exogenous substrates such as drugs, insecticides and chemical carcinogens.
• Cytochromes P450 according to the present invention can be used, for example, from bacteria such as actinobacteria, in particular from the genus Streptomyces, for example.
• the sequences can be isolated, for example, from genomic DNA or a cDNA library with the aid of known tech- niques.
• cytochromes P450 according to the present invention or their functional variants can optionally be present in their original organism or isolated from it, or they are recombinantly expressed or synthesized. According to the invention, recombinantly expressed polypeptides are preferably used.
• enzymes according to the present invention can be used for the recombinant expression of enzymes according to the present invention, such as, for example, Escherichia coli (E. coli), Bacillus subtilis, Saccharomyces cerevisiae or Pichia pastoris. Corresponding protocols are described in detail in the relevant specialist literature or are known to a competent person.
• enzymes / polypeptides are preferably used as proteins recombinantly overexpressed in E. coli, preferably the corresponding cell lysates either without further processing / purification or after relatively simple processing steps (eg centrifugation, precipitation, concentration or freeze-drying).
• E. coli Escherichia coli
• Bacillus subtilis Bacillus subtilis
• Saccharomyces cerevisiae Saccharomyces cerevisiae
• Pichia pastoris a competent person.
• enzymes / polypeptides are preferably used as proteins recombinantly overexpressed in E. coli,
• coli cells can also be used in the reaction after recombinant overexpression of the enzymes used without cell disruption, either directly or, for example, after a freezing / thawing cycle.
• Suitable expression plasmids are known to a person skilled in the art and many of them can be purchased commercially.
• “Functional variants” of cytochrome P450 can be fragments or mutation variants of cytochrome P450, fragments of cytochrome P450 also being referred to as "functional fragments". "Functional variants" of cytochrome P450 are able to catalyze the same reaction as the protein from which they were derived. Whether a variant is functional, ie whether it catalyzes the same reaction as the protein from which it is derived, can be determined by establishing that the variant catalyzes the same reaction. There are established methods for this in the prior art or those described here in The conversion rates of substrates by the functional variants according to the invention can be differ from the conversion rates of the cytochrome P450 from which these were derived.
• Deoxysteroids-derived compounds with a wide variety of modifications, one or more Modifi cations at positions 3, 12 and 17 of the 7-deoxysteroids being particularly preferred. These modifications preferably include substitutions as defined above.
• Xi, X2, R 4 and R 5 are H and Ri and R2 independently of one another are H, OH, ORs or 0, where Rs is -C (0) H, -C (0) CH 3 , -C (0) CH 2 CH 3 , -C (0) (CH 2 ) 2 CH 3 , -C (0) CH (CH 3 ) 2 , -C (0) (CH 2 ) 3 CH 3 , -C (0) CH (CH 3 ) CH 2 CH 3 , -C (0) CH 2 Is CH 2 (CH 3 ) 2 , -C (0) C (CH 3 ) 3 , -C (0) Ph, -C (0) CH 2 Ph,
• R 3 is a Ci to C10 alkyl radical, a Ci to C10 alkylene radical, - CH (CH 3 ) ((CH 2 ) 2 C0 2 R 9 ) or -CH (CH 3 ) ((CH 2 ) 2 CONHR 9 ), where Rg -CH 3 , -CH 2 COOH, -CH 2 CH 3 , -CH (CH 3 ) 2 , - (CH 2 ) 2 CH 3 , - (CH 2 ) 2 S0 3 H, C (CH 3 ) 3 , - (CH 2) 3 CH 3, -CH (CH 3) CH 2 CH 3, - CH 2 CH 2 (CH 3) 2, an aryl group or a Alkyla ryl distr is.
• the aryl group is selected from the group consisting of a phenyl radical, one with F,
• Ci, Br, N0 2 or CH 3 substituted phenyl radical and a heteroaryl.
• the alkylaryl group is selected from the group consisting of a benzyl group, a halogenated benzyl group, where the halogen is F, Ci or Br, and a benzyl group substituted with N0 2.
• Ri is OH, R 2 0 or OH, R 3 CH (CH 3 ) ((CH 2 ) 2CO2R5), R4 H and R 5 H.
• the 7-deoxysteroid with the general formula (I) is selected from the group consisting of 3a, 12a-dihydroxy-5ß-cholan-24-acid, 3a, 12ß-dihydroxy 5ß-cholan-24-acid, 3ß, 12a-dihydroxy-5ß-cholan-24-acid, 3ß, 12ß-dihydroxy-5ß-cholan-24-acid, 3ß-hydroxy-12-keto-5ß-cholan-24- Acid, 3-keto, 12ß-hydroxy-5ß-cholan-24-acid, 3-keto, 12a-hydroxy-5ß-cholan-24-acid, 3a-hydroxy-5ß-cholan-24-acid, 3-keto- 5ß-cholan-24-acid, 3ß-hydroxy-5ß-cholan-24-acid and esters of the respective acid.
