WO2021101351A2 - 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도 - Google Patents
비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도 Download PDFInfo
- Publication number
- WO2021101351A2 WO2021101351A2 PCT/KR2020/016605 KR2020016605W WO2021101351A2 WO 2021101351 A2 WO2021101351 A2 WO 2021101351A2 KR 2020016605 W KR2020016605 W KR 2020016605W WO 2021101351 A2 WO2021101351 A2 WO 2021101351A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nbfuct13
- sugar chain
- cancer
- plant
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
Definitions
- the present invention relates to antibodies produced using non-fucosylated tobacco and uses thereof.
- antibody drugs are being developed in the protein drug market.
- studies on drugs in which a monoclonal antibody (mAbs) and an Fc region of an immunoglobulin are fused are being actively conducted.
- mAbs monoclonal antibody
- Fc region of an immunoglobulin Fc region of an immunoglobulin are fused are being actively conducted.
- ADCC antibody-dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- galactosylation of the Fc region is known.
- galactose is attached after N-acetylglucosamine by galactosyltransferase in the glycosylation chain reaction.
- Manganese (Mn2+) is a cofactor of galactose transferase and plays a role in improving enzyme performance.
- Trastuzumab is a humanized antibody that specifically binds to human epidermal growth factor receptor 2 (HER2) having high activity in breast cancer and inhibits cell division. Trastuzumab not only directly inhibits cell proliferation, but also inhibits ADCC and angiogenesis. Trastuzumab is used for the treatment of breast cancer by intravenous administration to breast cancer patients overexpressing HER2.
- HER2 human epidermal growth factor receptor 2
- trastuzumab is produced using animal cells or microorganisms.
- trastuzumab is produced using animal cells and microorganisms.
- it is expensive, and infections such as animal-derived viruses or toxins may occur.
- trastuzumab is produced using plant cells, there is an advantage in that it does not contain animal-derived viruses and toxins.
- the process of purifying the antibody from the plant has a simple and economical advantage (Doran PM, Curr. Opin. Biotechnol. 11: 199-204, 2000).
- Patent Document 1 US 2012/0276631
- Patent Document 2 WO 2012/149197
- Non-Patent Document 1 Doran P.M., Curr. Opin. Biotechnol. 11: 199-204, 2000
- the inventors of the present invention were researching a technology for producing an antibody whose sugar chain is regulated, and CRISPR technology, in particular, when transforming tobacco using ribonucleoprotein (RNP), does not mutate other genes in tobacco, It was confirmed that only genes can be knocked out.
- RNP ribonucleoprotein
- the sugar chain of trastuzumab was modified.
- the present invention was completed by confirming that trastuzumab having a modified sugar chain exhibits an excellent anticancer effect.
- an aspect of the present invention provides a transgenic plant in which the expression of alpha 1,3-fucosyltransferase (FucT13) is suppressed.
- Another aspect of the present invention is a target protein having a modified sugar chain that does not contain any one residue selected from the group consisting of fucose, xylose, galactose, and combinations thereof. to provide.
- Another aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer comprising a target protein having a modified sugar chain as an active ingredient.
- Another aspect of the present invention i) a nucleotide sequence represented by SEQ ID NO: 3; And introducing a gene including the nucleotide sequence represented by SEQ ID NO: 4 into a transgenic plant in which expression of the alpha 1,3-fucosyltransferase is suppressed. ii) cultivating the transformed plant; And iii) recovering the antibody from the cultivated transgenic plant. It provides a method for producing an antibody (eg, trastuzumab) having a modified sugar chain.
- an antibody eg, trastuzumab
- Another aspect of the present invention provides a method for preventing or treating cancer comprising administering to an individual a target protein having the modified sugar chain.
- Another aspect of the present invention provides the use of a target protein having the modified sugar chain for preventing or treating cancer.
- Another aspect of the present invention provides the use of a target protein having the modified sugar chain for preparing a drug for preventing or treating cancer.
- the antibody produced using non-fucosylated tobacco according to the present invention has a different type of sugar chain than the antibody produced using conventional animal cells, and no fucose exists in the sugar chain of the antibody.
- the antibody having a modified sugar chain according to the present invention exhibits superior anti-cancer effects than antibodies produced using conventional animal cells. Therefore, the antibody having a modified sugar chain according to the present invention can be usefully used in the prevention or treatment of cancer.
- FIG. 1 is a schematic diagram of five alpha 1,3-fucosyltransferase (FucT13) genes present in tobacco (N. benthamiana).
- Figure 2 shows the phylogenic tree between the alpha 1,3-fucosyltransferase gene of tobacco and similar genes present in lettuce and Arabidopsis.
- the scale represents the degree of amino acid substitution present per position.
- N. benthamiana FucT13_1 (Niben101Scf01272), NbFucT13_2 (Niben101Scf02631), NbFucT13_3 (Niben101Scf05494), NbFucT13_4 (Niben101Scf17626) and NbFucT13_5 (Niben101Scf05447);
- Lactuca sativa FucT13_1 (Lsa020014.1), LsFucT13_2 (Lsa143107.1), LsFucT13_3 (Lsa040691.1), LsFucT13_4 (Lsa090095.1) and LsFucT13_5 (Lsa035782.1);
- 3 is a graph confirming the expression levels of five alpha 1,3-fucosyltransferase genes present in tobacco.
- Figure 4 is a schematic diagram of sgRNA for targeting five FucT13.
- FIG. 5 is a schematic diagram of sgRNAs for targeting five FucT13s. At this time, all sgRNAs targeted exon 1 and consisted of 20 mer nucleotides. In addition, "G” is included in 5'to be effective for the transcript of the T7 promoter.
- Figure 5a is the sgRNA sequence for AFT1 and AFT2.
- 5B is the sgRNA sequence for AFT3 and AFT4.
- Figure 5c is the sgRNA sequence for AFT5 and AFT6. The red box indicates the exon containing the part targeted by the sgRNA.
- FIG. 6 is a schematic diagram of an overview of a binary vector for gene editing containing six sgRNAs to be applied to the gRNA-tRNA system.
- Six gRNAs consist of 20 bp and are expressed by the AtU6 promoter.
- Fig. 7 is a view showing calli and plant bodies of tobacco.
- A Microcalli after 5 days, which is a prameoripo produced from single cells.
- B Microcalli after 2 weeks.
- C Micro-calli after 4 weeks.
- D Calli after 7 weeks.
- E It can be seen that green shoots were formed in three calli.
- F Half a half without growth hormone after two months. It can be seen that roots are generated in -strength MS medium. It took 5 months from single cell to plant. White bars and black bars represent 1 cm, and red bars represent 100 ⁇ m.
- Figure 8 shows a cigarette manufactured using Agrobacterium-mediated gene editing technology.
- A It shows the in vitro cultured tissue (explants) after co-culture with Agrobacterium.
- B 25 mg/L In the presence of gromycin, sprouts are shown in 6-week-old in vitro cultured tissues.
- C Seedlings are shown.
- D Transgenic plants are shown. At this time, the white bar represents 1 cm, and the red bar represents 10 cm.
- Fig. 10 shows five FucT13s genes amplified through PCR. Mutations in this gene were detected in 16 plant individuals.
- the PCR amplification product was amplified using a TA vector, and each PCR amplification product was sequenced.
- T0 Plant line #8 has three genes FucT13_1, FucT13_2 and FucT13_3 have double allelic mutations +5/+1, -1/+1, -593, -1 and +1/+1.
- FucT13_1 has the double allele mutations -5/+1, -1/+1.
- FucT13_2 has the double allele mutations -593, -1.
- FucT13_3 has a double allelic mutation, +1/+1. It was confirmed that FucT13_4 has hetero mutations +1/wt.
- FucT13_5 had no mutations.
- Red dotlines refer to deletion bases. Red letters mean insertion bases. Blue letters mean single nucleotide polymorphism (SNP). The numbers in parentheses mean deletion (-) and insertion (+).
- T0 Plant line #10 has four genes FucT13_1, FucT13_2, fuct13_3 and fuct13_4 with double allelic mutations +1/+1, -715/-3/+1, +1, +1.
- FucT13_1 has hetero mutations, +1/+1/wt.
- FucT13_2 has a hetero mutation, -715/wt.
- FucT13_3 has a hetero mutation, +1/wt. It was confirmed that FucT13_4 has hetero mutations +1/wt.
- FucT13_5 had no mutations.
- the red dot line indicates the deleted base.
- the red letter means the inserted base. Blue letters mean SNP.
- the numbers in parentheses mean deletion (-) and insertion (+).
- T0 Plant line #27 has two genes FucT13_2 and fuct13_3 with double allele mutations -714 and +1/+1.
- FucT13_2 has a hetero mutation, -714/wt.
- FucT13_3 has double allelic mutations, +1 and +1. It was confirmed that FucT13_4 has hetero mutations +1/wt.
- FucT13_1, FucT13_4, and FucT13_5 had no mutations.
- the red dot line indicates the deleted base.
- the red letter means the inserted base. Blue letters mean SNP.
- the numbers in parentheses mean deletion (-) and insertion (+).
- T1 plant line #37-26 was engineered with four genes, FucT13_1, FucT13_2, FucT13_3, and FucT13_4.
- FucT13_1 was confirmed to have double allelic mutations, -709/+1, +1/+1.
- FucT13_2 is a double allelic mutation, -2/-592; It was confirmed to have -1/-593. It was confirmed to have a FucT13_3 double allele mutation, +1, -9. It was confirmed to have FucT13_4 double allele mutations, +1, +1.
- FucT13_5 was not mutated.
- the red dot line indicates the deleted base.
- the red letter means the inserted base. Blue letters mean SNP. Numbers in parentheses mean deletion (-) and insertion (+).
- 16 shows the alignment of the FucT13_2 target region of sgRNA.
- 17 shows the alignment of the FucT13_3 target region of sgRNA.
- Figure 20 shows whether the target gRNA gene editing occurred in vivo. At this time, the gene editing efficiency (%) was indicated by a number above each band.
- Fig. 21 shows whether the target gRNA has undergone gene editing in vivo. At this time, the gene editing efficiency (%) was indicated by a number above each band.
- Figure 22 shows the profile of the N-glycan in order to confirm the glycosylation of the produced antibody.
- A shows the profile of wild-type tobacco (NBwt)
- B is a cigarette in which four genes are knocked out. It shows the profile of #37 (*: means an unidentified peak).
- ADCC 23 is a result of analyzing the effect of Antibody-Dependent Cell-Mediated Cytotoxicity (ADCC) using the produced antibody.
- Fig. 24 is a diagram showing the expression level of trastuzumab obtained from a transgenic plant by Western blot: M; Protein size marker, P; Trastuzumab, v1; Gene before codon optimization, v2; Codon-optimized gene.
- 25 is a graph confirming the expression level of trastuzumab obtained from transgenic plants: M: protein size marker, P: trastuzumab, v1: gene before codon optimization, v2: gene optimized for codon.
- 26 and 27 are diagrams analyzing the sugar chain structures of conventional trastuzumab (herceptin) and trastuzumab (GF003) obtained from transgenic plants.
- FIG. 28 is a diagram confirming the anticancer effect of trastuzumab (GF003) obtained from a transgenic plant.
- Figure 29 shows two beta 1,2-xylosyltransferase (beta 1,2 xylosyltransferase, XylT12) genes and beta 1,3-galactosyltransferase (beta 1,3 galactosyltransferase, GalT13) genes present in tobacco. It shows the schematic diagram of.
- Figure 30 shows the expression levels of five alpha 1,3-fucosyltransferase genes, two beta 1,2-xylosyltransferase genes, and two beta 1,3-galactosyltransferase genes present in tobacco. It is a graph that confirms.
- 31A-31C are schematic diagrams of sgRNAs for targeting two XylT12s. At this time, all sgRNAs targeted exon 1 and consisted of 23 mer or 24 mer nucleotides. In addition, "G” is included in 5'to be effective for the transcript of the T7 promoter.
- 31A is the sgRNA sequence for AXT1 and AXT2.
- 31B is the sgRNA sequence for AXT5 and AXT3.
- 31C is the sgRNA sequence for AXT4 and AXT6. The red box indicates the exon containing the part targeted by the sgRNA.
- 32A to 32C are schematic diagrams of sgRNAs for targeting two GalT13s. At this time, the sgRNA targeted exon 1 or exon 2, and consisted of 23-mer nucleotides. In addition, "G” is included in 5'to be effective for the transcript of the T7 promoter.
- 32A is the sgRNA sequence for AGT3 and AGT4.
- 32B is the sgRNA sequence for AGT1 and AGT2.
- Figure 32c is the sgRNA sequence for AGT5, AGT6 and AGT7. The red box indicates the exon containing the part targeted by the sgRNA.
- 33A is a schematic diagram of a binary vector for gene editing containing three sgRNAs (AXT1, AXT2, AXT3) to be applied to the gRNA-tRNA system.
- the three gRNAs consist of 23 bp and are expressed by the AtU6 promoter.
- 33B is a schematic diagram of a binary vector for gene editing containing three sgRNAs (AXT4, AXT5, AXT6) to be applied to the gRNA-tRNA system.
- the three gRNAs are composed of 23 bp or 24 bp, and are expressed by the AtU6 promoter.
- Figure 33c is a schematic diagram of a binary vector for gene editing containing seven sgRNAs (AGT1, AGT2, AGT3, AXT1, AXT2, AXT3, AXT4) to be applied to the gRNA-tRNA system. Seven gRNAs consist of 23 bp and are expressed by the AtU6 promoter.
- Figure 33d is a schematic diagram of a binary vector for gene editing containing seven sgRNAs (AGT4, AGT5, AGT6) to be applied to the gRNA-tRNA system.
