CN108410900B - Non-resistant lactobacillus plantarum anchoring expression vector p L PSa and preparation method thereof - Google Patents

Abstract

The invention discloses a non-resistant Lactobacillus plantarum anchoring expression vector p L PSa, which is a biologically safe foreign protein expression system, and aims to provide a novel expression vectorasdDeletion strainE.coli6212/. DELTA.asd andalrabsence ofL.plantarumNC8/Δ alr as host bacteria derived from lactococcus lactis (Lactococcus lactisCremoris strain JM 4) genome as promoter for alr gene expression，pYA4545, P L P-1261Inv, pSIP409PgsA '-I L-10 and pSIP409 PgsA' -EGFP are used as basic vectors to construct a nutrition complementation screening marker Escherichia coli-lactobacillus non-anchorage expression vector P L PSa taking surface protein (S _ achoring) as an anchorage model, and EGFP is used as a reporter gene to carry out screening and anchorage expression verification.

Description

Non-resistant lactobacillus plantarum anchoring expression vector p L PSa and preparation method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a non-resistant lactobacillus plantarum anchoring expression vector p L PSa and a preparation method thereof.

Background

The lactobacillus plantarum (L, Lactobacillus plantarum, L, plantarum) as an intestinal host strain can tolerate the environment of low pH value and high salt in the stomach, the optimal growth temperature is 30-37 ℃, the lactobacillus plantarum can tolerate the low temperature of about 10 ℃, but the growth inhibition occurs in the environment of above 45 ℃, and the lactobacillus plantarum is commonly found in fermented food made of cream, meat, vegetables and the like and can be separated from a plurality of plants, so the research shows that the lactobacillus plantarum conforms to the GRAS (general magnetized as safe) regulation of the Food and Drug Administration (FDA) and the Safety qualification certification (Qualified Safety) standard of the European Food Safety Agency (EFSA), generally colonizes in the digestive tracts of human and animals and plays a probiotic role, and the microecological preparation made by using the lactobacillus plantarum strain can enhance the immunity of the organism, can effectively prevent the occurrence of some gastrointestinal diseases, is also a good exogenous protein expression system, and can effectively solve the problem of the oral administration of various proteins, thereby effectively preventing and treating various medical digestive diseases.

The pSIP409 series plasmid is a shuttle plasmid vector peculiar to lactobacillus plantarum, and has the advantages that pUC is derived from Escherichia coli (E.coli) and 256rep is derived from two replicons of lactobacillus plantarum, so that the plasmid vector can be replicated in Escherichia coli and can express foreign proteins in lactobacillus plantarum, but the plasmid vector series uses erythromycin resistance genes (EM) as screening markers, and serious biological safety hazards are likely to be generated once the resistance genes are transferred into a host chromosome, so that the potential application value of the system is limited.

Alanine Racemase (alr) gene is widely present in prokaryotic genomes and converts L-Alanine into D-Alanine, which is an important cross-linking component in cell walls and is an essential substance for the growth of strains, and thus is essential for the growth of prokaryotic cells, although most microorganisms contain two Alanine Racemase genes, Biosynthetic Alanine Racemase (alr) and metabolic Alanine Racemase (dadx/B), Alanine Racemase is encoded by a single alr gene for lactococcus lactis and lactobacillus, and the alr gene deletion strain does not grow in normal MRS medium but only in medium with additional D-Alanine.

The Escherichia coli asd gene codes aspartic acid β -semialdehyde dehydrogenase, which is a key enzyme in a synthesis path of Diaminopimelic Acid (DAP), wherein the DAP is a basic component of peptidoglycan on a gram-negative bacteria cell wall, and after deletion mutation of the asd gene, lysolysis death is caused by incapability of synthesizing the cell wall.

Disclosure of Invention

The invention aims to solve the problems of cell wall thickness of lactobacillus plantarum and difficulty in screening positive recombinants by exogenous plasmid electrotransformation host bacteria and lactobacillus plantarum ligation products, and provides a non-resistant lactobacillus plantarum anchoring expression vector p L PSa which can be replicated in E.coli 6212/delta alr and can be anchored and expressed in L. plantarum NC 8/delta alr.

A non-resistance Lactobacillus plantarum anchored expression vector P L PSa is prepared by double digestion of genes shown in P L P-1261Inv and SEQ ID NO.1 by NdeI and Hind III, inserting the gene shown in SEQ ID NO.1 into P L P-1261Inv to obtain a vector P L PS, and replacing Erythromycin (EM) gene on the vector P L PS with a P23-alr-asd gene, wherein the base sequence of the P23-alr-asd gene is shown in SEQ ID NO. 2.

A method for preparing a non-resistant Lactobacillus plantarum anchored expression vector p L PSa, comprising:

1) preparation of S _ amplification gene S containing sig _ peptide signal peptide and S-layer protein C-terminal anchoring sequence

Referring to a Lactobacillus acidophilus SlpA gene sequence issued by NCBI, reserving a sig _ peptide signal peptide sequence and an S-layer protein C-terminal anchoring sequence, replacing a middle part gene sequence with L inker and polyclonal restriction site SalI, XbaI, XhoI, EcoR I and KpnI, and replacing L inker and polyclonal restriction site sequence with GGCACGATTGCGGCG GTCGAC TCTAGACTCGAG GAATTC GGTACC, artificially synthesizing a gene S shown in SEQ ID NO.1, inserting the gene shown in SEQ ID NO.1 into P L P-1261Inv by NdeI and HindIII double enzyme digestion, and naming a vector as P L PS;

2) preparation of P23-alr-asd Gene

The asd gene, the P23 promoter and the alr gene are connected in series by referring to the sequence of the PYA4545 vector asd gene, the P23 promoter published by NCBI and the sequence of the lactobacillus plantarum alr gene to obtain the P23-alr-asd gene, the size is 3027bp, and the base sequence is shown as SEQ ID NO. 2.

3) P23-alr-asd gene is used for replacing Erythromycin (EM) gene on vector P L PS to obtain resistance-free selection marker anchoring expression vector P L PSa

The P23-alr-asd gene is used for replacing the erythromycin gene on the vector P L PS, and because the vector is not linearized by a proper enzyme cutting site on the vector, the vector and the P23-alr-asd gene are linearized by a PCR method, primers are designed according to the sequence of the P L PS gene, a 5050bp segment L PS of the erythromycin gene is amplified and removed, and the primers are as follows:

LPS F：TTCTATGAGTCGCTTTTTTAAATTTG

LPS R：GGATCCCGCACGCATAGCGGTGC

the primer sequence for amplifying the P23-alr-asd gene is as follows:

asd F: CGCTATGCGTGCGGGATCCTCTTCCCTAAATTTAAATATAAAC (underlined is the cognate arm on the p L PS vector)

alr R: CAAATTTAAAAAAGCGACTCATAGAATTAATCTATATAAACTCTCG (homologous arm to p L PS vector);

amplifying a P23-alr-asd gene containing a homologous arm by taking a synthesized P23-alr-asd gene as a template, seamlessly cloning and connecting L PS and the P23-alr-asd, electrically transforming E.coli 6212/delta asd competent cells, paving a common L B solid culture medium, realizing nutrition complementation screening positive clone by utilizing the asd gene and host bacteria, sequencing and identifying a correct plasmid named as P L PSa, electrically transforming the P L PSa to L. plantarum NC 8/delta alr, and constructing a nonreactive screening marker anchoring expression vector P L PSa by utilizing the alr gene and L. plantarum NC 8/delta alr nutrition complementation screening positive clone.

The invention relates to a method for screening non-resistance screening expression vector of lactobacillus plantarum, which is characterized in that lactobacillus plantarum belongs to gram-positive bacteria, cell wall thickness and exogenous plasmid electrotransformation host bacteria have certain difficulty, if a connection product is directly subjected to electrotransformation and has lower efficiency, positive recombinants are difficult to screen, even recombinants cannot be screened, and a writer uses the lactobacillus plantarum as the host bacteria to construct a non-resistance screening expression vector, so that a gram-negative bacterium escherichia coli asd gene deletion strain E.coli asd which is easy to screen the positive recombinants is selected as an intermediate host bacteria, asd-alr genes are serially connected to replace erythromycin marker genes on a lactobacillus plantarum induced expression vector, the connection product is firstly electrotransformed into an asd gene deletion strain E.coli6212/Δ asd, the asd genes on the plasmid and the host bacteria E.coli6212/Δ asd nutritional complementation screening positive recombinant plasmids are utilized, then the positive recombinant plasmids are electrotransformed to be screened to an alr deletion gene deletion strain E.coli6212/Δ asd, the negative plasmid is electrically transformed into an alr deletion strain NC8/Δ alr, the plasmid deletion strain NC is linked to a non-resistance screening vector, and the non-resistance screening of the lactobacillus plantarum NC8 is realized, and the non-resistance screening of the plant lactobacillus plantarum NC 3954.

The invention provides a nonresistance lactobacillus plantarum anchorage expression vector P L PSa, which is a biological safety foreign protein expression system, takes asd deletion strains E.coli 6212/delta asd and alr deletion L. plantarum NC 8/delta alr as host bacteria, takes a P23 promoter on a genome derived from lactococcus lactis (L actococcus lactis subsp. cremoris strain JM 4) as a promoter for alr gene expression, takes pYA4545, P L P-1261Inv, pSIP409PgsA '-I L-10 and pSIP409 PgsA' -EGFP as basic vectors, constructs a nutrition complementation screening marker escherichia coli-lactobacillus nonresistance expression vector P L PSa taking surface protein (S _ achoring) as an anchorage model, and takes EGFP as a reporter gene for carrying out EGFP and anchorage expression screening and anchorage expression verification.

Drawings

FIG. 1 shows a PstI and SalI double-restriction electrophoretogram of plasmids 409eat and 409eat, wherein M is a D L5000 DNA molecular weight standard, the molecular weights of which from top to bottom are 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp, wherein 750bp is highlighted, 1-2 is the restriction of 409eat plasmid, the length of a carrier fragment is 4436bp, the length of a P23Alr tf is 1336bp, and 3-4 is the restriction of 409eat plasmid, the length of the carrier fragment is 4436bp and the length of the P23Alr t is 1312 bp;

FIG. 2409 shows an electrotransformation of eatf L b Western blotting results for plantaumNC8/Deltaalr 1 and 3. M is a protein molecular weight standard with molecular weights of 70kDa, 50kDa, 40kDa and 20kDa from top to bottom, 1 is negative control L b plantaumNC8/Deltaalr, 2: L b plantaumNC8/Deltaalr 409eatf1, 3: L b plantaumNC8/Deltaalr 409eatf3, 4: negative control L b plantaumNC8/Deltaalr supernatant, 5: L b plantaumNC8/Deltaalr eatf1 supernatant, 6: L b plantaumNC8/Deltaalr 409 supernatant 3);

FIG. 3E. coli6212/Δ asd-409 ata colony PCR identification result, M is D L5000 DNA molecular weight standard, whose molecular weight is 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp from top to bottom, wherein 750bp is highlighted, 1-8 E.coli6212/Δ asd-409 ata single colony, 9 negative control;

FIG. 9 shows a 4409 ata plasmid Hind III single restriction enzyme electrophoresis chart, wherein M is a D L5000 DNA molecular weight standard, the molecular weight is 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom, wherein 750bp is highlighted, 1 is 409ata plasmid restriction enzyme, the length of a large fragment is 4305bp and the length of a small fragment is 2035 bp;

FIG. 5409 ata electric transfer L b. plantaumNC8/delta alr plasmid miniprep result, M is D L5000 DNA molecular weight standard, wherein the molecular weight is 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom, wherein 750bp is highlighted, 1-4: L b. plantaumNC8/delta alr-409ata single bacterium No. 1-4;

FIG. 6 shows the recovery and purification of fusion PCR product EGFP agarose gel and the electrophoresis result of P L P-1261Inv with NdeI and HindIII double digestion, M is D L5000 DNA molecular weight standard with molecular weight of 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp, 750bp highlighted, 1 is fusion PCR product EGFP 1298bp, 2 is fusion PCR product EGFP L P-1261Inv with NdeI and HindIII double enzyme vector segment 5577 bp;

FIG. 7 erythromycin screening Strain L Observation with a fluorescent microscope of plantarum NC8-p L PS-EGFP;

FIG. 8 shows the results of double restriction enzyme digestion of the mutated vector with Sal I and HindIII after p L PSaT, wherein M is D L5000 DNA molecular weight standard, and the molecular weights of the DNA are 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom, wherein 750bp is highlighted, 1: 1122bp of EGFPS fragment, 2: p L PSaT is 7672bp of signal peptide-containing vector fragment cut out by Sal I and HindIII;

FIG. 9 genetic engineering L Western Blot analysis of plantarum NC8/Δ alr-p L PSaT anchored expression of EGFP, M is protein molecular weight standard, 70kDa, 55kDa, 40kDa from top to bottom, negative control L b plantarum NC8/Δ alr, 1: L, plantarum NC8/Δ alr-p L PSaT surface protein extraction of EGFP plus S-achor molecular weight of about 46 kDa;

FIG. 10L shows autofluorescence observation of plantarum NC 8/. DELTA.alr-p L PSaT-anchored-expression EGFP strains (100X 10);

FIG. 11 map of plasmid p L PSa;

FIG. 12 shows a restriction enzyme digestion verification electrophoretogram M of plasmid p L PSa, wherein the molecular weight of D10000 bp, 7000bp, 4000bp, 2000bp, 1000bp, 750bp and 500bp are sequentially from top to bottom, the molecular weight of the D10000DNA is 2000bp, 7000bp, 4000bp, 2000bp, 1000bp, 750bp and 500bp, the molecular weight of the D10000DNA is highlighted, the DNA fragment is 1: plasmid p L PSa, and the DNA fragment is sequentially singly restricted by SalI, XbalI, XhoI, EcoR I and KpnI for vector p L PSa.

Detailed Description

Example 1

Alr gene in alr-EM double-marker vector 409eatf and host bacterium L, plantarum NC 8/delta alr nutrition complementation screening verification

1. pSIP409 PgsA' -I L-10 double enzyme digestion

The vector was digested with SalI and PstI, and the 4436bp gene fragment containing erythromycin and replicon was recovered by agarose gel electrophoresis.

2. Alr t and Alr tf gene amplification

L, plantarum NC8 strain genome is extracted and used as a template to design a primer, a primer alr gene (a base sequence is shown as SEQ ID NO. 3) contains a SalI enzyme cutting site, so that a carrier is not convenient to construct, the primer is prolonged during design, the alr can be amplified and mutated, the first C in the enzyme cutting site is mutated into G, the amplified gene is named alr t (1149 bp), in order to detect the expression condition of the alr gene after being regressed to lactobacillus plantarum, a Flag tag primer is additionally designed to be added at the 3' end of the alr gene sequence, so that the alr gene expression detection is facilitated, and the amplified gene is named as alr tf (1176 bp).

The primers are as follows:

alr t F: ATGGTTGTAATTGGGGAGCACCGCCACACACAAGTCACAGTGGACT (alr gene contains SalI site, mutation of C to G)

Alr t R: GATCATTTGGCGTGCCTGCAGTTAATCTATATAAACTCTCG (underlined homologous sequences in the vector and italicized PstI cleavage sites)

Alr tf R：GATCATTTGGCGTGCCTGCAGTTATTTGTCATCGTCATCTTTGTAGTCATCTAT

ATAAACTCTCG (underlined is the homology arm on the vector, italicized is the PstI cleavage site, grey scale is Flag tag)

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

3. lactococcus lactis promoter P23 fused with alr gene

1) Promoter P23 amplification

Using synthesized pUC57-Pori23 FnBPA containing P23 promoter gene sequence as a template to amplify the promoter sequence containing homologous arms; the base sequence of the P23 promoter is shown in SEQ ID NO. 4.

P23F: GAATGGAGACCGGGGTCGACgaaaagccctgacaaccctc (homologous sequence upstream of the SalI cleavage site on the vector is underlined, and the italics is marked as the SalI cleavage site)

P23R: GTGGCGGTGCTCCCCAATTACAACCATAACATCATTGTCATTCAT (underlined sequence homologous to the alrt (alr tf) gene)

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

the promoter P23 is used for SOE-PCR with the alr t and alr tf genes respectively

Two genes P23Alr t (1355 bp) and P23Alr tf (1382) were fused by agarose gel using primers P23F and Alr t R and Alr t f R, respectively, to recover the fused fragment.

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

4. the P23Alr t and P23Alr tf genes are connected with a pSIP409 PgsA' -I L-10 (PstI and SalI double-enzyme digestion) fragment vector

P23Alr t, P23Alr tf were ligated to pSIP409 PgsA' -I L-10 vector (double digested with PstI and SalI) using a Seamless Cloning Kit (Seamless Assembly Cloning Kit from Mimetai and Beijing Biotechnology Co., Ltd.) transformed into E.coli TOPO10 competent cells by the CaCl2 method, erythromycin L B coated solid medium was prepared and then digested after plasmid miniprep, vector fragments 4436bp and 1312bp excised P23Alr t (P23 Alr tf size 1336 bp) were electrophoresed as shown in FIG. 1, the digested positive plasmids were sequenced and identified as 100% homology after alignment and designated 409eat and 409eat respectively, the correctly sequenced plasmids 409 and 409eat were electroporated into the Alr gene defect L. plantarum 8/409. delta ale cells respectively, and recombinant plasmids NC 7. 8. NC-409. NC-L. NC-409. NC-3532. for screening of resistance against erythromycin receptive genes and auxotrophy.

The linking system is as follows:

5. western Blotting detection of alr gene regression host bacterium expression alanine racemase

L for expressing Flag tags is picked, plantarum NC 8/delta alr-409eatf monoclonal is planted in a liquid MRS culture medium containing 5 mu g/m L erythromycin for overnight culture, the liquid MRS culture medium (with bacterial liquid: culture medium =1: 50) is transferred, after bacterial liquid grows to a logarithmic growth phase, the bacterial liquid is centrifugally collected, samples are processed by ultrasonic disruption, Western Blotting is carried out, rabbit anti-Flag tag monoclonal antibodies are used for room temperature incubation for 2h, HRP-labeled goat anti-rabbit IgG is used for room temperature incubation for 1h as secondary antibodies, TBST is washed for three times to develop color, the protein size is about 42.4kD, which shows that the alr genes are successfully expressed, L plantarum NC 8/delta alr plasmid 409eatf can complete nutrition complementation, the cells can grow in the MRS culture medium without adding D-alanine, the aim of screening positive recombinants is achieved, and the result is shown in figure 2.

Example 2 construction of a nutritionally complementary asd-alr double-tagged plasmid vector 409ata and non-resistance selection validation in E.coli 6212/. DELTA.asd and L. plantarum NC 8/. DELTA.alr

1. The plasmid 409eat was double digested with BamHI and SalI, and the 4625bp containing replicon and alr gene fragments were recovered.

2. Amplifying asd gene, taking PYA4545 plasmid as a template, and amplifying a 1758bp fragment containing homologous defects by using the following primers; the base sequence of the asd gene is shown as SEQ ID NO. 5.

Pasd positive F: CGCTATGCGTGCGGGATCCTCTTCCCTAAATTTAAATATAAAC (homologous sequence to vector underlined, italicized marker BamHI)

Pasd R: GGGTTGTCAGGGCTTTTCGTCGACAACATCAGGTAGTGACA (homologous sequence to vector underlined, italicized Sal I)

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

3. asd gene is connected with 409eat (BamHI and SalI double enzyme cutting), a connecting product is electrically transformed into E.coli 6212/delta asd competent cells, a positive recombinant is screened without resistance, a single colony is grown, the colony PCR identification result electrophoresis is shown in figure 3, a positive bacterium miniprep plasmid is obtained, the recombinant plasmid is named as 409ata, two HindIII enzyme cutting sites are arranged on the plasmid, the enzyme cutting identification result is shown in figure 4, the sequencing identification of Jilin province U.S. Biotech limited company, the plasmid with correct sequencing is electrically transformed L, plantarum NC 8/delta alr, and a single clone plasmid is picked to prepare the electrophoresis result, which is shown in figure 5.

The linking system is as follows:

example 3 erythromycin screening anchored expression vector p L PS-EGFP construction and verification of anchoring expression at L. plant NC8

1. P L P-1261Inv is subjected to double enzyme digestion to obtain a vector fragment

NdeI and Hind III are used for double enzyme digestion, agarose gel electrophoresis is carried out to recover a 5577bp gene fragment of the vector, and the base sequence is shown as SEQ ID NO. 6.

2. Signal peptide sequence and anchoring sequence secreted from slpA gene for expressing S-layer protein, and amplification of EGFP

Extracting a genome of a lactobacillus acidophilus strain (L acetobacter acidophilus ATCC 4356) as a template, designing primers according to published gene sequences, adding homologous sequences to upstream and downstream primers respectively, facilitating fusion PCR and seamless cloning connection with a vector, and amplifying primer sequences of sig _ peptide signal peptide, S-layer protein C-terminal anchoring sequence S _ achoring and EGFP respectively as follows:

amplification of Signal peptide sig _ peptide sequence

sig_peptide F

TATATAGGAGTATGATTCATATGAAGAAAAATTTAAG

sig_peptide R

CTCCTCGCCCTTGCTCACCATGTCGACCGCCGCAATCGTG

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

amplification of EGFP sequences

EGFPS F

GGCACGATTGCGGCGGTCGAC ATGGTGAGCAAGGGCGAGGAG

EGFPS R

GGTACCGAATTCCTCGAGTCTAGACTTGTACAGCTCGTCC

The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

c-terminal anchoring sequence S _ achoring of S-layer protein

PS F

CAAG TCTAGA CTCGAGGAATTCGGTACCATGCACAACGCATACTAC

PS R

CAAAGCAACACGTGCTGTAATTTGAAGCTTTTATTATCTAAAGTTTG

The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

4) the length of a fusion PCR fragment of sig _ peptide, S-layer protein C-terminal anchoring sequence S _ antigen and EGFP is 1298bp, and the product name is EGFPS gene

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

c. the fusion PCR product EGFPS agarose gel recovery and purification and P L P-1261Inv double digestion purification electrophoresis results with NdeI and Hind III are shown in FIG. 6.

The fusion PCR product EGFPS is seamlessly cloned and connected with a vector P L P-1261Inv (NdeI and Hind III double enzyme digestion)

EGFP is seamlessly cloned and connected with a vector P L P-1261Inv (NdeI and Hind III), a connecting product is transformed into E.coli TOPO competent cells, an erythromycin plate is paved, a positive recon is screened, a positive clone miniprep plasmid is named as P L PS-EGFP, sequencing and identification are carried out by Jilin province American biotechnology limited company, after sequencing is correct, electrotransformation L. plantarum NC8 obtains an erythromycin screening marker positive strain L. plantarum NC8-P L PS-EGFP, and the observation result of a fluorescence microscope is shown in figure 7.

The linking system is as follows:

example 4 construction of Anchorage expression vector p L PSaT without antibody screening and verification of anchoring expression EGFP at L. plantarum NC8/Δ alr

1. amplification of asd-alr Gene

Designing a seamless clone primer containing a homologous sequence by referring to a 409ata gene sequence, amplifying a 3765bp segment containing an asd-alr gene, replacing an EM gene on p L PS-EGFP with asd-alr, and amplifying the primer containing the asd-alr gene segment as follows:

409ataF: GCAGCGAGTCAGTGAGCGAGAAGGATTATTCGGCTGGTTG (homologous sequence underlined)

409ata R: CAAATTTAAAAAAGCGACTCATAGAATTAATCTATATAAACTCTCG (homologous sequence underlined)

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

2. amplification of p L PS-EGFP Gene

Primers are designed according to the p L PS-EGFP gene sequence, and a L PS-EGFP fragment with 5073bp is amplified

L PS-EGFP test F5 'TTCTATGAGTCGCTTTTTT 3'

L PS-EGFP measured R5 'CTCGCTCACTGACTCGCTG 3'

a. The PCR reaction system is as follows:

b. the PCR reaction conditions were as follows:

3. the asd-alr gene is connected with L PS-EGFP

Connecting asd-alr gene with L PS-EGFP seamless clone, electrically transforming E.coli 6212/delta asd competent cells, coating L B solid culture medium, overnight culturing at 37 ℃, selecting single clone, after plasmid miniprep, naming positive plasmid as p L PS-EGFP, sequencing by adopting sequencing primer, wherein the primer sequence is as follows:

p' ata alr for F: CGAGAGTTTATATAGATTAA

P' ata PUC for F: GCAGCGAGTCAGTGAGCGAG

4. HindIII site mutation of p L PS-EGFPA vector

The vector contains two HindIII enzyme cutting sites which influence the use of the vector, the HindIII enzyme cutting site AAGCTT in the alr gene is mutated into AAACTT, and point mutation primers are as follows:

Hind F:CCAGTCTCTGGCATCAAACTTGCAATGGCAAC;

Hind R:TTTGATGCCAGAGACTGGTGGCCGAATTGGAC

meanwhile, the vector also contains two Sal I enzyme cutting sites, the downstream Sal I enzyme cutting site GTCGAC of the asd gene is mutated into GTAGAC, and the primers are as follows:

1261ATT F: cactacctgatgtt GTAGACgaaaagccctgac

1261ATTR:TACAACATCAGGTAGTGACACTTCTTTGACCTG

after a PCR amplification product is purified by taking a plasmid p L PS-EGFP as a template, and is treated by a Dpn I restriction endonuclease, an E.coli 6212/delta asd competent cell is electrically transformed, a screened positive vector after two times of mutation is named as p L PSaT, the mutated vector is subjected to double enzyme digestion identification results of Sal I and Hind III as shown in a figure 8, and an EGFPS fragment containing 7672bp and 1122bp of a vector fragment containing a signal peptide is obtained by enzyme digestion.

5. Gene engineering L plant arum NC 8/delta alr-p L PSaT anchored expression EGFPlestern Blot analysis and thallus autofluorescence detection

After the sequencing is correct, plasmid p L PSaT is electrically transformed into L. plantarum NC 8/delta alr, L. plantarum NC 8/delta alr-p L PSaT is obtained, L. plantarum NC 8/delta alr-p L PSaT monoclonal antibody is inoculated into a liquid MRS culture medium for overnight culture, a liquid MRS culture medium is transferred (a bacteria solution: culture medium =1:50, pSSIP induction peptide is added after anaerobic culture is carried out for 1h at 37 ℃, the bacteria solution is continuously cultured for 4h until the bacteria solution grows to logarithmic growth phase, bacteria are centrifugally collected, after PBS is washed for three times, a slide is prepared, fluorescence is observed by using an inverted fluorescence microscope, the result is shown in figure 9. a repeated freezing and thawing method is adopted to extract bacteria surface protein, WesternBlot analysis is carried out, a mouse anti-EGFP monoclonal antibody is used for incubation, a secondary antibody is used for goat-labeled anti-IgG for incubation, after the membrane is washed for three times by TBST, and the EGFS laminar protein with the size of the anchored EGFS 46 plus figure 10 kD.

Example 5 construction of non-resistance screening anchored expression vector p L PSa

1. Preparation of S _ amplification gene S containing sig _ peptide signal peptide and S-layer protein C-terminal anchoring sequence

Referring to the sequence of Lactobacillus acidophilus (L Acobacter acidophilus ATCC 4356) SlpA gene issued by NCBI, the sig _ peptide signal peptide sequence and the C-terminal anchor sequence of S-layer protein were retained, the sequence of the middle part of the gene sequence was replaced with L inker and polyclonal restriction site MCS (SalI, XbaI, XhoI, EcoR I, KpnI) as follows GGCACGATTGCGGCG GTCGAC TCTAGA CTCGAG GAATTC GGTACC, NdeI and HindIII cleavage sites were added to the upper and lower streams of the designed sequence, the sequence was 540bp long and synthesized by Soujin Mingzhi Biotech Co., Ltd, and the cloning vector containing the desired gene after synthesis was named pUC 57-Kan-S.

