WO2021169457A1 - Sgrna of targeting tetracycline resistance gene teta, knockout vector thereof, method for establishing vector, and application thereof - Google Patents

Abstract

An sgRNA of a specific targeting antibiotic resistance gene tetA, a CRISPR/Cas9 gene knockout vector containing the sgRNA, a method for establishing the vector, and an application thereof, i.e., an SgRNA of a targeting tetracycline resistance gene tetA, a knockout vector thereof, a method for establishing the vector, and an application thereof. The sgRNA sequence which performs targeted cutting on the tetA gene is screened out by means of the sequence analysis on the tetracycline resistance gene tetA. Experiments verify that the provided CRISPR/Cas9 knockout vector can efficiently perform targeted cutting on the 251st to 270th sequences of the tetA gene.

Description

SgRNA targeting tetracycline resistance gene tetA and its knockout vector, vector construction method and application Technical field

The present invention relates to the field of biotechnology, in particular to sgRNA specifically targeting the antibiotic resistance gene tetA, a CRISPR/Cas9 gene knockout vector containing the sgRNA, and a construction method and application thereof.

Background technique

In recent years, with the extensive use of antibiotics in livestock and poultry breeding and clinical treatment, the abundance of antibiotic-resistant bacteria and antibiotic-resistant genes in the environment is increasing. Antibiotic resistance genes can cause bacteria to develop antibiotic resistance and are currently regarded as a new type of environmental pollutant. Tetracycline antibiotics are a class of broad-spectrum antibiotics produced or semi-synthesized by actinomycetes. Due to their low price, they are not only used as drugs to treat bacterial infections in humans or animals, but also as commonly used feed additives to improve Feed utilization rate promotes the growth of farmed animals. The abuse of tetracycline has led to the widespread spread of tetracycline resistance genes among bacteria, which has continuously weakened the therapeutic effect of tetracycline and has potential health risks to humans and animals. The tetA gene is an important one of the tetracycline resistance genes, and it has been widely detected in soil, surface water, atmosphere, sewage treatment plants, sediments and other environments.

At present, the reduction of antibiotic resistance genes is mainly through changes in the microbial community structure, for example, the reduction of microbial biomass through filtration. However, these methods have not fundamentally destroyed the resistance genes, and the remaining resistance genes in the system can still migrate and transform through integration, transposition, and conjugative transfer. The CRISPR/Cas9 system is an emerging gene editing technology in recent years. The Cas9 protein can target and cut specific sequences under the guidance of specific guide-RNAs. Some researchers have used the CRISPR/Cas9 system to knock out the functional genes of E. coli and other microorganisms, but the current research on the use of this system to knock out tetracycline resistance genes is still lacking.

Summary of the invention

The purpose of the present invention is to provide sgRNA specifically targeting the tetracycline resistance gene tetA, a CRISPR/Cas9 gene knockout vector containing the sgRNA, and a construction method thereof.

In the first aspect, the sgRNA sequence involved in the present invention targets the sequence from position 251 to position 270 of the tetA gene. The Cas9 protein has a good cleavage effect on this site under the guidance of the sgRNA. The specific nucleoside of the sgRNA The acid sequence is shown in sgRNA-1 (SEQ ID No. 1).

sgRNA-1: 5'-CATGATGGCGTAGTCGACAG-3'.

In the second aspect, the present invention provides a CRISPR/Cas9 gene knockout vector containing the above-mentioned sgRNA that specifically targets the nucleotide sequence 251 to 270 of the tetA gene. Preferably, the CRISPR/Cas9 gene knockout vector map is as attached Shown in Figure 3.

The aforementioned CRISPR/Cas9 gene knockout vector is a single plasmid system, that is, the same plasmid vector is used to express the Cas9 protein and sgRNA required for gene knockout.

In a third aspect, the present invention provides a method for constructing the above-mentioned CRISPR/Cas9 gene knockout vector, which is: the Cas9 protein gene, the above-mentioned sgRNA gene, the conjugation transfer site, the replicon, and the selection marker gene are obtained by a seamless cloning method. CRISPR/Cas9 gene knockout vector.