- the three gRNAs consist of 23 bp and are expressed by the AtU6 promoter.
- Figure 34 shows a cigarette prepared by using the Agrobacterium-mediated gene editing technology.
- A It shows that sprouts from tissues cultured in vitro in the presence of hygromycin after co-culture with Agrobacterium.
- B It shows a transgenic plant.
- 35 and 36 are Sanger fish of the T1 generation-based sequence analysis results to find mono-allelic homo and bi-allelic homo, and classify plants from which sugars have been removed single or double.
- FIG. 38 is a view showing mono-allelic homo and bi-allelic homos through the results of Sanger-base sequence analysis of T1 generation and T2 generation, and classification of plants from which sugars have been removed in triplicate.
- 39 and 40 illustrate the analysis of the sugar pattern of trastuzumab produced from cigarettes in which ⁇ -1,3 fucosyltransferase gene and ß-1,3 galactosyltransferase gene are knocked out.
- 41 and 42 are diagrams analyzing the sugar chain structure of trastuzumab (GF003) obtained from transgenic plants.
- FIG. 43 is a diagram confirming the expression level of trastuzumab (GF003) obtained from a transgenic plant.
- M protein size marker
- P pass fraction
- W washing fraction
- E elution fraction.
- ADCC antibody-dependent cytotoxicity
- One aspect of the present invention provides a transgenic plant in which the expression of alpha 1,3-fucosyltransferase (FucT13) is suppressed.
- the transgenic plant is beta 1,2-xylosyltransferase (XylT12), beta 1,3-galactosyltransferase (beta 1,3-galactosyltransferase, GalT13) and combinations thereof Expression of any one selected from the group consisting of may be additionally inhibited.
- the transgenic plant may be a transgenic plant in which the expression of alpha 1,3-fucosyltransferase (FucT13) is suppressed.
- the transgenic plant may have additionally inhibited expression of beta 1,2-xylosyltransferase, in this case, the transgenic plant is alpha 1,3-fucosyltransferase and beta 1,2-xylo It may be that the expression of siltransferase is suppressed.
- the transgenic plant may have additionally inhibited expression of beta 1,3-galactosyltransferase, in this case, the transgenic plant is alpha 1,3-fucosyltransferase and beta 1,3-galacto It may be that the expression of siltransferase is suppressed.
- the transgenic plant may have additionally inhibited expression of beta 1,2-xylosyltransferase and beta 1,3-galactosyltransferase, and in this case, the transgenic plant is alpha 1,3-fuco
- the expression of siltransferase, beta 1,2-xylosyltransferase, and beta 1,3-galactosyltransferase may be inhibited.
- the alpha 1,3-fucosyltransferase may be NbFucT13_1 (Niben101Scf01272), NbFucT13_2 (Niben101Scf02631), NbFucT13_3 (Niben101Scf05494), and NbFucT13_4 (Niben101Scf17626).
- the NbFucT13_1 (Niben101Scf01272), NbFucT13_2 (Niben101Scf02631), NbFucT13_3 (Niben101Scf05494), and NbFucT13_4 (Niben101Scf17626) may be encoded by nucleotide sequences represented by SEQ ID NOs: 70, 71, 72 and 73, respectively.
- the transgenic plant uses a complex of sgRNA and CRISPR proteins that complementarily bind genes encoding NbFucT13_1 (Niben101Scf01272), NbFucT13_2 (Niben101Scf02631), NbFucT13_3 (Niben101Scf05494) and NbFucT13_4 (Niben101Scf17626) 1, It may be designed to inhibit the expression of 3-fucosyltransferase.
- the sgRNA complementarily binding to the gene encoding the NbFucT13_1 (Niben101Scf01272), NbFucT13_2 (Niben101Scf02631), NbFucT13_3 (Niben101Scf05494) and NbFucT13_4 (Niben101Scf17626) may be represented by any one of SEQ ID NOs: 17 to 36. .
- the portions targeted by the sgRNA may be referred to in FIGS. 4 to 5A, 5B, 5C, and Table 6.
- the beta 1,2-xylosyltransferase may be NbXylT12_1 (Niben101Scf04551) and NbXylT12_2 (Niben101Scf04205).
- the NbXylT12_1 (Niben101Scf04551) and NbXylT12_2 (Niben101Scf04205) may include amino acid sequences represented by SEQ ID NOs: 75 and 76, respectively.
- NbXylT12_1 (Niben101Scf04551) and NbXylT12_2 (Niben101Scf04205) may be encoded by nucleotide sequences represented by SEQ ID NOs: 77 and 78, respectively.
- the transgenic plant uses a complex of sgRNA and CRISPR-associated proteins that complementarily bind to genes encoding NbXylT12_1 (Niben101Scf04551) and NbXylT12_2 (Niben101Scf04205), and expresses beta 1,2-xylosyltransferase. It may be designed to be suppressed.
- the sgRNA complementarily binding to the gene encoding NbXylT12_1 (Niben101Scf04551) and NbXylT12_2 (Niben101Scf04205) may include a nucleotide sequence represented by any one of SEQ ID NOs: 57 to 62.
- the portion targeted by the gRNA may be referred to in FIGS. 31A to 31C and Table 13.
- the beta 1,3-galactosyltransferase may be NbGalT13_1 (Niben101Scf04082) and NbGalT13_2 (Niben101Scf09597).
- the NbGalT13_1 (Niben101Scf04082) and NbGalT13_2 (Niben101Scf09597) may include amino acid sequences represented by SEQ ID NOs: 79 and 80, respectively.
- NbGalT13_1 (Niben101Scf04082) and NbGalT13_2 (Niben101Scf09597) may be encoded by nucleotide sequences represented by SEQ ID NOs: 81 and 82, respectively.
- the transgenic plant expresses beta 1,3-galactosyltransferase using a complex of sgRNA and CRISPR-associated proteins that complementarily bind to genes encoding NbGalT13_1 (Niben101Scf04082) and NbGalT13_2 (Niben101Scf09597). It may be designed to be suppressed.
- the sgRNA complementarily binding to the gene encoding NbGalT13_1 (Niben101Scf04082) and NbGalT13_2 (Niben101Scf09597) may include a nucleotide sequence represented by any one of SEQ ID NOs: 63 to 69.
- the portion targeted by the gRNA may be referred to in FIGS. 32A to 32C and Table 13.
- the plant may be derived from any one selected from the group consisting of tobacco, Arabidopsis, corn, rice, soybean, canola, alfalfa, sunflower, sorghum, wheat, cotton, peanut, tomato, potato, lettuce and pepper. Specifically, the plant may be tobacco.
- the transformed plant may have an expression vector containing a gene encoding a protein of interest additionally introduced.
- the gene encoding the target protein is a nucleotide sequence represented by SEQ ID NO: 3; And a nucleotide sequence represented by SEQ ID NO: 4.
- the expression vector is a vector capable of expressing a protein of interest in a host cell, and refers to a gene construct comprising essential regulatory elements operably linked so that a polynucleotide (gene) insert can be expressed.
- operably linked means that a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest are functionally linked to perform a general function, It means that the gene is linked so that the gene can be expressed by the expression control sequence.
- expression control sequence used in the present invention means a DNA sequence that controls the expression of a polynucleotide sequence operably linked in a specific host cell.
- regulatory sequences include promoters for carrying out transcription, any operator sequence for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, sequences regulating the termination of transcription and translation, initiation codon, stop codon, polyadenylation. It may include signals and enhancers.
- the expression control sequence and other essential elements for gene expression are preferably derived from a plant as a host or optimized for expression in a plant.
- a promoter of a plant gene or a plant as a host or a promoter of a gene expressible in a plant may be operably linked to a plant codon-optimized recombinant gene according to the present invention and inserted into an expression vector.
- the plant-derived promoter may be selected and used as long as it is commonly used in the art.
- ribulose-1,6-bisphosphate (RUBP) carboxylase small subunit (ssu) beta- Conglycinin promoter, paseolin promoter, ADH (alcohol dehydrogenase) promoter, shock promoter, ADF (actin depolymerization factor) promoter, tissue-specific promoter, and the like can be used without limitation.
- bacteria-derived octopine polymerase promoter, nopaline polymerase promoter, mannopain polymerase promoter, and the 35S and 19S promoters of cauliflower mosaic virus (CaMV) derived from virus can be used. .
- an additional expression control sequence such as an enhancer capable of increasing transcription efficiency may be additionally included.
- the promoter is a constitutive promoter that continuously expresses genes in all plant cells, or expresses genes only in specific plant tissues/organs or only at the time of development of a specific plant, or by specific stimulation or environment such as light or hormones. It may be an inducible promoter having
- An Agrobacterium binary vector may be used as an expression vector for expression in plants.
- the "binary vector” is obtained by separating the tumor inducible plasmid (Ti plasmid) into two plasmids, and the recombinant gene into the genome of the plant. It refers to a vector separated by a plasmid having a left border (LB) and a right border (RB) sequence required for migration and a plasmid encoding a protein required to transfer a recombinant gene.
- LB left border
- RB right border
- Another aspect of the present invention is a target protein having a modified sugar chain that does not contain any one residue selected from the group consisting of fucose, xylose, galactose, and combinations thereof. to provide.
- the target protein may be an antibody, and specifically trastuzumab.
- the trastuzumab may include a heavy chain consisting of an amino acid sequence represented by SEQ ID NO: 1 and a light chain consisting of an amino acid sequence represented by SEQ ID NO: 2.
- the modified sugar chain may not contain any one residue selected from the group consisting of fucose, xylose, galactose, and combinations thereof. Specifically, the modified sugar chain may not contain fucose.
- the modified sugar chain is fucose and xylose; It may not contain fucose and galactose.
- the modified sugar chain may not contain fucose, xylose, and galactose.
- the modified sugar chain may include 3, 7 or 8 mannose residues and 2 or 4 N-acetylglucosamine (GlcNAc) residues.
- the modified sugar chain , , , or It may be in the form, in this case, the Is mannose, above Is N-acetylglucosamine, wherein Is xylose.
- the target protein may be produced from a transgenic plant in which the expression of alpha 1,3-fucosyltransferase is suppressed.
- the transgenic plant in which the expression of the alpha 1,3-fucosyltransferase is suppressed is the same as described above in the transgenic plant.
- composition comprising a protein of interest (eg, trastuzumab) having a modified sugar chain as an active ingredient
- Another aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the target protein having the modified sugar chain as an active ingredient.
- the target protein having the modified sugar chain is the same as described above.
- the target protein may be produced from a transgenic plant in which the expression of alpha 1,3-fucosyltransferase is suppressed.
- the transgenic plant in which the expression of the alpha 1,3-fucosyltransferase is suppressed is the same as described above in the transgenic plant.
- the pharmaceutical composition contains 3, 5, 7 or 8 mannose residues and 2 or 4 N-acetylglucosamine (GlcNAc) residues.
- GlcNAc N-acetylglucosamine
- alpha 1,3-fucosyltransferase alpha 1,3 fucosyltransferase
- FucT13 may contain a protein of interest produced from a transgenic plant in which the expression is suppressed.
- the pharmaceutical composition contains 3, 5, 7, 8 or 9 mannose residues and 2 or 4 N-acetylglucosamine (GlcNAc) residues.
- GlcNAc N-acetylglucosamine residues.
- the amount of antibody without fucose and galactose residues is 95% or more, and alpha 1,3-fucosyltransferase (FucT13) and beta 1 ,3-galactosyltransferase (beta 1,3 galactosyltransferase, GalT13) may contain a target protein produced from a transgenic plant suppressed expression.
- the total amount of the antibody having a sugar chain in the form of a double antenna including 3, 5 or 8 mannose residues and 2 or 4 N-acetylglucosamine (GlcNAc) residues is 100%
- the amount of the antibody without fucose and xylose residues is 95% or more
- the amount of galactose in the sugar chain is 1% or less, alpha 1,3-fucosyltransferase (alpha 1).
- alpha 1,3-fucosyltransferase, FucT13) and beta 1,2-xylosyltransferase (beta 1,2 xylosyltransferase, XylT12) may contain a target protein produced from a transgenic plant suppressed expression.
- the cancer is gastric cancer, liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myelogenous leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer and lymphoma. It may be any one selected from the group.
- the pharmaceutical composition may further include a pharmaceutically acceptable carrier.
- binders, lubricants, disintegrating agents, excipients, solubilizing agents, dispersing agents, stabilizing agents, suspending agents, coloring agents, flavoring agents, etc. can be used.
- Stabilizers, etc. can be mixed and used, and in the case of topical administration, base agents, excipients, lubricants, preservatives, and the like can be used.
- the formulation of the pharmaceutical composition may be prepared in various ways by mixing with the pharmaceutically acceptable carrier described above.
- it when administered orally, it may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like, and in the case of injections, it may be prepared in the form of unit dosage ampoules or multiple dosage forms.
- the pharmaceutical composition may be administered in a pharmaceutically effective amount to treat cancer or their metastasis or to inhibit the growth of cancer. It may vary according to various factors such as cancer type, patient's age, weight, characteristics and degree of symptoms, type of current treatment, number of treatments, dosage form and route, and can be easily determined by experts in the field.
- the pharmaceutical composition may be administered together or sequentially with the pharmacological or physiological component described above, and may be administered in combination with an additional conventional therapeutic agent, and may be administered sequentially or simultaneously with the conventional therapeutic agent.
- Such administration can be single or multiple administrations. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all of the above factors, and this can be easily determined by a person skilled in the art.
- administration means introducing a predetermined substance to an individual by any suitable method, and the pharmaceutical composition may be administered through any route as long as it can reach the target tissue.
- administration methods include intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, or rectal administration, but are not limited thereto.
