WO2021153706A1

WO2021153706A1 - Genetically modified potato, production method thereof, and method of editing potato genome

Info

Publication number: WO2021153706A1
Application number: PCT/JP2021/003139
Authority: WO
Inventors: 亮遠藤; 洋三柳楽; 晴康濱田; 直行梅基; 斉藤　和季
Original assignee: 株式会社カネカ; 国立研究開発法人理化学研究所
Priority date: 2020-01-31
Filing date: 2021-01-29
Publication date: 2021-08-05
Also published as: JPWO2021153706A1

Abstract

This genetically modified potato is characterized in that a deletion, an insertion, or a substitution is introduced into the Orange gene, and this method for producing a genetically modified potato is characterized by comprising a step of introducing a deletion, an insertion, or a substitution into the Orange gene of a potato.

Description

Genetically modified potatoes, their production methods, and potato genome editing methods

The present invention relates to a genetically modified potato, a method for producing the same, and a method for editing the genome of the potato.

Carotenoids have a basic nutritional role as antioxidants and precursors of vitamin A. Ingestion of carotenoids is also associated with protection from various illnesses. Furthermore, it is also known that it is commercially used as a coloring agent for safe foods, feeds and cosmetics, and protects plants from photooxidative stress (Non-Patent Document 1). Therefore, breeding of high carotenoids is an important issue both in Japan and worldwide.
As potatoes showing carotenoid accumulation, Kita Akari, Toya, Sassy, etc. are known as yellow meat potato varieties, and Inca Awakening, Nagasaki Golden are known as potato varieties in which more carotenoids, especially zeaxanthin, are accumulated. ing. It is speculated that these are mutations in the CHY and ZEP genes (Non-Patent Document 2).

On the other hand, natural mutations of orange cauliflower, red meat melon, and orange sweet potato are known as high carotenoid varieties in cauliflower, melon, and sweet potato. As these causative genes, a gene named Orage (Or) is known (Non-Patent

Documents

3, 4, and 5). In addition, overexpression of an overt mutation gene that produces an orange color of orange cauliflower in potatoes causes the inside of the tuber of the potato variety Desiree to turn yellow, and violaxanthin, lutein, and β-carotene are accumulated. Has been reported (Non-Patent Document 6).

However, in potatoes, such mutations are not known, and it was unclear whether or not there is a gene that has the same function as the Orange gene among the genes originally possessed by potatoes. Rather, the lack of high carotenoid mutants from the same gene in the long history of cultivation is negatively thought to be that the endogenous homologous gene of potatoes can make mutations that cause high carotenoids. rice field.
As mentioned above, no functional Orange gene has been identified in potatoes. Therefore, modification of the endogenous Orange gene of potatoes has not led to the production of genetically modified potatoes in which carotenoids are accumulated.

Therefore, genetically modified potatoes in which carotenoids are accumulated and efficient production methods thereof have not yet been provided, and prompt provision thereof is strongly required.
In rice, the amount of carotenoids increased in callus due to the modification of the Orange gene, but the amount of carotenoids did not increase in the redifferentiated plants (Non-Patent Document 7). In general, when crop families, genera, species, etc. are different, synthetic pathways (for example, pigment synthesis, etc.) and metabolic pathways are often different (Non-Patent Document 8 etc.). Therefore, it is not easy to apply the finding that an agriculturally good phenotype appears when a gene of a certain plant species is modified to another crop species as it is.

An object of the present invention is to solve the above-mentioned problems in the past and to achieve the following objects. That is, an object of the present invention is to provide a genetically modified potato in which carotenoids are accumulated, and an efficient method for producing the same.

As a result of diligent research to achieve the above object, the present inventors have accumulated carotenoids due to genetically modified potatoes in which a deletion, insertion, or substitution has been introduced into the Orange gene. And an efficient method for producing the same, and by adopting a method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato, a gene in which carotenoids are accumulated. It has been found that an efficient method for producing modified potatoes can be provided.

The present invention is based on the above-mentioned findings by the present inventors, and the means for solving the above-mentioned problems are as follows. That is,
<1> A genetically modified potato characterized in that a deletion, insertion, or substitution has been introduced into the Orange gene.
<2> A method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato.
<3> A potato genome editing method comprising a step of introducing a deletion, insertion, or substitution into a potato Orange gene using a genome editing means.
<4> Containing either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and either a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme. It is a composition for producing a genetically modified potato, which is characterized by the above.
<5> A method for determining a genetically modified potato, which comprises a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index.

According to the present invention, it is possible to solve the above-mentioned problems in the past, achieve the above-mentioned object, provide a genetically modified potato in which carotenoids are accumulated, and an efficient method for producing the same.

FIG. 1 is a schematic diagram showing the genomic structure of the Orange gene of potato (S. tuberosum) and the site of the primer that sequenced the 3rd to 5th exons. FIG. 2 is a schematic diagram showing a design site of gRNA used for genome editing. FIG. 3 is a diagram showing the structure of the vector used for transformation. FIG. 4 is an electrophoretic image showing the results of heteroduplex mobility analysis (HMA) in which genome editing was detected for potatoes transformed with pStOr_t1 and pSTor_t2. In FIG. 5, the nucleotide sequence near the target sequence of genome editing of the Orange gene (first stage) and the amplified fragment containing the genome editing region were cloned from the genome-edited individual to determine the nucleotide sequence (second stage). It is a figure which shows the alignment result with (after eyes). FIG. 6 is a diagram showing the results of analyzing the genome sequence of the tuber of pStOr_t2 # 8Y.

(Genetically modified potato)
The genetically modified potato has a deletion, insertion, or substitution introduced into the Orange gene.

The Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a potato ortholog of the cauliflower Orange gene.
The potato ortholog of the cauliflower Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose. For example, it has a gene having the sequence of SEQ ID NO: 1 or 2 or the sequence of SEQ ID NO: 1 or 2. Examples include gene homologues.

The homolog is not particularly limited and may be appropriately selected depending on the intended purpose, but the sequence identity with the sequence of SEQ ID NO: 1 or 2 is preferably 80% or more, preferably 85% or more. The sequence identity of is more preferable, 90% or more of the sequence identity is more preferable, 95% or more of the sequence identity is particularly preferable, and 99% or more of the sequence identity is most preferable.

The deletion, insertion, or substitution is not particularly limited as long as the deletion, insertion, or substitution is introduced into the Orange gene, and can be appropriately selected depending on the intended purpose. , Or a replacement, or a combination thereof. Among these, it is preferable that the deletion, insertion, or substitution is introduced into three consecutive bases (however, the introduction that becomes a stop codon is excluded).

The gene modification rate of the genetically modified potato due to deletion, insertion, or substitution of the Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose, but 1% to 100% is more preferable. % To 100% is more preferable, and 5% to 100% is particularly preferable.

The gene modification rate was determined by using TOPO (R) TA Cloning (R) Kit for the genomic DNA of the gene-modified potato amplified using primers U1131: TCACATTTTTGGATTGTTCTCTG (SEQ ID NO: 3) and U1017: TGGACCATAAATCATGCCTTC (SEQ ID NO: 4). Randomly clone 16 to 100 clones to Securing (Thermofisher), obtain gene fragments, compare the sequence identity of the nucleotide sequence cloned into Escherichia coli with the sequence of SEQ ID NO: 5, and lack It is measured by calculating the percentage of clones that have been introduced into three consecutive bases lost, inserted, or substituted (excluding introductions that serve as stop codons).

The genetically modified potato preferably contains 1.1 times or more of carotenoids, more preferably 1.3 times or more, and even more preferably 1.5 times or more of the unmodified potatoes. It is particularly preferable to contain 1.8 times or more.
Here, the gene-unmodified potato is a potato before the deletion, insertion, or substitution is introduced into the Orange gene.

For the content of the carotenoid, refer to the method described in the document "Simultaneous quantification of carotenes in commercially available vegetable juice by high performance liquid chromatography" (Hokuriku Gakuin University / Hokuriku Gakuin University Junior College Research Bulletin No. 6 (2013)). Analyze by the following method with some modifications.
900 μL of hexane / ethanol (80: 20v / v) is added to 100 mg of tubers, shaken for 1 minute, and then centrifuged (6000 rotations, 1 minute). Take 600 μL from the upper layer (hexane layer) in another tube, add 400 μL of hexane / ethanol (80: 20v / v) to the remaining lower layer, shake again for 1 minute, and then centrifuge (6000 rpm, 1 minute). , 400 μL of the upper layer is added to the above extract to obtain a total of 1000 μL of extract. The absorbance (OD445) of this extract is measured, and the amount of carotenoid (A445 / g) is calculated.

The carotenoid is not particularly limited and may be appropriately selected depending on the intended purpose. For example, carotenes such as α-carotene, β-carotene, γ-carotene, δ-carotene and lycopene, lutein, zeaxanthin, cantaxanthin and fucoxanthin. , Xanthophylls such as astaxanthin, anteraxanthin, and violaxanthin.
Among these, violaxanthin, lutein, and β-carotene are preferable.

(Method of producing genetically modified potatoes)
The method for producing a genetically modified potato includes a step of introducing a deletion, insertion, or substitution into the Orange gene of the potato, and can further include other steps.

<Step of introducing deletion, insertion, or substitution into the Orange gene of potato>
The step of introducing a deletion, insertion, or substitution into the Orange gene of the potato is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a method using genome editing, a method using RNAi, or anti. Examples include a method using sense RNA.

-Method using genome editing-
The method using the genome editing is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a method of introducing a deletion, insertion or substitution into the Orange gene of potato by using the genome editing means. And so on.
The method of introduction is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a genome editing vector is introduced into Agrobacterium by an electroporation method, and the Agrobacterium is introduced into a microtuber of potato. Examples include a method of infecting tumef (Agrobacterium method) and a method of shooting fine particles coated by genome editing means into potato buds or axillary buds (particle bombardment method).

The genome editing means is not particularly limited and may be appropriately selected depending on the intended purpose. For example, either a guide RNA or a nucleic acid encoding the guide RNA, a nucleic acid metabolizing enzyme, or the nucleic acid metabolizing enzyme can be selected. Examples include a combination with any of the encoding nucleic acids.
Among these, from the viewpoint of genome editing efficiency, either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, a nucleic acid metabolizing enzyme, or the nucleic acid metabolizing enzyme is encoded. A combination of any of the nucleic acids is preferable, and a combination of a nucleic acid encoding a guide RNA targeting the Orange gene and a nucleic acid encoding a nucleic acid metabolizing enzyme is more preferable.

The lower limit of the length of the guide RNA is not particularly limited and may be appropriately selected depending on the intended purpose, but 15 nucleotides or more is preferable, 16 nucleotides or more is more preferable, 17 nucleotides or more is further preferable, and 18 Nucleotides and above are particularly preferred, 19 nucleotides and above are even more preferred, and 20 nucleotides and above are most preferred.
The upper limit of the length of the guide RNA is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 30 nucleotides or less, more preferably 25 nucleotides or less, further preferably 22 nucleotides or less, and 20 Nucleotides and below are particularly preferred.
The guide RNA may contain a guide sequence fused to the tracr sequence.

