CN106967744B - Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector - Google Patents
Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector Download PDFInfo
- Publication number
- CN106967744B CN106967744B CN201710296593.4A CN201710296593A CN106967744B CN 106967744 B CN106967744 B CN 106967744B CN 201710296593 A CN201710296593 A CN 201710296593A CN 106967744 B CN106967744 B CN 106967744B
- Authority
- CN
- China
- Prior art keywords
- salmonella
- suicide vector
- plasmids
- strain
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1055—Levansucrase (2.4.1.10)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/0101—Levansucrase (2.4.1.10)
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of microorganisms, and particularly relates to a method for eliminating multi-copy plasmids in salmonella by using a suicide vector and application thereof. The method adopts an exogenous suicide vector to eliminate multicopy plasmids in salmonella. The whole process is simple, rapid, stable and efficient. Lays a foundation for researching the functions of the plasmids.
Description
Technical Field
The invention belongs to the field of microorganisms, and particularly relates to a method for eliminating multi-copy plasmids in salmonella by using a suicide vector and application thereof.
Background
The salmonella is an important zoonosis pathogenic bacterium and is one of important food-borne pathogenic bacteria in the world, and has important public health significance. Meanwhile, salmonella is an important pathogenic bacterium of livestock and poultry, so that the harm to livestock and poultry breeding is great, and a new effective prevention and treatment measure needs to be established at present. Therefore, the research on the pathogenic mechanism of the salmonella enterica has important significance for effectively preventing and treating salmonella infection.
Plasmids are genetic material within bacterial cells independent of the extrachromosomal entity, often present within the cytoplasm, are double-helical, closed-loop DNA molecules that replicate themselves and are capable of generational transmission. They play an extremely important role in drug resistance, toxin-producing ability and the like of salmonella. A4080 bp multicopy mini-plasmid, designated pSPI12, has been found by researchers in Salmonella pullorum and the plasmid map is shown in FIG. 5. (Li, Q., et al (2014). "A gene knock-in method used to deliver plasmid pSPI12from Salmonella enterica serovar pullerovorum and chromatography of IpaJ." J Microbiol Methods 98: 128-.
Suicide vectors (suicidide vectors) are characterized by replication and survival in only specific host bacteria, but not long-term survival in other bacteria. Therefore, suicide vectors are also one of the commonly used tools for constructing gene-deleted strains and mutant strains of bacteria. pDM4 is a suicide vector for the construction of genetic mutants of gram-negative bacteria, derived from the pGF704 plasmid (Milton et al 1996), which, when sucrose is present in the environment of the gram-negative bacteria, induces the expression of the sacB gene on pDM4 suicide vector, produces sucrose synthase, catalyzes the hydrolysis of sucrose to glucose and fructose, and polymerizes fructose to high molecular weight fructans. Fructans accumulate gram-negative bacteria causing toxic effects that cause cell death, thereby killing the bacteria. Only if the plasmid containing the gene is lost, the host bacterium can survive. The suicide vector map is shown in figure 6.
The existing plasmid elimination methods mainly adopt chemical elimination agents (chimeric dyes, coumaromycin, neomycin, rifampicin, mitomycin C and sodium dodecyl sulfate) and physical elimination methods (high-temperature, high-pressure electroporation and protoplast) and molecular biological elimination methods (transposon and plasmid incompatibility) to achieve the elimination of plasmids, but the methods are only effective on partial plasmids in certain strains, namely the effectiveness of the plasmid elimination methods is greatly different among different strains or among different plasmids. In addition, many of the eliminating agents are mutagens which easily cause mutation of host bacteria genes. Therefore, it is very important to develop molecular biology techniques for directionally eliminating a specific plasmid or a multicopy plasmid.
Disclosure of Invention
In order to overcome the problems in the prior art, the invention aims to provide a method for eliminating multicopy plasmids in salmonella by using a suicide vector and application thereof.
In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:
in the first aspect of the invention, a method for eliminating multicopy plasmids in salmonella by using a suicide vector is provided, wherein the exogenous suicide vector is used for eliminating the multicopy plasmids in the salmonella.
Preferably, the salmonella is salmonella pullorum. The salmonella pullorum is the prior art, and the specific information is as follows: access, NC-021984.1; and a GI of 529218781.