- intraperitoneal administration intravenous administration, intramuscular administration, subcutaneous administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, or rectal administration, but are not limited thereto.
- the active agent since the protein is digested, it may be desirable to coat the active agent or formulate the oral composition to protect it from degradation in the stomach.
- Another aspect of the present invention i) a nucleotide sequence represented by SEQ ID NO: 3; And introducing a gene including the nucleotide sequence represented by SEQ ID NO: 4 into a transgenic plant in which expression of the alpha 1,3-fucosyltransferase is suppressed. ii) cultivating the transformed plant; And iii) recovering trastuzumab from the cultivated transgenic plant.
- the transgenic plant is the same as described above.
- Step i) is a step of introducing an expression vector containing a gene encoding a target protein into a transgenic plant.
- the method of transforming the plant may use a plant transforming method known in the art without limitation. Those skilled in the art may select and carry out a known transformation method suitable for a specific plant in consideration of the characteristics of the plant selected as the host.
- the target protein may be an antibody, and specifically trastuzumab.
- Plant transformation methods include, for example, a method of fusion of a liposome containing an expression vector with a plant protoplast, a method of injecting an expression vector into a plant protoplast using PEG, a method of direct injection of an expression vector into a plant cell, Microparticle impact method, gene gun, electroporation method, transformation method using virus, transformation method using vacuum (vaccum infiltration method), floral meristem dipping method (floral meristem dipping method), etc. can be used.
- the method of transforming the plant may use a transformation method using Agrobacterium.
- The'transformation method using Agrobacterium' is a method of transferring foreign genes to plant cells using Agrobacterium, which is a Gram-negative bacterium in the soil that causes tumors in the roots and stems of plants.
- T-DNA (transfer DNA) of tumor-inducing plasmid (Ti plasmid) found in Agrobacterium such as Agrobacterium tumefaciens and Agrobacterium rhizogenes It is a method using the phenomenon of being inserted into the genome of plants.
- a binary plasmid or binary vector
- T-DNA containing an external gene (exogenous DNA) and T-DNA (LB and RB sequences located at both edges of the foreign gene)
- LB and RB sequences located at both edges of the foreign gene It is common to use a binary system consisting of two plasmids, a helper plasmid, which allows for insertion into the plant genome.
- the transformation method using Agrobacterium can be used for tissues of various plants such as leaves, stems, and roots, and young tissues tend to be well transformed.
- the recombinant protein may be transiently expressed or stably expressed.
- a part of a plant for example, a leaf of a plant, is transformed by infecting it with Agrobacterium containing a recombinant expression vector, and the infected part is obtained from the plant after a time for sufficient expression of the desired protein has passed. can do.
- transgenic plants For stable expression, cells or tissues of plants are cultured, infected with Agrobacterium, and transformed, followed by further culturing to select suitable transformants, undergo re-differentiation, and culture into transgenic plants having a complete structure. have. By obtaining and germinating seeds from the transgenic plant, a transgenic plant can be stably obtained even in the next generation.
- Step ii) is a step of cultivating the transformed plant.
- the step of cultivating the plant includes environmental conditions such as light, temperature, humidity, and water, inorganic salts, nutrients, and hormones required for the growth of the plant during the time when the plant is transformed and the protein is expressed in an amount suitable for the purpose. It means providing the necessary elements for plant growth.
- elements necessary for plant tissue culture such as water, nutrients, inorganic salts, and growth regulators, may be delivered through a culture media.
- elements necessary for plant tissue culture such as water, nutrients, inorganic salts, and growth regulators, may be delivered through a culture media.
- the EC-SOD according to the present invention when expressed in a plant using an inducible promoter, it can be cultivated while applying the corresponding stimulation required to activate the inducible promoter, for example, light, heat, or hormones.
- Step iii) is a step of obtaining a cultivated transgenic plant, and isolating and recovering a target protein therefrom.
- To obtain the plant means to obtain all or part of the plant that is transformed to overexpress the desired protein. It may be to obtain a transformed part such as a root, stem, leaf, etc. that overexpresses the target protein or a seed of a transformed plant, and a culture of plant cells or tissues, for example, callus or protoplast transformed with a recombinant gene And the like may be obtained.
- trastuzumab can be extracted by pulverizing and filtering the obtained transgenic plant.
- the target protein can be separated with high purity by filtration by a known method such as chromatography.
- pretreatment such as freezing and drying of the plant may be performed.
- the transformant tobacco overexpressing the protein of interest according to the present invention can be rapidly proliferated in large quantities to produce a target protein in large quantities.
- Another aspect of the present invention provides a method for preventing or treating cancer comprising administering to an individual a target protein having the modified sugar chain.
- the target protein may be an antibody, specifically, trastuzumab.
- the individual may be a mammal, including a human, and may be a non-human animal.
- non-human animal refers to all vertebrates, and may include non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, and other mammals and non-mammals. have.
- the individual refers to an individual suffering from a cancer disease or a state in which a disease can be alleviated, suppressed, or treated by administering trastuzumab having the modified sugar chain.
- the administration means introducing a predetermined substance to the individual by any suitable method, and the administration method and route of administration are the same as described above in the pharmaceutical composition.
- Another aspect of the present invention provides the use of a target protein having the modified sugar chain for preventing or treating cancer.
- the target protein may be an antibody, specifically, trastuzumab.
- Another aspect of the present invention provides the use of a target protein having the modified sugar chain for preparing a drug for preventing or treating cancer.
- the target protein may be an antibody, specifically, trastuzumab.
- the genomic DNAs of five NbFucT13 were analyzed by NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and Sol Genomics Network (https://solgenomics.net; (Fernandez-Pozo et al., 2015) ) Was blasted and identified in tobacco, followed by sequencing.
- NbFucT13_1 has a length of 7,280 bp containing 7 exons (black box) and 6 introns (white box), and is spliced to cDNA of 1,503 bp coding region and translated into 500 amino acids.
- NbFucT13_2 has a length of 7,728 bp including 7 exons and 6 introns, and is translated into 499 amino acids by splicing into cDNA of 1,500 bp coding region.
- NbFucT13_3 has a length of 6,600 bp comprising 7 exons and 6 introns, and is translated into 514 amino acids by splicing to cDNA of the coding region 1,545 bp.
- NbFucT13_4 has a length of 13,774 bp comprising 7 exons and 6 introns, and is translated into 514 amino acids by splicing to cDNA of the coding region 1,545 bp.
- NbFucT13_5 has a length of 2,312 bp including a single exon, and is transcribed into cDNA of a coding region 1,535 bp and translated into 509 amino acids.
- Introns black lines were preserved in NbFucT13_1 , NbFucT13_2 , NbFucT13_3 and NbFucT13_4 , but the introns were not present in NbFucT13_5 (FIG. 1).
- the phylogenetic tree with 5 NbFucT13, 5 LsFucT13, and 2 Arabidopsis FUT11 and FUT12 is shown in FIG. 2.
- Five NbFucT13a were distinguished from LsFucT13 and Arabidopsis FUT.
- Two NbFucT13_1 and NbFucT13_2 were grouped, and the remaining NbFucT13_3, NbFucT13_4, and NbFucT13_5 were grouped.
- the NbFucT13_1 protein had 88%, 77%, 78%, and 73% protein identity with NbFucT13_2, NbFucT13_3, NbFucT13_4, and NbFucT13_5, respectively.
- NbFucT13_2 had 71%, 72%, and 72% protein identity with NbFucT13_3, NbFucT13_4, and NbFucT13_5, respectively.
- NbFucT13_3 had 95% and 89% protein identity with NbFucT13_4 and NbFucT13_5, respectively.
- NbFucT13_4 and NbFucT13_5 each had 91% protein identity.
- Five NbFucT13 had 41% to 69% identity with five LsFucT13 proteins, and 60% to 67% identity with two Arabidopsis FUT proteins (see Table 1 below).
- a primer pair was designed to amplify the UTR regions, and 3 for, and NbFucT13_3 NbFucT13_4 to amplify the untranslated region (UTR), 5 to NbFucT13_1 and NbFucT13_2.
- UTR untranslated region
- primer pairs were designed to amplify on a single exon for NbFucT13_5. All primers were designed on gene specific regions representing each gene expression. For 5 NbFucT13 The designed primers are shown in Table 2 below.
- QIAzol Lysis Reagent Cat NO. 79306, QIAGEN
- RT-qPCR real-time quantitative PCR
- Quantitative PCR was carried out in a volume of 20 ⁇ l using the KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Cat NO. KK4601, KAPABiosystems) and 96- by StepOnePlusTM Real-Time PCR System Upgrade (Cat No. 4379216, Applied Biosystems). It was done in a well block. The reaction was run in duplicate for each run, and included at least two or more biological replicates. Absolute quantification was performed using a standard curve generated by amplification of serial dilutions of cDNA containing individual genes. The level of transcription of each gene in different samples was normalized to the internal control PP2A mRNA.
- NbFucT13 transcripts were universally present in roots, stems, leaves of 4 weeks old, leaves of 6 weeks old, and flowers (FIG. 3). At this time, it was based on the level of transcripts consistently expressed in different tissues without a pronounced expression pattern, and all five NbFucT13s were transcriptional activity.
- sgRNA target region which is the binding site of CRISPR/Cas9 RNP.
- sgRNA was designed so that three sgRNAs can knock out five NbFucT13 (FIG. 4).
- PFT1 sgRNA is targeted to exon 4 of the 5 NbFucT13, PFT1 of 20 bp completely match NbFucT13_1 and NbFucT13_2
- PFT1 is "C” in a "G” at the 20th upstream of PAM sequence of PFT1 target site in NbFucT13_3 and NbFucT13_4 one having a discrepancy, due to a single nucleotide polymorphism (SNP) in the red and in the "T” at the fifth and 20th upstream of PAM sequence of PFT1 target site in NbFucT13_5 a "C" to "G” in the "C” There are two discrepancies in the furnace (Fig. 4).
- SNP single nucleotide polymorphism
- PFT2 sgRNA is five is targeted to exon 5 of NbFucT13, PFT2 of 20 bp completely match NbFucT13_1 and NbFucT13_2 However, PFT2 from NbFucT13_3, NbFucT13_4, and the eighth and 18th upstream of PAM sequence of PTF2 target site in NbFucT13_5 " There are two mismatches, from T" to "A” and from "C” to "A".
- PFT3 sgRNA is targeted to exon 3 of the 5 NbFucT13, PFT3 of 20 bp completely match NbFucT13_1 and NbFucT13_2 However, PFT3 four to PFT3 target site in has five mismatches in PFT3 target site of NbFucT13_3 and NbFucT13_4, NbFucT13_5 Have inconsistencies.
- AFT1 and AFT2 target exon 1 of NbFucT13_1 (FIG. 5A )
- AFT3 and AFT4 target exon 1 of FucT13_2 (FIG. 5B )
- AFT5 and AFT6 target exon 1 of NbFucT13_3 , NbFucT13_4 , and NbFucT13_5 (FIG. 5c).
- All six sgRNAs were constructed with a tandemly arranged tRNA-target 20 bp-sgRNA scaffold system, and each row of tRNA-sgRNA was converted to another row of tRNA-sgRNA using a golden-gate cloning system. Combined.
- Six tandem repeats were placed under the AtU6 promoter (Figure 6).
- Example 4.1 Transformation of pET28a-SpCas9-BPNLS or pET28a-FnCpf1-BPNLS into BL21 receptor cells (competent cells)
- SpCas9 is Plasmid vectors, pET28a-SpCas9 ( S. pyogenic Cas9) and pET28a-FnCpf1 ( Franciella novicida Cpf1) were transferred to E. coli strain BL21 DE3 was transformed. Thereafter, when the strain was sufficiently cultured, the strain was crushed and purified using His6-tag. At this time, the expressionable plasmid vector includes an N-terminal His6-tag and a base sequence encoding the amino acid sequence 1 to 1368 of SpCas9.
- the prepared pET28a-SpCas9-BPNLS or pET28a-FnCpf1-BPNLS was chemically transformed into BL21 RosettaTM2 (DE3) pLysS (Novagen, Madison, WI) cells (Agilent, Santa Clara, CA) receiving the above prepared pET28a-SpCas9-BPNLS or pET28a-FnCpf1-BPNLS. 10 ng of plasmid DNA was treated in 50 ⁇ l of thawed recipient cells and incubated on ice for 30 minutes. Thereafter, the cells were cultured at 42° C.
- the cell culture solution was placed in a 500 ml tube and centrifuged for 30 minutes at 4,000 rpm. The supernatant was removed, and 25 ml of lysis buffer (20 mM Tris-HCl (pH 8.0), 0.5 NaCl, 5 mM imidazole, 1 mM 1,4-dithiothreitol (DTT)) per cell pellet in 1 L of cell culture. ), and 1 mM phenylmethylsulfonyl fluoride (PMSF)) were used to resuspend the cell pellet. The resuspended cell pellet was further purified and used immediately, or rapidly cooled in liquid nitrogen and stored at -80°C until the SpCas9 or FnCpf1 purification process.
- lysis buffer 20 mM Tris-HCl (pH 8.0), 0.5 NaCl, 5 mM imidazole, 1 mM 1,4-dithiothreitol (DTT)
- DTT
- the resuspended cell pellet was lysed using an ultrasonic disperser. At this time, the cell suspension was pulverized 3 to 4 times for 1 minute with an amplitude of 40% in an ultrasonic disperser, so that the cells were completely lysed. The cell suspension was lysed on ice, and the lysate was stored on ice.
- the lysate was centrifuged for 60 minutes at a temperature of 4° C. and 15,000 rpm ( ⁇ 30,000 ⁇ g) in a 50 ml Nalgene Oak Ridge tube. Thereafter, the supernatant was collected, filtered through two connected syringe filters of 1 ⁇ m and 0.45 ⁇ m, and the filtrate was collected.
