CN107904228B - Vibrio harveyi homologous recombination gene knockout method based on heat shock - Google Patents

Abstract

The invention discloses a method for knocking out Vibrio harveyi homologous recombination genes based on heat shock, which comprises the following steps: performing heat shock treatment on receptor bacteria of Vibrio harveyi cultured to early logarithmic phase, uniformly mixing the receptor bacteria and donor bacteria cultured to early logarithmic phase in an equal volume, centrifuging at room temperature to remove supernatant, performing resuspension after bacteria precipitation, dibbling the mixture onto a solid plate, jointing overnight, and performing heat shock treatment on the receptor bacteria of Vibrio harveyi to ensure that the joint transformation efficiency of the Vibrio harveyi is from zero to zero, thereby performing gene knockout on the Vibrio harveyi. The method is based on the technology of the traditional joint transfer method, and the joint transformation efficiency of the Vibrio harveyi is enabled to be from zero to zero by carrying out heat shock treatment on the Vibrio harveyi which is a joint acceptor, so that the gene knockout of the Vibrio harveyi is successfully carried out.

Description

Vibrio harveyi homologous recombination gene knockout method based on heat shock

Technical Field

The invention belongs to the technical field of vibrio harveyi, and particularly relates to a heat shock based vibrio harveyi homologous recombination gene knockout method.

Background

Vibrio harveyi is a gram-negative, luminescent, campylobacter, fermentative, polar single flagellum. Vibrio harveyi exists in free water bodies, surfaces of phytoplankton and seabed sediments in oceans in large quantities, is a pathogenic bacterium commonly existing in marine environments, can infect various fishes, shrimps, crabs and the like and cause a large amount of death, and brings huge loss to the mariculture industry. Therefore, the pathogenic mechanism is clarified, the related vaccine is prepared, and the immune control is in the forefront.

The gene knockout, also called gene targeting, is a new type of molecular biology technology, which utilizes conjoint transformation to introduce the constructed targeting vector into the target cell, and then site-specific integration of the vector DNA into a certain site on the genome of the target cell or replacement with a certain fragment on the genome of the target cell by recombining the vector DNA sequence and the homologous DNA sequence on the chromosome in the target cell, so as to inactivate or delete the specific gene of the organism, thereby changing the genetic characteristics of the cell.

The pathogenic mechanism research usually involves genetic engineering operations of gene knockout, and these methods are usually performed by gene joining transfer methods. However, the efficiency of conjugative transfer of this method varies for different species of bacteria. So far, the efficiency of conjugative transfer of Vibrio harveyi has been low and most strains are not successful in conjugative transfer, and the conventional homologous recombination method of gene knockout is often hindered.

Disclosure of Invention

The invention aims at the problem that gene knockout is difficult to carry out due to unsuccessful conjugation transformation or low efficiency of vibrio harveyi, and establishes a method for knocking out the homologous recombination genes of vibrio harveyi based on heat shock by carrying out heat shock treatment on a receptor bacterium vibrio harveyi.

The above purpose of the invention is realized by the following technical scheme: a method for knocking out Vibrio harveyi homologous recombination genes based on heat shock comprises the following steps: performing heat shock treatment on receptor bacteria of Vibrio harveyi cultured to early logarithmic phase, uniformly mixing the receptor bacteria of Vibrio harveyi cultured to early logarithmic phase and donor bacteria cultured to early logarithmic phase in equal volume, centrifuging at room temperature to remove supernatant, performing resuspension after bacterial precipitation, dibbling the mixture onto a solid plate, jointing overnight, and performing heat shock treatment on the receptor bacteria of Vibrio harveyi to ensure that the jointing transformation efficiency of Vibrio harveyi is from zero to zero, thereby performing gene knockout on the Vibrio harveyi.

Preferably, the temperature during the heat shock treatment is 35-50 ℃.

Further, the temperature of the heat shock treatment of the present invention is 35 to 50 ℃, and the time of the heat shock treatment is 10min or more.

Preferably, the present invention is engaged overnight at 28 ℃.

The donor strain of the present invention is preferably a recombinant suicide plasmid carrying the upstream and downstream homology arms of the fragment to be deleted.

Specifically, the method for knocking out the homologous recombination genes of the vibrio harveyi based on heat shock comprises the following steps:

(1) determining an upstream and downstream sequence of a gene X to be mutated and a suicide plasmid insertion site, designing a recombination vector construction primer by a seamless cloning method by using NEB online software (http:// NEB mu ilder. NEB. com /), and obtaining an upstream homologous arm amplification primer pair X-UP-F/R, a downstream homologous arm amplification primer pair X-DOWN-F/R, a suicide plasmid linearization primer pair P-F/R, a recombination plasmid detection primer pair P-check-F/R and a gene deletion detection primer pair X-Del-check-F/R to be mutated;

(2) extracting Vibrio harveyi genome as a template, based on a primer pair X-UP-F/R and X-DOWN-F/R, obtaining an upstream homologous arm fragment UP and a downstream homologous arm fragment DOWN of which the length of a pseudoknock-out gene is about 1000bp by utilizing a PCR technology, and cutting and recovering gel after agarose electrophoresis detection;

(3) extracting suicide plasmid as a template, obtaining a plasmid fragment P with the length of 3309bp by utilizing a PCR technology based on a primer pair P-F/R, and cutting and recovering gel after agarose electrophoresis detection;

(4) performing isothermal assembly on the upstream and downstream homology arms obtained in the Step (2) and the plasmid fragment obtained in the Step (3) by using a commercial multi-fragment seamless Cloning Kit (Clon express Multi One Step Cloning Kit (Vazyme);

(5) transforming the isothermal assembly liquid into Escherichia coli GEB802 competent cells, and obtaining a positive recon P-delta X after PCR detection;

(6) extracting positive recombinant plasmid P-delta X, transforming into Escherichia coli GEB883 competent cells to obtain P-delta X-E.coli GEB883 carrying recombinants, and taking the P-delta X-E.coli GEB883 as a conjugal donor bacterium;