Preferably, the salmonella is salmonella pullorum S06004.
Preferably, the multicopy plasmid is pSPI 12. The size of pSPI12 was 4080 bp. The plasmid map of pSPI12 is shown in FIG. 5.
For details of the multicopy plasmid pSPI12, reference is also made to Li, Q., et al (2014), "A geneknock-in method used to purify plasmid pSPI12from Salmonella enterica serovarum and culture of IpaJ." J Microbiol Methods 98:128-133.
Preferably, the suicide vector is pDM 4. A map of suicide vector pDM4 is shown in FIG. 6.
Further, the method comprises the following steps:
(1) constructing a recombinant suicide vector: connecting a target segment to be eliminated to a suicide vector to obtain a recombinant suicide vector;
(2) constructing donor bacteria: introducing the recombinant suicide vector obtained in the step (1) into competent bacteria to obtain donor bacteria;
(3) bonding and transferring: carrying out mixed culture on the donor bacteria and the acceptor salmonella obtained in the step (2), and screening to obtain the salmonella strain which generates homologous recombination;
(4) screening sucrose: inoculating the homologous recombination salmonella strain obtained by screening in the step (3) into a culture medium containing cane sugar, and screening out a strain which can survive and has a plurality of copies of plasmids eliminated.
Preferably, in the step (1), the nucleotide sequence of the target fragment is shown as SEQ ID NO. 9.
Preferably, the suicide vector is pDM 4. A map of suicide vector pDM4 is shown in FIG. 6. Further, the suicide vector is XbaI single-enzyme digested pDM 4. The pDM4 contains a chloramphenicol resistance marker.
Preferably, in the step (2), the competent bacteria are Diaminopimelic Acid (DAP) -dependent competent bacteria.
Preferably, in the step (2), the competent bacteria are e.
Further, in the step (3), the recombinant suicide vector is introduced into the recipient salmonella by means of binding transfer.
Preferably, in the step (3), the target strain is selected using an LB plate free of Diaminopimelic Acid (DAP) and resistant to chloramphenicol.
Preferably, in the step (3), the salmonella is salmonella pullorum. The salmonella pullorum is the prior art, and the specific information is as follows: access, NC-021984.1; and a GI of 529218781.
Preferably, the salmonella is salmonella pullorum S06004.
Further, in the step (4), sucrose is used to induce the suicide vector to start death.
Preferably, in the step (4), the medium is free of sodium chloride. Further, the culture medium is an LB culture medium.
Preferably, in the step (4), the mass volume concentration of sucrose in the culture medium is 5-20%.
Further, the mass volume concentration of sucrose in the culture medium is 10%.
Preferably, in the step (4), a strain in which the plasmid is eliminated in multiple copies is selected by using a PCR method.
In a second aspect of the invention, there is provided the use of the aforementioned method for constructing a multicopy plasmid for eliminating a salmonella strain.
Compared with the prior art, the invention has the following beneficial effects:
the method for eliminating the multi-copy plasmids in the salmonella by using the exogenous suicide vector, which is established by the invention, can eliminate specific single-copy plasmids and multi-copy plasmids, and has the advantages of simple, quick, stable and efficient whole process. Lays a foundation for researching the functions of the plasmids.
Drawings
FIG. 1: PCR identification of recombinant plasmid X7213(pDM 4-delta pSPI12), wherein M is DNA molecular mass standard; 1-2, amplifying an ipaJupF/R upstream segment; SalIup and SacIdown amplified the product of the p DM 4-delta pSPI12 plasmid;
FIG. 2: PCR identification of the S06004-delta pSPI12 external primer, wherein M is DNA molecular mass standard; 1-3, amplifying a product of S06004-delta pSPI12 by ipaJOutF/R; 4 ipaJOutF/R amplification of the product of S06004.
FIG. 3: PCR identification of the S06004-delta pSPI12 internal detection primer, wherein M is DNA molecular mass standard; 1-6, amplifying a product of S06004-delta pSPI12 by ipaJNBF/R; 7, amplification product of S06004 by ipaJNBF/R.