- a binding buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, and 1 mM DTT) was prepared.
- an elution buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM imidazole, and 1 mM DTT) was prepared. Purified by Histrap-HP affinity column.
- a 50 ml syringe was connected to the Histrap-HP column.
- the Histrap-HP column was washed with 10 column volumes of distilled water.
- the Histrap-HP column was equilibrated with 10 column volumes of binding buffer.
- the flow rate and FPLC flow rate (5 ml/min) were adjusted by pressing the syringe piston.
- the flow rate and FPLC flow rate (5 ml/min) were adjusted by pressing the syringe piston. The flow-through was collected to observe the loss of His-protein. Replaced with a new 50 ml syringe, which was connected to a Histrap-HP column. The column was washed with 10 column volumes of binding buffer. Replaced with a new 50 ml syringe, which was connected to a Histrap-HP column. Five column volumes of elution buffer were added. Fractionation was performed for every 5 ml of eluent. Replaced with a new 50 ml syringe, which was connected to a Histrap-HP column. The column was washed with 10 column volumes of binding buffer.
- the eluted SpCas9 or FnCpf1 protein was concentrated using a 30 kDa Amicon (Millipore), and the concentration required for the experiment was reached. At this time, SpCas9 or FnCpf1 protein may be concentrated to 3 mg/ml to 7 mg/ml without precipitation. The concentration was determined based on the assumption that 1 mg/ml has an absorbance of 0.76 at a wavelength of 280 nm (based on the calculated extinction coefficient of 120,450/Mcm).
- a gene-specific oligonucleotide containing a T7 (5'-TAATACGACTCACTATA-3') promoter sequence, a target site of 20 bases without PAM, and a complementary region was used to reverse the tracrRNA tail -Annealed to a constant oligonucleotide encoding the complement.
- the ssDNA overhang was filled with T4 DNA polymerase (M0203S, NEB), and the resulting sgRNA template was purified using a QIAquick PCR purification kit (28104, QIAGEN).
- sgRNA was transcribed using the MEGAshortscriptTM T7 Transcription Kit (A1335, ThermoFisher). Subsequently, all sgRNAs were treated with DNase and MEGAclearTM Transcription Clean-Up Kit (A1908, ThermoFisher). RNA concentration was quantified using Microplate Reader System (FLUOstar Omega, BMG LABTECH).
- SpCas9 can be programmed into a chimeric sgRNA in which an essential part of a crRNA and a tracrRNA molecule within a single oligonucleotide chain is bound (Jinek et al., 2012).
- the resulting sgRNA contained a 20-mer target specific sequence having a T7 polymerase binding site upstream thereof and a Cas9 protein binding site downstream thereof.
- the design of the gene-specific targeting sequence was performed using the web tool CHOPCHOP (http://chopchop.cbu.uib.no).
- the sgRNA was designed to target within the coding region without any mismatch, and the sequence preferably contained GG at the 5'-end.
- the crRNA guide consists of a 5'-end 20-nt spacer sequence followed by an invariant 76-nt guide RNA scaffold at the 3'-end (5'-XXXXXXXXXXXXXXXXXXX-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGGCCGTTATCAACTTGAAAAAGTGGCACCGAGTCTCGTTATCAACTTGAAAAAGTGGCACCGAGTC ').
- a target-specific sgRNA sequence was synthesized with a 17-mer T7 promoter region at its 5'-end and a 23-mer gRNA scaffold annealing region at its 3'-end, and the total length of the oligonucleotide was 60-mer. I made it possible.
- an 80-mer gRNA scaffold sequence was also synthesized separately. Then, the 60-mer and 80-mer oligonucleotides were annealed together using a thermocycler, and the finished dsDNA was synthesized using T4 DNA polymerase and annealed dimerized oligonucleotides as templates.
- a plasmid containing a T7 promoter and a guide RNA scaffold was constructed. Cloning only the 20 bp double-stranded oligonucleotide of the target in the center of the two Bsa I sites (A ⁇ TAGGTGAGACCGCAGGTCTCG ⁇ GTTTT) located between the T7 promoter and the guide RNA scaffold by two BsaI type IIS restriction enzymes by Golden Gate cloning method. I did. Forward single oligonucleotides must contain a 5'-TAGG-3' overhang in front of the target 20 nt, and reverse single nucleotides must start with 5'-CAAA-3' in front of the reverse target 20 nt.
- Both 1 picomolar forward and reverse single oligonucleotides were mixed in 45 ⁇ l of distilled water, transferred to a 0.2 ml PCR tube, and annealing at 95°C for 5 minutes and 55°C for 10 minutes by thermocycler. ), and the annealed oligonucleotide was placed on ice.
- a dimerized oligonucleotide was used to clone into a linear plasmid having two flanking sequences, 5-CCTA-3' and 5'-GTTT-3'.
- the finished construct was used as a template to synthesize sgRNA.
- a plasmid containing a T7 promoter and a guide RNA scaffold was constructed.
- the 20 bp double-stranded oligonucleotide of the target was cloned at the end of the guide RNA scaffold by two BsaI type IIS restriction enzymes.
- the forward single oligonucleotide should include a 5'-AGAT-3' overhang in front of the target 20 nt, and the reverse single nucleotide should start with 5'-AAAA-3' in front of the reverse target 20 nt.
- Both 1 picomolar of forward and reverse single oligonucleotides were mixed in 45 ⁇ l of distilled water, transferred to a 0.2 ml PCR tube, and annealed by a thermocycler at 95° C. for 5 minutes and 55° C. for 10 minutes, Annealed double-stranded oligonucleotides (dsODN) were placed on ice.
- dsODN Annealed double-stranded oligonucleotides
- a dimerized oligonucleotide was used to clone into a linear plasmid having two flanking sequences, 5'-ATCT-3' and 5'-TTTT-3'.
- the finished construct was used as a template to synthesize sgRNA.
- Two 63 nt single stranded oligonucleotides were synthesized consisting of a 5 nt overhang, a 19 nt T7 promoter, and a 20 nt target spacer sequence in front of the T7 promoter. Both 10 ⁇ l of 200 nmol forward and reverse single oligonucleotides were mixed, and 20 ⁇ l of the mixture was transferred to a 0.2 ml PCR tube, annealed by a thermocycler at 95° C. for 5 minutes and 55° C. for 10 minutes. , The annealed dsODN was placed on ice.
- Example 5.6 Amplification of dsDNA template for sgRNA by PCR amplification
- PCR primers suitable for the transcription template for sgRNA synthesis forward primer is 5′-AATTCTAATACGACTCACTATAGG-3′, which contains an additional 5 AATTC in front of the T7 promoter sequence, and the reverse primer is sgRNA scaffold 5′-GCACCGACTCGGTGCCACTT-3′. At the end of) can be used for PCR amplification from a plasmid or a synthetic oligonucleotide template. A large amount of dsDNA template was simply obtained by performing PCR. Q5® polymerase was used to amplify the transcription template.
- PCR amplification product was subjected to DNA electrophoresis to predict the concentration, and the amplification product size was confirmed before use in T7 RNA transcription synthesis. At this time, the PCR mixture can be used immediately when diluted to at least 10X in the transcription reaction. However, the yield is better to use the purified PCR amplification product.
- PCR amplifications can be purified according to the protocol for commercial clean-up kit instructions. The PCR conditions are shown in Tables 3 and 4 below.
- Gloves and nuclease-free tubes and reagents were used to avoid RNase contamination.
- the reaction is typically 20 ⁇ l, but can be increased as needed. Reactions were constructed in nuclease-free microcentrifuge tubes or PCR strip tubes.
- the components of the MEGA short script T7 transcription kit or HiScribeTM T7 High Yield RNA synthesis kit were thawed and mixed, and the solution was collected at the bottom of the tube by pulse-spinning in microcentrifugation, and then placed on ice.
- a PCR reaction solution was prepared under the conditions described in Table 5 below.
- the PCR reaction solution was thoroughly mixed and pulse-spinned in a microcentrifuge. Incubation was performed for 4 hours or more (O/N possible) at 37°C for maximum yield. At this time, it is safe to incubate the reaction for 16 hours.
- the amount of sgRNA can be sufficiently synthesized within 4 hours, and incubated in a thermocycler to prevent evaporation of the sample.
- 20 ⁇ l of nuclease-free water was added to each 20 ⁇ l reaction, followed by 2 ⁇ l of DNase I (no RNase), and 37 Incubated for 15 minutes at °C temperature.
- the transcription product was purified through the MEGAclean-up kit.
- the purified product was transferred to a new 1.5 ml tube and 100 ⁇ l of the elution solution was added. Then, 350 ⁇ l of the binding solution concentrate was added to the sample. Mixing by pipetting, 250 ⁇ l of 100% ethanol was added to the sample and mixed by pipetting. According to the manual of the MEGAclean-up kit, the mixed sample was transferred to a spin-down column/2 ml. Centrifugation was performed for 1 minute at 12,000 rpm. The spin-down solution was removed, 500 ⁇ l of the washing solution was added, and then centrifuged again at 12,000 rpm for 1 minute.
- the spin-down solution was removed, and 500 ⁇ l of the washing solution was added, followed by centrifugation at 12,000 rpm for 1 minute.
- the spin-down solution was removed, and the spin-column/2 ml tube was centrifuged for 1 minute at 12,000 rpm. Only the spin-column was transferred to a new 1.5 ml tube.
- 50 ⁇ l of water was added to each spin-column/1.5 ml tube.
- the spin-column/1.5 ml tube was reacted on a heat-block at a temperature of 70° C. for 10 minutes. After 10 minutes, the spin-column/1.5 ml tube was centrifuged for 1 minute at 12,000 rpm.
- 50 [mu]l of water was additionally added to each spin-column/1.5 ml tube. The concentration of sgRNA was measured in the spin-down solution.
- the transcription product was purified by ethanol precipitation. Ethanol precipitation can be applied to sgRNA enrichment as well as to small RNAs less than 100 nt.
- the FnCpf1 crRNA size is 66 nt, much smaller than 100 nt, which is the minimum size to use the MEGAclean-up kit.
- 1/10 volume of 3M sodium acetate of the PCR amplification product was added to the PCR amplification product, and the sample was inverted and mixed gently. 100% ethanol was added to each sample tube. The sample tube was incubated for 30 minutes at -20°C temperature. The precipitated sgRNA was centrifuged for 10 minutes at a temperature of 4°C and 14,000 rpm (16,900 ⁇ g).
- RNA concentration was determined by measuring ultraviolet absorbance at a wavelength of 260 nm.
- Protoplasts emerged from the 5th to 8th leaves of 4 weeks of age of the in vitro plantlet. After CRISPR/Cas9 transfection, protoplasts were fixed on low-melting agar medium. The fixed protoplasts reproduced on the 5th day after embedding to form microcallus (Fig. 7; a). Microcallus was subcultured in 1/2 B5 medium containing 2,4-D and BAP plant hormone (FIG. 7; b to d). At 3 months after embedding, 17 green shoots appeared on the surface of 39 calli (Fig. 7; e). Seventeen green shoots turned into plantlets at 4 months after embedding, and 17 plantlets took root in 1/2 MS medium without plant hormones at 5 months after embedding (FIG. 7; f). It was tested whether 17 news objects contained the edited NbFucT13 gene.
- the knockout construct included an antibiotic resistance gene cassette, a Cas9 cassette, and a tandem polycistronic tRNA-gRNA cassette for positive selection for kanamycin and hygromycin.
- the human codon optimized Cas9 gene was cloned into the pCAMBIA1300 plasmid to allow the Cas9 protein to be expressed.
- AtUbi Arabidopsis thaliana ubiquitin 10
- promoter was used to induce hCas9 expression in tobacco.
- a bipartite (KRPAATKKAGQAKKKK) nuclear localization signal was added to the amino and carboxyl ends of the hCas9 open reading frame, respectively.
- gRNAs were inserted into pCAMBIA-Cas9, and gRNAs were A. thaliana U6 promoter.
- the gRNA was designed to target the N.benthamiana genes NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4 and NbFucT13_5.
- Tobacco Nicotiana benthamiana seeds were sterilized in 0.4% hypochlorite solution for 1 minute, washed three times with distilled water, and sprinkled on 0.5 ⁇ Gamborg B5 solid medium supplemented with 2% sucrose. Four-week-old leaves grown in B5 medium were subjected to an enzyme (1.5% cellulose R10, 0.3% macerozyme R10, 0.5 M mannitol, 8 mM CaCl 2 , 5 mM MES [pH 5.7], 0.1% BSA) at 25°C for 4 hours. Reacted in a dark place.
- an enzyme (1.5% cellulose R10, 0.3% macerozyme R10, 0.5 M mannitol, 8 mM CaCl 2 , 5 mM MES [pH 5.7], 0.1% BSA
- the mixture was filtered before collecting the protoplasts by centrifugation at 100 ⁇ g for 6 minutes in a round bottom tube.
- the resuspended protoplasts were washed with a solution of W5 (154 mM NaCl, 125 mM CaCl 2 2H 2 O, 5 mM KCI, 2 mM MES [pH5.7]), and centrifuged at 100 ⁇ g for 6 minutes to pelletize.
- W5 154 mM NaCl, 125 mM CaCl 2 2H 2 O, 5 mM KCI, 2 mM MES [pH5.7]
- MMG 0.4 M mannitol, 15 mM MgCl 2 , 4 mM MES [pH 5.7]
- Protoplasts were diluted to a density of 1 ⁇ 10 6 protoplasts/ml of MMG solution and stabilized at 4° C. for at least 30 minutes prior to PEG-mediated transfection.