(7) coli GEB883 was streaked onto LB solid plates supplemented with 20. mu.g/mL chloramphenicol and 0.3mM DAP (2,6-Diaminopimelic acid), and cultured overnight at 37 ℃ for activation;

(8) selecting a monoclonal colony formed by the activated bacteria in the step (7), inoculating the colony in an LB liquid culture medium added with 20 mu g/mL chloramphenicol and 0.3mM DAP, and culturing at 37 ℃ and 200rpm until the logarithmic early OD600nm is 0.3-0.7;

(9) preparing an LBS solid flat plate, and carrying out overnight culture and activation on receptor bacteria Vibrio harveyi at 28 ℃;

(10) selecting the monoclonal colonies formed by the activated bacteria in the step (9), inoculating the colonies in an LBS-added liquid culture medium, and culturing at 28 ℃ and 200rpm until the log-early OD600nm is 0.3-0.7;

(11) transferring 0.5mL (10) of prepared recipient bacteria into a 1.5mL sterile centrifuge tube by a liquid transfer machine, placing the sterile centrifuge tube into a metal bath, carrying out heat shock treatment at 35-50 ℃ for more than 10min, uniformly mixing the sterile centrifuge tube with 0.5mL of prepared donor bacteria in the step (8), and centrifuging the mixture at 6000rpm and room temperature for 3 min;

(12) after removing the supernatant, the bacterial pellet is resuspended by 50 μ L LBS liquid medium, dibbled to LBS +0.3mM DAP solid plate, cultured overnight at 28 ℃;

(13) scraping overnight junctional bacterial plaque by using an inoculating ring, suspending in 1mL LBS liquid culture medium, centrifuging at 11,000rpm and room temperature for 2min, removing supernatant, and suspending thallus precipitate in 1mL LBS liquid culture medium;

(14) centrifuging at 11,000rpm for 2min, removing supernatant, resuspending thallus precipitate with 0.1mL LBS liquid culture medium, coating on LBS +34 μ g/mL Cm + 0.2% D-glucose plate, and performing inverted culture at 28 deg.C until clone grows out;

(15) the conjugal clones that underwent the first homologous recombination were purified twice on the same plate;

(16) the joint clone is streaked on an LBS + 0.2% arabinosine solid plate, the joint clone is subjected to second homologous recombination, and the vector leaves the chromosome of the recipient bacterium, so that the vector leaves the recipient bacterium;

(17) recombinant clones were purified on LBS + 0.2% arabinosine plates and simultaneously streaked to LBS +34 μ g/ml Cm + 0.2% arabinosine plates to test whether they were Cm resistant;

(18) and carrying out PCR detection on arabinose resistant and chloramphenicol sensitive clones based on a primer pair X-Del-check-F/R to obtain mutant strains.

Further, the suicide plasmid in the step (1) is pSW7848, is a low copy plasmid, carries chloramphenicol resistance, has R6K replication origin requiring pir protein, transfer origin oriT, and arabinose-induced virulence gene ccdB;

further, Escherichia coli GEB802 described in step (5) may encode the pir protein and is auxotrophic for 2' -Dexythymine (Thy);

further, Escherichia coli GEB883 described in step (6) may encode pir protein and is 2,6-Diaminopimelic Acid (DAP) auxotrophic, and may encode RP4 for conjugative transfer;

further, the LB solid plate configured with 20. mu.g/mL chloramphenicol and 0.3mM DAP (2,6-Diaminopimelic acid) described in step (7) contained 5g/L yeast extract, 10g/L, NaCl 10g/L peptone, 15g/L technical agar powder, 20. mu.g/mL chloramphenicol, and 0.3mM DAP.

Further, the LB liquid medium supplemented with 20. mu.g/mL chloramphenicol and 0.3mM DAP as described in step (8) contained 5g/L yeast extract, 10g/L, NaCl 10g/L peptone, 20. mu.g/mL chloramphenicol and 0.3mM DAP, and the balance water.

Further, the LBS solid plate prepared in the step (9) contains 5g/L of yeast extract, 10g/L, NaCl 30g/L of peptone and 15g/L of technical agar powder;

further, the LBS liquid medium in the step (10) contains 5g/L of yeast extract, 10g/L, NaCl 30g/L of peptone and the balance of water;

further, LBS +0.3mM DAP solid plate described in step (12) contains yeast extract 5g/L, peptone 10g/L, NaCl 30g/L, technical agar powder 15g/L and 0.3mM DAP.

Further, LBS + 34. mu.g/mL Cm + 0.2% D-gl. mu.cose solid plate described in step (14) contains yeast extract 5g/L, peptone 10g/L, NaCl 30g/L, technical agar powder 15g/L, 34. mu.g/mL chloramphenicol and 0.2% D-gl. mu.cose.

Further, LBS + 0.2% arabinosine solid plate described in step (16) contains 5g/L yeast extract, 10g/L, NaCl 30g/L peptone, 15g/L technical agar powder and 0.2% arabinosine.

Further, LBS + 34. mu.g/mL Cm + 0.2% arabinase solid plate described in step (17) contained yeast extract 5g/L, peptone 10g/L, NaCl 30g/L, technical agar powder 15g/L, 34. mu.g/mL chloramphenicol and 0.2% arabinase.

The invention has the following advantages:

(1) the invention relates to a heat shock-based vibrio harveyi homologous recombination gene knockout method, which is characterized in that the method successfully performs gene knockout on vibrio harveyi by carrying out heat shock treatment on a joint acceptor bacterium vibrio harveyi on the basis of the traditional joint transfer method to ensure that the joint conversion efficiency of the vibrio harveyi is from zero to zero;

(2) the invention carries out the gene knockout of the vibrio harveyi based on the principle of twice homologous recombination, has simple operation, carries out heat shock treatment on receptor bacteria in the process of conjugal transformation, ensures that the conjugal transformation efficiency is changed from nothing to nothing, and the quality is changed, develops a platform for knocking out the vibrio harveyi homologous recombination gene, is different from the traditional transposition insertion mutation, has definite purpose, is difficult to generate polar effect, does not introduce exogenous genes, and ensures that the function analysis of target genes is more accurate.