• the cytochrome P450 hydroxylase which according to the invention is used for the hydroxylation of 7-deoxysteroids and derivatives of which with the general formula (I) is used to give a steroid or a derivative thereof with the general formula (II), comprises an amino acid sequence which is at least 80%, preferably at least 85%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 96%, even more preferably at least 97%, even more preferably at least 98%, even more preferably at least 99%, in particular 100%, is identical to the amino acid sequence SEQ ID No. 1 or 2 is.
• Amino acid sequences SEQ ID No. 1 and 2 are preferably encoded by nucleic acid sequences SEQ ID No. 3 and 4, nucleic acid sequences SEQ ID No. 5 and 6 being optimized for expression in E. coli.
• SEQ ID No. 3 ATGTTGACCACAGCCGAGACGACATCCATCGCCTATCCCTTCAACACCGCCGAAGGGCTGGC
• Identity means that two or more amino acid sequences, when these are superimposed, can have a certain “identity” (matching amino acid residues at identical positions) to one another. “Identity” is defined in this invention as the percentage of amino acids of the amino acid sequences in question which are identical to the amino acids of the starting sequence, after aligning the two sequences and introducing gaps, if necessary, by the maximum percentage To achieve sequence identity, as is the case with the “Protein BLAST” program (blastp; Altschul et al., J. Mol. Biol.
• blastp Protein-Protein-BLAST
• word size 6
• Matrix BLOSUM62
• Gap costs "Existence” 11, “Extension” 1; conditional compositional score matrix adaptation; no filter and no mask.
• a percentage (%) value for the amino acid sequence identity is divided by the number of matching identical nucleotides by the sequence length for which the percentage identity is recorded.
• Another aspect of the present invention relates to a process for the preparation of a steroid or a derivative thereof having the general formula (II)
• Xi and X2 independently of one another H, Ci, F, Br, I, CF 3 , a Ci to C 6 alkyl radical, OH, a Ci to C 6 alkoxy radical, CN, N0 2 , N (R 6 ) 2 , an epoxy group, CHO or a C0 2 R 6 radical, where
• Ri and R 2 are independently H, OH, OR 7 or 0, where
• R 3 H OH, ORs, a Ci to C 10 alkyl radical, a Ci to C 10 alkenyl radical, -CHO, -C (0) (CH 3 ), -C (0) (CH 2 OH), - CH (CH 3) C (0) CH 3, -CH (CH 3) ((CH 2) 2CO2R9) or - CH (CH 3) ((CH 2) 2CONHR9), wherein
• R5 is H, CF 3 , a Ci to C 6 alkyl radical, a Ci to C 6 alkenyl radical, OH, 0, or a Ci to C 6 alkoxy radical, the dashed line denoting an optional double bond, with the proviso that the B-ring has no double bond when the A-ring has a C4-C5 double bond and the C-ring has no double bond when Xi and X 2 form an epoxy group comprising the step of reacting a 7-deoxy steroid or a derivative thereof with of the general formula (I) with cytochrome P450 or a functional variant thereof, characterized in that the cytochrome P450 enzyme comprises an amino acid sequence which is at least 80%, preferably at least 90%, in particular 100%, identical to the amino acid sequence SEQ ID No. 1 or 2.
• 7-deoxysteroids or derivatives thereof with the general formula (I) can be converted with cytochrome P450 according to the invention or a functional variant thereof to steroids or derivatives thereof with the general formula (II).
• NAD (P) H flavins or ferredoxins can be used as reducing agents. If, for example, the redox cofactors NAD (P) + and / or NAD (P) H are used, it is advantageous to use them in a reaction mixture with a concentration of 0.001 mM and 10 mM, even more preferably between 0.05 mM and 1 mM to use.
• the inventive method is preferably carried out in the presence of redox partners for cytochrome P450.
• Redox partners are understood as meaning proteins of the ferredoxin and ferredoxin reductase classes, which are advantageous for the function of cytochrome P450 according to the present invention.
• a possible pair of redox partners preferably includes putidaredoxin and putidare- doxin reductase from Pseudomonas putida.