- 2 ⁇ 10 5 protoplast cells were transfected with Cas9 protein (10 ⁇ g) premixed with in vitro-transcribed sgRNA (20 ⁇ g). Before transfection, Cas9 protein was mixed with sgRNA in 1 ⁇ NEB buffer 3 and incubated for 10 minutes at room temperature. Protoplast mixture resuspended in 200 ⁇ l MMG solution was mixed with 10 ⁇ l to 20 ⁇ l of RNP complex and 210 ⁇ l to 220 ⁇ l of the prepared PEG (0.2M mannitol, 40% w/v PEG-4000, 100 mM CaCl 2 ) solution and Mixed and incubated for 15 minutes at 25 °C temperature.
- Cas9 protein 10 ⁇ g
- sgRNA in 1 ⁇ NEB buffer 3
- Protoplast mixture resuspended in 200 ⁇ l MMG solution was mixed with 10 ⁇ l to 20 ⁇ l of RNP complex and 210 ⁇ l to 220 ⁇ l of the prepared PEG (0.2M mannito
- RNP-transfected cells were resuspended in PIM medium.
- the cells were mixed with a 1:1 solution of PIM medium and 2.4% agarose to obtain a culture density of 2.5x10 5 cells/ml.
- Protoplasts embedded in agarose were plated on a 6-well plate, 1 ml of a liquid PIM culture medium was laid, and cultured at 25°C. After 7 days, the liquid medium was replaced with a fresh culture medium.
- the culture was transferred to light (14 h light [50 ⁇ mol m -2 s -1 ] and 10 h dark) and incubated at 25°C.
- micro-callus grown to a diameter of several tens of millimeters was supplemented with 30 g/L sucrose, 0.6% plant agar, 0.2 mg/L ⁇ -naphthaleneacetic acid (NAA), and 0.3 mg/L BAP. Transfer to regeneration medium. Induction of multiple shoots was observed after about 4 weeks in regeneration medium.
- a 1 cm square leaf explant co-cultured with Agrobacterium was used for the Agrobacterium-mediated genome editing method (FIG. 8; a).
- the co-cultured explants were subcultured under 25 mg/L hygromycin for 6 weeks through two or three agar plate replacements, and then new shoots were generated (Fig. 8; b).
- New shoots were transferred to half-strength MS medium and grown in a container as a seed body (Fig. 8; c).
- the newsletter was transferred to the pot and kept until the seeds were harvested (Fig. 8; d).
- the square leaves were selected as induction medium (1X Murashige and Skoog basic salt mixture, 3% sucrose, 2.0 mg/l BAP, 0.2 mg/l NAA, 1% (w/v) plant agar, 25 mg/l. Hygromycin, 200 mg/L thymentin, pH 5.8).
- the callus tissue was transferred to the selection induction medium. Cut shoots from callus and root induction medium (1X Murashige and Skoog basic salt mixture, 3% sucrose, 1% (w/v) plant agar, 25 mg/L hygromycin, 200 mg/L thymentin® sterile tica Cylindrical disodium and clavuloate potassium, pH 5.8).
- Transgenic plants with roots were transferred to the soil. After 6 to 7 weeks, seeds were collected from the transgenic plants. At this time, all plants were grown under 150Em -2 s -1 LED light at 25°C under long-day (14-h light/10-h dark photoperiod) conditions.
- NbFucT13s Five NbFucT13s have highly conserved coding regions, so there were difficulties when designing primers to amplify specific regions before monitoring the effect of NbFucT13 editing. Gene-specific primers were designed to amplify each gene, including the target sgRNA site and sufficient SNPs, making it possible to differentiate between five NbFucT13s (Table 6).
- the gene-specific primer pairs were amplified 2,978 bp, 3,434 bp, 4,393 bp, 1,028 bp, and 1,664 bp, respectively, for NbFucT13_1, NbFucT13_2 , NbFucT13_3 , NbFucT13_4 , and NbFucT13_5. 9).
- the PCR amplification product showed a multi-sized amplification product at #37 of NbFucT13_1; It showed the sizes of the multiple amplicons from # 10, # 33 and # 36 exhibited the NbFucT13_2 amplicons of a smaller size from # 37 of NbFucT13_2 (Fig. 9).
- the gene-specific primer pairs amplified 774 bp, 760 bp, 411 bp, 461 bp, and 1,664 bp, respectively, for NbFucT13_1, NbFucT13_2 , NbFucT13_3 , NbFucT13_4 , and NbFucT13_5.
- PCR amplification products showed multi-sized amplification products #101 to #116 in 16 transformation lines (FIG. 10).
- the PCR amplified product amplified from genomic DNA using Q5 Hot Start High-Fidelity 2x Master Mix (NewEngland Biolabs) of a plant transformed by Agrobacterium-mediated genome editing method All in one Cloning Kit (Biofact, South Korea) was cloned into the TA vector. For each PCR amplification, 15 positive colonies of the cloned TA vector were sequenced.
- line #8 included triple KO for NbFucT13_1, NbFucT13_2 , and NbFucT13_3 and heterozygous for NbFucT13_4 (FIG. 11).
- Line #10 contained a single KO for NbFucT13_2 and three heterozygotes for NbFucT13_1 , NbFucT13_3, and NbFucT13_4 (FIG. 12 ).
- Line #27 contained a single KO for NbFucT13_3 and a heterozygous for NbFucT13_2 (FIG. 13 ).
- Line #33 is the double KO for NbFucT13_1 and NbFucT13_2 And two heteroconjugates for NbFucT13_3 and NbFucT13_4.
- Line #36 had the same results as line #10.
- Line #37 had triple KO for NbFucT13_1, NbFucT13_2 , and NbFucT13_3 and heterozygous for NbFucT13_4 (Table 4).
- grid # 27-4 has had a single KO for NbFucT13_3, strain # 27-21 had a KO of 2 for NbFucT13_2 and NbFucT13_3.
- Line #10-15 had a double KO for NbFucT13_1 and NbFucT13_2 and line #10-8 had a triple KO for NbFucT13_1, NbFucT13_2 , and NbFucT13_4 .
- Lines #37-26 had quadruple KOs for NbFucT13_1, NbFucT13_2 , NbFucT13_3 and NbFucT13_4 (Table 7).
- line #37-26 included four edited genes for NBFucT13_1 , NBFucT13_2 , NBFucT13_3 , and NBFucT13_4.
- NBFucT13_1 has a biallelic mutation of -709/+1, +1/+1; NBFucT13_2 is -2/-592; There is a double allelic mutation of -1/-593; NBFucT13_3 has +1, -9 double allelic mutations; NBFucT13_4 has +1, +1 double allelic mutations;
- NbFucT13_5 has no mutations; This is shown in Figure 14.
- the 16 T1 transformed lines #101 to #116 were genetically edited by an Agrobacterium-mediated genome editing method (Table 8 and FIGS. 15 to 19).
- Grid # 101 had a three heterozygous for from 2 to NbFucT13_1 and NbFucT13_5 KO and NbFucT13_2, NbFucT13_3 and NbFucT13_4.
- Line #102 had quadruple KOs for NbFucT13_1, NbFucT13_2, NbFucT13_3 , NbFucT13_4 and NbFucT13_5 .
- System # 4 had a three heterozygous for a single KO and NbFucT13_2, NbFucT13_3 and ⁇ 5 for NbFucT13_1.
- Line #107 had triple KO for NbFucT13_1, NbFucT13_3 and NbFucT13_5 and two heterozygotes for NbFucT13_2 and NbFucT13_4.
- Line #108 had a quadruple KO for NbFucT13_1, NbFucT13_2 , NbFucT13_3 and NbFucT13_4 and one heterozygous for NbFucT13_4.
- Grid # 109 had a three heterozygous for from 2 to NbFucT13_1 and NbFucT13_2 KO and NbFucT13_3, NbFucT13_4 and NbFucT13_5.
- Line #111 had quadruple KOs for NbFucT13_1, NbFucT13_2, NbFucT13_3 , NbFucT13_4 and NbFucT13_5 .
- Line #112 had quadruple KOs for NbFucT13_1, NbFucT13_3, NbFucT13_4 and NbFucT13_5 and one heterozygous for NbFucT13_2.
- Line #113 had triple KO for NbFucT13_1, NbFucT13_4 and NbFucT13_5 and two heterozygotes for NbFucT13_2 and NbFucT13_3.
- Grid # 114 had a three heterozygous for from 2 to NbFucT13_1 and NbFucT13_3 KO and NbFucT13_2, NbFucT13_4 and 5.
- Line #15 had a double KO for NbFucT13_4 and 5 and three heterozygotes for NbFucT13_1 , NbFucT13_2 and NbFucT13_3.
- Line #116 had a single KO to NbFucT13_1 and 4 heterozygotes to NbFucT13_2 , NbFucT13_3 , NbFucT13_4 and NbFucT13_5.
- sgRNAs were transfected at once into tobacco protoplasts by a DNA-free genome editing method. Each sgRNA showed different genome editing efficiencies based on Sanger-sequencing (Table 9).
- PFT1 is in NbFucT13_1 , NbFucT13_2 , NbFucT13_3 , NbFucT13_4 , and NbFucT13_5 , respectively It had editing efficiencies of 29%, 37%, 22%, 9%, and 0%.
- PFT2 had an editing efficiency of 17%, 14%, 11%, 7%, and 0% in NbFucT13_1 , NbFucT13_2 , NbFucT13_3 , NbFucT13_4 , and NbFucT13_5, respectively.
- PFT3 had an editing efficiency of 12%, 22%, 0%, 0%, and 0% in NbFucT13_1 , NbFucT13_2 , NbFucT13_3 , NbFucT13_4 , and NbFucT13_5, respectively.
- PFT1 showed the highest genome editing efficiency among the three sgRNAs, and 19 bp matching with 1 bp mismatch at the 20th of the spacers of NbFucT13_3 and NbFucT13_4 showed editing efficiency of 22% and 9%, but among the spacers of NbFucT13_5 From the 5th and 20th A match of 18 bp with a mismatch of 2 bp showed an efficiency of 0%.
- AFT1 and AFT2 exhibited 80% and 27% editing efficiency only in NbFucT13_1.
- AFT3 showed 8% and 37% editing efficiency in NbFucT13_1 and NbFucT13_2, respectively.
- AFT4 showed editing efficiency of 25% and 26% in NbFucT13_1 and NbFucT13_2, respectively.
- AFT5 showed editing efficiency of 46%, 42%, and 72% in NbFucT13_3, NbFucT13_4, and NbFucT13_5, respectively.
- AFT6 showed editing efficiency of 58%, 44%, and 71% in NbFucT13_3, NbFucT13_4, and NbFucT13_5, respectively.
- the NbFucT13_1 gene showed 28% gene editing at 24 hours
- the NbFucT13_3 gene showed 42% gene editing at 48 hours
- the NbFucT13_4 gene showed 20% gene editing at 72 hours.
- the overall gene editing efficiency is 20% to 30%. It was confirmed that the currently used target sgRNA can exhibit gene editing effects in vivo, that is, in vivo.
- the N -glycan profile of the total protein was determined by matrix-assisted laser desorption ionization (MALDI)-time-of-flight (TOF) mass spectrometry (MS). Specifically, the frozen leaves of the Nb wt plant and the NbFT KO plant (#37) were pulverized using a mortar and pestle. Two volumes of phosphate buffered saline solution (GE Healthcare Life Sciences, USA) were added to the powder and mixed for 10 minutes with repeated stirring. Then, the mixture was centrifuged at 4° C. for 20 minutes, and the supernatant was recovered.
- MALDI matrix-assisted laser desorption ionization
- TOF time-of-flight
- the supernatant was filtered using a Minisart RC4 syringe filter (0.45 ⁇ m, Sartorius Stedim Lab Ltd, UK) and concentrated using a VIVASPIN 500 concentrator (30 kDa, PES, Sartorius Stedim Lab Ltd, UK). The amount of total soluble protein in the filtrate was determined by Bradford analysis.
- N-glycan 50 ⁇ g of TSP was reacted with PNGase A (10 U, NEB, USA) at 37°C for 16 hours.
- the released N-glycan was extracted as follows using an Extract-Clean SPE cartridge (S* Pure Pte Ltd., Singapore): The cartridge was extracted as follows: 10 ml of Solution I (80% acetonitrile, 0.1% trifluoroacetic acid). ) And washed with 10 ml of water.
- the N-glycan mixture was loaded onto the cartridge, washed with 10 ml of water and eluted with 1 ml of solution II (25% acetonitrile, 0.075% trifluoroacetic acid).
- the eluted N-glycan was dried using a high speed vacuum (HyperVAC-MAX, Labex, South Korea).
- the dried N-glycan was labeled with 2-aminobenzamide (2-AB, Sigma-Aldrich, USA) at 65° C. for 3 hours, and the labeled N-glycan was bonded to the Bond Elut-CN cartridge (Agilent technologies, USA). USA) was used as follows: the cartridge was activated with 1 ml of Solution I (25% acetonitrile) and washed with 1 ml of Solution II (96% acetonitrile). The labeled N-glycan was loaded onto the cartridge, washed with 2 ml of solution II, and eluted with solution III (60% acetonitrile).
- the eluted N-glycans were dried using high-speed vacuum, dissolved in water, and analyzed by MALDI-TOF mass spectrometer (ultraflex III, Bruker Daltonics, Germany) using a positive reflectron mode.
- MALDI-TOF mass spectrometer ultraflex III, Bruker Daltonics, Germany
- 2-AB and trifluoroacetic acid were purchased from Sigma-Aldrich (USA), respectively.