FIG. 4: pSPI12/KmRPCR identification of the introduced deletion strain S06004-delta pSPI12, wherein M is DNA molecular mass standard; 1 ipaJNBF/R amplification S06004-delta pSPI12-pSPI12/KmRThe product of (a); 2 ipaJNBF/R amplification product S06004-delta pSPI 12.
FIG. 5: plasmid map of pSPI 12.
FIG. 6: map of suicide vector pDM 4.
Detailed Description
Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORY MANUAL, Second edition, Cold Spring harbor LABORATORY Press, 1989and Third edition, 2001; ausubel et al, Current PROTOCOLS Inmolecular BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATINSTRUCUTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; (iii) Methods Inenzymolygy, Vol.304, Chromatin (P.M. Wassarman and A.P.Wolffe, eds.), academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, chromatography protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.
Example 1 construction of plasmid-deleted mutant pSPI12 of S06004
The sources of salmonella pullorum S06004 are: the Yangzhou university zoonosis laboratory is used for preservation.
Identification of S06004:
1.1. bacterial identification
1.1.1 Biochemical assay
And (3) selecting a pure cultured single colony to inoculate a biochemical identification tube, and observing the result after culturing for 24 hours at 37 ℃.
Construction of pSPI12 plasmid-deleted mutant of S06004
2.1 sequencing of target Gene
2.1.1 amplification of target Gene
Specific primers were designed using primer design software Primer5.0 based on the published genomic sequences of Salmonella in GenBank, as shown in Table 2. The IPaJ upstream gene segment is amplified by a PCR method by taking the salmonella pullorum S06004 genome DNA as a template.
The 50. mu.l PCR amplification system is shown in the following table:
TABLE 1 IpaJ Gene PCR amplification System
The reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, for 30 cycles, extension at 72 ℃ for 10min, and storage at 4 ℃.
Table 2: amplification target Gene primer sequences
2.1.2 identification of amplified fragments
The PCR product is detected by 1% agarose gel electrophoresis, the size of the target Fragment (target gene) is 582bp, the PCR product is recovered and purified by the Kit, and the recovery operation is carried out according to the Fragment purification Kit instruction.
The nucleotide sequence of the target fragment (target gene) is shown as SEQ ID NO.9, and specifically comprises the following steps:
GTTTGTTCAGGACGGGAGAAGGAAATTTCTGGTCCTTCCGTACGGGAAATCAGCAGAGGTGACGCACTATCAGGGGAAGGACTGGATACAACTGACGGAGTGATACGGAATGACAGAGCTGGAAACACATTTGCTGAACGCCTTAGAGCAGCTGCAACAGGACTATATGCAGCGGCTGAACGAATGGGAGAGCGCCTTCGTGGAATTGCAGAAGATGTTTTCGCTTACGCAACGGGACAACGCGATGCTGAACGAGCGGGTCATGCAGTTGAGTCAGCAGGTACAGCACTTGAGCGAGCGGACAGAACACTTGAGCCAGTTATACAGCGAGAACTGGAGATAAGAGAGGAACGGCTGATACAGGAGCGCGAACATGCGTTATCCCTGGAACGGGAACGCCAGCTGGAAATACAGGAACGCACACTGGATGGTCCTTCGTTGTCGCTGTGATGGCGAAACTATGAAAAATGGCAGGTTCGGTGGATTTTGACGGGCTAATGTGGTCTGCACCATCTGGTTGCATAGGTATTC。
2.2 construction of recombinant suicide vector and plasmid Elimination
2.2.1 construction and identification of recombinant suicide vectors
The purified and recovered DNA fragment was ligated to XbaI single-digested suicide vector pDM4 by the method referred to CloneExpressTM II (One Step Cloning Kit), transformed into E.coli DH 5. alpha. lambda. pir by chemical transformation, plated on LB plate containing chloramphenicol resistance, and cultured overnight at 37 ℃. Single colonies were picked for PCR verification (primers were SalIup and SacIdown as common primers of pDM 4) and the results are shown in FIG. 1, and the correctly verified bacteria were cultured and the recombinant suicide plasmid pDM4-ipaJ was extracted and stored at-20 ℃ until use.