The guide RNA that targets the Orange gene is not particularly limited and may be appropriately selected depending on the intended purpose. For example, it is represented by either StOr_t1 (SEQ ID NO: 6) or STOR_t2 (SEQ ID NO: 7). Examples thereof include sequences and sequences having sequence identity with respect to these sequences.

The sequence identity is not particularly limited and may be appropriately selected depending on the intended purpose, but 80% or more of sequence identity is preferable, 85% or more of sequence identity is more preferable, and 90% or more of sequences is preferable. Identity is even more preferred, with 95% or greater sequence identity being particularly preferred.

The Orange gene may be mutated by inserting or substituting foreign DNA by recombination between the cleaved sites.

The nucleic acid-metabolizing enzyme is not particularly limited and may be appropriately selected depending on the intended purpose, and examples thereof include nuclease and deaminase. The nucleic acid metabolizing enzyme may contain one or more nuclear localization signals (NLS).

The nuclease is not particularly limited and may be appropriately selected depending on the intended purpose. CRISPR-CAS system CAS nuclease, zinc finger nuclease, protein expressing zinc finger nuclease activity, TAL effector nucleoase (TALEN), TARGET. Examples include AID and meganuclease. In addition, the nuclease may be derived from a different species, and for example, genes such as animals, plants, microorganisms, and viruses, or artificially synthesized genes can be used.

The CASnuclease is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include type I CRISPR enzyme, type II CRISPR enzyme, type III CRISPR enzyme, and type II CRISPR enzyme. Cas9 is preferable.
The Cas nuclease may be codon-optimized for expression in eukaryotic cells. The Cas nuclease can direct the cleavage of one or two strands in the localization of the target sequence. In another aspect of the invention, the expression of the gene product is reduced and the gene product is a protein.

The Cas9 is not particularly limited and may be appropriately selected depending on the intended purpose. Cas9 of Streptococcus pneumoniae and Cas9 of Streptococcus pyogenes, S. cerevisiae. Examples thereof include Cas9 of Thermophilus (Streptococcus thermophilus) and Cas9 of Staphylococcus aureus, but Cas9 of Streptococcus pyogenes is preferable. Further, it may be a mutant Cas9 derived from these organisms, or even a D10A mutant of Cas9 known to function as a nickase (a DNA cleavage enzyme that inserts a nick into only one DNA strand). It may be Cas9 homolog or ortholog.

The deaminase is not particularly limited as long as it has deamination enzyme activity, and can be appropriately selected depending on the intended purpose. It is used by adding it to a CRISPR-CAS system from which nuclease activity has been removed. can do.

As the nucleic acid encoding the guide RNA or the nucleic acid encoding the nucleic acid metabolizing enzyme, one incorporated in a vector can be used.

The type of the vector may be a circular plasmid, and may be a linear DNA obtained by cutting the plasmid with a restriction enzyme or the like, a linear plasmid, a nucleic acid cassette fragment obtained by cutting out only the DNA fragment to be introduced, or one or both of the cassette fragments. It may be a DNA fragment to which a nucleic acid of 0.8 kb or more and 1.2 kb or less is added to the end. These DNA fragments may be DNA fragments amplified by PCR. In this case, the nucleic acid to be added is not particularly limited and may be a sequence derived from a vector, but the sequence of the target site for introduction is more preferable.
The lower limit of the length of the nucleic acid added to the end of the cassette fragment is preferably 0.5 kb or more, more preferably 0.8 kb or more, still more preferably 1.0 kb or more.
The upper limit of the length of the nucleic acid added to the end of the cassette fragment is preferably 3.0 kb or less, more preferably 2.0 kb or less, still more preferably 1.5 kb or less.

Examples of the vector include pAL system (pAL51, pAL156, etc.), pUC system (pUC18, pUC19, pUC9, etc.), pBI system (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP system, pSMA system, etc. Examples include intermediate vector systems (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), green beans mosaic virus (BGMV), tobacco mosaic virus (TMV), and the like.

The method for inserting the target sequence into the vector is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a purified nucleic acid is cleaved with an appropriate restriction enzyme and an appropriate vector DNA restriction enzyme is used. Examples thereof include a method of inserting into a site or a multi-cloning site and linking to a vector. Further, the target sequence may be inserted into the intermediate vector by double cross-over, and TA cloning, In-Fusion cloning, or the like may be used.

In addition to the nucleic acid encoding the guide RNA or the nucleic acid encoding the nucleic acid metabolizing enzyme, for example, a promoter, an enhancer, an insulator, an intron, a terminator, a poly A addition signal, a selectable marker gene, or the like is ligated to the vector. Can be done.

The promoter may be derived from a plant as long as it is a DNA that functions in a plant or in a plant cell and is constitutively expressed, or can induce expression in a specific tissue of a plant or at a specific developmental stage. It does not have to be. Specific examples include, for example, cauliflower mosaic virus (CaMV) 35S promoter, El2-35S omega promoter, noparin synthase gene promoter (Pnos), corn-derived ubiquitin promoter, rice-derived actin promoter, tobacco-derived PR protein promoter, ADH. Promoters, RuBisco promoters and the like can be mentioned. Translation efficiency can be increased by using a sequence that enhances translation activity, for example, an omega sequence of tobacco mosaic virus. In addition, a protein can be translated from a plurality of coding regions by inserting an IRES (internal ribosome entry site) as a translation start region on the 3'-downstream side of the promoter and on the 5'-upstream side of the translation start codon.

The terminator may be any sequence that can terminate the transcription of the gene transcribed by the promoter and has a poly A addition signal. For example, the terminator of the nopaline synthase (NOS) gene and the octopine synthase (OCS) gene. Examples include a terminator and a CaMV 35S terminator.