Drawings

FIG. 1 is a flow chart of the construction of a Vibrio harveyi fragment and a gene knockout based on a heat shock in example 1, which is exemplified by rbsB;

FIG. 2 is a graph showing the results of electrophoretic detection of the upstream and downstream homology arms of rbsB in example 1, wherein lane M is DL2000DNA marker, lane 1 is the result of amplification of the upstream homology arm of rbsB, and lane 2 is the result of amplification of the downstream homology arm of rbsB;

FIG. 3 is a graph showing the results of electrophoretic detection of linearized fragments of pSW7848 in example 1, wherein lane M is DL10000DNA marker, and lane 1 is the result of linearized amplification of pSW 7848;

FIG. 4 is a diagram showing the result of electrophoretic detection of recombinants in example 1, wherein lane M is DL10000DNA marker, and lane 1 is the result of PCR detection of recombinants;

FIG. 5 is a diagram showing the results of electrophoresis detection of the R.harveyi rbsB mutant strain in example 1, wherein lane M is DL2000DNAmarker, lane 1 is the result of PCR detection of the mutant strain, and lane 2 is the result of amplification of the wild strain.

Detailed Description

The technical solution of the present invention is further described below with reference to the following examples, but the scope of the present invention is not limited thereto.

The source of the biological material is as follows:

the recombinant intermediate host E.coli GEB802, the donor strain E.coli GEB883 and the suicide plasmid pSW7848 are donated by professor Annick JACQ of university of Paris eleven; homology arms and DNA polymerase used for plasmid linearized amplification are high-fidelity enzymes from Takara

Max DNA Polymerase, Premix Taq from Takara as DNA Polymerase for detecting recombinants and mutations ^TM DNA Polymerase; the bacterial genome extraction kit is purchased from Tiangen Biotechnology limited; the plasmid extraction kit is purchased from MACHEREY-NAGEL, Germany; gel recovery kits were purchased from Axygen; the seamless cloning kit was purchased from biotechnology limited of nuozokenza, south kyo.

General description:

preparation of competent cells of E.coli GEB802 or E.coli GEB883

(1) Coli GEB802 or E.coli GEB883 was streaked onto LB solid plates supplemented with 0.3mM Thy or 0.3mM DAP, and incubated overnight at 37 ℃;

(2) e.coli GEB802 or E.coli GEB883 was picked up and cultured overnight at 37 ℃ and 200rpm in LB liquid medium supplemented with 0.3mM Thy or 0.3mM DAP;

(3) diluting 1mL of overnight-culture liquid to 100mL of LB liquid medium added with 0.3mM Thy or 0.3mM DAP, and culturing at 37 ℃ and 200rpm until OD600nm is 0.6-0.8;

(4) cooling the bacterial liquid on ice for 10min, and centrifuging at 4000rpm at 4 ℃ for 15 min;

(5) removing supernatant, and sterilizing the bacterial pellet with 50mL sterilized and cooled 50mM CaCl ₂ Resuspending, placing on ice for 20 min;

(6) centrifuging the bacterial liquid at 4 ℃ and 4000rpm for 15 min;

(7) the supernatant was removed and the pellet was treated with 2.5mL of sterilized and cooled 50mM CaCl containing 25% glycerol ₂ Resuspending;

(8) the resuspended cells were aliquoted into 100. mu.L/tube using a sterile 1.5mL centrifuge tube and placed at-80 ℃ until needed.

Transformation of isothermal assembly liquid or positive recombinant plasmid into competent cells of E.coli GEB802 or E.coli GEB883

(1) Thawing 100 μ le. coli GEB802 or e. coli GEB883 competent cells on ice;

(2) adding 5.0 μ L of isothermal assembly solution or positive recombinant plasmid into 100 μ L of competent cells, gently mixing, and incubating on ice for 20 min;

(3) thermally shocking at 42 deg.C for 2min, immediately placing on ice and incubating for 2 min;

(4) adding 1mL LB liquid medium added with 0.3mM Thy or 0.3mM DAP, shaking and culturing at 37 deg.C and 150rpm for 1 h;

(5) coating 100 mu L of the bacterial liquid on an LB solid plate added with 20 mu g/mL chloramphenicol and 0.3mM Thy or 0.3mM DAP, and performing inverted culture at 37 ℃ overnight until the clone grows out;

(6) selecting a single clone with toothpick, culturing the single clone in an LB liquid culture medium added with 20 mu g/mL chloramphenicol and 0.3mM Thy or 0.3mM DAP, detecting by PCR after thalli grow out, and cryopreserving the positive clone in a sterilized cryopreservation tube by using sterilized 15% glycerol, and storing the positive clone at the temperature of-80 ℃ for later use.

Example 1

A step of realizing homologous recombination gene knockout of Vibrio harveyi based on a heat shock method is described by taking a gene rbsB (ABC transporter substrate-binding protein) as an example (figure 1).

The full length of ORF of rbsB gene (SEQ ID NO.1) is 879bp, which can code ribosome binding protein composed of 292 amino acids, and the main function is involved in the binding and transport of D-ribose. In some bacteria, the gene is also supposed to be used as an AI-2 receptor, participate in quorum sensing, and mediate bacterial growth and biofilm formation, but the specific regulation mechanism is not clear.

The rbsB gene knockout strain obtained in the research provides a premise for the deep research of the function of the rbsB gene, and the elucidation of the gene function is helpful for further analyzing the pathogenic mechanism of Vibrio harveyi and can be used as a potential target point for vaccine development.