2.2.2 construction and identification of Donor bacteria
pDM4-ipaJ was introduced into E.coli χ 7213 competent bacteria (DAP-dependent, final concentration 50 μ g/mL) using chemical transformation, and DAP and chloramphenicol resistant LB plates were coated. Single colonies were picked and cultured, followed by PCR verification (using SalIup and SacIdown primers), and the results are shown in FIG. 1. The positive clone is donor bacterium E.coli chi 7213-pDM 4-ipaJ.
2.2.3 bond transfer
The donor bacterium E.coli chi 7213-pDM4-ipaJ and the recipient bacterium S06004 were respectively cultured in LB liquid medium to OD600 of about 0.6. The donor was centrifuged at 4,000rpm for 3min in 1mL of the strain, the supernatant was discarded, resuspended with 1mL of LB, and the supernatant was removed after recentrifugation and washed twice with fresh LB. Then 1mL of recipient bacterium S06004 was added, centrifuged at 4,000rpm for 3min, 900. mu.L of supernatant was discarded, 100. mu.L of LB resuspended cells remaining in the tube was added dropwise onto a 0.22 μm hydrophilic filter membrane on a DAP-containing LB solid plate, air dried, and then cultured overnight at 37 ℃.
The lawn on the filter was washed with 1mL sterile PBS solution into a 10mL centrifuge tube and 100. mu.L was spread on LB solid plates containing 25. mu.g/mL chloramphenicol resistance. The target strain can be selected using an LB plate without DAP and chloramphenicol resistance, based on the DAP dependence of the donor bacterium E.coli chi 7213 and the chloramphenicol resistance marker of the pDM4 plasmid. Colonies that survived the plate were strains containing recombinant suicide plasmids, including single-crossover strains in which one homologous recombination occurred.
2.2.4 sucrose screening and characterization
Culturing the single-exchange strain subjected to the primary homologous recombination in an LB culture medium containing 10% (mass volume concentration) of sucrose and no NaCl for 24h, diluting according to a 1:10 gradient, and respectively coating the strain on the LB culture medium containing 10% (mass volume concentration) of sucrose and no NaCl2On LB plates. After 24 hours of culture, a single colony with a better growth state is picked, and bacteria can be screened and identified by a PCR method (the primer is ipaJoutF/R, a band which can not be amplified by a plasmid-eliminated strain can be amplified to obtain a band with the size of about 2000bp, the result is shown in figure 2; the ipaJNFF/R primer can not be amplified to obtain a band in an eliminated strain, and a band with the size of about 750bp can be amplified in a plasmid-unabated strain, the result is shown in figure 3). The strain deleted from the pSPI12 plasmid was designated S06004-. DELTA.pSPI 12.
In order to further verify that the pSPI12 plasmid is lost in the plasmid-cured strain, pSPI12-Km carrying kanamycin resistance and stored in the laboratory is used by utilizing the plasmid incompatibility principleRThe plasmid was electrotransferred into a plasmid-elimination mutant. If the resistant plasmid can be introduced into the bacterium, namely the bacterium is a pSPI12 plasmid elimination mutant strain; if the resistant plasmid cannot be introduced into the bacterium, it is a false positive bacterium, i.e., the plasmid is not eliminated. At the same time, the transformed strain was verified by PCR (using the primer ipaJNBF/R, the cured strain was introduced into pSPI12/KmRThe plasmid can amplify a band of about 2000bp, and the result is shown in FIG. 4).
The invention also tries to construct the recombinant suicide vector by using target fragments with various sequences, and finally, only the target fragment with the sequence shown in SEQ ID NO.9 constructs the recombinant suicide vector with the best elimination effect on pSPI 12.
While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.