Examples of the selection marker gene include a herbicide resistance gene (biaraphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS), etc.), drug resistance gene (tetracycline resistance gene, ampicillin resistance gene, canamycin). Resistance genes, hyglomycin resistance genes, spectinomycin resistance genes, chloramphenicol resistance genes, neomycin resistance genes, etc.), fluorescent or luminescent reporter genes (luciferase, β-galactosidase, β-glucuronidase (GUS), green fluorescence Examples include enzyme genes such as protein (GFP), neomycin phosphotransferase II (NPT II), and dihydrofolate reductase.
However, according to the present invention, it is possible to prepare a transformant without introducing a selectable marker gene.

The target sequence to be inserted into the vector may be a plurality of types per vector. Further, a recombinant vector containing a nucleic acid encoding the guide RNA and / or a nucleic acid encoding the nucleic acid metabolizing enzyme and a recombinant vector containing a drug resistance gene are separately prepared, mixed and coated with fine particles. You may.

The target gene for genome editing may be two or more, or a vector may be constructed so that two or more target genes can be cleaved. In that case, two or more kinds of vectors may be prepared, or a plurality of guide RNAs may be inserted so as to be expressed on one plasmid.

The guide RNA and the nucleic acid-metabolizing enzyme may be naturally occurring (combinations) or may be non-naturally occurring combinations.

--Agrobacterium method ---
The method for introducing the genome editing vector into Agrobacterium by the electroporation method is not particularly limited and may be appropriately selected depending on the intended purpose. For example, Gelvin and Schilleror, Plant Molecular Biology Manual, C2 , 1-32 (1994), Klewer Academic Publicers, and the like.

The method for infecting potatoes with the Agrobacterium is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include the method described in Monma (1990) Plant Tissue Culture 7: 57-63. Be done.

－－Particle bombardment method －－
In the method of shooting the fine particles coated by the genome editing means into the buds or axillary buds of potatoes, the fine particles are not particularly limited and may be appropriately selected depending on the intended purpose. From the viewpoint of increasing the penetrating power, those having a high specific gravity, which are chemically inactive and do not easily cause harm to the living body are preferable, and examples thereof include metal fine particles, ceramic fine particles, and glass fine particles.
The metal fine particles are not particularly limited and may be appropriately selected depending on the intended purpose, and examples thereof include metal simple substance fine particles and alloy fine particles.
As the simple metal fine particles, gold particles, tungsten particles and the like are preferable.

The lower limit of the average particle size of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 0.3 μm or more, more preferably 0.4 μm or more, and further preferably 0.5 μm or more. Preferably, 0.6 μm is particularly preferable.
The upper limit of the average particle size of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 1.5 μm or less, more preferably 1.4 μm or less, still more preferably 1.3 μm or less. , 1.2 μm or less is particularly preferable, 1.1 μm is even more preferable, and 1.0 μm or less is most preferable.
The average particle size is not particularly limited and may be appropriately selected depending on the intended purpose, and examples thereof include a number average particle size.

The shape of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a sphere, a cube, a rod and a plate, and among these, a sphere is preferable.

The coating method is not particularly limited and may be appropriately selected depending on the intended purpose. However, the fine particles are washed and sterilized, and the fine particles, nucleic acids (recombinant vector, linear DNA, RNA, etc.) and / Or add protein, CaCl ₂ , spermidine, etc. with stirring with a vortex mixer or the like, coat (coat) the nucleic acid and / or protein with fine particles, and wash with ethanol or phosphate buffered saline (PBS, etc.). The method etc. can be mentioned.

The fine particles can be applied to the macrocarrier film as uniformly as possible using a micropipette or the like, and then dried in a sterile environment such as a clean bench. In the case of protein-coated fine particles, it is preferable to use a hydrophilic macrocarrier film.

As the hydrophilic macrocarrier film, a hydrophilic film may be attached to the macrocarrier film, or a hydrophilic coating may be applied.
Examples of the method for making a film hydrophilic include a method using a surfactant, a photocatalyst, and a hydrophilic polymer.

The hydrophilic polymer is not particularly limited and may be appropriately selected depending on the intended purpose. For example, polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol. Hydrophilicity such as methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethylphosphorylcholine, 1-carboxydimethylmethacryloyloxyethylmethaneammonium, etc. Examples thereof include polymers of monomers.

The coverage of the fine particles is not particularly limited and may be appropriately selected depending on the intended purpose, and may be the entire surface or a part of the fine particles.

The means for shooting the fine particles is not particularly limited as long as the fine particles can be shot into plant cells, and examples thereof include a particle gun (gene gun) in the particle gun method. From the viewpoint of introduction efficiency, a method of introducing into young buds or axillary buds by using a particle gun method is preferable.

The method of introducing into the bud or axillary bud by using the particle gun method is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a macrocarrier film coated with fine particles, a target bud or a target bud or An example is a method in which a plate on which the axillary bud apex is placed is installed in a particle gun device, and high-pressure gas is emitted from a gas acceleration tube toward a macrocarrier film. The macrocarrier film stops at the stopping plate, but the fine particles coated on the macrocarrier film pass through the stopping plate and penetrate into the target placed under the stopping plate, and the target gene is introduced.

The high-pressure gas is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include helium.

The particle gun device is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD).

The upper limit of the distance between the stopping plate and the target shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but 9 cm or less is preferable, 8 cm or less is more preferable, and 7 cm or less is preferable. More preferably, 6 cm or less is particularly preferable.
The lower limit of the distance between the stopping plate and the target shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 2 cm or more, more preferably 3 cm or more, and 4 cm or more. More preferred.

The gas pressure of the particle gun device is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 1,100 to 1,600 psi, more preferably 1,200 to 1,500 psi.