(1) Determining an upstream and downstream sequence of a gene rbsB to be mutated and an insertion site of a suicide plasmid pSW7848, designing a recombination vector construction primer by a seamless cloning method by using NEB online software (http:// NEB μ ilder. NEB. com /), obtaining an upstream homologous arm amplification primer pair rbsB-UP-F/R, a downstream homologous arm amplification primer pair rbsB-DOWN-F/R, a suicide plasmid linearization primer pair pSW7848-F/R, a recombination plasmid detection primer pair pSW7848-check-F/R and a gene deletion detection primer pair rbsB-Del-check-F/R to be mutated;

the PCR primer sequences are as follows:

rbsB-UP-F：aagcttgatatcgaattcgtcactgattgcactgttatttttg

rbsB-UP-R：tttacctgacgttctagtcctttgtgtaggg

rbsB-DOWN-F：ctagaacgtctggtaaagatgtactcatcgttggc

rbsB-DOWN-R：ttggtaacgaatcagacgccgcttcttgtgcgctg

pSW7848-F：gtctgattcgttaccaattatgacaac

pSW7848-R：gaattcgatatcaagcttatcgatac

pSW7848-check-F：tcactgtcccttattcgcacc

pSW7848-check-R：ctgcttttgagcactacccg

rbsB-Del-check-F：tgggtggtaaaggtcgcataa

rbsB-Del-check-R：tcgcctggacgagggaaag

(2) extracting Vibrio harveyi genome as template, based on primer pair rbsB-UP-F/R and rbsB-DOWN-F/R, obtaining 996bp upstream homologous arm fragment UP and 1022bp downstream homologous arm fragment DOWN (SEQ ID NO.1, as shown in figure 2) by PCR technology, cutting gel and recovering after agarose electrophoresis detection, recovering product and storing at-20 ℃ for later use;

the PCR amplification system is as follows:

2 XPrimeSTAR Max Premix 25.0. mu.L, upstream primer F (10. mu.M) 2.0. mu.L, downstream primer R (10. mu.M) 2.0. mu.L, genomic template (20 ng/. mu.L) 2.0. mu.L, with ddH ₂ O is complemented to 50 mu L;

the PCR amplification procedure is as follows:

pre-denaturation at 98 ℃ for 30 sec; denaturation at 98 ℃ for 10sec, 55 ℃ for 5sec, 72 ℃ for 5sec, 35 cycles; extension for 7min at 72 ℃.

(3) Extracting suicide plasmid as template, based on primer pair pSW7848-F/R, obtaining plasmid linearized fragment (shown in figure 3) with length of 3309bp by PCR technology, cutting gel and recovering after agarose electrophoresis detection, recovering product and storing at-20 deg.C for use;

the PCR amplification system is as follows:

2 XPrimeSTAR Max Premix 25.0. mu.L, upstream primer F (10. mu.M) 2.0. mu.L, downstream primer R (10. mu.M) 2.0. mu.L, plasmid template (1 ng/. mu.L) 2.0. mu.L, with ddH ₂ O is complemented to 50 mu L;

the PCR amplification procedure was as follows:

pre-denaturation at 98 ℃ for 30 sec; denaturation at 98 ℃ for 10sec, 53 ℃ for 15sec, 72 ℃ for 17sec, 35 cycles; extension for 7min at 72 ℃.

(4) Carrying out isothermal assembly on the upstream and downstream homology arms obtained in the step (2) and the plasmid fragments obtained in the step (3) by utilizing a commercialized multi-fragment seamless cloning kit;

(5) transforming the isothermal assembly liquid into Escherichia coli GEB802 competent cells, detecting by PCR based on a primer pair pSW7848-check-F/R to obtain a positive recombinant pSW 7848-delta rbsB (SEQ ID NO.2), and detecting a PCR product by agarose gel electrophoresis, wherein the length of the PCR product is 2216bp (shown in figure 4);

the PCR amplification system is as follows:

2×Premix Taq ^TM (DNA Polymerase, Buffer, dNTP mix) 25.0. mu.L, forward primer F (10. mu.M) 2.0. mu.L, reverse primer R (10. mu.M) 2.0. mu.L, bacterial suspension template 2.0. mu.L, ddH ₂ O is complemented to 50 mu L;

the PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30sec, 57 ℃ for 30sec, 72 ℃ for 2.5min, 35 cycles; extension at 72 ℃ for 10 min.

(6) Extracting positive recombinant plasmid pSW 7848-delta rbsB, transforming into escherichia coli E.coli GEB883 competent cells to obtain pSW 7848-delta rbsB-E.coli GEB883 carrying recombinants, and taking the pSW 7848-delta rbsB-E.coli GEB883 as a conjugal donor bacterium;

(7) donor strain pSW7848- Δ rbsB-E.coli GEB883 was streaked onto LB solid plates supplemented with 20. mu.g/mL chloramphenicol and 0.3mM DAP (2,6-Diaminopimelic acid), activated by overnight culture at 37 ℃;

(8) selecting a monoclonal colony formed by the activated bacteria in the step (7), inoculating the colony in an LB liquid culture medium added with 20 mu g/mL chloramphenicol and 0.3mM DAP, and culturing at 37 ℃ and 200rpm until the logarithmic early OD600nm is 0.3-0.7;

(9) preparing an LBS solid flat plate, and performing overnight culture activation on a receptor bacterium Vibrio harveyi at 28 ℃;

(10) selecting the monoclonal colonies formed by the activated bacteria in the step (9), inoculating the colonies in an LBS-added liquid culture medium, and culturing at 28 ℃ and 200rpm until the log-early OD600nm is 0.3-0.7;

(11) transferring 0.5mL (10) of prepared recipient bacterium into a 1.5mL sterile centrifuge tube by a liquid transfer machine, placing the sterile centrifuge tube into a metal bath, carrying out heat shock treatment at 38 ℃ for 30min, uniformly mixing the sterile centrifuge tube with 0.5mL of prepared donor bacterium in the step (8), and centrifuging the sterile centrifuge tube at 6000rpm and room temperature for 3 min;