2. Insertion of the S Gene into the P L P-1261Inv (NdeI and HindIII double restriction enzymes) vector to construct the C-terminal anchored expression vector P L PS

P L P-1261Inv and pUC57-Kan-S are respectively cut by NdeI and Hind III to recover 5578bp vector and 533bp target fragment S (the number of the synthetic gene base after cutting is changed), then T4DNA ligase is used for connection, E.coliTOP10 competent cells are transformed by a chemical method, an erythromycin solid culture medium is paved, and a positive clone is screened by an erythromycin resistance gene, and the vector is named as P L PS.

3. Preparation of P23-alr-asd Gene

The gene sequence of the ASD gene of a PYA4545 vector, a P23 promoter published by NCBI and the alr gene sequence of lactobacillus plantarum are referred, the asd gene, the P23 promoter and the alr gene are connected in series to obtain the P23-alr-asd gene, the gene is artificially synthesized, and the gene size is 3027 bp.

4. P23-alr-asd gene is used for replacing Erythromycin (EM) gene on vector P L PS to obtain resistance-free selection marker anchoring expression vector P L PSa

The P23-alr-asd gene is used for replacing the erythromycin gene on the vector P L PS, and because the vector is not linearized by a proper enzyme cutting site on the vector, the vector and the P23-alr-asd gene are linearized by a PCR method, primers are designed according to the sequence of the P L PS gene, a 5050bp segment L PS of the erythromycin gene is amplified and removed, and the primers are as follows:

LPS F：TTCTATGAGTCGCTTTTTTAAATTTG

LPS R：GGATCCCGCACGCATAGCGGTGC

the primer sequence for amplifying the P23-alr-asd gene is as follows:

asd F: CGCTATGCGTGCGGGATCCTCTTCCCTAAATTTAAATATAAAC (underlined is the cognate arm on the p L PS vector)

alr R: CAAATTTAAAAAAGCGACTCATAGAATTAATCTATATAAACTCTCG (homologous arm to p L PS vector);

amplifying a P23-alr-asd gene containing a homologous arm by taking a synthesized P23-alr-asd gene as a template, seamlessly cloning and connecting L PS and the P23-alr-asd, electrically transforming E.coli 6212/delta asd competent cells, paving a common L B solid culture medium, realizing nutrition complementation screening positive clone by utilizing the asd gene and host bacteria, sequencing and identifying a correct plasmid named as P L PSa, and electrically transforming the P L PSa to L. plantarum NC 8/delta alr, constructing a nonresistance screening marker anchoring expression vector P L PSa by utilizing the alr gene and L. plantarum NC 8/delta alr nutrition complementation screening positive clone, wherein the map of the P L PSa is shown in figure 11.

Enzyme digestion verification of non-resistance selection marker anchored expression vector p L PSa

Multiple cloning enzyme cutting sites MCS (SalI, XbaI, XhoI, EcoR I and KpnI) are added between the sig-peptide signal peptide and the C-terminal anchoring sequence of the S-layer protein to facilitate the insertion of the target gene, the result of single enzyme digestion of the vector by SalI, XbaI, XhoI, EcoR I and KpnI is shown in a figure 12, and the 8077bp vector fragment can be cut by enzyme.

Sequence listing

<110> Jilin university of agriculture

<120> non-resistant Lactobacillus plantarum anchoring expression vector p L PSa and preparation method thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>540

<212>DNA

<213> Artificial Synthesis ()

<400>1

catatgaaga aaaatttaag aatcgttagc gctgctgctg ctgctttact tgctgttgct 60

ccagttgctg cttctgctgt atctactgtt agcgctgcta ctactattaa cgcaggcacg 120

attgcggcgg tcgactctag actcgaggaa ttcggtacca tgcacaacgc atactactac 180

gacaaggacg ctaagcgtgt tggtactgac agcgttaagc gttacaactc agtaagcgta 240

ttgccaaaca ctactactat caacggtaag acttactacc aagtagttga aaacggtaag 300

gctgttgaca agtacatcaa cgctgcaaac atcgatggta ctaagcgtac tttgaagcac 360

aacgcttacg tttacgcatc atcaaagaag cgtgctaaca aggttgtatt gaagaagggt 420

gaagttgtaa ctacttacgg tgcttcatac acattcaaga acggccaaaa gtactacaag 480

atcggtgaca acactgacaa gacttacgtt aaggttgcaa actttagata ataaaagctt 540

<210>2

<211>3027

<212>DNA

<213> Artificial Synthesis ()