• a skilled person will also be able to identify further ferredoxin proteins and ferredoxin reductases which are potential redox partners for the cytochrome P450 according to the invention.
• the suitability as a redox partner can be checked in a functional assay, as described, for example, in Examples 3 to 5.
• putidare doxin used in these examples and / or the putidaredoxin reductase used therein can be replaced by possible alternative proteins or enzymes. If sufficient formation of the desired product (e.g. ursocholic acid) is observed, the tested redox partners can be viewed as functional alternatives to putidaredoxin and / or putidaredoxin reductase.
• desired product e.g. ursocholic acid
• the ferredoxin used in the method according to the invention comprises an amino acid sequence which is at least 80%, preferably at least 85%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 96%, even more preferably at least 97%, even more preferably at least 98%, even more preferably at least 99%, in particular 100%, is identical to the amino acid sequence SEQ ID No. 7, where X is a methionine residue or not an amino acid.
• the ferredoxin reductase used in the method according to the invention comprises an amino acid sequence which is at least 80%, preferably at least 85%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 96%, even more preferably at least 97%, even more preferably at least 98%, even more preferably at least 99%, in particular 100%, is identical to the amino acid sequence SEQ ID No. 8.
• Amino acid sequences SEQ ID No. 7 and 8 are preferably replaced by nucleic acid sequences SEQ ID No. 9 or
• nucleic acid sequences SEQ ID No. 11 and 12 are optimized for expression in E. coli.
• SEQ ID No. 9 (ATG) 0 or 1
• cytochrome P450 any ferredoxins and ferredoxin reductases in bacteria, in particular in E. coli, is particularly advantageous when using nucleic acids with the nucleic acid sequences SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 11 and / or SEQ ID No. 12. Therefore, further aspects of the present invention relate to a nucleic acid (DNA and / or RNA) with a nucleic acid sequence selected from the group consisting of SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 11 and SEQ ID No. 12 and vectors and / or cells, in particular E. coli cells, comprising at least one of these sequences.
• ferredoxins and ferredoxin reductases are expressed (coexpressed) together with cytochrome P450 in a production strain (e.g. E. coli strain).
• a production strain e.g. E. coli strain.
• the inventive method at a temperature of 10 ° C to 40 ° C, preferably from 15 ° C to 38 ° C, even more preferably from 20 ° C to 30 ° C, still more preferably from 22 ° C to 26 ° C.
• the enzyme activity of cytochrome P450 for the reaction according to the invention is particularly high in this range.
• the method according to the invention is carried out at a pH of 6.5 to 8.5, preferably from 7 to 8, even more preferably from 7.2 to 7.8.
• the enzyme activity of cytochrome P450 is highest at this pH value in order to ensure a corresponding conversion of the substrate.
• the hydroxylation of deoxysteroids or deoxysteroid derivatives can take place regioselectively at position 7 of the steroid backbone. This allows a 7beta-hydroxyl group to be introduced stereoselectively, so that, for example, ursocholic acid and / or ursocholic acid derivatives can be produced.
• the isolation of the product can be done in different ways.
• the product can be removed from the reaction by a suitable organic solvent onmixture can be extracted.
• a suitable organic solvent onmixture can be extracted.
• solvents are described in the literature.
• Cholic acids and their derivatives according to the present invention can be isolated from reaction mixtures, for example with ethyl acetate, optionally after acidifying the reaction mixture, for example with HCl.
• a special case is a process in which bile acids are present in the form of a salt, for example a sodium salt in aqueous solution.
• the product can be precipitated by acidifying the reaction mixture. Sufficient amounts of HCl or dilute HCl, for example, can be added to the reaction mixture. If a pH of, for example, 1 to 4, preferably 2 to 3, is reached, the product is predominantly in the form of a sus pension.