The lower limit of the number of times the fine particles are shot into the shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 2 times or more, more preferably 3 times or more, still more preferably 4 times or more. ..
The upper limit of the number of times the fine particles are shot into the shoot apex is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 20 times or less, more preferably 15 times or less, still more preferably 10 times or less. ..

-Method using RNAi-
The method using the RNAi is not particularly limited and may be appropriately selected depending on the intended purpose. For example, the RNAi vector is introduced into Agrobacterium by an electroporation method, and the Agrobacterium is introduced into a potato microtuber. Examples include methods for infecting Um.

The RNAi vector is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a vector based on a binary vector.
The sequence contained in the RNAi vector is not particularly limited as long as it contains the Orange gene fragment of potato, and can be appropriately selected depending on the intended purpose, and may contain other sequences. Among these, it is preferable to contain the Orange gene fragment of potato in the forward direction and the reverse direction.

The Orange gene fragment of the potato is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a gene fragment amplified by a primer having the sequences of SEQ ID NOs: 3 and 4, a homologue of this gene fragment, and the like. Can be mentioned.

The homolog is not particularly limited and may be appropriately selected depending on the intended purpose, but the sequence identity with the gene fragment amplified by the primers having the sequences of SEQ ID NOs: 3 and 4 is 80% or more. Sequence identity is preferred, 85% or higher sequence identity is more preferred, 90% or higher sequence identity is even more preferred, 95% or higher sequence identity is particularly preferred, and 99% or higher sequence identity is most preferred.

The other sequence is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include promoters, enhancers, insulators, introns, terminators, poly-A addition signals, and selectable marker genes.

The promoter does not have to be of plant origin as long as it is a DNA that functions in potato and can be constitutively expressed, or can induce expression in a specific tissue of potato or at a specific developmental stage. Specific examples include, for example, cauliflower mosaic virus (CaMV) 35S promoter, El2-35S omega promoter, noparin synthase gene promoter (Pnos), corn-derived ubiquitin promoter, rice-derived actin promoter, tobacco-derived PR protein promoter, ADH. Promoters, RuBisco promoters and the like can be mentioned. Translation efficiency can be increased by using a sequence that enhances translation activity, for example, an omega sequence of tobacco mosaic virus. In addition, a protein can be translated from a plurality of coding regions by inserting an IRES (internal ribosome entry site) as a translation start region on the 3'-downstream side of the promoter and on the 5'-upstream side of the translation start codon.

Examples of the selection marker gene include a herbicide resistance gene (the third intron of the phytoendesaturase gene (AT4g14210), bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS), etc.), and drug resistance. Genes (tetracycline resistance gene, ampicillin resistance gene, canamycin resistance gene, hyglomycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, etc.), fluorescent or luminescent reporter gene (luciferase, β-galactosidase) , Β-Glucronidase (GUS), Green Fluorescence Protein (GFP), etc.), Neomycin Phosphortransferase II (NPT II), Dihydrofolate Reductase, and other enzyme genes.

<Other processes>
Examples of the other steps include a step of selecting an individual into which a deletion, insertion, or substitution has been introduced into the Orange gene of potato.
The selection step is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a method of selection based on a drug resistance gene.

(Potato genome editing method)
The potato genome editing method includes a step of introducing a deletion, insertion, or substitution into a potato Orange gene by using a genome editing means, and can further include other steps.
The step of introducing a deletion, insertion, or substitution into a potato Orange gene using the above-mentioned genome editing means introduces a deletion, insertion, or substitution into a potato Orange gene using the above-mentioned genome editing means. The method is as follows.

(Composition for producing genetically modified potatoes)
The composition for producing a genetically modified potato comprises either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, a nucleic acid metabolizing enzyme, or a nucleic acid encoding the nucleic acid metabolizing enzyme. And any of the above, and may further contain other components.
Either the guide RNA targeting the Orange gene or the nucleic acid encoding the guide RNA targeting the Orange gene, and either the nucleic acid metabolizing enzyme or the nucleic acid encoding the nucleic acid metabolizing enzyme are as described above. be.

(Method of determining genetically modified potatoes)
The method for determining a genetically modified potato includes a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index, and may further include other steps. can.
The step of determining whether or not the potato is a genetically modified potato using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index is not particularly limited and can be appropriately selected depending on the purpose, for example. , A method of analyzing the Orange gene sequence of potato and comparing it with the DNA sequence of SEQ ID NO: 5 and the like.
According to the method for determining a potato modified potato, it can be efficiently determined whether or not the potato has accumulated carotenoids.

In general, it is considered difficult to apply the finding that a specific phenotype appears when a gene of a certain plant species is genetically modified to another crop species as it is. This is due to the fact that different crop bioclasses (family, genus, species, etc.) have different metabolic and synthetic pathways.
For example, even if an anthocyanin (a type of pigment) synthase is expressed in marvel-of-peru or cockscomb, anthocyanins are not synthesized. Similarly, expressing betalain (a type of pigment) synthase in roses and carnations does not synthesize betalain (The Plant Journal 2008 54: 733-749).
Further, in relation to the present invention, carotenoids are accumulated in flower buds which are edible parts due to mutation of the Orange gene in potash flowers, while in rice, the amount of carotenoids is increased in curls by editing the Orange gene, but significant carotenoid accumulation in endosperm. Is not recognized (Rice 2019 12:81).
Since some of the carotenoid synthases are deficient in the endosperm of rice, it has been reported that carotenoids are not accumulated in the endosperm unless a new synthase is supplemented from the outside (Nature Biotechnology 2005 23: 482-487). ).

Hereinafter, examples of the present invention will be described, but the present invention is not limited to these examples.