SEQUENCE LISTING
<110> Yangzhou university
<120> a method for eliminating multicopy plasmid in salmonella using suicide vector
<130>171949
<160>9
<170>PatentIn version 3.3
<210>1
<211>50
<212>DNA
<213>Artificial
<220>
<223>sPI12-F
<400>1
gagcggataa caatttgtgg aatcccggga gtttgttcag gacgggagaa 50
<210>2
<211>52
<212>DNA
<213>Artificial
<220>
<223>sPI12-R
<400>2
agcggagtgt atatcaagct tatcgatacc gaatacctat gcaaccagat gg 52
<210>3
<211>19
<212>DNA
<213>Artificial
<220>
<223>ipaJNB-F
<400>3
tacctgtctg ctgccgtga 19
<210>4
<211>19
<212>DNA
<213>Artificial
<220>
<223>ipaJNB-R
<400>4
accctgcaaa cctgaaatc 19
<210>5
<211>20
<212>DNA
<213>Artificial
<220>
<223>ipaJOut-F
<400>5
cggaaactga acgcgaagac 20
<210>6
<211>20
<212>DNA
<213>Artificial
<220>
<223>ipaJOut-R
<400>6
agcatcacaa aaaccgacgc 20
<210>7
<211>25
<212>DNA
<213>Artificial
<220>
<223>SalⅠup
<400>7
ggtgctccag tggcttctgt ttcta 25
<210>8
<211>25
<212>DNA
<213>Artificial
<220>
<223>SacⅠdown
<400>8
cagcaactta aatagcctct aaggt 25
<210>9
<211>531
<212>DNA
<213>Artificial
<220>
<223> target fragment
<400>9
gtttgttcag gacgggagaa ggaaatttct ggtccttccg tacgggaaat cagcagaggt 60
gacgcactat caggggaagg actggataca actgacggag tgatacggaa tgacagagct 120
ggaaacacat ttgctgaacg ccttagagca gctgcaacag gactatatgc agcggctgaa 180
cgaatgggag agcgccttcg tggaattgca gaagatgttt tcgcttacgc aacgggacaa 240
cgcgatgctg aacgagcggg tcatgcagtt gagtcagcag gtacagcact tgagcgagcg 300
gacagaacac ttgagccagt tatacagcga gaactggaga taagagagga acggctgata 360
caggagcgcg aacatgcgtt atccctggaa cgggaacgcc agctggaaat acaggaacgc 420
acactggatg gtccttcgtt gtcgctgtga tggcgaaact atgaaaaatg gcaggttcgg 480
tggattttga cgggctaatg tggtctgcac catctggttg cataggtatt c 531
Claims (6)
1. A method for eliminating multi-copy plasmids in salmonella by utilizing a suicide vector is to eliminate the multi-copy plasmids pSPI12 in salmonella pullorum by utilizing the suicide vector pDM4 and a target fragment SEQ ID NO. 9.
2. The method according to claim 1, characterized in that it comprises the following steps:
(1) constructing a recombinant suicide vector: connecting a target segment to be eliminated to a suicide vector to obtain a recombinant suicide vector;
(2) constructing donor bacteria: introducing the recombinant suicide vector obtained in the step (1) into competent bacteria to obtain donor bacteria;
(3) bonding and transferring: carrying out mixed culture on the donor bacteria and the acceptor salmonella obtained in the step (2), and screening to obtain the salmonella strain which generates homologous recombination;
(4) screening sucrose: inoculating the homologous recombination salmonella strain obtained by screening in the step (3) into a culture medium containing cane sugar, and screening out a strain which can survive and has a plurality of copies of plasmids eliminated.
3. The method as claimed in claim 2, wherein the competent bacterium is a diaminopimelate-dependent competent bacterium in step (2).
4. The method as claimed in claim 2, wherein in the step (3), the target strain is selected using an LB plate free of diaminopimelic acid and resistant to chloramphenicol.