• the product can then be removed from the reaction mixture by common methods such as filtration or centrifugation.
• Another alternative that can be used, for example, for product isolation are chromatographic methods, such as column chromatography or flash chromatography. It is also possible, for example, to obtain product by evaporating the reaction solvent.
• the product (s) can also remain in the reaction mixture after the reaction, e.g. to carry out further reactions and, if necessary, to isolate an end product after these reactions have been completed. It is also conceivable that the substrate (s) for the method according to the present invention are generated by previous or parallel reactions in the same reaction batch.
• Example 1 Test of bacterial strains The following bacterial strains were obtained from the German strain collection for microorganisms and cell cultures (DSMZ): Saccharothrix longispora (DSM-43749), Catellatospora citrae (DSM-44097), Streptomyces hygroscopicus subsp. hygroscopicus (DSM-40578) and Asanoa ferruginea (DSM-44099). The strains were cultivated under standard conditions as recommended by DSMZ. As soon as the growth of the cultures had resulted in a visible cloudiness, deoxycholic acid (0.5 mM) was added and cultivation continued for up to 72 hours.
• DSMZ German strain collection for microorganisms and cell cultures
• the following construct comprising coding regions for putidaredoxin reductase (PtR) and putidaredoxin (Ptx) was cloned into the plasmid pJ411 (DNA 2.0).
• Synthetic DNA Life Technologies: 5 ', Xhol interface, HindIII interface, approx. 50 bp spacer DNA, ribosome binding site (rbs), ORF (open reading frame) putidaredoxin reductase (PtR), approx. 50 bp spacer DNA, rbs, ORF putidaredoxin (Ptx), Xhol site, 3 '.
• the result of the cloning step was checked by means of restriction enzyme digestion and DNA sequencing.
• the expression plasmids produced with the identified P450 candidates can be used together with putidaredoxin reductase and putidaredoxin for the joint expression of the respective P450 proteins.
• the 3 ORFs of the respective expression plasmids are expressed under the control of a T7 promoter on a common mRNA but as separate polypeptides.
• the constructs of the P450 candidates to be tested were transformed into the E. coli expression strain BL21 (DE3). Overnight cultures were inoculated from individual colonies (LB (lysogeny broth) + kanamycin). The next day, 1: 100 expression cultures were inoculated with it (150 ml of TB (terrific broth) P450 expression medium) and shaken in Schi kan flasks (1 L) initially at 37 ° C. for 3 h. The temperature was then lowered to 24 ° C. and shaking continued for 22 h. The cultures were harvested by centrifugation at 5000 g for 10 min, washed once with 0.9% (w / v) NaCl and pellets frozen at -80 ° C.
• the cell pellets were thawed, weighed and resuspended with an equivalent amount of P450 lysis buffer, incubated on ice for 1 h and then disrupted using a sonifier. After centrifugation (30 min, 21,000 g) the supernatants were used for test reactions.
• Screw-on bottles attached and closed with a lid with aluminum foil. The film was pierced in several places. It was shaken gently for 18 h at 24 ° C. 200 ml of the reaction mixture were diluted with 600 ml aceto nitrile / 5 ml H3PO4 (50%) and incubated at 55 ° C. for 15 minutes.
• NADH a redox cofactor

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Biomedical Technology (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Steroid Compounds (AREA)
• Enzymes And Modification Thereof (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=69780052

Family Applications (1)

Country Status (5)

Cited By (1)

Citations (1)

• 2020
  • 2020-03-06 EP EP20161536.6A patent/EP3875596A1/de not_active Withdrawn
• 2021
  • 2021-03-05 KR KR1020227034684A patent/KR20220150947A/ko active Pending
  • 2021-03-05 JP JP2022552739A patent/JP7783187B2/ja active Active
  • 2021-03-05 US US17/908,507 patent/US12305212B2/en active Active
  • 2021-03-05 WO PCT/EP2021/055617 patent/WO2021176068A1/de not_active Ceased
  • 2021-03-05 EP EP21709988.6A patent/EP4114929A1/de active Pending

Patent Citations (1)

Non-Patent Citations (9)

Also Published As

Similar Documents

Legal Events