(12) after removing the supernatant, the bacterial pellet was re-seeded with 50 μ L LBS liquid medium to LBS +0.3mM DAP solid plate, and cultured overnight at 28 ℃;

(13) scraping overnight junctional bacterial plaque by using an inoculating ring, suspending in 1mL LBS liquid culture medium, centrifuging at 11,000rpm and room temperature for 2min, removing supernatant, and suspending thallus precipitates in 1mLLBS liquid culture medium;

(14) centrifuging at 11,000rpm for 2min, removing supernatant, resuspending thallus precipitate with 0.1mL LBS liquid culture medium, coating on LBS +34 μ g/mL Cm + 0.2% D-glucose plate, and performing inverted culture at 28 deg.C until clone grows out;

(15) the conjugal clones that underwent the first homologous recombination were purified twice on the same plate;

(16) the joint clone is streaked on an LBS + 0.2% arabinosine solid plate, the joint clone is subjected to second homologous recombination, and the vector leaves the chromosome of the recipient bacterium, so that the vector leaves the recipient bacterium;

(17) recombinant clones were purified on LBS + 0.2% arabinase plates and simultaneously streaked to LBS +34 μ g/ml Cm + 0.2% arabinase plates to determine whether they were Cm resistant;

(18) based on the primers, rbsB-Del-check-F/R arabinose resistance and chloramphenicol sensitivity clone are subjected to PCR detection to obtain a mutant strain delta rbsB-Vibrio harveyi, meanwhile, DNA of a wild strain V.harveyi SCS-2 is used as a template, PCR amplification is subjected to contrast, and agarose gel electrophoresis is used for detecting PCR products, wherein the length of the wild strain is 1413bp, and the length of the mutant strain is 735bp (shown in figure 5).

The PCR amplification system is as follows:

2×Premix Taq ^TM (DNA Polymerase, Buffer, dNTP mix) 25.0. mu.L, forward primer F (10. mu.M) 2.0. mu.L, reverse primer R (10. mu.M) 2.0. mu.L, bacterial suspension template 2.0. mu.L, ddH ₂ O is complemented to 50 mu L;

the PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30sec, 58 ℃ for 30sec, 72 ℃ for 1.5min, 35 cycles; extension for 10min at 72 ℃.

The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The above-described embodiments of the present invention are to be considered in all respects as illustrative and not restrictive. For example, the recipient bacterium Vibrio harveyi can be treated by heat shock for more than 10min within the range of 35-50 ℃ to knock out any gene or nucleotide fragment in Vibrio harveyi. Therefore, any minor modifications, equivalent changes and modifications to the above embodiments according to the spirit of the present invention are within the scope of the technical solution of the present invention.

Sequence listing

<110> research institute for south China sea aquatic products

<120> heat shock based vibrio harveyi homologous recombination gene knockout method

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2696

<212> DNA

<213> ribosome binding protein (rbsB)