- trastuzumab/Nbwt and trastuzumab/#37 were examined for drug efficacy using trastuzumab as a positive control by an antibody-dependent cell-mediated cytotoxicity (ADCC) assay.
- ADCC antibody-dependent cell-mediated cytotoxicity
- the day before the analysis the target cell (T), SKBR3 cancer cell line (ATCC), was 1 ⁇ 10 4 cells/100 ⁇ l/well, considering the number of samples required, and a 96-well plate (SPL, South Korea). Was busy.
- FBS may affect the analysis
- low IgG FBS was used, and hygromycin and G418 antibiotics were not used because they could kill the SKBR3 cancer cell line.
- trastuzumab for Jurkat T cells (Herceptin, Avastin; Roche, Switzerland), trastuzumab and NbFT KO plants isolated from Nbwt in Example 11 (# 37), starting from 10 ⁇ g/ml of trastuzumab, serially diluted 15:1 (1.5 ⁇ 10 6 /ml: effector cells, 1 ⁇ 10 5 /ml: target cells; final volume: 100 ⁇ l) was added.
- the medium of the SKBR3 cancer cell line in the 96-well plate was removed, and the total volume of jurkat T cells and each of the trastuzumab was 100 ⁇ l, and then added to the SKBR3 cancer cell line.
- Bio-GloTM luciferase reagent Promega, USA
- 70 ⁇ l of Bio-GloTM luciferase reagent was added to each well, and luminescence using a FLUO star Omega Plate counter (PerkinElmer, USA) was expressed in relative luciferase units (RLU).
- the concentration value of IC 50 was calculated using the GraphPAD PRISM program.
- the IC 50s for Trastuzumab, Trastuzumab/Nbwt, and Trastuzumab/#37 were 4 ng/ml, 11 ng/ml, and 1 ng/ml. It was confirmed that the purified trastuzumab/#37 exhibited a higher antibody-dependent cytotoxic effect than other trastuzumabs in the ADCC assay (FIG. 23).
- Genes corresponding to SEQ ID NOs: 3 and 4 are codon-optimized base sequences to improve the expression of heterologous proteins in plants, and codon-optimized through the following method.
- the codon usage for the base sequence mechanically obtained from the amino acid sequence of trastuzumab including the heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 1 and the light chain consisting of the amino acid sequence shown in SEQ ID NO: 2, and the codon frequency for each amino acid are CAIcal SERVER. It was analyzed using. Thereafter, codon analysis was performed on the reference genes of Arabidopsis thaliana and tobacco, which are representative model plants of plants, and the result was compared with the analysis result of trastuzumab to optimize each codon so as to be similar to the codon analysis result of the reference.
- codons encoding one amino acid the sequence was optimized in consideration of the GC content and the rare codon frequency for codons that are biased in the gene. Finally, after checking whether there is a restriction enzyme recognition site to be used during plasmid recombination, it was confirmed that the codon was modified and the entire amino acid sequence was not changed.
- the nucleotide sequence of the codon-optimized gene was requested to be synthesized by IDT (Integrated DNA Technologies, Inc.) to obtain a plasmid recombined into a basic cloning vector.
- the synthesized plasmid was added with a Bsa I restriction enzyme, and only the heavy chain gene (SEQ ID NO: 3) and light chain gene (SEQ ID NO: 4) of trastuzumab were extracted by agarose gel. Each gene segment was ligated to a plant expression vector (pICH31070, pICH31180) cut with Bsa I using T4 ligase.
- Each expression vector (pICH31070, pICH31180) having the heavy chain gene (SEQ ID NO: 3) and the light chain gene (SEQ ID NO: 4) of trastuzumab was transformed into Agrobacterium cells (GV3101), respectively, and then medium (YEP agar plate) It was smeared on and incubated for about 2 days at a temperature of 28°C. Thereafter, the resulting single colony was inoculated into a liquid medium (YEP broth) and pre-cultured for about 2 days at a temperature of 28° C. and 200 rpm. The pre-culture was inoculated at a ratio of 0.5% of the amount of the new liquid medium, and cultured at a temperature of 28° C. at 200 rpm until an O.D. value of 1.2 to 1.8.
- the shake-cultured transformed Agrobacteria were diluted to an OD value of 0.02 by adding a buffer solution for impregnation (10 mM MES, pH 5.6, 10 mM MgSO 4 ).
- Diluted transgenic Agrobacteria including heavy and light chains were mixed in a ratio of 1:1, and tobacco leaves were immersed in this mixture in a vacuum chamber. After applying a vacuum to the vacuum chamber and reaching the target pressure, the pressure was released, and the tobacco leaves were removed and dried. Thereafter, the dried tobacco leaves were placed in a dedicated culture chamber at a temperature of 24° C. and a relative humidity of 41%. After 7 days of infiltration, the tissue was recovered and the amount of expressed protein was confirmed.
- the recovered plant was frozen with liquid nitrogen and then crushed with a glass rod. Thereafter, a buffer solution for protein extraction (50 mM Sodium phosphate, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.1% (v/v) Triton X-100) was added and mixed, and allowed to stand at 4°C for 10 minutes. The supernatant was recovered by centrifugation for 10 minutes at a temperature of 4°C and 13,000 rpm.
- a buffer solution for protein extraction 50 mM Sodium phosphate, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.1% (v/v) Triton X-100
- PH and TH represent a PVX vector:: trastuzumab HC- TMV vector:: trastuzumab LC pair and a TMV vector:: trastuzumab HC- PVX vector:: trastuzumab LC pair, respectively.
- the expression amount of trastuzumab increased by 2.5 times or more compared to the control group.
- the amount of expression increased from 7 to 17 times.
- the amount of expression of trastuzumab was less than that of the control group.
- trastuzumab produced from transformed plant cells 50 ⁇ g was reacted in a denaturation buffer (0.1% RapiGest, 5 mM DTT, 20 mM IAA) for 1 hour.
- Recombinant PNGase A peptide N-glycosidase A; 5,000 units/ml, New England BioLabs 10 units expressed in Pichia pastoris was added, and the mixture was incubated for 16 hours in an incubator at 37°C.
- the sugar chain-containing sample separated by PNGase A was purified with graphite-treated carbon cartridge SPE (Extract-clean SPE carbo; filling amount 150 mg, cartridge volume 4 ml). After activation with 10 ml of 80% (v/v) acetonitrile (ACN) containing 0.1% trifluoroacetic acid (TFA), it was washed with 10 ml of ultrapure water. After the sugar chain-containing sample was flowed and adsorbed, the salt was removed by flowing ultrapure water several times the volume of the cartridge. As for the N-sugar chain, the sugar chain was eluted with 25% (v/v) ACN and 0.075% (v/v) TFA, and dried with a centrifugal evaporator.
- ACN acetonitrile
- TFA trifluoroacetic acid
- the fluorescently labeled sugar chain was analyzed by mass spectrometry (UltraflexIII TOF/TOF, Bruker Daltonics) in MALDI-TOF positive ion mode.
- Example 20 Confirmation of anticancer effect of sugar chains of trastuzumab produced from transformed plant cells: in vivo
- mice female, 7 weeks were subjected to an adaptation period of 7 days and then xenotransplanted into Calu-3 cancer cells (Korea Cell Line Bank), which is a human lung cancer cell line with a number of 5 ⁇ 10 6 cells. After observing the tumor until the size of the tumor reaches 100 mm 3 to 150 mm 3 , the anticancer effect of the existing trastuzumab (Herceptin) and the trastuzumab produced from the transformed plant cells of the present invention (GF003) was compared. .
- the group receiving PBS intraperitoneally was set as a negative control group, and the group receiving the existing trastuzumab (Herceptin) 30 mg/kg intraperitoneally was set as a positive control group.
- Example 21 Preparation of non-fucosylated, non-ylosylated and/or non-galactosylated tobacco
- Genomic DNAs of two XylT12 and two GalT13 were blasted by Sol Genomics Network (https://solgenomics.net) to identify them in tobacco and then sequenced.
- NbXylT12_1 (Niben101Scf04551) has a length of 3632 bp including 4 exons (black box) and 3 introns (white box), and is spliced to cDNA of 1542 bp coding region to be translated into 513 amino acids.
- NbXylT12_2 (Niben101Scf04205) has a length of 3426 bp including three exons and two introns, and is translated into 516 amino acids by splicing to cDNA of the coding region 1551 bp.
- NbGalT13_1 (Niben101Scf04082) has a length of 1878 bp containing 6 exons and 6 introns, and is spliced to cDNA of 1128 bp coding region and translated into 375 amino acids.
- NbGalT13_2 (Niben101Scf09597) has a length of 3336 bp containing 7 exons and 6 introns, and is spliced to cDNA of 1104 bp coding region and translated into 367 amino acids (FIG. 29 ).
- NbFucT13 was universally present in roots, stems, leaves of 4 weeks old, leaves and flowers of 6 weeks old. It was based on the level of transcripts that were consistently expressed in different tissues without a pronounced expression pattern.
- NbXylT12 was predominantly present in roots, leaves and flowers at 6 weeks old, and NbGalT13 was predominantly in roots, leaves at 4 weeks old, and leaves at 6 weeks old (Fig. 30).
- Example 23 Design and selection of sgRNA for generation of multiple knockouts
- sgRNA target region which is the binding site of CRISPR/Cas9 RNP.
- sgRNA was selected using the CHOPCHOP (https://chopchop.cbu.uib.no/) site, and sgRNA activity was verified using IVT (in vitro DNA cleavage assay).
- IVT in vitro DNA cleavage assay
- AXT1 to AXT6 targeted exon 1 of NbXylT12_1 and NbXylT12_2 (FIGS. 31A to 31C ).
- AGT1 to AGT5 were targeting the exon 1 of NbGalT13_1 and NbGalT13_2, AGT6 AGT7 and was targeted to exon 2 of NbGalT13_1 and NbGalT13_2 (Fig. 32a to Fig. 32c).
- the pNGPJ0014 vector was constructed based on pCAMBIA (Abcam).
- the pNGPJ0014 vector has a cassette for antibiotics so as to be selected by kanamycin and hygromycin antibiotics, and a polycistronic tRNA-gRNA cassette synthesized with Cas9 was constructed to go.
- Cas9 was constructed to be expressed by the Arabidopsis ubiquitin 10 promoter, and tRNA-gRNA was produced by the Arabidopsis ubiquitin 6 promoter.
- SV40 PKKRKV, SEQ ID NO: 70
- a Bipartite KEPAATKKAGQAKKKK, SEQ ID NO: 71
- sgRNAs (AXT1 to AXT3) were prepared in a tandemly arranged tRNA-target 23bp-sgRNA scaffold system, and each row of tRNA-sgRNA was also added using a Golden-gate cloning system. It was combined with another line of tRNA-sgRNA. Three tandem repeats were placed under the AtU6 promoter ( Figure 33A).
- all three sgRNAs (AXT4 to AXT6) were prepared in a tandemly arranged tRNA-target 23/24bp-sgRNA scaffold system, and each row of tRNA-sgRNAs was prepared using a golden-gate cloning system. Another line of tRNA-sgRNA was combined.
- FIG. 33B Three tandem repeats were placed under the AtU6 promoter (FIG. 33B ). Furthermore, seven sgRNAs (AGT1 to AGT3 and AXT1 to AXT4) were all arranged in tandemly with a tRNA-target 23bp-sgRNA scaffold system, and each row of tRNA- The sgRNA was combined with another line of tRNA-sgRNA. Seven tandem repeats were placed under the AtU6 promoter ( Figure 33c). In addition, all three sgRNAs (AGT4 to AGT6) were prepared in a tandemly arranged tRNA-target 23bp-sgRNA scaffold system, and each row of tRNA-sgRNA was prepared by using a golden-gate cloning system. It was combined with a series of tRNA-sgRNAs. Three tandem repeats were placed under the AtU6 promoter (Figure 33D).
- the expression vector (pNGPJ0014) prepared in Example 23 was transformed into Agrobacterium cells (GV3101), respectively, and then plated on a medium (YEP agar plate) and cultured at 28° C. for about 2 days. Thereafter, the resulting single colony was inoculated into a liquid medium (YEP broth) and pre-cultured for about 2 days at a temperature of 28° C. and 200 rpm. The pre-culture was inoculated at a ratio of 0.5% of the amount of the new liquid medium, and incubated at a temperature of 28°C at 200 rpm until an OD value of 1.2 to 1.8. The shake-cultured transformed Agrobacteria were diluted to an OD value of 0.02 by adding a buffer solution for impregnation (10 mM MES, pH 5.6, 10 mM MgSO 4 ).
- the six-week-old wild type or line #37 tobacco leaves were used, and first, the leaf surface was immersed in 20% Clorox containing 0.1% Tween 20 for 10 minutes. To wash the soaked leaves, they were prepared by washing four times with distilled water containing 0.1% Tween 20, and then covered with filter paper to dry the surface of the leaves. The shaking cultured Agrobacteria were diluted with an OD value of 0.6 using a transformation medium (1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, pH5.8). The surface-sterilized leaves were cut into 1 cm square and immersed for 10 minutes in a previously prepared Agrobacteria transformation medium.
- a transformation medium (1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, pH5.8
- the soaked leaves were transferred to a medium (1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, 1% Agar, pH5.8) and cultured in the dark for 2 days. After 2 days, it was transferred to antibiotic medium (1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, 25mg/L Hygromycin, 200mg/L Timentin, 1% Agar, pH5.8), and the effectiveness of antibiotics In order to maintain, it was transferred to a new medium every two weeks.
- the root-inducing medium (1MS, 3% Sucrose, Hygromycin, 200 mg/L Timentin, 1% Agar, pH5.8) was transferred. Roots were induced after 2-3 weeks, and transferred to a large container to obtain new individuals after 4 weeks (Fig. 34).