The construction of the aforementioned CRISPR/Cas9 gene knockout vector includes the following steps:

(1) Synthesize the expression element sgRNA (tetA) containing the above sgRNA sequence. The expression element includes the prokaryotic J23119 (SpeI) promoter, the above sgRNA sequence, the gRNA scaffold sequence and the terminator sequence. The sequence is as shown in SEQ ID No. 2. Show (the sequence is as follows):

(2) Insert the sgRNA (tetA) synthesized in step (1) into the puc57 vector to obtain the vector puc57-sgRNA (tetA). The map is shown in Figure 1.

(3) Using the pk18mobsacB plasmid as a template, primer pair 1 PCR was used to amplify the RP4-oriT sequence, where the RP4-oriT sequence contained the conjugative transfer site, and the amplified product was gel purified.

(4) Using the puc57-sgRNA (tetA) in step (2) as a template, the oriV-sgRNA (tetA) sequence was amplified by PCR using primer pair 2 and the amplified product was gel purified.

(5) The primer pairs 1 and 2 involved in steps (3) and (4) contain homologous fragments. Use seamless cloning to connect the amplified products purified in steps (3) and (4) to obtain puc57-oriT- The map of sgRNA (tetA) plasmid is shown in Figure 2.

(6) Using the pCas plasmid as a template, the Cas9-Kan sequence was amplified by primer pair 3 PCR, and the amplified product was gel purified.

(7) Using the puc57-oriT-sgRNA (tetA) obtained in step (5) as a template, the oriV-oriT-sgRNA (tetA) sequence is amplified by primer pair 4 PCR, and the amplified product is gel purified.

(8) The primer pairs 3 and 4 involved in steps (6) and (7) contain homologous fragments. Use seamless cloning to connect the amplified products purified in steps (6) and (7) to obtain puc57-oriT- The Cas9-sgRNA (tetA) plasmid, whose map is shown in Figure 3, is a CRISPR/Cas9 gene knockout vector targeting the sequence from position 251 to position 270 of the tetA gene.

Primer pair 1:

OriT-S: CTGGAGGATCATCCAGCCCTG

OriT-F:GCCGAGCTTCCTGCTGAACATC

Primer pair 2

Puc19-F:GATGTTCAGCAGGAAGCTCGGCCTTCCGCTTCCTCGCTCACTG

Puc19-S:ATCAGGGCTGGATGATCCTCCAGTCATTAATGCAGCTGGCACGAC

Primer pair 3:

Fragment-F:ATCTCAGCGATCCAGGTCATTCAGACTGGCTAATGC

Fragment-S: GATGATCCTCCAGGATGTAGCCGTCAAGTTGTCAT

Primer pair 4:

Vector-F:GACGGCTACATCCTGGAGGATCATCCACGTACAGCACTGATGCATCG

Vector-S: TCTGAATGACCTGGATCGCTGAGATAGGTGCCTC

Similarly, the present invention uses PCR amplification and seamless cloning to obtain puc57-oriT-Cas9-△sgRNA plasmid. Its map is shown in Figure 4. Compared with puc57-oriT-Cas9-sgRNA (tetA), the plasmid lacks The sgRNA (tetA) sequence containing the above-mentioned sgRNA cannot perform the function of gene knockout, while puc57-oriT-Cas9-sgRNA (tetA) can perform the function of knockout.

The PCR reaction mentioned above uses a 50ul system, and the reaction system is as follows: PrimeSTAR Max Premix 25ul, 1ul _{upstream and downstream primers, 1ul template, 22ul ddH 2 O.}

The PCR reaction procedure involved above is as follows: denaturation at 98°C for 10s, annealing at 55°C for 10s, extension temperature at 72°C, speed of 5s/kb, and cycle number of 30.

The above-mentioned seamless cloning reaction system is as follows: 1ul NovoRec plus recombinase, 4ul 5× buffer, 0.05pmol long fragment, 0.025pmol short fragment, _{supplement the reaction system to 20ul with ddH 2} O, and react at 50°C for 15 minutes .