<400> 1

gtcactgatt gcactgttat ttttgattgt tgtcgtgtca tttttgaacc cgaacttttt 60

tacggtagac aacattctta atatccttcg tcaaacctca gttaacgcaa tcatcgcggt 120

aggtatgacg ttggttatcc tgaccgcagg catcgaccta agcgtaggtt ctgtactcgc 180

actatgtggt gcgtttgccg cgagcatgat tgcattagaa gtgcctgtgc ttatcgcagt 240

tccgactgca ttgttcgctg gtgcggcttt gggggcgatc agcggtatca tcattgccaa 300

aggtaaggtt caagccttta tcgcaacact ggttaccatg acgttactac gcggcgtgac 360

gatggtttac accgacggtc gtcctatctc tacgggcttt actgacacag cagatgcatt 420

tgcatggttt ggtacaggtt acgcacttgg tatcccggtt ccagtttggt tgatggtgat 480

tgtctttgcg gcagcttggt acctactgaa ccacactcgt tttggtcgct acgtgtacgc 540

acttggtggc aacgaatcag caacgcgcct ttctggtatc aacgttgacc gtgtgaaaat 600

tggtgtatac gccatctgcg gcatgttggc agcgcttgct ggcattatcg tgacgtctcg 660

tctgtcttcg gcacaaccaa cagcgggtat gggctacgag ctagacgcta tcgcagcggt 720

tgttcttggc ggtaccagct tgatgggtgg taaaggtcgc ataatgggaa cattgattgg 780

tgctctaatc atcggcttcc taaacaacgc gctgaaccta ctcgatgttt cttcttacta 840

ccaaatgatt gcgaaagcag tggttatctt gctagcagta ctggtagaca acaaaaacaa 900

gtaattgata tttaaaataa agagctccat tacatcctga atacaaaccg agccagagga 960

cgtgtgctgg ctcaccctac acaaaggact agaacgatga aaaaactcgc aactcttatc 1020

tctgctgcac ttctttcttc aaccgtatcg gtagcggcgc acgctcaaga tacaatggcg 1080

attgtagttt ctacattgaa taacccgttc ttcgtaacga tgaaagacgg tgcagaagcg 1140

aaagcgaaag aactgggata cgacttgatt gtactggact cgcaaaatga cccgagtaaa 1200

gaactgtcaa acatcgaaga cctaacgatt cgtggcgtaa aagcgattct gattaaccca 1260

acagattcag acgctgtgtc aaacgcaatt cgtatggcga accgttctaa gatccctgtg 1320

ttgacactag accgtggtgc aagccgtggt gacgtagtga gccacatcgc ttctgacaac 1380

gtagttggtg gcgaaatggc tggtcactac atcatggaaa aagtaggtga gaaagcgaaa 1440

gttatccagc tagaaggtat tgccggtacg tctgcggcgc gtgagcgtgg tgaaggcttc 1500

atgacagcag tgaagggcag caacatggag ctactagcaa gccaacctgc tgattttgac 1560

cgtactaaag gtctgaacgt aatggaaaac ttgcttgcag cgaaccctga cgttcaagca 1620

gtatttgctc agaacgatga gatggcactg ggtgcgcttc gcgcagttca agcgtctggt 1680

aaagatgtac tcatcgttgg cttcgacggc actgacgacg gcattgcagc agttaaccgt 1740

ggcaagctag cagcaactat cgcgcagcag ccagatctta ttggtgcttt gggtgtagaa 1800

acggccgaca aagtattgaa aggtgagaag gttgaggagt acattcctgt tccgcttaaa 1860

gtcgtgacta agtaagttta actcccaact cagtgattct tctttgttga agataatgga 1920

atgacccaat gaatgtgttg ggtcattcca aacaacaaaa atggtacgtt agaaaactga 1980

atctatttga atcgtaatac gcttacgttt tttcaaagag cgtaaaccta ttactcctgt 2040

tcaaatataa agggttcatt cagaaccgag gataaccgta tgaataagtt agtggtgtta 2100

ggtagtgtaa acgctgacca tgttcttcaa gtgccttctt tccctcgtcc aggcgagacg 2160

ctgcatggtc gcaactatca agttatccca ggtggcaagg gtgccaacca agctgttgcg 2220

gcagctcgat taaacgcaga catcggtttt attgcgtgtg tgggtgatga ttcattcggc 2280

atcaacattc gtgagaactt caaaatggat ggtatcgaca ttgctggcgt gaaaatgcag 2340

ccgaactgcc caacgggcat tgccatgatt caagtggcgg acagcggcga gaacagcatt 2400

tgtatctccg cagaagccaa cgccaagctg actgcagagg cgattgagcc agatctagag 2460

cgcattcgtc aggctgatta cttgttgatg caactagaaa cgccaatgtg cggcatcgag 2520

aaagctgcgc gaatcgcgaa agatgccaaa accaacgtca ttctgaaccc agcgccagcg 2580

cgtgaattgt ctgatgagtt actgtcttgc attgatgtca tcacaccaaa tgaaacggaa 2640

gcggaagtac taacaggtgt gacggtaacg gacgatgaca gcgcacaaga agcggc 2696

<210> 2

<211> 5327

<212> DNA

<213> ribosome binding protein (rbsB)