<Example 1: Acquisition of potato Orange candidate gene>
A tblast analysis was performed on the sequences contained in the potato (S. tuberosum) genome database (Spud DB: http: // solaraceae.plantcauliflower.mus.edu/index.shtml), and two expected transcripts were obtained. (PGSC0003DMT4000022863 and PGSC0003DMT400021454) were found to be homologous to the cauliflower genome gene.

For the expression analysis of these predicted transcripts, SRX3127474: Solanum tuberosum, Atlantic, leaf, RNA-Seq, which are NGS data registered in the NCBI database, were subjected to Trinity (https://ghub.com/trinityrinaseq/triny). , Bowtie (http://boutie-bio.sourceforge.net/index.shtmml), DEFsec (Original site), eXpress (Original site), gene expression level (fpkm) When one of the general indexes of the expression level) was analyzed, the fpkm value of PGSC0003DMT40022863 could be calculated as 59.66, and the fpkm value of PGSC0003DMT40021454 could not be calculated.

Similarly, Phytoene synthase 1-PSY1, Phytoene synthase 2-PSY2, Phytoene desaturase-PDS, Lycopene-β cyclose-LCYb, and -carotenoid hydroxylase 1-CHARse 1-Chey1 It was 89, 61.10, 68.06, 38.98, 16.02, 184.13, and it was confirmed that it was expressed in the tissue expressing the carotenoid biosynthesis gene. From the above results, it was considered that PGSC0003DMT4000022863 is an Orange candidate gene in potatoes.

<Example 2: Acquisition of genome sequence of potato Orange candidate gene>
In order to clarify the genomic sequences of the 3rd to 5th exons in which mutations have been found in orange cauliflower in the potato variety "Sassy" to be used in the experiment, synthesis was performed on the genomic DNA of "Sassy" based on the above PGSC0003DMT40022863. PCR (30 cycles, using Takara Bio's PrimeSTAR) was performed at an annealing temperature of 55 ° C. using the primers U1200: GTACGTAGCTAAGAATACAACAAAG (SEQ ID NO: 8) and U1201: GGCAAGTAATCCACCGAAGA (SEQ ID NO: 9). rice field. The box in FIG. 1 indicates each exon.
The obtained PCR amplification product was cloned into a pENTR / D-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and two types of full-length sequences (3rd to 5th exons) were determined (SEQ ID NO:). : 1 and 2).

<Example 3: Preparation of genome editing vector for potato Orange candidate gene>
Based on the genomic DNA sequence identified in Example 2, it is assumed that the insertion deletion mutation caused by DNA cleavage of Cas9 induces splicing abnormality of the StOr transcript, near the boundary site between the 3rd exon and the 3rd intron. Two target sequences were designed (StOr_t1: SEQ ID NO: 6, STOR_t2: SEQ ID NO: 7) (FIG. 2). The white arrows in FIG. 2 indicate each expected cutting site.
Two vectors, pStOr_t1 and pSTor_t2, containing the target sequence were prepared (FIG. 3). FIG. 3 shows the right border (RB) and left border (LB) of the T-DNA of the gene portion to be introduced, and the internal structure of these borders.

<Example 4: Preparation of transformant of potato Orange candidate gene>
The vector prepared in Example 4 was introduced into Agrobacterium tumefaciens GV3101 by an electroporation method (Gelvin and Schilperor ed., Plant Molecular Biology Manual, C2, 1-32 (1994), Kruwer Academic Publicers). Agrobacterium tumefaciens GV3110 strain containing vector, YEB liquid medium containing 50 ppm kanamycin [5 g / L beef extract, 1 g / L yeast extract, 5 g / L peptone, 5 g / L scroll, 2 mM magnesium sulfate ( The culture was shaken at 28 ° C. for 12 hours at pH 7.2)]. 1.5 mL of the culture broth was centrifuged at 10,000 rpm for 3 minutes to collect the cells, and then washed with 1 mL of LB medium to remove kanamycin. After further centrifuging at 10,000 rpm for 3 minutes and collecting the bacteria, MS medium containing 1.5 mL of 3% sucrose [Murashige & Skoog, Physiol. Plant. , 15,473-497 (1962)] to prepare a bacterial solution for infection.

Potato transformation was performed according to [Monma (1990) plant tissue culture 7: 57-63]. Microtubers obtained from the potato variety "Sassy" were sliced into 2-3 mm pieces and used as a material for Agrobacterium infection. After immersing this in the above-mentioned Agrobacterium solution, it was placed on a sterilized filter paper to remove excess Agrobacterium. Place on MS medium (including Zeatin 1 ppm, IAA 0.1 ppm, acetosyringone 100 μM, and agar 0.8%) in a petri dish, and culture for 3 days at 25 ° C. for 16 hours (photon bundle density 32 μE / m2s). / 8 hours under no lighting conditions. Then, the cells were cultured in a medium containing 250 ppm of carbenicillin instead of acetosyringone for 1 week. Then, it was further transferred onto a medium containing 50 ppm of kanamycin and subcultured every two weeks. During this time, adventitious shoots formed and shoots were produced. The elongated shoots were placed in MS medium containing 250 ppm of carbenicin and 100 ppm of kanamycin and not containing plant growth regulators. An individual containing a kanamycin resistance gene as a foreign gene from a plant in which rooted shoots are resistant to kanamycin is subjected to PCR (conditions: 95 ° C. for 5 minutes, (95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. 1). (Min) was detected 30 times (at 72 ° C. for 10 minutes), and it was confirmed that the redifferentiated plant was a transformed plant. Here, U1200 (SEQ ID NO: 8) and U1225: CAGATGACTTTCCCGAAACAGA (SEQ ID NO: 10) were used as primers for specifically amplifying the sequence of the kanamycin resistance gene. From the above, # 13 of each pStOr_t1 and # 8 line of pSTor_t2 of each transformed plant of potato into which the vectors pStOr_t1 and pSTor_t2 were introduced were obtained.