- NbXylT12 and NbGalT13 prepared in Example 25 a Sanger-based sequence analysis of the target region was performed for the additional genome-edited lines.
- genomic DNA was extracted according to the manufacturer's manual using Q5 Hot Start High-Fidelity 2x Master Mix (NewEngland Biolabs) in a volume of 20 ⁇ l of the gRNA target region.
- the gene of the target region was amplified from the genomic DNA extract. Thereafter, the PCR amplified product was cloned into a TA vector according to the manufacturer's manual using an All in one Cloning Kit (Biofact, South Korea), and 15-20 clones were individually sequenced for each sample.
- T1 is It means the next generation of the transformed plant, transformed plant 1 generation, abbreviated as T1.
- the plants from which the sugars were removed were classified, and as a result of confirming the indels of each gene, the mono-allelic homo line of the plants from which gyros and ⁇ -1,3 galactose sugars were removed was T3 generation. It was confirmed that they were #310-4-60-3 and #310-4-60-69.
- Example 28 NbGalT13 Trastuzumab production and sugar chain analysis using an additional genome-edited lineage for
- Trastuzumab was produced by transforming the non-fucosylated and non-galactosylated tobacco prepared in Example 25 in the same manner as in Examples 16 and 17. After collecting the leaves of a plant (N.benthamiana) frozen with liquid nitrogen by pulverizing it in a mortar, a phosphate buffer solution (pH 7.2) of twice the volume was added to the powder and mixed. It was allowed to stand on ice for 10 minutes and centrifuged (15,000 ⁇ g, 20 minutes, 4° C.) to collect the first transparent supernatant. To the remaining powder, a double volume phosphate buffer solution (pH 7.2) was additionally added, and the same procedure as described above was repeated to recover the supernatant, and then the supernatant was mixed with the first recovered supernatant.
- a phosphate buffer solution pH 7.2
- Total soluble protein was filtered through a 0.45 ⁇ m filter to remove large insoluble particles and then concentrated (30 kDa, 15,000 ⁇ g, 30 minutes, 4° C.).
- the concentrated TSP was repeatedly treated with ultrapure water 3 times to replace the phosphate buffer solution with ultrapure water (30 kDa, 15,000 ⁇ g, 30 minutes, 4°C), and the amount of protein was quantified through Bradford analysis.
- TSP sample 50 ⁇ g of the obtained TSP sample was added to a denaturing solution (0.1% RapiGest SF, 10 mM DTT) and reacted for 45 minutes at a temperature of 56° C., and then iodoacetamide (20 mM) was additionally added and dark conditions ( At room temperature) for 1 hour. Thereafter, sugar cleavage enzyme (2 ⁇ l, 5 U/ ⁇ l, PNGase A) was added to the reaction solution, and the mixture was reacted overnight at 37°C. The N-sugar chain was extracted using a PGC cartridge (Porous graphitize carbon SPE cartridge) and dried by vacuum centrifugation.
- PGC cartridge Porous graphitize carbon SPE cartridge
- N-glycans in wild type revealed the presence of eight N-glycans (MUX, MUF, GnGnX2, GnGnX2F3, MMX2, MMX2F3, GnMX2/MGnX2 and GnMX2F3/MGnX2F3).
- MUX MUX, MUF, GnGnX2, GnGnX2F3, MMX2, MMX2F3, GnMX2/MGnX2 and GnMX2F3/MGnX2F3
- MUX, MUF, GnGnX2 and GnGnX2F3 were all detected in #103 plants in which ß-1,3 galactosyltransferase was knocked out.
- MUF and GnGnX2F3 were not detected, and only MUX and GnGnX2 were detected.
- MMX2F3 and GnMX2F3/MGnX2F3 were not detected, and only MMX2 and GnMX2/MGnX2 were highly detected.
- MMX2, MMX2F3, GnMX2/MGnX2 and GnMX2F3/MGnX2F3 were all detected in #103 plants in which ⁇ -1,3 galactosyltransferase was knocked out.
- Example 25 Plants of various lines prepared in Example 25 were transformed in the same manner as in Examples 16 and 17 to produce trastuzumab. Then, the sugar pattern was analyzed in the same manner as in Example 28.
- Plants of various lines prepared in Example 25 were transformed in the same manner as in Examples 16 and 17 to produce trastuzumab. Then, the expression level of trastuzumab was confirmed using electrophoresis in the same procedure as in Example 18.
- trastuzumab was well expressed in each host plant.
- the SKBR3 cancer cell line which is a target cell (T) was 1 ⁇ 10 4 cells. It was dispensed into 96-well-plates in consideration of the number of samples required at /100 ⁇ l/well.
- FBS may affect the analysis
- low IgG FBS was used, and hygromycin and G418 antibiotics were not used because they could kill the SKBR3 cancer cell line.
- trastuzumab A-trastuzumab, B-trastuzumab
- each trastuzumab produced in Example 28 was set to be the highest concentration of 1 ⁇ g/ml, and 1/3 serial dilution was performed to treat a total of 10 different concentrations.
- the medium of the SKBR3 cancer cell line in the 96-well plate was removed, and the total volume of jurkat T cells and each of the trastuzumab was 100 ⁇ l, and then added to the SKBR3 cancer cell line.
- 1 ⁇ g of antibody was added to 1 ml of 11.5 ⁇ 10 6 cells/ml jurkat T cells in an e-tube, and 200 ⁇ l was added to a 96-well plate.
- 120 ⁇ l of jurkat T cells were added to the next nine wells, and then sequentially diluted by 60 ⁇ l in the first 1 ⁇ g/ml well to prepare a sample containing a total of 10 different concentrations of antibodies.
- the luciferase substrate solution was added to 60 ⁇ l/well and incubated in a CO 2 incubator for 2 minutes.
- Luminescence was measured by the Luciferase assay protocol in the FLUO STAR OMEGA microplate reader, and the concentration value of IC 50 was calculated using the GraphPAD PRISM program.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
본 발명은 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도에 관한 것이다. 본 발명에 따른 비푸코실화된 담배를 이용하여 생산한 항체는 기존의 동물세포를 이용하여 생산한 항체와 다른 형태의 당쇄를 가지며, 항체의 당쇄에 푸코스가 존재하지 않는 것을 확인하였다. 또한, 본 발명에 따른 변형된 당쇄를 갖는 항체가 기존의 동물세포를 이용하여 생산한 항체보다 우수한 항암효과를 나타내는 것을 확인하였다. 따라서, 본 발명에 따른 변형된 당쇄를 갖는 항체는 암의 예방 또는 치료에 유용하게 사용될 수 있다.
Description
본 발명은 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도에 관한 것이다.
최근 단백질 의약품 시장에서 항체 의약품에 대한 개발이 이루어지고 있다. 특히, 단클론 항체(mAbs)와 면역글로불린의 Fc 영역을 융합시킨 약물에 대한 연구가 활발히 진행되고 있다. 이러한 항체 의약품은 목적 세포의 신호 전달 체계를 저해하여 세포사멸(apoptosis)을 직접 유도하거나, 항체의존성 세포독성(Antibody Dependent Cell-mediated Cytotoxicity, ADCC) 또는 보체의존성 세포독성(Complement Dependent Cytotoxicity, CDC)과 같은 간접적인 면역 반응을 유도함으로써 치료 효과를 나타낸다.
구체적으로, 항체의 CDC에 영향을 주는 요인으로는 Fc 영역의 갈락토실화(galactosylation)가 알려져 있다. 갈락토실화의 메커니즘에서 갈락토스(Galactose)는 글리코실화 연쇄 반응(glycosylation chain reaction)에서 갈락토스전달효소(galactosyltransferase)에 의해 N-아세틸글루코사민(N-acetylglucosamine) 다음에 붙게 된다. 망간(Manganese, Mn2+)은 갈락토스전달효소의 조효소(cofactor)로 효소의 성능을 향상시키는 역할을 수행한다.
또한, 항체의 ADCC를 향상시키기 위해 항체의 당 함량을 조절하고자 하는 연구가 수행되고 있다. 그 이유는 당사슬의 성분 및 구조가 항체의 인체 내 체류시간, 약리 활성 및 면역 반응 등의 치료 효과에 큰 영향을 미치기 때문이다. 이와 관련하여, 애보트(Abbott) 사의 아달리무맙(adalimumab) 특허(US 2012/0276631 및 WO 2012/149197)에 망간과 갈락토즈를 이용하는 항체 당쇄 조절에 대한 내용이 개시되어 있다. 그러나, 아직까지도 원하는 목표 함량으로 당쇄가 조절된 항체를 제조하는데 어려움을 겪고 있는 실정이다.
한편, 트라스투주맙(Trastuzumab)은 유방암에서 높은 활성을 가지는 인간상피증식인자 수용체 2(Human epidermal growth factor receptor 2, 이하, HER2)에 특이적으로 결합하여 세포 분열을 억제하는 인간화 항체이다. 트라스투주맙은 직접적으로 세포의 증식을 억제할 뿐만 아니라, ADCC와 혈관신생을 저해시킨다. 트라스투주맙은 HER2를 과발현하는 유방암 환자에게 정맥내 투여하여 유방암 치료에 사용되고 있다.
또한, 트라스투주맙은 동물세포나 미생물을 이용하여 생산되고 있다. 하지만, 동물세포와 미생물을 이용하여 트라스투주맙을 생산할 경우 비용이 많이 들고, 동물 유래 바이러스나 독소(toxin) 등의 감염이 발생할 수 있다는 문제점이 남아있다. 반면, 식물세포를 이용하여 트라스투주맙을 생산할 경우, 동물 유래의 바이러스와 독소 등을 포함하지 않는다는 이점이 있다. 또한, 동물세포 배양액에서 항체를 정제하는 과정에 비해, 식물로부터 항체를 정제하는 과정이 간단하고 경제적인 이점이 있다(Doran P.M., Curr. Opin. Biotechnol. 11: 199-204, 2000).
[선행기술문헌]
[특허문헌]
(특허문헌 1) US 2012/0276631
(특허문헌 2) WO 2012/149197
[비특허문헌]
(비특허문헌 1) Doran P.M., Curr. Opin. Biotechnol. 11: 199-204, 2000
이에 본 발명자들은 당쇄가 조절된 항체를 생산하는 기술을 연구하던 중, 크리스퍼 기술, 특히, 리보핵단백질(RNP)을 이용하여 담배를 형질전환 시킬 경우, 담배에 다른 유전자는 변이시키지 않고, 특정 유전자만을 녹아웃 시킬 수 있음을 확인하였다. 또한, 상기 형질전환 식물에 트라스투주맙을 코딩하는 유전자를 도입하여, 트라스투주맙을 생산한 결과, 트라스투주맙의 당쇄가 변형된 것을 확인하였다. 나아가, 변형된 당쇄를 갖는 트라스투주맙이 우수한 항암효과를 나타내는 것을 확인함으로써 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명의 일 측면은, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13)의 발현이 억제된 형질전환 식물을 제공한다.
본 발명의 다른 측면은, 푸코스(fucose), 자일로스(xylose), 갈락토스(galactose) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 잔기가 포함되지 않은, 변형된 당쇄를 갖는 목적 단백질을 제공한다.
본 발명의 또 다른 측면은, 변형된 당쇄를 갖는 목적 단백질을 유효성분으로 포함하는 암 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 또 다른 측면은, i) 서열번호 3으로 표시되는 염기서열; 및 서열번호 4로 표시되는 염기서열을 포함하는 유전자를 상기 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물에 도입하는 단계; ii) 상기 형질전환 식물을 재배하는 단계; 및 iii) 상기 재배한 형질전환 식물로부터 항체를 회수하는 단계를 포함하는 변형된 당쇄를 갖는 항체(예컨대, 트라스투주맙)를 생산하는 방법을 제공한다.
본 발명의 또 다른 측면은, 상기 변형된 당쇄를 갖는 목적 단백질을 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료하는 방법을 제공한다.
본 발명의 또 다른 측면은, 암을 예방 또는 치료하기 위한 상기 변형된 당쇄를 갖는 목적 단백질의 용도를 제공한다.
본 발명의 또 다른 측면은, 암의 예방 또는 치료용 약제를 제조하기 위한 상기 변형된 당쇄를 갖는 목적 단백질의 용도를 제공한다.
본 발명에 따른 비푸코실화된 담배를 이용하여 생산한 항체는 기존의 동물세포를 이용하여 생산한 항체와 다른 형태의 당쇄를 가지며, 항체의 당쇄에 푸코스가 존재하지 않는 것을 확인하였다. 또한, 본 발명에 따른 변형된 당쇄를 갖는 항체가 기존의 동물세포를 이용하여 생산한 항체보다 우수한 항암효과를 나타내는 것을 확인하였다. 따라서, 본 발명에 따른 변형된 당쇄를 갖는 항체는 암의 예방 또는 치료에 유용하게 사용될 수 있다.
도 1은 담배(N.benthamiana)에 존재하는 5개의 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13) 유전자의 개요도를 나타낸 것이다.
도 2는 담배의 알파 1,3-푸코실트랜스퍼라제 유전자와 상추 및 애기장대에 존재하는 유사한 유전자 간의 계통수(phylogenic tree)를 나타낸 것이다. 스케일은 위치당 존재하는 아미노산 치환 정도를 나타낸다. 식물에 존재하는 유전자를 다음과 같이 표기하였다:
N.benthamiana: FucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494), NbFucT13_4(Niben101Scf17626) 및 NbFucT13_5(Niben101Scf05447);
Lactuca sativa: FucT13_1(Lsa020014.1), LsFucT13_2(Lsa143107.1), LsFucT13_3(Lsa040691.1), LsFucT13_4(Lsa090095.1) 및 LsFucT13_5(Lsa035782.1);
Arabidopsis: FUT11(At1g49710) 및 FUT12(At3g19280).