<400> 2

caattgatat cgcgcgcgta atacgactca ctatagggcg aattgggtac cagcgctttt 60

ccgctgcata accctgcttc ggggtcatta tagcgatttt ttcggtatat ccatcctttt 120

tcgcacgata tacaggattt tgccaaaggg ttcgtgtaga ctttccttgg tgtatccaac 180

ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc gagcgggtgt tccttcttca 240

ctgtccctta ttcgcacctg gcggtgctca acgggaatcc tgctctgcga ggctggccgg 300

cgtcgacggt atcgataagc ttgatatcga attcgtcact gattgcactg ttatttttga 360

ttgttgtcgt gtcatttttg aacccgaact tttttacggt agacaacatt cttaatatcc 420

ttcgtcaaac ctcagttaac gcaatcatcg cggtaggtat gacgttggtt atcctgaccg 480

caggcatcga cctaagcgta ggttctgtac tcgcactatg tggtgcgttt gccgcgagca 540

tgattgcatt agaagtgcct gtgcttatcg cagttccgac tgcattgttc gctggtgcgg 600

ctttgggggc gatcagcggt atcatcattg ccaaaggtaa ggttcaagcc tttatcgcaa 660

cactggttac catgacgtta ctacgcggcg tgacgatggt ttacaccgac ggtcgtccta 720

tctctacggg ctttactgac acagcagatg catttgcatg gtttggtaca ggttacgcac 780

ttggtatccc ggttccagtt tggttgatgg tgattgtctt tgcggcagct tggtacctac 840

tgaaccacac tcgttttggt cgctacgtgt acgcacttgg tggcaacgaa tcagcaacgc 900

gcctttctgg tatcaacgtt gaccgtgtga aaattggtgt atacgccatc tgcggcatgt 960

tggcagcgct tgctggcatt atcgtgacgt ctcgtctgtc ttcggcacaa ccaacagcgg 1020

gtatgggcta cgagctagac gctatcgcag cggttgttct tggcggtacc agcttgatgg 1080

gtggtaaagg tcgcataatg ggaacattga ttggtgctct aatcatcggc ttcctaaaca 1140

acgcgctgaa cctactcgat gtttcttctt actaccaaat gattgcgaaa gcagtggtta 1200

tcttgctagc agtactggta gacaacaaaa acaagtaatt gatatttaaa ataaagagct 1260

ccattacatc ctgaatacaa accgagccag aggacgtgtg ctggctcacc ctacacaaag 1320

gactagaacg tctggtaaag atgtactcat cgttggcttc gacggcactg acgacggcat 1380

tgcagcagtt aaccgtggca agctagcagc aactatcgcg cagcagccag atcttattgg 1440

tgctttgggt gtagaaacgg ccgacaaagt attgaaaggt gagaaggttg aggagtacat 1500

tcctgttccg cttaaagtcg tgactaagta agtttaactc ccaactcagt gattcttctt 1560

tgttgaagat aatggaatga cccaatgaat gtgttgggtc attccaaaca acaaaaatgg 1620

tacgttagaa aactgaatct atttgaatcg taatacgctt acgttttttc aaagagcgta 1680

aacctattac tcctgttcaa atataaaggg ttcattcaga accgaggata accgtatgaa 1740

taagttagtg gtgttaggta gtgtaaacgc tgaccatgtt cttcaagtgc cttctttccc 1800

tcgtccaggc gagacgctgc atggtcgcaa ctatcaagtt atcccaggtg gcaagggtgc 1860

caaccaagct gttgcggcag ctcgattaaa cgcagacatc ggttttattg cgtgtgtggg 1920

tgatgattca ttcggcatca acattcgtga gaacttcaaa atggatggta tcgacattgc 1980

tggcgtgaaa atgcagccga actgcccaac gggcattgcc atgattcaag tggcggacag 2040

cggcgagaac agcatttgta tctccgcaga agccaacgcc aagctgactg cagaggcgat 2100

tgagccagat ctagagcgca ttcgtcaggc tgattacttg ttgatgcaac tagaaacgcc 2160

aatgtgcggc atcgagaaag ctgcgcgaat cgcgaaagat gccaaaacca acgtcattct 2220

gaacccagcg ccagcgcgtg aattgtctga tgagttactg tcttgcattg atgtcatcac 2280

accaaatgaa acggaagcgg aagtactaac aggtgtgacg gtaacggacg atgacagcgc 2340

acaagaagcg gcgtctgatt cgttaccaat tatgacaact tgacggctac atcattcact 2400

ttttcttcac aaccggcacg aaactcgctc gggctggccc cggtgcattt tttaaatact 2460

cgcgagaaat agagttgatc gtcaaaacca acattgcgac cgacggtggc gataggcatc 2520

cgggtagtgc tcaaaagcag cttcgcctga ctaatgcgtt ggtcctcgcg ccagcttaag 2580

acgctaatcc ctaactgctg gcggaaaaga tgtgacagac gcgacggcga caagcaaaca 2640

tgctgtgcga cgctggcgat atcaaaattg ctgtctgcca ggtgatcgct gatgtactga 2700

caagcctcgc gtacccgatt atccatcggt ggatggagcg actcgttaat cgcttccatg 2760

cgccgcagta acaattgctc aagcagattt atcgccagca gctccgaata gcgcccttcc 2820

ccttgcccgg cgttaatgat ttgcccaaac aggtcgctga aatgcggctg gtgcgcttca 2880

tccgggcgaa agaaacccgt attggcaaat attgacggcc agttaagcca ttcatgccag 2940

taggcgcgcg gacgaaagta aacccactgg tgataccatt cgcgagcctc cggatgacga 3000

ccgtagtgat gaatctctcc tggcgggaac agcaaaatat cacccggtcg gcagacaaat 3060

tctcgtccct gatttttcac caccccctga ccgcgaatgg tgagattgag aatataacct 3120

ttcattccca gcggtcggtc gataaaaaaa tcgagataac cgttggcctc aatcggcgtt 3180

aaacccgcca ccagatgggc gttaaacgag tatcccggca gcaggggatc attttgcgct 3240

tcagccatac ttttcatact cccaccattc agagaagaaa ccaattgtcc atattgcatc 3300

agacattgcc gtcactgcgt cttttactgg ctcttctcgc taacccaacc ggtaaccccg 3360

cttattaaaa gcattctgta acaaagcggg accaaagcca tgacaaaaac gcgtaacaaa 3420

agtgtctata atcacggcag aaaagtccac attgattatt tgcacggcgt cacactttgc 3480

tatgccatag catttttatc cataagatta gcggatccta cctgacgctt tttatcgcaa 3540

ctctctactg tttctccata cccgtttttt tggatggagt gaaacgatgc agtttaaggt 3600

ttacacctat aaaagagaga gccgttatcg tctgtttgtg gatgtacaga gtgatattat 3660

tgacacgccc gggcgacgga tggtgatccc cctggccagt gcacgtctgc tgtcagataa 3720

agtctcccgt gaactttacc cggtggtgca tatcggggat gaaagctggc gcatgatgac 3780

caccgatatg gccagtgtgc cggtctccgt tatcggggaa gaagtggctg atctcagcca 3840

ccgcgaaaat gacatcaaaa acgccattaa cctgatgttc tggggaatat aagagctcca 3900

gcttttgttc cctttagtga gggttaattg cgcgcaattc ccatgtcagc cgttaagtgt 3960

tcctgtgtca ctcaaaattg ctttgagagg ctctaagggc ttctcagtgc gttacatccc 4020

tggcttgttg tccacaaccg ttaaacctta aaagctttaa aagccttata tattcttttt 4080

tttcttataa aacttaaaac cttagaggct atttaagttg ctgatttata ttaattttat 4140

tgttcaaaca tgagagctta gtacgtgaaa catgagagct tagtacgtta gccatgagag 4200

cttagtacgt tagccatgag ggtttagttc gttaaacatg agagcttagt acgttaaaca 4260

tgagagctta gtacgtgaaa catgagagct tagtacgtac tatcaacagg ttgaactgct 4320

gatcttcaga tcctctacgc cggacgcatc gtggccggat cagatctgat atcgtcgcag 4380

accaaaacga tctcaagaag atcatcttat taatcagata aaatatttct aggcaccaat 4440

aactgcctta aaaaaattac gccccgccct gccactcatc gcagtactgt tgtaattcat 4500

taagcattct gccgacatgg aagccatcac aaacggcatg atgaacctga atcgccagcg 4560

gcatcagcac cttgtcgcct tgcgtataat atttgcccat ggtgaaaacg ggggcgaaga 4620

agttgtccat attggccacg tttaaatcaa aactggtgaa actcacccag ggattggctg 4680

agacgaaaaa catattctca ataaaccctt tagggaaata ggccaggttt tcaccgtaac 4740

acgccacatc ttgcgaatat atgtgtagaa actgccggaa atcgtcgtgg tattcactcc 4800

agagcgatga aaacgtttca gtttgctcat ggaaaacggt gtaacaaggg tgaacactat 4860

cccatatcac cagctcaccg tctttcattg ccatacgaaa ttccggatga gcattcatca 4920

ggcgggcaag aatgtgaata aaggccggat aaaacttgtg cttatttttc tttacggtct 4980

ttaaaaaggc cgtaatatcc agctgaacgg tctggttata ggtacattga gcaactgact 5040

gaaatgcctc aaaatgttct ttacgatgcc attgggatat atcaacggtg gtatatccag 5100

tgattttttt ctccatttta gcttccttag ctcctgaaaa tctcgataac tcaaaaaata 5160

cgcccggtag tgatcttatt tcattatggt gaaagttgga acctcttacg tgccgatcaa 5220

cgtctcattt tcgccaaaag ttggcccagg gcttcccggt atcaacaggg acaccaggat 5280

ttatttattc tgcgaagtga tcttccgtca caggtattta ttcggcg 5327

Claims (1)