<Example 5: Genome editing of potato Orange candidate gene Preparation of potato strain>
Heteroduplex mobility assay (HMA) was used to evaluate whether or not the genome was edited site-specifically in the obtained individuals. PCR (35 cycles, Takara Bio Inc. TakaraTaq) was used at an annealing temperature of 55 ° C. using primers U1131: TCACATTTTTGGATTGTTCTCTG (SEQ ID NO: 3) and U1017: TGGACCATAAATCATGCCTTC (SEQ ID NO: 4) sandwiching the target sequence of the Orange candidate gene. ), And the analysis was performed with the microchip electrophoresis device "MultiNA" (Shimadzu Corporation).
The results of heteroduplex mobility analysis (HMA) on the transformant leaves obtained in Example 4 are shown in FIG.
In HMA, the presence of multiple bands compared to controls indicates that genome editing has occurred. In FIG. 4, multiple bands were observed at the bottom of the 190 bp marker as compared to the control.

From the results shown in FIG. 4, among the transformants from Sassy, it was possible to obtain an individual in which a foreign gene was not integrated into the genome but genome editing occurred (Fig. 4).

Amplified fragment DNA of gRNA in the genome of leaves of transformants # 13 of pStOr_t1 and # 8 of pSTor_t2 obtained in Example 4 was transferred to TOPO (R) TA Cloning (R) Kit for Sequencing (Thermofisher). It was cloned and a gene fragment was obtained. The nucleotide sequences of the following SEQ ID NOs: 11 to 42 cloned into Escherichia coli were determined, and it was confirmed that genome editing had occurred (Fig. 5). The "-" in FIG. 5 indicates the deletion, and the underline indicates the third exon.
Nucleotide sequence near the target sequence of genome editing of Orange gene (SEQ ID NO: 5)
pSOr_t1 # 13 # 3 (SEQ ID NO: 11)
pSOr_t1 # 13 # 14 (SEQ ID NO: 12)
pSOr_t1 # 13 # 5 (SEQ ID NO: 13)
pSOr_t1 # 13 # 7 (SEQ ID NO: 14)
pSOr_t1 # 13 # 12 (SEQ ID NO: 15)
pSOr_t1 # 13 # 13 (SEQ ID NO: 16)
pSOr_t1 # 13 # 10 (SEQ ID NO: 17)
pSOr_t1 # 13 # 2 (SEQ ID NO: 18)
pSOr_t1 # 13 # 8 (SEQ ID NO: 19)
pSOr_t1 # 13 # 15 (SEQ ID NO: 20)
pSOr_t1 # 13 # 16 (SEQ ID NO: 21)
pSOr_t1 # 13 # 4 (SEQ ID NO: 22)
pSOr_t1 # 13 # 9 (SEQ ID NO: 23)
pSOr_t1 # 13 # 11 (SEQ ID NO: 24)
pSOr_t1 # 13 # 6 (SEQ ID NO: 25)
pSOr_t1 # 13 # 1 (SEQ ID NO: 26)
pSOr_t2 # 8 # 1 (SEQ ID NO: 27)
pSOr_t2 # 8 # 6 (SEQ ID NO: 28)
pSOr_t2 # 8 # 15 (SEQ ID NO: 29)
pSOr_t2 # 8 # 2 (SEQ ID NO: 30)
pSOr_t2 # 8 # 3 (SEQ ID NO: 31)
pSOr_t2 # 8 # 7 (SEQ ID NO: 32)
pSOr_t2 # 8 # 9 (SEQ ID NO: 33)
pSOr_t2 # 8 # 10 (SEQ ID NO: 34)
pSOr_t2 # 8 # 12 (SEQ ID NO: 35)
pSOr_t2 # 8 # 4 (SEQ ID NO: 36)
pSOr_t2 # 8 # 8 (SEQ ID NO: 37)
pSOr_t2 # 8 # 14 (SEQ ID NO: 38)
pSOr_t2 # 8 # 16 (SEQ ID NO: 39)
pSOr_t2 # 8 # 13 (SEQ ID NO: 40)
pSOr_t2 # 8 # 5 (SEQ ID NO: 41)
pSOr_t2 # 8 # 11 (SEQ ID NO: 42)

<Example 6: Genome editing of potato Orange candidate gene Preparation of microtuber from potato strain>
Potatoes cultured in vitro (transformant obtained in Example 4) were transferred to foliage growth medium: MS + suc 1% + BA 0.02 ppm + KCl 1 g / L and illuminated at 23 ° C. for 16 hours (photon bundle density 32 μE / m2 s). ) / 8 hours under unlit conditions for 4-5 weeks. Next, the medium was transferred to MT-forming medium: MS + suc 10% + BA 2 ppm + KCl 1 g / L, and cultured at 23 ° C. in the dark for 6 weeks to prepare a microtuber. When the produced microtubers were stored for about 3 weeks and then the tubers were cut, it became clear that the tubers obtained from # 13 of pStOr_t1 and # 8 of pSTor_t2 had a deep yellow color.

As a result, it was found that a strain in which carotenoids are accumulated can be obtained by genome editing of the potato Orange candidate gene, and it was confirmed that the Orange candidate gene is the Orange gene. It has been shown that genome editing can achieve high carotenoids.