In a fourth aspect, the present invention provides a microorganism, which contains the above-mentioned puc57-oriT-Cas9-sgRNA (tetA) plasmid. Wherein, the microorganism is Escherichia coli, which is obtained by transforming competent Escherichia coli into puc57-oriT-Cas9-sgRNA (tetA) plasmid.

The beneficial effects of the present invention include:

(1) The present invention selects the above-mentioned sgRNA sequence targeted to cut the tetA gene through sequence analysis of the tetracycline resistance gene tetA. Experiments have verified that the CRISPR/Cas9 knockout vector provided by the present invention can efficiently target and cut the sequence from position 251 to position 270 of the tetA gene.

(2) The CRISPR/Cas9 knockout vector provided by the present invention can enter recipient cells through transformation or conjugative transfer, and perform targeted cleavage of the target sequence in the recipient cell (high-efficiency targeted cleavage of the tetA gene from position 251 to position 270-bit sequence).

(3) The CRISPR/Cas9 knockout vector and its construction method provided by the present invention have strong practicability, and provide an effective method and basis for the knockout and research of tetA gene and other resistance genes.

Description of the drawings

Figure 1 is a map of puc57-sgRNA (tetA) plasmid in Example 2 of the present invention. The figure shows the replicon (ori), the ampicillin resistance gene (Amp), and the expression element sgRNA (tetA) of sgRNA-1.

Figure 2 is a map of puc57-oriT-sgRNA (tetA) plasmid in Example 2 of the present invention. This plasmid adds a conjugative transfer site (OriT) on the basis of the puc57-sgRNA (tetA) plasmid.

Figure 3 is a plasmid map of the puc57-oriT-Cas9-sgRNA (tetA) knockout vector in Example 2 of the present invention. The figure shows the replicon (ori), the Kanar resistance gene (Kan), the sgRNA-1 expression element sgRNA (tetA), the Cas9 protein gene (Cas9) and the conjugative transfer site (OriT).

Figure 4 is a plasmid map of the puc57-oriT-Cas9-ΔsgRNA control vector in Example 2 of the present invention. Compared with the puc57-oriT-Cas9-sgRNA (tetA) plasmid, this plasmid lacks the expression element sgRNA (tetA) of sgRNA-1.

Fig. 5 is the result of the junction transfer experiment in Example 3 of the present invention. There was a significant difference in the number of bacterial colonies between the experimental group and the control group (P<0.01).

Detailed ways

The present invention will be further explained below in conjunction with specific embodiments. These examples are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, after reading the content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims of the present application.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

Example 1 Obtaining the sgRNA sequence specifically targeting tetA gene

(1) Download the gene sequence of the tetracycline resistance gene tetA (GenBank: NG_048148.1) from the website http://www.ncbi.nlm.nih.gov.

(2) Import the sequence obtained in (1) into https://zlab.bio/guide-design-resources to obtain qualified sgRNA, and select sgRNA-1 and sgRNA-1 with higher efficiency and specificity scores. The sequence is as follows:

sgRNA-1: 5'-CATGATGGCGTAGTCGACAG-3'.

Example 2 Construction of CRISPR/Cas9 gene knockout vector containing sgRNA-1

The construction method of CRISPR/Cas9 gene knockout vector containing sgRNA-1 includes the following steps:

(1) Use the software Snapgene to design the expression element sequence sgRNA (tetA) containing sgRNA-1, and synthesize the sequence in Hangzhou Jinke Zixi Biotechnology Company. The expression element contains the prokaryotic J23119 (SpeI) promoter and the above-mentioned sgRNA-1 , GRNA scaffold sequence and terminator sequence, the sequence is shown in sequence 1.

(2) Insert the sgRNA (tetA) synthesized in step (1) into the puc57 vector to obtain the vector puc57-sgRNA (tetA), and transform the vector into E. coli competent cells. The plasmid vector map is shown in Figure 1. .

(3) Using the pk18mobsacB plasmid as a template, primer pair 1 PCR was used to amplify the RP4-oriT sequence, where the RP4-oriT sequence contains the conjugation transfer site, and the amplified product was purified with Tiangen gel purification kit.

(4) Amplify the E. coli positive clones obtained in step (2), extract 5ml of bacterial solution from the 5ml bacterial solution with the Tiangen plasmid small extraction kit, use this plasmid as a template and use primers For 2PCR, the oriV-sgRNA (tetA) sequence was amplified, and the amplification was purified with Tiangen gel purification kit.

(5) The primer pairs 1 and 2 involved in steps (3) and (4) contain homologous fragments. Use the NovoRec plus seamless cloning kit to connect the amplified products purified in steps (3) and (4) to obtain puc57-oriT-sgRNA (tetA) plasmid, and transform the vector into E. coli competent cells. The plasmid vector map is shown in Figure 2.

(6) Using the pCas plasmid as a template, the Cas9-Kan sequence was amplified by primer pair 3 PCR, and the amplified product was purified with Tiangen gel purification kit.

(7) Amplify the E. coli positive clones obtained in step (5), extract 5ml of bacterial liquid from the 5ml bacterial solution with the Tiangen plasmid small extraction kit, and use this plasmid as a template, Primer pair 4 was used to amplify the oriV-oriT-sgRNA (tetA) sequence by PCR, and the amplified product was purified with Tiangen gel purification kit.

(8) The primer pairs 3 and 4 involved in steps (6) and (7) contain homologous fragments. Use the NovoRec plus seamless cloning kit to connect the amplified products purified in steps (6) and (7) to obtain The vector map of the puc57-oriT-Cas9-sgRNA(tetA) plasmid is shown in Figure 3. This plasmid is a CRISPR/Cas9 gene knockout vector targeting the sequence from position 251 to position 270 of the tetA gene.

Similarly, the present invention uses PCR amplification and seamless cloning to obtain the puc57-oriT-Cas9-△sgRNA control plasmid. The plasmid vector map is shown in Figure 4. This plasmid is similar to puc57-oriT-Cas9-sgRNA (tetA) Compared with the lack of sgRNA (tetA) sequence containing sgRNA-1, it cannot perform the function of gene knockout, while puc57-oriT-Cas9-sgRNA (tetA) can perform the function of knockout.

The PCR reaction involved in Example 2 uses PrimeSTAR Max high-fidelity polymerase from Takara Company, and the reaction system is as follows: 25ul PrimeSTAR Max Premix, 1ul _{upstream and downstream primers, 1ul template, and 22ul ddH 2 O.} The PCR reaction procedure is as follows: denaturation at 98°C for 10s, annealing at 55°C for 10s, extension temperature at 72°C, speed of 5s/kb, and cycle number of 30.

The seamless cloning involved in Example 2 uses the NovoRec plus one step PCR Cloning kit. The reaction system is as follows: 1ul NovoRec plus recombinase, 4ul 5× buffer, 0.05pmol long fragment, 0.025pmol short fragment, and ddH ₂ O Replenish the reaction system to 20ul, react at 50°C for 15 minutes

The transformation steps involved in Example 2 are as follows: take 100ul of competent cells to thaw on ice, add the seamless clone ligation product, and place on ice for 30 minutes; put the competent cells in a 42°C water bath for 60 seconds and quickly transfer to an ice bath Cool for 3 minutes; add 500ul LB liquid medium to the competent cells, mix well and place in a 200rpm shaker at 37℃ to recover for 60 minutes; draw 100ul of the recovered competent cells and spread on the corresponding resistant medium , Placed in a constant temperature incubator for 16 hours.

Example 3 Verification of knockout effect of the CRISPR/Cas9 knockout vector constructed in Example 2

For E. coli, under the action of the puc57-oriT-Cas9-sgRNA (tetA) knockout vector, if the plasmid DNA is broken, the plasmid will gradually be lost and tetracycline resistance will be lost. If the chromosomal DNA is broken, the bacteria will It's hard to survive.

1. Use conjugative transfer to verify the reduction effect of the plasmid vector on E. coli containing the tetA gene

(1) Bacterial culture

The Escherichia coli containing the RP4 plasmid was streaked and activated and inoculated in a tetracycline-resistant LB liquid medium, and placed in a constant temperature shaking incubator at 37° C. for shaking for 16 hours at a speed of 200 rpm. Among them, the RP4 plasmid is an IncPα series, a pan-host plasmid that can be conjugatively transferred between a variety of bacteria. Its size is 60099bp. The plasmid carries a variety of antibiotic resistance genes, including the tetracycline resistance gene tetA.

The E. coli containing the puc57-oriT-Cas9-sgRNA (tetA) knockout vector and the puc57-oriT-Cas9-△sgRNA control vector were streaked and activated, respectively, inoculated into the Kanak-resistant LB liquid medium, and placed Incubate with shaking at 37°C for 16 hours in a constant temperature shaking incubator at a speed of 200 rpm.

(2) Bacteria washing

Centrifuge the shake tube after step (1) expansion and culture at 5000 rpm for 5 minutes. After centrifugation, the supernatant was discarded, an appropriate amount of PBS buffer was added to the shake tube to resuspend the deposited bacterial solution and centrifuged again, and the supernatant was discarded again, repeating 3 times in total. Finally, the OD600 value of the bacterial solution was adjusted to 0.7 (±0.03) again with PBS buffer.

(3) Bacterial conjugation

Experimental group: Add 2.5ml of PBS-resuspended Escherichia coli containing RP4 plasmid and 2.5ml of PBS-resuspended Escherichia coli containing puc57-oriT-Cas9-sgRNA (tetA) knockout vector into a 10ml centrifuge tube.

Control group: Add 2.5ml PBS resuspended Escherichia coli containing RP4 plasmid and 2.5ml PBS resuspended Escherichia coli containing puc57-oriT-Cas9-△sgRNA control vector into a 10ml centrifuge tube.

The centrifuge tubes of the experimental group and the control group were cultured with shaking at 37°C for 1 hour, and then placed in a constant temperature incubator at 37°C for 12 hours.

(4) Plate counting

Dilute the bacterial solution of the experimental group and the control group in step (3) to an appropriate concentration, and apply 100 ul of the bacterial solution to the tetracycline-resistant LB solid medium, and repeat 3 times in parallel. The plate was placed in a constant temperature incubator at 37°C for 15 hours, the colonies were counted, and the number of tetracycline-resistant bacteria per unit volume of the bacterial solution in the experimental group and the control group (CFU/ml) was calculated.

(5) Drawing results

According to the results of the plate count in step (4), this experiment uses the R language to draw a box plot of the number of tetracycline-resistant bacterial colonies in the experimental group and the control group, as shown in Figure 5, where the ordinate represents the logarithm of the unit volume The number of colonies (lg(CFU)/ml). The results showed that compared with the control group, the number of colonies carrying tetracycline resistance in the experimental group was significantly reduced (P<0.01), indicating that the puc57-oriT-Cas9-sgRNA (tetA) knockout vector can effectively remove the tetA gene on the RP4 plasmid .

2. The plasmid vector knocks out the homologous fragment of tetA gene in Escherichia coli S17-1 strain

The RP4-2 plasmid is integrated on the chromosome of the E. coli S17-1 strain, which includes the homologous fragment of the tetA gene. Therefore, in this experiment, the puc57-oriT-Cas9-sgRNA (tetA) knockout vector was transformed into the S17-1 strain If the knock-out vector can target the sequence from position 251 to position 270 of the tetA gene, the transformant containing the plasmid will not grow. The specific verification method is as follows:

(1) Conversion

Take 100ul of Escherichia coli S17-1 competent cells and thaw them on ice to a state of ice-water mixture, and divide the 100ul competent cells into 2 parts, 50ul each, and place them in 2 centrifuge tubes.

Experimental group: Add 100ng puc57-oriT-Cas9-sgRNA (tetA) knockout vector to 50ul competent cells, and place on ice for 30 minutes.

Control group: Add 100ng puc57-oriT-Cas9-△sgRNA control vector to 50ul competent cells and place on ice for 30 minutes.

The control group and the experimental group were bathed at 42°C for 60 seconds, quickly transferred to an ice bath, and cooled for 3 minutes. Add 500ul of LB liquid medium to the competent cells of the control group and the experimental group respectively. After mixing, place them in a shaker at 37°C and 200rpm to recover for 60 minutes. After diluting to a suitable concentration, draw 100ul of the diluted competent cells and spread them on Repeat 3 times in parallel on the corresponding resistant medium, and place the medium in a constant temperature incubator for 16 hours.

(2) Plate count and results

After culture on resistant plates, the average number of colonies of the control group transformants was 62000CFU/ml, while the average number of colonies of the experimental group transformants was 0CFU/ml. The transformation experiment showed that puc57-oriT-Cas9-sgRNA(tetA) knockout vector It can effectively target the 251st to 270th sequence of tetA gene.

In summary, the sgRNA sequence that specifically targets the tetA gene and the CRISPR/Cas9 knockout vector containing the sgRNA provided by the present invention can efficiently target and cut the sequence from positions 251 to 270 of the tetA gene to realize the resistance gene tetA Knockout of genes. At the same time, the CRISPR/Cas9 knockout vector preparation method provided by the present invention is easier to obtain the CRISPR/Cas9 knockout vector targeting the corresponding antibiotic resistance gene, which provides an effective method for the knockout and research of tetA and other resistance genes. And foundation.

Claims (10)

1. The sgRNA specifically targeting the antibiotic resistance gene tetA is characterized in that the sgRNA targets the sequence from position 251 to position 270 of the tetA gene.
2. The sgRNA that specifically targets the tetA gene according to claim 1, wherein the nucleotide sequence of the coding gene is SEQ ID No. 1: 5'-CATGATGGCGTAGTCGACAG-3'.
3. A CRISPR/Cas9 gene knockout vector containing the sgRNA that specifically targets the tetA gene according to claim 1 or 2.
4. The CRISPR/Cas9 gene knockout vector according to claim 3, characterized in that its map is shown in Figure 3.
5. A method for constructing the CRISPR/Cas9 gene knockout vector of claim 3 or 4, which is characterized in that it comprises:

   (1) According to claim 1 or 2, the sgRNA targeted for cutting the tetA gene is synthesized, and the expression element sgRNA (tetA) containing the sgRNA is synthesized, and the expression element sgRNA (tetA) includes the prokaryotic J23119 (SpeI) promoter and the coding gene The nucleotide sequence of is: 5'-CATGATGGCGTAGTCGACAG-3' sgRNA, gRNA scaffold sequence and terminator sequence, the sequence is as SEQ ID No. 2; insert the expression element sgRNA (tetA) into the puc57 vector to obtain the vector puc57-sgRNA(tetA);

   (2) Use seamless cloning technology to insert the conjugative transfer site (OriT) into the puc57-sgRNA (tetA) vector described in (1) above to obtain the puc57-oriT-sgRNA (tetA) plasmid;

   (3) The target fragments in the puc57-oriT-sgRNA (tetA) plasmid and pCas plasmid described in (2) above were respectively amplified by PCR, and the puc57-oriT-Cas9-sgRNA (tetA) plasmid was obtained by seamless cloning technology.
6. The method according to claim 5, wherein the PCR reaction program of step (3) is denaturation at 98°C for 10s, annealing at 55°C for 10s, extension temperature at 72°C, speed of 5s/kb, and cycle number of 30 The PCR reaction system is PrimeSTAR Max Premix 25ul, the upstream and downstream primers are each 1ul, the template is 1ul, and ddH2O 22ul; the seamless cloning reaction system is NovoRec plus recombinase 1ul, 5× buffer 4ul, long fragment 0.05pmol , The short fragment is 0.025pmol, supplement the reaction system to 20ul with ddH2O, and react at 50°C for 15 minutes.
7. A microorganism containing the CRISPR/Cas9 gene knockout vector of claim 3 or 4, and the microorganism is Escherichia coli.
8. The use of the sgRNA of claim 1 or 2 in knocking out the tetracycline resistance gene tetA.
9. The use of the CRISPR/Cas9 gene knockout vector of claim 3 or 4 in the knockout of the tetracycline resistance gene tetA.
10. The use of the microorganism of claim 7 in knocking out the tetracycline resistance gene tetA.

Images