5. The method according to claim 2, wherein in the step (4), the medium is LB medium.
6. Use of the method of any one of claims 1 to 5 for the elimination of multicopy plasmids in Salmonella.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710296593.4A CN106967744B (en) | 2017-04-28 | 2017-04-28 | Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710296593.4A CN106967744B (en) | 2017-04-28 | 2017-04-28 | Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106967744A CN106967744A (en) | 2017-07-21 |
| CN106967744B true CN106967744B (en) | 2020-08-11 |
Family
ID=59330950
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710296593.4A Active CN106967744B (en) | 2017-04-28 | 2017-04-28 | Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967744B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517802B (en) * | 2018-11-20 | 2022-06-14 | 扬州大学 | Hybridoma cell strain secreting salmonella pullorum IpaJ monoclonal antibody, monoclonal antibody thereof and application of monoclonal antibody |
| CN110129246B (en) * | 2019-04-29 | 2021-02-19 | 华南农业大学 | Donor bacterium, construction method and application thereof, and plasmid inhibitor screening method |
| CN111057671A (en) * | 2019-12-04 | 2020-04-24 | 扬州大学 | Salmonella pullorum single-gene traceless knockout attenuated strain and preparation method and application thereof |
| CN111850026A (en) * | 2020-08-07 | 2020-10-30 | 南开大学 | Method for efficiently and specifically eliminating plasmids in bacteria by utilizing integrated suicide vector |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789337A (en) * | 2014-02-18 | 2014-05-14 | 扬州大学 | Suicide vector pGMB152 for blue-white selection and application thereof |
| CN104474539B (en) * | 2014-11-17 | 2017-07-11 | 中国人民解放军第三军医大学 | Knock out the dual-gene paratyphosus A bacillus attenuated vaccines of yncD aroC |
-
2017
- 2017-04-28 CN CN201710296593.4A patent/CN106967744B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Construction of pSPI12-cured Salmonella enterica serovar Pullorum and identification of IpaJ as an immune response modulator;Chao Yin et al.;《Avian Pathology》;20180529;第47卷(第4期);第410-417页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106967744A (en) | 2017-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106967744B (en) | Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector | |
| Zeng et al. | Cold adaptation regulated by cryptic prophage excision in Shewanella oneidensis | |
| CN107904228B (en) | Vibrio harveyi homologous recombination gene knockout method based on heat shock | |
| CA2803340C (en) | Self-deleting plasmid | |
| Hung et al. | Association of a D-alanyl-D-alanine carboxypeptidase gene with the formation of aberrantly shaped cells during the induction of viable but nonculturable Vibrio parahaemolyticus | |
| JP2024028933A (en) | Auxotrophic strains of staphylococcus bacterium | |
| US11549115B2 (en) | Compositions and methods for regulated gene expression | |
| Chen et al. | A network of regulators promotes dehydration tolerance in Escherichia coli | |
| US20220056457A1 (en) | Cis conjugative plasmid system | |
| Song et al. | Identification of seven novel virulence genes from Xanthomonas citri subsp. citri by Tn5-based random mutagenesis | |
| Lipuma et al. | A vapBC‐type toxin–antitoxin module of S inorhizobium meliloti influences symbiotic efficiency and nodule senescence of M edicago sativa | |
| US8877502B2 (en) | Plasmid curing | |
| CN110591994B (en) | Sodium hydroxide stimulation-based vibrio harveyi homologous recombination gene knockout method | |
| CN110591993A (en) | Vibrio harveyi homologous recombination gene knockout method based on hydrochloric acid stimulation | |
| CN114891806B (en) | Citrobacter welchii yqjH gene knockout mutant strain and application thereof | |
| Gorshkov et al. | Global gene expression analysis of cross-protected phenotype of Pectobacterium atrosepticum | |
| CN113403246B (en) | Vibrio alginolyticus Hfq gene knockout mutant strain and application thereof | |
| Brzozowska et al. | Functioning of the TA cassette of streptococcal plasmid pSM19035 in various Gram-positive bacteria | |
| Prozorov | Additional chromosomes in bacteria: properties and origin | |
| Hassan et al. | Salt inducible-proteins and conjugal gene transfer of halotolerant Staphylococcus isolated from salinity soil | |
| CN114540351B (en) | sRNA of targeted klebsiella pneumoniae MdtABC efflux pump and application thereof in preparation of tetracycline antibiotic resistant strain | |
| Liang et al. | Genome engineering of E. coli for improved styrene production and polymerization | |
| Bartling | Francisella tularensis Insertion Sequence Elements Contribute to Differential Gene Expression | |
| López Muñoz | DELECIÓN DE UN ARN REGULADOR PEQUEÑO (SDSR) EN DOS CEPAS PATÓGENAS DE ESCHERICHIA COLI (CFT073 Y EDL933) Y SU INFLUENCIA EN LA RECUPERACIÓN DEL CRECIMIENTO Y VIABILIDAD BACTERIANA | |
| Jana et al. | An unusually long 5’UTR of ATP dependent cold shock DEAD-box RNA helicase gene csdA negatively regulates its own expression in Escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |