WO2021153706A1 - Pomme de terre génétiquement modifiée, son procédé de production et procédé d'édition de génome de pomme de terre - Google Patents

Pomme de terre génétiquement modifiée, son procédé de production et procédé d'édition de génome de pomme de terre Download PDF

Info

Publication number
WO2021153706A1
WO2021153706A1 PCT/JP2021/003139 JP2021003139W WO2021153706A1 WO 2021153706 A1 WO2021153706 A1 WO 2021153706A1 JP 2021003139 W JP2021003139 W JP 2021003139W WO 2021153706 A1 WO2021153706 A1 WO 2021153706A1
Authority
WO
WIPO (PCT)
Prior art keywords
potato
gene
nucleic acid
genetically modified
orange
Prior art date
Application number
PCT/JP2021/003139
Other languages
English (en)
Japanese (ja)
Inventor
亮 遠藤
洋三 柳楽
晴康 濱田
直行 梅基
斉藤　和季
Original Assignee
株式会社カネカ
国立研究開発法人理化学研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 株式会社カネカ, 国立研究開発法人理化学研究所 filed Critical 株式会社カネカ
Priority to JP2021574131A priority Critical patent/JPWO2021153706A1/ja
Publication of WO2021153706A1 publication Critical patent/WO2021153706A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/04—Stems
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Definitions

  • the present invention relates to a genetically modified potato, a method for producing the same, and a method for editing the genome of the potato.
  • Carotenoids have a basic nutritional role as antioxidants and precursors of vitamin A. Ingestion of carotenoids is also associated with protection from various illnesses. Furthermore, it is also known that it is commercially used as a coloring agent for safe foods, feeds and cosmetics, and protects plants from photooxidative stress (Non-Patent Document 1). Therefore, breeding of high carotenoids is an important issue both in Japan and worldwide. As potatoes showing carotenoid accumulation, Kita Akari, Toya, Sassy, etc. are known as yellow meat potato varieties, and Inca Awakening, Nagasaki Golden are known as potato varieties in which more carotenoids, especially zeaxanthin, are accumulated. ing. It is speculated that these are mutations in the CHY and ZEP genes (Non-Patent Document 2).
  • Non-Patent Documents 3, 4, and 5 a gene named Orage (Or) is known (Non-Patent Documents 3, 4, and 5).
  • Orage Orage
  • overexpression of an overt mutation gene that produces an orange color of orange cauliflower in potatoes causes the inside of the tuber of the potato variety Desiree to turn yellow, and violaxanthin, lutein, and ⁇ -carotene are accumulated.
  • violaxanthin, lutein, and ⁇ -carotene Has been reported (Non-Patent Document 6).
  • Non-Patent Document 7 the amount of carotenoids increased in callus due to the modification of the Orange gene, but the amount of carotenoids did not increase in the redifferentiated plants.
  • Non-Patent Document 8 synthetic pathways (for example, pigment synthesis, etc.) and metabolic pathways are often different. Therefore, it is not easy to apply the finding that an agriculturally good phenotype appears when a gene of a certain plant species is modified to another crop species as it is.
  • An object of the present invention is to solve the above-mentioned problems in the past and to achieve the following objects. That is, an object of the present invention is to provide a genetically modified potato in which carotenoids are accumulated, and an efficient method for producing the same.
  • the present inventors have accumulated carotenoids due to genetically modified potatoes in which a deletion, insertion, or substitution has been introduced into the Orange gene. And an efficient method for producing the same, and by adopting a method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato, a gene in which carotenoids are accumulated. It has been found that an efficient method for producing modified potatoes can be provided.
  • the present invention is based on the above-mentioned findings by the present inventors, and the means for solving the above-mentioned problems are as follows. That is, ⁇ 1> A genetically modified potato characterized in that a deletion, insertion, or substitution has been introduced into the Orange gene. ⁇ 2> A method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato. ⁇ 3> A potato genome editing method comprising a step of introducing a deletion, insertion, or substitution into a potato Orange gene using a genome editing means.
  • ⁇ 4> Containing either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and either a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme. It is a composition for producing a genetically modified potato, which is characterized by the above.
  • a method for determining a genetically modified potato which comprises a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index.
  • FIG. 1 is a schematic diagram showing the genomic structure of the Orange gene of potato (S. tuberosum) and the site of the primer that sequenced the 3rd to 5th exons.
  • FIG. 2 is a schematic diagram showing a design site of gRNA used for genome editing.
  • FIG. 3 is a diagram showing the structure of the vector used for transformation.
  • FIG. 4 is an electrophoretic image showing the results of heteroduplex mobility analysis (HMA) in which genome editing was detected for potatoes transformed with pStOr_t1 and pSTor_t2.
  • HMA heteroduplex mobility analysis
  • FIG. 6 is a diagram showing the results of analyzing the genome sequence of the tuber of pStOr_t2 # 8Y.
  • the genetically modified potato has a deletion, insertion, or substitution introduced into the Orange gene.
  • the Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a potato ortholog of the cauliflower Orange gene.
  • the potato ortholog of the cauliflower Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose. For example, it has a gene having the sequence of SEQ ID NO: 1 or 2 or the sequence of SEQ ID NO: 1 or 2. Examples include gene homologues.
  • the homolog is not particularly limited and may be appropriately selected depending on the intended purpose, but the sequence identity with the sequence of SEQ ID NO: 1 or 2 is preferably 80% or more, preferably 85% or more.
  • the sequence identity of is more preferable, 90% or more of the sequence identity is more preferable, 95% or more of the sequence identity is particularly preferable, and 99% or more of the sequence identity is most preferable.
  • the deletion, insertion, or substitution is not particularly limited as long as the deletion, insertion, or substitution is introduced into the Orange gene, and can be appropriately selected depending on the intended purpose. , Or a replacement, or a combination thereof. Among these, it is preferable that the deletion, insertion, or substitution is introduced into three consecutive bases (however, the introduction that becomes a stop codon is excluded).
  • the gene modification rate of the genetically modified potato due to deletion, insertion, or substitution of the Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose, but 1% to 100% is more preferable. % To 100% is more preferable, and 5% to 100% is particularly preferable.
  • the gene modification rate was determined by using TOPO (R) TA Cloning (R) Kit for the genomic DNA of the gene-modified potato amplified using primers U1131: TCACATTTTTGGATTGTTCTCTG (SEQ ID NO: 3) and U1017: TGGACCATAAATCATGCCTTC (SEQ ID NO: 4). Randomly clone 16 to 100 clones to Securing (Thermofisher), obtain gene fragments, compare the sequence identity of the nucleotide sequence cloned into Escherichia coli with the sequence of SEQ ID NO: 5, and lack It is measured by calculating the percentage of clones that have been introduced into three consecutive bases lost, inserted, or substituted (excluding introductions that serve as stop codons).
  • the genetically modified potato preferably contains 1.1 times or more of carotenoids, more preferably 1.3 times or more, and even more preferably 1.5 times or more of the unmodified potatoes. It is particularly preferable to contain 1.8 times or more.
  • the gene-unmodified potato is a potato before the deletion, insertion, or substitution is introduced into the Orange gene.
  • the carotenoid is not particularly limited and may be appropriately selected depending on the intended purpose.
  • carotenes such as ⁇ -carotene, ⁇ -carotene, ⁇ -carotene, ⁇ -carotene and lycopene, lutein, zeaxanthin, cantaxanthin and fucoxanthin.
  • Xanthophylls such as astaxanthin, anteraxanthin, and violaxanthin.
  • violaxanthin, lutein, and ⁇ -carotene are preferable.
  • the method for producing a genetically modified potato includes a step of introducing a deletion, insertion, or substitution into the Orange gene of the potato, and can further include other steps.
  • the step of introducing a deletion, insertion, or substitution into the Orange gene of the potato is not particularly limited and may be appropriately selected depending on the intended purpose.
  • the method using the genome editing is not particularly limited and may be appropriately selected depending on the intended purpose.
  • the method of introduction is not particularly limited and may be appropriately selected depending on the intended purpose.
  • a genome editing vector is introduced into Agrobacterium by an electroporation method, and the Agrobacterium is introduced into a microtuber of potato. Examples include a method of infecting tumef (Agrobacterium method) and a method of shooting fine particles coated by genome editing means into potato buds or axillary buds (particle bombardment method).
  • the genome editing means is not particularly limited and may be appropriately selected depending on the intended purpose.
  • a guide RNA or a nucleic acid encoding the guide RNA, a nucleic acid metabolizing enzyme, or the nucleic acid metabolizing enzyme can be selected.
  • examples include a combination with any of the encoding nucleic acids.
  • a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, a nucleic acid metabolizing enzyme, or the nucleic acid metabolizing enzyme is encoded.
  • a combination of any of the nucleic acids is preferable, and a combination of a nucleic acid encoding a guide RNA targeting the Orange gene and a nucleic acid encoding a nucleic acid metabolizing enzyme is more preferable.
  • the lower limit of the length of the guide RNA is not particularly limited and may be appropriately selected depending on the intended purpose, but 15 nucleotides or more is preferable, 16 nucleotides or more is more preferable, 17 nucleotides or more is further preferable, and 18 Nucleotides and above are particularly preferred, 19 nucleotides and above are even more preferred, and 20 nucleotides and above are most preferred.
  • the upper limit of the length of the guide RNA is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 30 nucleotides or less, more preferably 25 nucleotides or less, further preferably 22 nucleotides or less, and 20 Nucleotides and below are particularly preferred.
  • the guide RNA may contain a guide sequence fused to the tracr sequence.
  • the guide RNA that targets the Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose.
  • it is represented by either StOr_t1 (SEQ ID NO: 6) or STOR_t2 (SEQ ID NO: 7). Examples thereof include sequences and sequences having sequence identity with respect to these sequences.
  • sequence identity is not particularly limited and may be appropriately selected depending on the intended purpose, but 80% or more of sequence identity is preferable, 85% or more of sequence identity is more preferable, and 90% or more of sequences is preferable. Identity is even more preferred, with 95% or greater sequence identity being particularly preferred.
  • the Orange gene may be mutated by inserting or substituting foreign DNA by recombination between the cleaved sites.
  • the nucleic acid-metabolizing enzyme is not particularly limited and may be appropriately selected depending on the intended purpose, and examples thereof include nuclease and deaminase.
  • the nucleic acid metabolizing enzyme may contain one or more nuclear localization signals (NLS).
  • the nuclease is not particularly limited and may be appropriately selected depending on the intended purpose.
  • the nuclease may be derived from a different species, and for example, genes such as animals, plants, microorganisms, and viruses, or artificially synthesized genes can be used.
  • the CASnuclease is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include type I CRISPR enzyme, type II CRISPR enzyme, type III CRISPR enzyme, and type II CRISPR enzyme. Cas9 is preferable.
  • the Cas nuclease may be codon-optimized for expression in eukaryotic cells. The Cas nuclease can direct the cleavage of one or two strands in the localization of the target sequence. In another aspect of the invention, the expression of the gene product is reduced and the gene product is a protein.
  • the Cas9 is not particularly limited and may be appropriately selected depending on the intended purpose.
  • the deaminase is not particularly limited as long as it has deamination enzyme activity, and can be appropriately selected depending on the intended purpose. It is used by adding it to a CRISPR-CAS system from which nuclease activity has been removed. can do.
  • nucleic acid encoding the guide RNA or the nucleic acid encoding the nucleic acid metabolizing enzyme one incorporated in a vector can be used.
  • the type of the vector may be a circular plasmid, and may be a linear DNA obtained by cutting the plasmid with a restriction enzyme or the like, a linear plasmid, a nucleic acid cassette fragment obtained by cutting out only the DNA fragment to be introduced, or one or both of the cassette fragments. It may be a DNA fragment to which a nucleic acid of 0.8 kb or more and 1.2 kb or less is added to the end. These DNA fragments may be DNA fragments amplified by PCR.
  • the nucleic acid to be added is not particularly limited and may be a sequence derived from a vector, but the sequence of the target site for introduction is more preferable.
  • the lower limit of the length of the nucleic acid added to the end of the cassette fragment is preferably 0.5 kb or more, more preferably 0.8 kb or more, still more preferably 1.0 kb or more.
  • the upper limit of the length of the nucleic acid added to the end of the cassette fragment is preferably 3.0 kb or less, more preferably 2.0 kb or less, still more preferably 1.5 kb or less.
  • Examples of the vector include pAL system (pAL51, pAL156, etc.), pUC system (pUC18, pUC19, pUC9, etc.), pBI system (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP system, pSMA system, etc.
  • Examples include intermediate vector systems (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), green beans mosaic virus (BGMV), tobacco mosaic virus (TMV), and the like.
  • the method for inserting the target sequence into the vector is not particularly limited and may be appropriately selected depending on the intended purpose.
  • a purified nucleic acid is cleaved with an appropriate restriction enzyme and an appropriate vector DNA restriction enzyme is used. Examples thereof include a method of inserting into a site or a multi-cloning site and linking to a vector.
  • the target sequence may be inserted into the intermediate vector by double cross-over, and TA cloning, In-Fusion cloning, or the like may be used.
  • nucleic acid encoding the guide RNA or the nucleic acid encoding the nucleic acid metabolizing enzyme for example, a promoter, an enhancer, an insulator, an intron, a terminator, a poly
  • a promoter, an enhancer, an insulator, an intron, a terminator, a poly is ligated to the vector. Can be done.
  • the promoter may be derived from a plant as long as it is a DNA that functions in a plant or in a plant cell and is constitutively expressed, or can induce expression in a specific tissue of a plant or at a specific developmental stage. It does not have to be. Specific examples include, for example, cauliflower mosaic virus (CaMV) 35S promoter, El2-35S omega promoter, noparin synthase gene promoter (Pnos), corn-derived ubiquitin promoter, rice-derived actin promoter, tobacco-derived PR protein promoter, ADH. Promoters, RuBisco promoters and the like can be mentioned. Translation efficiency can be increased by using a sequence that enhances translation activity, for example, an omega sequence of tobacco mosaic virus.
  • a protein can be translated from a plurality of coding regions by inserting an IRES (internal ribosome entry site) as a translation start region on the 3'-downstream side of the promoter and on the 5'-upstream side of the translation start codon.
  • IRES internal ribosome entry site
  • the terminator may be any sequence that can terminate the transcription of the gene transcribed by the promoter and has a poly A addition signal.
  • the terminator of the nopaline synthase (NOS) gene and the octopine synthase (OCS) gene examples include a terminator and a CaMV 35S terminator.
  • the selection marker gene examples include a herbicide resistance gene (biaraphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS), etc.), drug resistance gene (tetracycline resistance gene, ampicillin resistance gene, canamycin). Resistance genes, hyglomycin resistance genes, spectinomycin resistance genes, chloramphenicol resistance genes, neomycin resistance genes, etc.), fluorescent or luminescent reporter genes (luciferase, ⁇ -galactosidase, ⁇ -glucuronidase (GUS), green fluorescence Examples include enzyme genes such as protein (GFP), neomycin phosphotransferase II (NPT II), and dihydrofolate reductase. However, according to the present invention, it is possible to prepare a transformant without introducing a selectable marker gene.
  • EPSPS glyphosate resistance gene
  • ALS sulfonylurea resistance gene
  • drug resistance gene tetracycline resistance
  • the target sequence to be inserted into the vector may be a plurality of types per vector. Further, a recombinant vector containing a nucleic acid encoding the guide RNA and / or a nucleic acid encoding the nucleic acid metabolizing enzyme and a recombinant vector containing a drug resistance gene are separately prepared, mixed and coated with fine particles. You may.
  • the target gene for genome editing may be two or more, or a vector may be constructed so that two or more target genes can be cleaved. In that case, two or more kinds of vectors may be prepared, or a plurality of guide RNAs may be inserted so as to be expressed on one plasmid.
  • the guide RNA and the nucleic acid-metabolizing enzyme may be naturally occurring (combinations) or may be non-naturally occurring combinations.
  • the method for introducing the genome editing vector into Agrobacterium by the electroporation method is not particularly limited and may be appropriately selected depending on the intended purpose.
  • the method for introducing the genome editing vector into Agrobacterium by the electroporation method is not particularly limited and may be appropriately selected depending on the intended purpose.
  • Gelvin and Schilleror Plant Molecular Biology Manual, C2 , 1-32 (1994), Klewer Academic Publicers, and the like.
  • the method for infecting potatoes with the Agrobacterium is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include the method described in Monma (1990) Plant Tissue Culture 7: 57-63. Be done.
  • the fine particles are not particularly limited and may be appropriately selected depending on the intended purpose. From the viewpoint of increasing the penetrating power, those having a high specific gravity, which are chemically inactive and do not easily cause harm to the living body are preferable, and examples thereof include metal fine particles, ceramic fine particles, and glass fine particles.
  • the metal fine particles are not particularly limited and may be appropriately selected depending on the intended purpose, and examples thereof include metal simple substance fine particles and alloy fine particles. As the simple metal fine particles, gold particles, tungsten particles and the like are preferable.
  • the lower limit of the average particle size of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 0.3 ⁇ m or more, more preferably 0.4 ⁇ m or more, and further preferably 0.5 ⁇ m or more. Preferably, 0.6 ⁇ m is particularly preferable.
  • the upper limit of the average particle size of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 1.5 ⁇ m or less, more preferably 1.4 ⁇ m or less, still more preferably 1.3 ⁇ m or less. , 1.2 ⁇ m or less is particularly preferable, 1.1 ⁇ m is even more preferable, and 1.0 ⁇ m or less is most preferable.
  • the average particle size is not particularly limited and may be appropriately selected depending on the intended purpose, and examples thereof include a number average particle size.
  • the shape of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a sphere, a cube, a rod and a plate, and among these, a sphere is preferable.
  • the coating method is not particularly limited and may be appropriately selected depending on the intended purpose.
  • the fine particles are washed and sterilized, and the fine particles, nucleic acids (recombinant vector, linear DNA, RNA, etc.) and / Or add protein, CaCl 2 , spermidine, etc. with stirring with a vortex mixer or the like, coat (coat) the nucleic acid and / or protein with fine particles, and wash with ethanol or phosphate buffered saline (PBS, etc.).
  • PBS phosphate buffered saline
  • the fine particles can be applied to the macrocarrier film as uniformly as possible using a micropipette or the like, and then dried in a sterile environment such as a clean bench.
  • a hydrophilic macrocarrier film it is preferable to use a hydrophilic macrocarrier film.
  • hydrophilic macrocarrier film a hydrophilic film may be attached to the macrocarrier film, or a hydrophilic coating may be applied.
  • a hydrophilic coating may be applied.
  • the method for making a film hydrophilic include a method using a surfactant, a photocatalyst, and a hydrophilic polymer.
  • the hydrophilic polymer is not particularly limited and may be appropriately selected depending on the intended purpose.
  • Hydrophilicity such as methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethylphosphorylcholine, 1-carboxydimethylmethacryloyloxyethylmethaneammonium, etc.
  • Examples thereof include polymers of monomers.
  • the coverage of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose, and may be the entire surface or a part of the fine particles.
  • the means for shooting the fine particles is not particularly limited as long as the fine particles can be shot into plant cells, and examples thereof include a particle gun (gene gun) in the particle gun method. From the viewpoint of introduction efficiency, a method of introducing into young buds or axillary buds by using a particle gun method is preferable.
  • the method of introducing into the bud or axillary bud by using the particle gun method is not particularly limited and may be appropriately selected depending on the intended purpose.
  • a macrocarrier film coated with fine particles, a target bud or a target bud or An example is a method in which a plate on which the axillary bud apex is placed is installed in a particle gun device, and high-pressure gas is emitted from a gas acceleration tube toward a macrocarrier film.
  • the macrocarrier film stops at the stopping plate, but the fine particles coated on the macrocarrier film pass through the stopping plate and penetrate into the target placed under the stopping plate, and the target gene is introduced.
  • the high-pressure gas is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include helium.
  • the particle gun device is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD).
  • the upper limit of the distance between the stopping plate and the target shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but 9 cm or less is preferable, 8 cm or less is more preferable, and 7 cm or less is preferable. More preferably, 6 cm or less is particularly preferable.
  • the lower limit of the distance between the stopping plate and the target shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 2 cm or more, more preferably 3 cm or more, and 4 cm or more. More preferred.
  • the gas pressure of the particle gun device is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 1,100 to 1,600 psi, more preferably 1,200 to 1,500 psi.
  • the lower limit of the number of times the fine particles are shot into the shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 2 times or more, more preferably 3 times or more, still more preferably 4 times or more. ..
  • the upper limit of the number of times the fine particles are shot into the shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 20 times or less, more preferably 15 times or less, still more preferably 10 times or less. ..
  • RNAi vector is introduced into Agrobacterium by an electroporation method, and the Agrobacterium is introduced into a potato microtuber. Examples include methods for infecting Um.
  • the RNAi vector is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a vector based on a binary vector.
  • the sequence contained in the RNAi vector is not particularly limited as long as it contains the Orange gene fragment of potato, and can be appropriately selected depending on the intended purpose, and may contain other sequences. Among these, it is preferable to contain the Orange gene fragment of potato in the forward direction and the reverse direction.
  • the Orange gene fragment of the potato is not particularly limited and may be appropriately selected depending on the intended purpose.
  • a gene fragment amplified by a primer having the sequences of SEQ ID NOs: 3 and 4, a homologue of this gene fragment, and the like. can be mentioned.
  • the homolog is not particularly limited and may be appropriately selected depending on the intended purpose, but the sequence identity with the gene fragment amplified by the primers having the sequences of SEQ ID NOs: 3 and 4 is 80% or more. Sequence identity is preferred, 85% or higher sequence identity is more preferred, 90% or higher sequence identity is even more preferred, 95% or higher sequence identity is particularly preferred, and 99% or higher sequence identity is most preferred.
  • the other sequence is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include promoters, enhancers, insulators, introns, terminators, poly-A addition signals, and selectable marker genes.
  • the promoter does not have to be of plant origin as long as it is a DNA that functions in potato and can be constitutively expressed, or can induce expression in a specific tissue of potato or at a specific developmental stage.
  • Specific examples include, for example, cauliflower mosaic virus (CaMV) 35S promoter, El2-35S omega promoter, noparin synthase gene promoter (Pnos), corn-derived ubiquitin promoter, rice-derived actin promoter, tobacco-derived PR protein promoter, ADH. Promoters, RuBisco promoters and the like can be mentioned.
  • Translation efficiency can be increased by using a sequence that enhances translation activity, for example, an omega sequence of tobacco mosaic virus.
  • a protein can be translated from a plurality of coding regions by inserting an IRES (internal ribosome entry site) as a translation start region on the 3'-downstream side of the promoter and on the 5'-upstream side of the translation start codon.
  • IRES internal ribosome entry site
  • the terminator may be any sequence that can terminate the transcription of the gene transcribed by the promoter and has a poly A addition signal.
  • the terminator of the nopaline synthase (NOS) gene and the octopine synthase (OCS) gene examples include a terminator and a CaMV 35S terminator.
  • selection marker gene examples include a herbicide resistance gene (the third intron of the phytoendesaturase gene (AT4g14210), bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS), etc.), and drug resistance.
  • a herbicide resistance gene the third intron of the phytoendesaturase gene (AT4g14210)
  • bialaphos resistance gene glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS), etc.
  • EPSPS glyphosate resistance gene
  • ALS sulfonylurea resistance gene
  • Genes (tetracycline resistance gene, ampicillin resistance gene, canamycin resistance gene, hyglomycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, etc.), fluorescent or luminescent reporter gene (luciferase, ⁇ -galactosidase) , ⁇ -Glucronidase (GUS), Green Fluorescence Protein (GFP), etc.), Neomycin Phosphortransferase II (NPT II), Dihydrofolate Reductase, and other enzyme genes.
  • fluorescent or luminescent reporter gene luciferase, ⁇ -galactosidase
  • GUS ⁇ -Glucronidase
  • GFP Green Fluorescence Protein
  • NPT II Neomycin Phosphortransferase II
  • Dihydrofolate Reductase Dihydrofolate Reductase, and other enzyme genes.
  • Examples of the other steps include a step of selecting an individual into which a deletion, insertion, or substitution has been introduced into the Orange gene of potato.
  • the selection step is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a method of selection based on a drug resistance gene.
  • the potato genome editing method includes a step of introducing a deletion, insertion, or substitution into a potato Orange gene by using a genome editing means, and can further include other steps.
  • the step of introducing a deletion, insertion, or substitution into a potato Orange gene using the above-mentioned genome editing means introduces a deletion, insertion, or substitution into a potato Orange gene using the above-mentioned genome editing means.
  • the method is as follows.
  • composition for producing genetically modified potatoes comprises either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, a nucleic acid metabolizing enzyme, or a nucleic acid encoding the nucleic acid metabolizing enzyme. And any of the above, and may further contain other components.
  • Either the guide RNA targeting the Orange gene or the nucleic acid encoding the guide RNA targeting the Orange gene, and either the nucleic acid metabolizing enzyme or the nucleic acid encoding the nucleic acid metabolizing enzyme are as described above. be.
  • the method for determining a genetically modified potato includes a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index, and may further include other steps.
  • the step of determining whether or not the potato is a genetically modified potato using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index is not particularly limited and can be appropriately selected depending on the purpose, for example. , A method of analyzing the Orange gene sequence of potato and comparing it with the DNA sequence of SEQ ID NO: 5 and the like. According to the method for determining a potato modified potato, it can be efficiently determined whether or not the potato has accumulated carotenoids.
  • carotenoids are accumulated in flower buds which are edible parts due to mutation of the Orange gene in potash flowers, while in rice, the amount of carotenoids is increased in curls by editing the Orange gene, but significant carotenoid accumulation in endosperm. Is not recognized (Rice 2019 12:81). Since some of the carotenoid synthases are deficient in the endosperm of rice, it has been reported that carotenoids are not accumulated in the endosperm unless a new synthase is supplemented from the outside (Nature Biotechnology 2005 23: 482-487). ).
  • Example 1 Acquisition of potato Orange candidate gene> A tblast analysis was performed on the sequences contained in the potato (S. tuberosum) genome database (Spud DB: http: // solaraceae.plantcauliflower.mus.edu/index.shtml), and two expected transcripts were obtained. (PGSC0003DMT4000022863 and PGSC0003DMT400021454) were found to be homologous to the cauliflower genome gene.
  • SRX3127474 Solanum tuberosum, Atlantic, leaf, RNA-Seq, which are NGS data registered in the NCBI database, were subjected to Trinity (https://ghub.com/trinityrinaseq/triny).
  • Example 2 Acquisition of genome sequence of potato Orange candidate gene>
  • synthesis was performed on the genomic DNA of "Sassy” based on the above PGSC0003DMT40022863.
  • PCR (30 cycles, using Takara Bio's PrimeSTAR) was performed at an annealing temperature of 55 ° C. using the primers U1200: GTACGTAGCTAAGAATACAACAAAG (SEQ ID NO: 8) and U1201: GGCAAGTAATCCACCGAAGA (SEQ ID NO: 9). rice field.
  • the box in FIG. 1 indicates each exon.
  • the obtained PCR amplification product was cloned into a pENTR / D-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and two types of full-length sequences (3rd to 5th exons) were determined (SEQ ID NO:). : 1 and 2).
  • Example 3 Preparation of genome editing vector for potato Orange candidate gene> Based on the genomic DNA sequence identified in Example 2, it is assumed that the insertion deletion mutation caused by DNA cleavage of Cas9 induces splicing abnormality of the StOr transcript, near the boundary site between the 3rd exon and the 3rd intron.
  • Two target sequences were designed (StOr_t1: SEQ ID NO: 6, STOR_t2: SEQ ID NO: 7) (FIG. 2).
  • the white arrows in FIG. 2 indicate each expected cutting site.
  • Two vectors, pStOr_t1 and pSTor_t2, containing the target sequence were prepared (FIG. 3).
  • FIG. 3 shows the right border (RB) and left border (LB) of the T-DNA of the gene portion to be introduced, and the internal structure of these borders.
  • Example 4 Preparation of transformant of potato Orange candidate gene>
  • the vector prepared in Example 4 was introduced into Agrobacterium tumefaciens GV3101 by an electroporation method (Gelvin and Schilperor ed., Plant Molecular Biology Manual, C2, 1-32 (1994), Kruwer Academic Publicers).
  • 1.5 mL of the culture broth was centrifuged at 10,000 rpm for 3 minutes to collect the cells, and then washed with 1 mL of LB medium to remove kanamycin. After further centrifuging at 10,000 rpm for 3 minutes and collecting the bacteria, MS medium containing 1.5 mL of 3% sucrose [Murashige & Skoog, Physiol. Plant. , 15,473-497 (1962)] to prepare a bacterial solution for infection.
  • Potato transformation was performed according to [Monma (1990) plant tissue culture 7: 57-63].
  • Microtubers obtained from the potato variety "Sassy” were sliced into 2-3 mm pieces and used as a material for Agrobacterium infection. After immersing this in the above-mentioned Agrobacterium solution, it was placed on a sterilized filter paper to remove excess Agrobacterium. Place on MS medium (including Zeatin 1 ppm, IAA 0.1 ppm, acetosyringone 100 ⁇ M, and agar 0.8%) in a petri dish, and culture for 3 days at 25 ° C. for 16 hours (photon bundle density 32 ⁇ E / m2s). / 8 hours under no lighting conditions.
  • the cells were cultured in a medium containing 250 ppm of carbenicillin instead of acetosyringone for 1 week. Then, it was further transferred onto a medium containing 50 ppm of kanamycin and subcultured every two weeks. During this time, adventitious shoots formed and shoots were produced.
  • the elongated shoots were placed in MS medium containing 250 ppm of carbenicin and 100 ppm of kanamycin and not containing plant growth regulators.
  • An individual containing a kanamycin resistance gene as a foreign gene from a plant in which rooted shoots are resistant to kanamycin is subjected to PCR (conditions: 95 ° C. for 5 minutes, (95 ° C.
  • HMA Heteroduplex mobility assay
  • HMA heteroduplex mobility analysis
  • Amplified fragment DNA of gRNA in the genome of leaves of transformants # 13 of pStOr_t1 and # 8 of pSTor_t2 obtained in Example 4 was transferred to TOPO (R) TA Cloning (R) Kit for Sequencing (Thermofisher). It was cloned and a gene fragment was obtained.
  • the nucleotide sequences of the following SEQ ID NOs: 11 to 42 cloned into Escherichia coli were determined, and it was confirmed that genome editing had occurred (Fig. 5).
  • the "-" in FIG. 5 indicates the deletion, and the underline indicates the third exon.
  • Nucleotide sequence near the target sequence of genome editing of Orange gene (SEQ ID NO: 5) pSOr_t1 # 13 # 3 (SEQ ID NO: 11) pSOr_t1 # 13 # 14 (SEQ ID NO: 12) pSOr_t1 # 13 # 5 (SEQ ID NO: 13) pSOr_t1 # 13 # 7 (SEQ ID NO: 14) pSOr_t1 # 13 # 12 (SEQ ID NO: 15) pSOr_t1 # 13 # 13 (SEQ ID NO: 16) pSOr_t1 # 13 # 10 (SEQ ID NO: 17) pSOr_t1 # 13 # 2 (SEQ ID NO: 18) pSOr_t1 # 13 # 8 (SEQ ID NO: 19) pSOr_t1 # 13 # 15 (SEQ ID NO: 20) pSOr_t1 # 13 # 16 (SEQ ID NO: 21) pSOr_t1 # 13 # 4 (SEQ ID NO: 22) p
  • Example 6 Genome editing of potato Orange candidate gene Preparation of microtuber from potato strain> Potatoes cultured in vitro (transformant obtained in Example 4) were transferred to foliage growth medium: MS + suc 1% + BA 0.02 ppm + KCl 1 g / L and illuminated at 23 ° C. for 16 hours (photon bundle density 32 ⁇ E / m2 s). ) / 8 hours under unlit conditions for 4-5 weeks. Next, the medium was transferred to MT-forming medium: MS + suc 10% + BA 2 ppm + KCl 1 g / L, and cultured at 23 ° C. in the dark for 6 weeks to prepare a microtuber. When the produced microtubers were stored for about 3 weeks and then the tubers were cut, it became clear that the tubers obtained from # 13 of pStOr_t1 and # 8 of pSTor_t2 had a deep yellow color.
  • Example 7 Genome editing of potato Orange gene Analysis of microtuber of potato strain> Examples of the method described in the document “Simultaneous quantification of carotenes in commercial vegetable juice by high performance liquid chromatography” (Hokuriku Gakuin University / Hokuriku Gakuin University Junior College Research Bulletin No. 6 (2013)). The amount of carotenoids in the stalks obtained from the transformants of pStOr_t1 # 13 and pSTor_t2 # 8 obtained in No. 4 was analyzed.
  • the genome was extracted and cloned from the tubers of the # 8 strain of pSTor_t2, and the sequence was analyzed.
  • the following genomic sequences (SEQ ID NOs: 43 to 57) are shown in the upper part of FIG. 6, and the expected amino acid sequences (SEQ ID NOs: 58 to 60) are shown in the lower part of FIG.
  • a genotype in which the amount of carotenoid is considered to be high (Fig. 6 pSOr-t2 # 8Y # 10: Deletion, insertion, or substitution is introduced into 3 consecutive bases (excluding introduction that becomes a stop codon)) was detected.
  • Examples of aspects of the present invention include the following.
  • ⁇ 1> A genetically modified potato characterized in that a deletion, insertion, or substitution has been introduced into the Orange gene.
  • ⁇ 2> The genetically modified potato according to ⁇ 1>, wherein the deletion, insertion, or substitution has been introduced into three consecutive bases (excluding the introduction that serves as a stop codon).
  • ⁇ 3> The genetically modified potato according to any one of ⁇ 1> to ⁇ 2> above, which contains 1.3 times or more of carotenoids with respect to the genetically modified potato.
  • ⁇ 4> A method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato.
  • a potato genome editing method comprising a step of introducing a deletion, insertion, or substitution into a potato Orange gene using a genome editing means.
  • the genome editing means includes either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme.
  • the method for editing a nucleic acid of a potato according to ⁇ 5> which comprises any of the above.
  • ⁇ 8> Containing either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and either a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme. It is a composition for producing a genetically modified potato, which is characterized by the above.
  • a method for determining a genetically modified potato which comprises a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Environmental Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Physiology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cette pomme de terre génétiquement modifiée est caractérisée en ce qu'une délétion, une insertion, ou une substitution est introduite dans le gène orange, et ce procédé de production d'une pomme de terre génétiquement modifiée est caractérisé en ce qu'il comprend une étape d'introduction d'une délétion, d'une insertion ou d'une substitution dans le gène orange d'une pomme de terre.
PCT/JP2021/003139 2020-01-31 2021-01-29 Pomme de terre génétiquement modifiée, son procédé de production et procédé d'édition de génome de pomme de terre WO2021153706A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2021574131A JPWO2021153706A1 (fr) 2020-01-31 2021-01-29