<Example 7: Genome editing of potato Orange gene Analysis of microtuber of potato strain>
Examples of the method described in the document "Simultaneous quantification of carotenes in commercial vegetable juice by high performance liquid chromatography" (Hokuriku Gakuin University / Hokuriku Gakuin University Junior College Research Bulletin No. 6 (2013)). The amount of carotenoids in the stalks obtained from the transformants of pStOr_t1 # 13 and pSTor_t2 # 8 obtained in No. 4 was analyzed.
900 μL of hexane / ethanol (80: 20v / v) was added to 100 mg of tubers obtained from the transformants of pStOr_t1 # 13 and pSTor_t2 # 8 obtained in Example 4, shaken for 1 minute, and then centrifuged. (6000 rotations, 1 minute) was performed. Take 600 μL from the upper layer (hexane layer) in another tube, add 400 μL of hexane / ethanol (80: 20v / v) to the remaining lower layer, shake again for 1 minute, and then centrifuge (6000 rpm, 1 minute). , 400 μL of the upper layer was added to the above extract to obtain a total of 1000 μL of extract. The absorbance (OD445) of this extract was measured, and the amount of carotenoid was calculated. The results are shown in Table 1.

It was found that the amount of carotenoids was accumulated in # 13 of pStOr_t1 and # 8 of pSTor_t2 as compared with the control (wild strain: gene-unmodified potato: sassy).

The genome was extracted and cloned from the tubers of the # 8 strain of pSTor_t2, and the sequence was analyzed. The following genomic sequences (SEQ ID NOs: 43 to 57) are shown in the upper part of FIG. 6, and the expected amino acid sequences (SEQ ID NOs: 58 to 60) are shown in the lower part of FIG. As a result, a genotype in which the amount of carotenoid is considered to be high (Fig. 6 pSOr-t2 # 8Y # 10: Deletion, insertion, or substitution is introduced into 3 consecutive bases (excluding introduction that becomes a stop codon)) Was detected.

pSOr-t2 # 8Y # 2 (SEQ ID NO: 43)
pSOr-t2 # 8Y # 3 (SEQ ID NO: 44)
pSOr-t2 # 8Y # 6 (SEQ ID NO: 45)
pSOr-t2 # 8Y # 9 (SEQ ID NO: 46)
pSOr-t2 # 8Y # 11 (SEQ ID NO: 47)
pSOr-t2 # 8Y # 12 (SEQ ID NO: 48)
pSOr-t2 # 8Y # 13 (SEQ ID NO: 49)
pSOr-t2 # 8Y # 4 (SEQ ID NO: 50)
pSOr-t2 # 8Y # 5 (SEQ ID NO: 51)
pSOr-t2 # 8Y # 7 (SEQ ID NO: 52)
pSOr-t2 # 8Y # 15 (SEQ ID NO: 53)
pSOr-t2 # 8Y # 16 (SEQ ID NO: 54)
pSOr-t2 # 8Y # 1 (SEQ ID NO: 55)
pSOr-t2 # 8Y # 14 (SEQ ID NO: 56)
pSOr-t2 # 8Y # 10 (SEQ ID NO: 57)
pSOr-t2 # 8Y # 1 (SEQ ID NO: 58)
pSOr-t2 # 8Y # 14 (SEQ ID NO: 59)
pSOr-t2 # 8Y # 10 (SEQ ID NO: 60)

Examples of aspects of the present invention include the following.
<1> A genetically modified potato characterized in that a deletion, insertion, or substitution has been introduced into the Orange gene.
<2> The genetically modified potato according to <1>, wherein the deletion, insertion, or substitution has been introduced into three consecutive bases (excluding the introduction that serves as a stop codon).
<3> The genetically modified potato according to any one of <1> to <2> above, which contains 1.3 times or more of carotenoids with respect to the genetically modified potato.
<4> A method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato.
<5> A potato genome editing method comprising a step of introducing a deletion, insertion, or substitution into a potato Orange gene using a genome editing means.
<6> The genome editing means includes either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme. The method for editing a nucleic acid of a potato according to <5>, which comprises any of the above.
<7> The method for editing a potato genome according to <6>, wherein the nucleic acid-metabolizing enzyme contains either nuclease or deaminase.
<8> Containing either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and either a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme. It is a composition for producing a genetically modified potato, which is characterized by the above.
<9> A method for determining a genetically modified potato, which comprises a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index.

Claims

A genetically modified potato characterized in that a deletion, insertion, or substitution has been introduced into the Orange gene.
The genetically modified potato according to claim 1, wherein the deletion, insertion, or substitution is introduced into three consecutive bases (excluding introduction that serves as a stop codon).
The genetically modified potato according to any one of claims 1 to 2, which contains 1.3 times or more of carotenoids with respect to the genetically modified potato.
A method for producing a genetically modified potato, which comprises a step of introducing a deletion, insertion, or substitution into the Orange gene of potato.
A potato genome editing method comprising a step of introducing a deletion, insertion, or substitution into a potato Orange gene using a genome editing means.
The genome editing means comprises either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, a nucleic acid metabolizing enzyme, or a nucleic acid encoding the nucleic acid metabolizing enzyme. The method for editing a genome of a potato according to claim 5, which comprises.
The method for editing a potato genome according to claim 6, wherein the nucleic acid-metabolizing enzyme contains either nuclease or deaminase.
It is characterized by containing either a guide RNA targeting the Orange gene or a nucleic acid encoding a guide RNA targeting the Orange gene, and either a nucleic acid metabolizing enzyme or a nucleic acid encoding the nucleic acid metabolizing enzyme. Composition for producing genetically modified potatoes.
A method for determining a genetically modified potato, which comprises a step of determining whether or not the potato is a genetically modified potato, using the presence or absence of deletion, insertion, or substitution of the Orange gene of the potato as an index.