<400>2

tcttccctaa atttaaatat aaacaacgaa ttatctcctt aacgtacgtt ttcgttccat 60

tggccctcaa acccctaatt aggatcaata aaacagcgac ggaaatgatt cccttcctaa 120

cgcaaattcc ctgataatcg ccactggact ttctgcttgc gcggtaaggc aggataagtc 180

gcattactga tggcttcgct atcattgatt aatttcactt gcgactttgg ctgctttttg 240

tatggtgaag gatgcgccac aggatactgg cgcgcataca cagcacatct ctttgcagga 300

aaaaaacgct atgaaaaatg ttggttttat cggctggcgc ggaatggtcg gctctgttct 360

catgcaacgc atggtagagg agcgcgattt cgacgctatt cgccctgttt tcttttctac 420

ctcccagttt ggacaggcgg cgcccacctt cggcgacacc tccggcacgc tacaggacgc 480

ttttgacctg gatgcgctaa aagcgctcgatatcatcgtg acctgccagg gcggcgatta 540

taccaacgaa atttatccaa agctgcgcga aagcggatgg cagggttact ggattgatgc 600

ggcttctacg ctgcgcatga aagatgatgc cattattatt ctcgacccgg tcaaccagga 660

cgtgattacc gacggcctga acaatggcgt gaagaccttt gtgggcggta actgtaccgt 720

tagcctgatg ttgatgtcgc tgggcggtct ctttgcccat aatctcgttg actgggtatc 780

cgtcgcgacc tatcaggccg cctccggcgg cggcgcgcgc catatgcgcg agctgttaac 840

ccagatgggt cagttgtatg gccatgtcgc cgatgaactg gcgacgccgt cttccgcaat 900

tcttgatatt gaacgcaaag ttacggcatt gacccgcagc ggcgagctgc cggttgataa 960

ctttggcgta ccgctggcgg gaagcctgat cccctggatc gacaaacagc tcgataacgg 1020

ccagagccgc gaagagtgga aaggccaggc ggaaaccaac aagattctca atactgcctc 1080

tgtgattccg gttgatggtt tgtgtgtgcg cgtcggcgcg ctgcgctgtc acagccaggc 1140

gttcaccatc aagctgaaaa aagaggtatc cattccgacg gtggaagaac tgctggcggc 1200

acataatccg tgggcgaaag tggtgccgaa cgatcgtgat atcactatgc gcgaattaac 1260

cccggcggcg gtgaccggca cgttgactac gccggttggt cgtctgcgta agctgaacat 1320

ggggccagag ttcttgtcgg cgtttaccgt aggcgaccag ttgttatggg gcgccgccga 1380

gccgctgcgt cgaatgctgc gccagttggc gtagtggcta ttgcagcgct tatcgggcct 1440

gcgtgtggtt ctgtaggccg gataaggcgc gtcagcgccg ccatccggcg gggaaatttg 1500

tgttaaacca ggggtgcatc gtcacccttt ttttgcgtaa tacaggagta aacgcagatg 1560

tttcattttt atcaggagtt aagcagagca ttggctattc tttaagggtagcttaatccc 1620

acgggtatta agcctaacct gaaggtagga cgacgcagat aggatgcaca gtgtgctgcg 1680

ccgttcaggt caaagaagtg tcactacctg atgttgtaga cgaaaagccc tgacaaccct 1740

cgttcctaaa aaggaataag cgtttggtca gtaaataata gaaataaaaa atcagaccta 1800

agactgatga caaaaagagc aaattttgat aaaatagtat tagaattaaa ttaaaaaggg 1860

aggccaaata taatgaaaaa tatgaatgac aatgatgtta tggttgtaat tggggagcac 1920

cgccacacac aagtcacagt ggacttgcag gcaattaaga caaatattag taatgaaatg 1980

gcgcaaaagg atgagttgac cgagttatgg gcagtcgtta aagcgaatgg ttatggacat 2040

ggaattatcc aagttgctca ggccgccaaa gaagccgggg cgaccggctt ttgtgttgca 2100

atcctggatg aggccttagc gttgcgggcc gctggctttg cggaacccat cctagtactt 2160

ggaattacgg aaccggaata cgccccactg gtagctgaaa aggatatttc actagctgtt 2220

ggaacgcaag attggctgac tacggccgca gcaattttag cggctaatca agtgacgaca 2280

ccacttcacg ttcatcttgc attagatacg ggtatgggac gaatcgggtt tcagacgccc 2340

gaagaattgg caacggcggt tacgactttg cgtcaaccgc agtcaccatt tgactttgaa 2400

gggattttta cgcattttgc aacggctgac caggcagatg atacgtattt tactcatcaa 2460

ttaaataatt ggaaacactt gattgcagtg gtggatgagc taccacgcta tgtccacgtg 2520

tccaattcgg ccaccagtct ctggcatcaa acttgcaatg gcaacatggt gcgctttggg 2580

gttgcactct atggtctaaa tccttctggt cgcgaactca gcgcaccata ccccttgcaa 2640

cccgcgttgt cgctaacggc acgcttgacg tttgttaaac gcttggctcg gggcaaatcg 2700

gtcagctatg gtgccacgta tacggccgca caggatgaat ggattggcac ggtgccgatt 2760

gggtatgcgg acggctatga acgccgatta caaggcttcc atgtacttgt tgatggtgag 2820

ttttgcgaaa tcgtcggacg ggtctgcatg gaccagctga tggttcgtct gccacatgaa 2880

gtaccggttg gagctaaggt aactttggtt ggcacggacg gtgctcgtac catttcgttg 2940

caagatattg ctgactattg tgggacaatt cattatgaga ttgcttgtgg gttagcacca 3000

cgagtgccga gagtttatat agattaa 3027

<210>3

<211>1128

<212>DNA

<213> Artificial Synthesis ()

<400>3

atggttgtaa ttggggagca ccgccacaca caagtcacag tggacttgca ggcaattaag 60

acaaatatta gtaatgaaat ggcgcaaaag gatgagttga ccgagttatg ggcagtcgtt 120

aaagcgaatg gttatggaca tggaattatc caagttgctc aggccgccaa agaagccggg 180

gcgaccggct tttgtgttgc aatcctggat gaggccttag cgttgcgggc cgctggcttt 240

gcggaaccca tcctagtact tggaattacg gaaccggaat acgccccact ggtagctgaa 300

aaggatattt cactagctgt tggaacgcaa gattggctga ctacggccgc agcaatttta 360

gcggctaatc aagtgacgac accacttcac gttcatcttg cattagatac gggtatggga 420

cgaatcgggt ttcagacgcc cgaagaattg gcaacggcgg ttacgacttt gcgtcaaccg 480

cagtcaccat ttgactttga agggattttt acgcattttg caacggctga ccaggcagat 540

gatacgtatt ttactcatca attaaataat tggaaacact tgattgcagt ggtggatgag 600

ctaccacgct atgtccacgt gtccaattcg gccaccagtc tctggcatca aacttgcaat 660

ggcaacatgg tgcgctttgg ggttgcactc tatggtctaa atccttctgg tcgcgaactc 720

agcgcaccat accccttgca acccgcgttg tcgctaacgg cacgcttgac gtttgttaaa 780

cgcttggctc ggggcaaatc ggtcagctat ggtgccacgt atacggccgc acaggatgaa 840

tggattggca cggtgccgat tgggtatgcg gacggctatg aacgccgatt acaaggcttc 900

catgtacttg ttgatggtga gttttgcgaa atcgtcggac gggtctgcat ggaccagctg 960

atggttcgtc tgccacatga agtaccggtt ggagctaagg taactttggt tggcacggac 1020

ggtgctcgta ccatttcgtt gcaagatatt gctgactatt gtgggacaat tcattatgag 1080

attgcttgtg ggttagcacc acgagtgccg agagtttata tagattaa 1128

<210>4

<211>184

<212>DNA

<213> Artificial Synthesis ()

<400>4

gtcgacgaaa agccctgaca accctcgttc ctaaaaagga ataagcgttt ggtcagtaaa 60

taatagaaat aaaaaatcag acctaagact gatgacaaaa agagcaaatt ttgataaaat 120

agtattagaa ttaaattaaa aagggaggcc aaatataatg aaaaatatga atgacaatga 180

tgtt 184

<210>5

<211>1715

<212>DNA

<213> Artificial Synthesis ()

<400>5

tcttccctaa atttaaatat aaacaacgaa ttatctcctt aacgtacgtt ttcgttccat 60

tggccctcaa acccctaatt aggatcaata aaacagcgac ggaaatgatt cccttcctaa 120

cgcaaattcc ctgataatcg ccactggact ttctgcttgc gcggtaaggc aggataagtc 180

gcattactga tggcttcgct atcattgatt aatttcactt gcgactttgg ctgctttttg 240

tatggtgaag gatgcgccac aggatactgg cgcgcataca cagcacatct ctttgcagga 300

aaaaaacgct atgaaaaatg ttggttttat cggctggcgc ggaatggtcg gctctgttct 360

catgcaacgc atggtagagg agcgcgattt cgacgctatt cgccctgttt tcttttctac 420

ctcccagttt ggacaggcgg cgcccacctt cggcgacacc tccggcacgc tacaggacgc 480

ttttgacctg gatgcgctaa aagcgctcga tatcatcgtg acctgccagg gcggcgatta 540

taccaacgaa atttatccaa agctgcgcga aagcggatgg cagggttact ggattgatgc 600

ggcttctacg ctgcgcatga aagatgatgc cattattatt ctcgacccgg tcaaccagga 660

cgtgattacc gacggcctga acaatggcgt gaagaccttt gtgggcggta actgtaccgt 720

tagcctgatg ttgatgtcgc tgggcggtct ctttgcccat aatctcgttg actgggtatc 780

cgtcgcgacc tatcaggccg cctccggcgg cggcgcgcgc catatgcgcg agctgttaac 840

ccagatgggt cagttgtatg gccatgtcgc cgatgaactg gcgacgccgt cttccgcaat 900

tcttgatatt gaacgcaaag ttacggcatt gacccgcagc ggcgagctgc cggttgataa 960

ctttggcgta ccgctggcgg gaagcctgat cccctggatc gacaaacagc tcgataacgg 1020

ccagagccgc gaagagtgga aaggccaggc ggaaaccaac aagattctca atactgcctc 1080

tgtgattccg gttgatggtt tgtgtgtgcg cgtcggcgcgctgcgctgtc acagccaggc 1140

gttcaccatc aagctgaaaa aagaggtatc cattccgacg gtggaagaac tgctggcggc 1200

acataatccg tgggcgaaag tggtgccgaa cgatcgtgat atcactatgc gcgaattaac 1260

cccggcggcg gtgaccggca cgttgactac gccggttggt cgtctgcgta agctgaacat 1320

ggggccagag ttcttgtcgg cgtttaccgt aggcgaccag ttgttatggg gcgccgccga 1380

gccgctgcgt cgaatgctgc gccagttggc gtagtggcta ttgcagcgct tatcgggcct 1440

gcgtgtggtt ctgtaggccg gataaggcgc gtcagcgccg ccatccggcg gggaaatttg 1500

tgttaaacca ggggtgcatc gtcacccttt ttttgcgtaa tacaggagta aacgcagatg 1560

tttcattttt atcaggagtt aagcagagca ttggctattc tttaagggta gcttaatccc 1620

acgggtatta agcctaacct gaaggtagga cgacgcagat aggatgcaca gtgtgctgcg 1680

ccgttcaggt caaagaagtg tcactacctg atgtt 1715

<210>6

<211>5583

<212>DNA

<213> Artificial Synthesis ()

<400>6

aagcttcaaa ttacagcacg tgttgctttg attgatagcc aaaaagcagc agttgataaa 60

gcaattactg atattgctga aaaattgtaa tttataaata aaaatcacct tttagaggtg 120

gtttttttat ttataaatta ttcgtttgat ttcgctttcg atagaacaat caaagcgaga 180

ataaggaaga taaatcccat aagggcggga gcagaatgtc cgagactaat tcatgaccaa 240

aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg 300

atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc 360

gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac 420

tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca 480

ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt 540

ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc 600

ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg 660

aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc 720

cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gaggcgcacg 780

agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc 840

tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatc gaaaaacgcc 900

agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt 960

cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc 1020

gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgagaagga ttattcggct 1080

ggttgagacg ttaaaatgat aaaggttgta ttaatcttat attacggtta taatgtactc 1140

aacttaataa atgaacgcaa aaaaaagaac cctcaactta gcagagttag gattcacgac 1200

ttatcagcac aacctgataa gattttcgat agcaagtact accaatacaa gctatctaac 1260

ttggtactat tataacatgt aggctaagtt tttcaaccat tgatacttaa agtaaacggt 1320

tgttatcggg aatcttaaca gaaacctgat agcaaccgtt tttttgttat tcaatggtta 1380

gcaaccatca aagcaactaa aggctggaaa cctgttcttagctagtaaaa cctcccgtga 1440

gtgtcgttcg tgaccccgct tgcagttaac aacataggta tgctaaacct tgtcgagatc 1500

aacgcgacta aagacgtggc tggaagacta ggaaatgata cggacaggct aactattaac 1560

gcagattatt cgggttgctg ctaaaaccaa ctctaataat agttagtgca agggctggtt 1620

gagcttaaat tgtctgataa agagttctct ctttatactg caaaagaagc gcagttattc 1680

acgattagga taactgtttg agagagccta agggcttgac ccttgatggt ttaagcaccg 1740

ctatgcgtgc gggatcccct tagaagcaaa cttaagagtg tgttgatagt gcattatctt 1800

aaaattttgt ataataggaa ttgaagttaa attagatgct aaaaatagga attgaagtta 1860

aattagatgc taaaaatttg taattaagaa ggagggattc gtcatgttgg tattccaaat 1920

gcgtaatgta gataaaacat ctactgtttt gaaacagact aaaaacagtg attacgcaga 1980

taaataaata cgttagatta attcctacca gtgactaatc ttatgacttt ttaaacagat 2040

aactaaaatt acaaacaaat cgtttaactt caggagagat tacatgaaca aaaatataaa 2100

tatctcaaac tttttaacga gtgaaaaagt actcaaccaa ataataaaac aattgaattt 2160

aaaagaaacc gataccgttt acgaaattgg aacaggtaaa gggcatttaa cgacgaaact 2220

ggctaaaata agtaaacagg taacgtctat tgaattagac agtcatctat tcaacttatc 2280

gtcagaaaaa ttaaaactga atactcgtgt cactttaatt caccaagata ttctacagtt 2340

tcaattccct aacaaacaga ggtataaaat tgttgggaat attccttaca atttaagcac 2400

acaaattatt aaaaaagtgg tttttgaaag ccgtgcgtct gacatctatc tgactgttga 2460

agaaggattc tacaagcgta ccttggatat tcaccgaaca ctagggttgc tcttgcacac 2520

tcaagtctcg attcagcaat tgcttaagct gccagcggaa tgctttcatc ctaaaccaaa 2580

agtaaacagt gtcttaataa aacttacccg ccataccaca gatgttccag ataaatattg 2640

gaagctatat aagtactttg tttcaaaatg ggtcaatcga gaatatcgtc aactgtttac 2700

taaaaatcag tttcgtcaag caatgaaaca cgccaaagta aacaatttaa gtaccattac 2760

ttatgagcaa gtattgtcta tttttaatag ttatctatta tttaacggga ggaaataatt 2820

ctatgagtcg cttttttaaa tttggaaagt tacacgttac taaagggaat ggagaccggg 2880

gcccttcaat agagttctta acgttaatcc gaaaaaaact aacgttaata ttaaaaaata 2940

agatccgctt gtgaattatg tataatttga ttagactaaa gaataggaga aagtatgatg 3000

atatttaaaa aactttctcg ttaagatagg ttgttggtga gcatgttata tacggatgta 3060

tcggtttcct taatgcaaaa ttttgttgct atcttattaa tttttctatt atatagatat 3120

attcaaagaa agataacatt taaacggatc atattagata ttttaatagc gattattttt 3180

tcaatattat atctgtttat ttcagatgcg tcattacttg taatggtatt aatgcgatta 3240

gggtggcatt ttcatcaaca aaaagaaaat aagataaaaa cgactgatac agctaattta 3300

attctaatta tcgtgatcca gttattgtta gttgcggttg ggactattat tagtcagttt 3360

accatatcga ttatcaaaag tgatttcagc caaaatatat tgaacaatag tgcaacagat 3420

ataactttat taggtatttt ctttgctgtt ttatttgacg gcttgttctt tatattattg 3480

aagaataagc ggactgaatt acaacattta aatcaagaaa tcattgaatt ttcgttagaa 3540

aaacaatatt ttatatttat atttatttta tttatagtaa tagaaattat tttagcagtt 3600

gggaatcttc aaggagtaac agccacgata ttattaacca ttatcattat tttttgtgtc 3660

cttatcggga tgactttttg gcaagtgatg ctttttttga aggcttattc gattcgccaa 3720

gaagccaatg accaattggt ccggaatcaa caacttcaag attatctagt caatatcgaa 3780

cagcagtaca ccgaattacg gcgatttaag catgattatc aaaacatctt attatcgttg 3840

gagagttttg ccgaaaaggg cgatcagcaa cagtttaagg cgtattacca agaattatta 3900

gcacaacggc caattcaaag tgaaatccaa ggggcagtca ttgcacaact cgactacttg 3960

aaaaatgatc ctattcgagg attagtcatt caaaagtttt tggcagccaa acaggctggt 4020

gttactttaa aattcgaaat gaccgaacca atcgaattag caaccgctaa tctattaacg 4080

gttattcgga ttatcggtat tttattagac aatgcgattg aacaagccgt tcaagaaacc 4140

gatcaattgg tgagttgtgc tttcttacaa tctgatggtt taatcgaaat tacgattgaa 4200

aatacggcca gtcaagttaa gaatctccaa gcattttcag agttaggcta ttcaacgaaa 4260

ggcgctggtc gggggactgg tttagctaat gtgcaggatt tgattgccaa acaaaccaat 4320

ttattcttag aaacacagat tgaaaataga aagttacgac agacattgat gattacggag 4380

gaaacttaat ttgtatcccg tttatttatt agaggatgat ttacagcaac aagcgattta 4440

tcagcaaatt atcgcgaata cgattatgat taacgaattt gcaatgactt taacatgcgc 4500

tgccagtgat actgagacat tgttggcggc aattaaggat cagcaacgag gtttattctt 4560

tttggatatg gaaattgagg ataaccgcca agccggttta gaagtggcaa ctaagattcg 4620

gcagatgatg ccgtttgcgc aaattgtctt cattacaacc cacgaggaac tgacattatt 4680

aacgttagaa cgaaaaatag cgcctttaga ttacattctc aaggaccaaa caatggctga 4740

aatcaaaagg caattgattg atgatctatt gttagctgag aagcaaaacg aggcggcagc 4800

gtatcaccga gaaaatttat ttagttataa aataggtcct cgctttttct cattaccatt 4860

aaaggaagtt gtttatttat atactgaaaa agaaaatccg ggtcatatta atttgttagc 4920

cgttaccaga aaggttactt ttccaggaaa tttaaatgcg ctggaagccc aatatccaat 4980

gctctttcgg tgtgataaaa gttacttagt taacctatct aatattgcca attatgacag 5040

taaaacacgg agtttaaaat ttgtagatgg cagtgaggca aaagtctcgt tccggaaatc 5100

acgggaacta gtggccaaat taaaacaaat gatgtagcgc ctgcagcacg ccaaatgatc 5160

ccagtaaaaa gccacccgca tggcgggtgg ctttttatta gccctagaag ggcttcccac 5220

acgcatttca gcgccttagt gccttagttt gtgaatcata ggtggtatag tcccgaaata 5280

cccgtctaag gaattgtcag ataggcctaa tgactggctt ttataatatg agataatgcc 5340

gactgtactt tttacagtcg gttttctaat gtcactaacc tgccccgtta gttgaagaag 5400

gtttttatat tacagctcca gatctaccgg tgggcccata ttaacgttta accgataaag 5460

ttgaacgtta atattttttt tgcgcagaaa tggtaaattg aagcataata gtcttgtaag 5520

gtatttagct ggctggcgta aagtatgctt tataaaataa tatataggag tatgattcat 5580

atg 5583

Claims (2)

1. A non-resistant Lactobacillus plantarum anchored expression vector P L PSa is characterized in that NdeI and Hind III are used for double enzyme digestion of genes shown by P L P-1261Inv and SEQ ID NO.1, the gene shown by SEQ ID NO.1 is inserted into P L P-1261Inv to obtain a vector P L PS, and then a P23-alr-asd gene is used for replacing an erythromycin gene on the vector P L PS, wherein the base sequence of the P23-alr-asd gene is shown by SEQ ID NO. 2.

2. A method for preparing a non-resistant Lactobacillus plantarum anchored expression vector p L PSa, comprising:

1) preparation of S _ amplification gene S containing sig _ peptide signal peptide and S-layer protein C-terminal anchoring sequence

With reference to the SlpA gene sequence of Lactobacillus acidophilus ATCC 4356 issued by NCBI, the sig _ peptide signal peptide sequence and the C-terminal anchor sequence of S-layer protein were retained, the middle part of the gene sequence was replaced with L inker and the multiple cloning site SalI, XbaI, XhoI, EcoR I, KpnI, L inker and the multiple cloning site sequence was GGCACGATTGCGGCG GTCGACTCTAGA CTCGAG GAATTC GGTACC, the gene S shown in SEQ ID No.1 was artificially synthesized, the gene shown in SEQ ID No.1 was inserted into P L P-1261Inv by double digestion with NdeI and HindIII, and the vector was named P L PS;

2) preparation of P23-alr-asd Gene

The asd gene, the P23 promoter and the alr gene are connected in series by referring to the sequence of the asd gene of a PYA4545 vector, the P23 promoter published by NCBI and the alr gene sequence of lactobacillus plantarum to obtain the P23-alr-asd gene and artificially synthesize the gene, wherein the base sequence of the gene is shown as SEQID NO. 2;

3) p23-alr-asd gene is used to replace erythromycin gene on vector P L PS to obtain resistance-free selection marker anchoring expression vector P L PSa

The P23-alr-asd gene is used for replacing the erythromycin gene on the vector P L PS, and because the vector is not linearized by a proper enzyme cutting site on the vector, the vector and the P23-alr-asd gene are linearized by a PCR method, primers are designed according to the sequence of the P L PS gene, a 5050bp segment L PS of the erythromycin gene is amplified and removed, and the primers are as follows:

LPS F：TTCTATGAGTCGCTTTTTTAAATTTG

LPS R：GGATCCCGCACGCATAGCGGTGC

the primer sequence for amplifying the P23-alr-asd gene is as follows:

asd F：CGCTATGCGTGCGGGATCCTCTTCCCTAAATTTAAATATAAAC

alr R：CAAATTTAAAAAAGCGACTCATAGAATTAATCTATATAAACTCTCG；

amplifying a P23-alr-asd gene containing a homologous arm by taking a synthesized P23-alr-asd gene as a template, seamlessly cloning and connecting L PS and the P23-alr-asd, electrically transforming E.coli 6212/delta asd competent cells, paving a common L B solid culture medium, realizing nutrition complementation screening positive clone by utilizing the asd gene and host bacteria, sequencing and identifying a correct plasmid named as P L PSa, electrically transforming the P L PSa to L. plantarum NC 8/delta alr, and constructing a nonreactive screening marker anchoring expression vector P L PSa by utilizing the alr gene and L. plantarum NC 8/delta alr nutrition complementation screening positive clone.

Images