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2020-015044 2020-01-31
JP2020015044 2020-01-31

Publications (1)

Publication Number Publication Date
WO2021153706A1 true WO2021153706A1 (fr) 2021-08-05

Family

ID=77079362

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2021/003139 WO2021153706A1 (fr) 2020-01-31 2021-01-29 Pomme de terre génétiquement modifiée, son procédé de production et procédé d'édition de génome de pomme de terre

Country Status (2)

Country Link
JP (1) JPWO2021153706A1 (fr)
WO (1) WO2021153706A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8071841B2 (en) * 2005-12-07 2011-12-06 The United States Of America As Represented By The Secretary Of Agriculture Or gene and its use in manipulating carotenoid content and composition in plants and other organisms

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8071841B2 (en) * 2005-12-07 2011-12-06 The United States Of America As Represented By The Secretary Of Agriculture Or gene and its use in manipulating carotenoid content and composition in plants and other organisms

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ECK, J. V. ET AL.: "Modulation of carotenoid accumulation in transgenic potato by inducing chromoplast formation with enhanced sink strength", METHODS IN MOLECULAR BIOLOGY, vol. 643, 2010, pages 77 - 93 *

Also Published As

Publication number Publication date
JPWO2021153706A1 (fr) 2021-08-05

Similar Documents

Publication Publication Date Title
US10047370B2 (en) Tobacco enzymes for regulating content of plant metabolites, and use thereof
EP3456181A1 (fr) Procédé de création de plante transformée
US11155827B2 (en) Methods for generating transgenic plants
EP3058073B1 (fr) Éléments régulateurs de zea mays et leurs utilisations
WO2021153706A1 (fr) Pomme de terre génétiquement modifiée, son procédé de production et procédé d'édition de génome de pomme de terre
EP3052633B1 (fr) Éléments régulateurs du gène de type métallothionéine de zea mays et leurs utilisations
US20150106978A1 (en) Zea mays regulatory elements and uses thereof
EP4086353A1 (fr) Procédé de modification de plante
JP6696806B2 (ja) プラスチド形質転換体の製造方法
KR102348638B1 (ko) 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도
CN108977414B (zh) 一种β-胡萝卜素酮化酶的人工合成突变体及其编码序列和应用
JP5186683B2 (ja) 形質転換植物体の作出方法及びその利用
WO2023008076A1 (fr) Pomme de terre génétiquement modifiée à teneur réduite en glycoalcaloïde et son procédé de production
KR102110870B1 (ko) 고구마 유래의 IbOr-R96H 변이체 및 이의 용도
US20220298518A1 (en) Plant modification method using axillary bud meristem
EP3011036B1 (fr) Plantes transgéniques
US11034969B2 (en) Plant comprising recombinant polynucleotides encoding a pigment regulatory transcription factor with a tissue-preferred promoter
WO2021070549A1 (fr) Procédé d'édition de génome dans le blé et son utilisation
US8143478B2 (en) Peptide transporting to chromoplasts in petals and method of constructing plant having yellowish petals by using the same
JP2021121183A (ja) 遺伝子改変ジャガイモ、及びその作製方法、並びにジャガイモのゲノム編集方法
Abadi Development and application of novel genetic transformation technologies in maize (Zea mays L.)
WO2007145267A1 (fr) Promoteur capable d'être exprimé dans les racines de végétaux

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21747036

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021574131

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21747036

Country of ref document: EP

Kind code of ref document: A1