1. A method for knocking out Vibrio harveyi homologous recombination genes based on heat shock is characterized by comprising the following steps: performing heat shock treatment on receptor bacteria of vibrio harveyi cultured to the early stage of logarithm, uniformly mixing the receptor bacteria of vibrio harveyi with donor bacteria cultured to the early stage of logarithm in an equal volume manner, centrifuging at room temperature to remove supernatant, performing resuspension after bacterial precipitation, dibbling the mixture onto a solid flat plate, jointing the solid flat plate overnight, and performing heat shock treatment on the receptor bacteria of vibrio harveyi to ensure that the jointing transformation efficiency of the vibrio harveyi is from zero to zero, thereby performing gene knockout on the vibrio harveyi;

the temperature during the heat shock treatment is 38 ℃;

the time for heat shock treatment is 30 min;

conjugation at 28 ℃ overnight;

the donor bacterium is pSW 7848-delta rbsB-E. coli GEB883, and the construction method is as follows;

(1) determining upstream and downstream sequences of a gene rbsB to be mutated and an insertion site of a suicide plasmid pSW7848, designing a recombinant vector construction primer by using NEB online software to obtain an upstream homologous arm amplification primer pair rbsB-UP-F/R, a downstream homologous arm amplification primer pair rbsB-DOWN-F/R, a suicide plasmid linearization primer pair pSW7848-F/R, a recombinant plasmid detection primer pair pSW7848-check-F/R and a gene deletion detection primer pair rbsB-Del-check-F/R to be mutated;

the PCR primer sequences were as follows:

rbsB-UP-F：aagcttgatatcgaattcgtcactgattgcactgttatttttg

rbsB-UP-R：tttacctgacgttctagtcctttgtgtaggg

rbsB-DOWN-F：ctagaacgtctggtaaagatgtactcatcgttggc

rbsB-DOWN-R：ttggtaacgaatcagacgccgcttcttgtgcgctg

pSW7848-F：gtctgattcgttaccaattatgacaac

pSW7848-R：gaattcgatatcaagcttatcgatac

pSW7848-check-F：tcactgtcccttattcgcacc

pSW7848-check-R：ctgcttttgagcactacccg

rbsB-Del-check-F：tgggtggtaaaggtcgcataa

rbsB-Del-check-R：tcgcctggacgagggaaag

(2) extracting Vibrio harveyi genome as a template, obtaining an upstream homologous arm fragment UP of 996bp and a downstream homologous arm fragment DOWN of 1022bp by utilizing a PCR technology based on primer pairs rbsB-UP-F/R and rbsB-DOWN-F/R, specifically as shown in SEQ ID NO.1, cutting and recovering gel after agarose electrophoresis detection, and storing the recovered product at-20 ℃ for later use;

the PCR amplification system is as follows:

2 × PrimeSTAR Max Premix 25.0 μ L, upstream primer F10 μ M2.0 μ L, downstream primer R10 μ M2.0 μ L, genomic template 20 ng/. mu.L 2.0 μ L, complemented by ddH2O to 50 μ L;

the PCR amplification procedure was as follows:

pre-denaturation at 98 ℃ for 30 sec; denaturation at 98 ℃ for 10sec, 55 ℃ for 5sec, 72 ℃ for 5sec, 35 cycles; extending for 7min at 72 ℃;

(3) extracting suicide plasmid as a template, obtaining a plasmid linearized fragment with the length of 3309bp by using a PCR (polymerase chain reaction) technology based on a primer pair pSW7848-F/R, cutting gel and recovering after agarose electrophoresis detection, and storing recovered products at-20 ℃ for later use;

the PCR amplification system is as follows:

2 × PrimeSTAR Max Premix 25.0 μ L, upstream primer F10 μ M2.0 μ L, downstream primer R10 μ M2.0 μ L, plasmid template 1 ng/. mu.L 2.0 μ L, make up 50 μ L with ddH 2O;

the PCR amplification procedure was as follows:

pre-denaturation at 98 ℃ for 30 sec; denaturation at 98 ℃ for 10sec, 53 ℃ for 15sec, 72 ℃ for 17sec, 35 cycles; extending for 7min at 72 ℃;

(4) carrying out isothermal assembly on the upstream and downstream homology arms obtained in the step (2) and the plasmid fragments obtained in the step (3) by utilizing a commercialized multi-fragment seamless cloning kit;

(5) transforming the isothermal assembly liquid into Escherichia coli GEB802 competent cells, and detecting by PCR based on a primer pair pSW7848-check-F/R to obtain a positive recombinant pSW 7848-delta rbsB, wherein the length of a PCR product is 2216bp as shown in SEQ ID NO.2 by agarose gel electrophoresis;

the PCR amplification system is as follows:

2 XPremix TaqTM 25.0 μ L, upstream primer F10 μ M2.0 μ L, downstream primer R10 μ M2.0 μ L, bacterial liquid template 2.0 μ L, and ddH2O to make up 50 μ L;

the PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30sec, 57 ℃ for 30sec, 72 ℃ for 2.5min, 35 cycles; extending for 10min at 72 ℃;

(6) extracting positive recombinant plasmid pSW 7848-delta rbsB, transforming into Escherichia coli E, coli GEB883 competent cells to obtain pSW 7848-delta rbsB-E, coli GEB883 carrying recombinants, and taking the pSW 7848-delta rbsB-E, coli GEB883 as a conjugant donor bacterium.

Images