도 3은 담배에 존재하는 5개의 알파 1,3-푸코실트랜스퍼라제 유전자의 발현 정도를 확인한 그래프이다.
도 4는 5개의 FucT13을 타겟팅하기 위한 sgRNA의 개요도이다.
도 5는 5개의 FucT13을 타겟팅하기 위한 sgRNA의 개요도이다. 이때, 모든 sgRNA는 엑손 1을 타겟팅하였고, 20머의 뉴클레오티드로 구성되었다. 또한, T7 프로모터의 전사체에 효과적이도록 5'에 "G"를 포함한다. 도 5a는 AFT1 및 AFT2에 대한 sgRNA 서열이다. 도 5b는 AFT3 및 AFT4에 대한 sgRNA 서열이다. 도 5c는 AFT5 및 AFT6에 대한 sgRNA 서열이다. 붉은 박스는 sgRNA가 타겟으로 하는 부분을 포함하고 있는 엑손을 나타낸다.
도 6은 gRNA-tRNA 시스템에 적용될 6개의 sgRNA가 포함된 유전자 편집용 바이너리 벡터(binary vector)의 개요를 도식화한 것이다. 6개의 gRNA는 20 bp로 구성되어 있으며, AtU6 프로모터에 의해 발현이 된다.
도 7은 담배의 캘러스 및 식물체를 나타낸 도면이다.(A) 5일이 경과된 마이크로캘리(microcalli)로서, 단일 세포로부터 생산된 프라머리포이다.(B) 2주 경과 후의 마이크로캘리이다.(C) 4주 경과 후의 마이크로캘리이다.(D) 7주 경과 후의 캘리이다.(E) 3개의 캘리에서 녹색의 싹이 형성되었음을 알 수 있다.(F) 두달 경과 후에 성장 호르몬이 존재하지 않는 half-strength MS 배지에서 뿌리가 생성됨을 알 수 있다. 단일 세포에서 식물체까지 5개월이 소요되었다. 흰색바 및 검은색바는 1 cm를 나타내며, 붉은바는 100 ㎛를 나타낸다.
도 8은 아그로박테리움 매개 유전자 편집 기술을 이용하여 제조한 담배를 나타낸 것이다.(A) 아그로박테리움과 함께 공배양한 후의 체외 배양 조직(explants)를 나타낸 것이다.(B) 25 ㎎/ℓ 히그로마이신(hygromycin) 존재하에서 6주 체외 배양 조직에서 싹이 나는 것을 나타낸 것이다.(C) 묘목(plantlets)을 나타낸 것이다.(D) 형질전환 식물을 나타낸 것이다. 이때, 흰색바는 1 cm를 나타내며, 붉은바는 10 cm를 나타낸다.
도 9는 5개의 FucT13s 유전자를 PCR을 통해 증폭한 것이다. 15개의 식물 개체에서 상기 유전자의 돌연변이를 검출하였다. PCR 증폭물은 TA 벡터를 이용하여 증폭하였고, 각각의 PCR 증폭물을 시퀀싱하였다.
도 10은 5개의 FucT13s 유전자를 PCR을 통해 증폭한 것이다. 16개의 식물 개체에서 상기 유전자의 돌연변이를 검출하였다. PCR 증폭물은 TA 벡터를 이용하여 증폭하였고, 각각의 PCR 증폭물을 시퀀싱하였다.
도 11은 sgRNA의 타겟 영역을 정렬한 것이다. T0 Plant line #8는 세개의 유전자 FucT13_1, FucT13_2 및 FucT13_3은 이중 대립 돌연변이(biallelic mutations) +5/+1, -1/+1, -593, -1 및 +1/+1을 가진다. FucT13_1은 이중 대립 돌연변이 -5/+1, -1/+1을 가진다. FucT13_2은 이중 대립 돌연변이 -593, -1를 가진다. FucT13_3은 이중 대립 돌연변이, +1/+1을 가진다. FucT13_4는 헤테로 돌연변이(hetero mutations) +1/wt을 가짐을 확인하였다. 반면, FucT13_5는 돌연변이가 없었다. 빨간색 도트라인(Red dotlines)은 삭제된 염기(deletion bases)를 의미한다. 빨간색 문자(Red letters)는 삽입된 염기(insertion bases)를 의미한다. 파란색 문자(Blue letters)는 SNP(single nucleotide polymorphism)를 의미한다. 괄호안의 숫자는 결실(-) 및 삽입(+)을 의미한다.
도 12는 sgRNA의 타겟 영역을 정렬한 것이다. T0 Plant line #10는 네개의 유전자 FucT13_1, FucT13_2, fuct13_3 및 fuct13_4는 이중 대립 돌연변이 +1/+1, -715/-3/+1, +1, +1를 가진다. FucT13_1은 헤테로 돌연변이(hetero mutations), +1/+1/wt를 가진다. FucT13_2는 헤테로 돌연변이, -715/wt를 가진다. FucT13_3은 헤테로 돌연변이, +1/wt을 가진다. FucT13_4는 헤테로 돌연변이(hetero mutations) +1/wt을 가짐을 확인하였다. 반면, FucT13_5는 돌연변이가 없었다. 빨간색 도트라인은 삭제된 염기를 의미한다. 빨간색 문자는 삽입된 염기를 의미한다. 파란색 문자는 SNP를 의미한다. 괄호안의 숫자는 결실(-) 및 삽입(+)을 의미한다.
도 13은 sgRNA의 타겟 영역을 정렬한 것이다. T0 Plant line #27는 두개의 유전자 FucT13_2 및 fuct13_3는 이중 대립 돌연변이 -714 및 +1/+1를 가진다. FucT13_2는 헤테로 돌연변이, -714/wt를 가진다. FucT13_3은 이중 대립 돌연변이, +1 and +1을 가진다. FucT13_4는 헤테로 돌연변이(hetero mutations) +1/wt을 가짐을 확인하였다. 반면, FucT13_1, FucT13_4, 및 FucT13_5 는 돌연변이가 없었다. 빨간색 도트라인은 삭제된 염기를 의미한다. 빨간색 문자는 삽입된 염기를 의미한다. 파란색 문자는 SNP를 의미한다. 괄호안의 숫자는 결실(-) 및 삽입(+)을 의미한다.
도 14은 sgRNA의 타겟 영역의 서열을 비교한 것이다. T1 plant line #37-26은 4개의 유전자가 조작되었으며, FucT13_1, FucT13_2, FucT13_3, 및 FucT13_4. FucT13_1은 이중 대립 돌연변이(biallelic mutations), -709/+1, +1/+1을 가짐을 확인하였다. FucT13_2은 이중 대립 돌연변이, -2/-592; -1/-593을 가짐을 확인하였다. FucT13_3 이중 대립 돌연변이, +1, -9를 가짐을 확인하였다. FucT13_4 이중 대립 돌연변이, +1, +1을 가짐을 확인하였다. FucT13_5은 돌연변이가 생기지 않았다. 빨간색 도트라인은 삭제된 염기를 의미한다. 빨간색 문자는 삽입된 염기를 의미한다. 파란색 문자는 SNP를 의미한다. 괄호안의 숫자는 결실(-) 및 삽입(+)을 의미한다.
도 15는 sgRNA의 FucT13_1 타겟 영역을 정렬한 것이다.
도 16은 sgRNA의 FucT13_2 타겟 영역을 정렬한 것이다.
도 17은 sgRNA의 FucT13_3 타겟 영역을 정렬한 것이다.
도 18은 sgRNA의 FucT13_4 타겟 영역을 정렬한 것이다.
도 19는 sgRNA의 FucT13_5 타겟 영역을 정렬한 것이다.
도 20은 타겟 gRNA가 in vivo 상에서 유전자 편집이 일어났는지 확인한 것이다. 이때, 유전자 편집 효율(%)은 각 밴드 위에 숫자로 표시하였다.
도 21은 타겟 gRNA가 in vivo 상에서 유전자 편집이 일어났는지 확인한 것이다. 이때, 유전자 편집 효율(%)은 각 밴드 위에 숫자로 표시하였다.
도 22는 생산된 항체의 당화를 확인하기 위하여, N-글리칸의 프로파일을 나타낸 것이다.(A)는 야생형의 담배(NBwt)의 프로파일을 나타내며,(B)는 4개의 유전자가 녹아웃된 담배인 #37의 프로파일을 나타낸 것이다(*: 미확인된 피크를 의미함).
도 23은 생산된 항체를 이용하여 항체 의존적 세포 매개 세포독성(Antibody-Dependent Cell-Mediated Cytotoxicity, ADCC) 효과를 분석한 결과이다.
도 24는 형질전환 식물로부터 수득한 트라스투주맙의 발현양을 발현양을 웨스턴 블랏을 통해 확인한 도면이다: M; 단백질 크기 마커, P; 트라스투주맙, v1; 코돈 최적화 전 유전자, v2; 코돈 최적화된 유전자.
도 25는 형질전환 식물로부터 수득한 트라스투주맙의 발현양을 확인한 그래프이다: M: 단백질 크기 마커, P: 트라스투주맙, v1: 코돈 최적화 전 유전자, v2: 코돈 최적화된 유전자.
도 26 및 27은 기존의 트라스투주맙(herceptin) 및 형질전환 식물로부터 수득한 트라스투주맙(GF003)의 당쇄 구조를 분석한 도면이다.
도 28은 형질전환 식물로부터 수득한 트라스투주맙(GF003)의 항암효과를 확인한 도면이다.
도 29는 담배에 존재하는 2개의 베타 1,2-자일로실트랜스퍼라제(beta 1,2 xylosyltransferase, XylT12) 유전자 및 베타 1,3-갈락토실트랜스퍼라제(beta 1,3 galactosyltransferase, GalT13) 유전자의 개요도를 나타낸 것이다.
도 30은 담배에 존재하는 5개의 알파 1,3-푸코실트랜스퍼라제 유전자, 2개의 베타 1,2-자일로실트랜스퍼라제 유전자 및 2개의 베타 1,3-갈락토실트랜스퍼라제 유전자의 발현 정도를 확인한 그래프이다.
도 31a 내지 도 31c는 2개의 XylT12를 타겟팅하기 위한 sgRNA의 개요도이다. 이때, 모든 sgRNA는 엑손 1을 타겟팅하였고, 23머 또는 24머의 뉴클레오티드로 구성되었다. 또한, T7 프로모터의 전사체에 효과적이도록 5'에 "G"를 포함한다. 도 31a는 AXT1 및 AXT2에 대한 sgRNA 서열이다. 도 31b는 AXT5 및 AXT3에 대한 sgRNA 서열이다. 도 31c는 AXT4 및 AXT6에 대한 sgRNA 서열이다. 붉은 박스는 sgRNA가 타겟으로 하는 부분을 포함하고 있는 엑손을 나타낸다.
도 32a 내지 도 32c는 2개의 GalT13을 타겟팅하기 위한 sgRNA의 개요도이다. 이때, sgRNA는 엑손 1 또는 엑손 2를 타겟팅하였고, 23머의 뉴클레오티드로 구성되었다. 또한, T7 프로모터의 전사체에 효과적이도록 5'에 "G"를 포함한다. 도 32a는 AGT3 및 AGT4에 대한 sgRNA 서열이다. 도 32b는 AGT1 및 AGT2에 대한 sgRNA 서열이다. 도 32c는 AGT5, AGT6 및 AGT7에 대한 sgRNA 서열이다. 붉은 박스는 sgRNA가 타겟으로 하는 부분을 포함하고 있는 엑손을 나타낸다.
도 33a는 gRNA-tRNA 시스템에 적용될 3개의 sgRNA(AXT1, AXT2, AXT3)가 포함된 유전자 편집용 바이너리 벡터의 개요를 도식화한 것이다. 3개의 gRNA는 23 bp로 구성되어 있으며, AtU6 프로모터에 의해 발현이 된다.
도 33b는 gRNA-tRNA 시스템에 적용될 3개의 sgRNA(AXT4, AXT5, AXT6)가 포함된 유전자 편집용 바이너리 벡터의 개요를 도식화한 것이다. 3개의 gRNA는 23 bp 또는 24 bp로 구성되어 있으며, AtU6 프로모터에 의해 발현이 된다.
도 33c는 gRNA-tRNA 시스템에 적용될 7개의 sgRNA(AGT1, AGT2, AGT3, AXT1, AXT2, AXT3, AXT4)가 포함된 유전자 편집용 바이너리 벡터의 개요를 도식화한 것이다. 7개의 gRNA는 23 bp로 구성되어 있으며, AtU6 프로모터에 의해 발현이 된다.
도 33d는 gRNA-tRNA 시스템에 적용될 7개의 sgRNA(AGT4, AGT5, AGT6)가 포함된 유전자 편집용 바이너리 벡터의 개요를 도식화한 것이다. 3개의 gRNA는 23 bp로 구성되어 있으며, AtU6 프로모터에 의해 발현이 된다.
도 34는 아그로박테리움 매개 유전자 편집 기술을 이용하여 제조한 담배를 나타낸 것이다.(A) 아그로박테리움과 함께 공배양한 후 히그로마이신 존재하에서 체외 배양한 조직에서 싹이 나는 것을 나타낸 것이다. (B) 형질전환 식물을 나타낸 것이다.
도 35 및 도 36은 T1 세대의 생어-염기서열 분석결과를 통해 mono-allelic homo와 bi-allelic homo를 찾아서 단일 또는 이중으로 당이 제거된 식물체를 분류한 것이다.
도 37은 T1 세대 및 T3 세대의 생어-염기서열 분석결과를 통해 mono-allelic homo와 bi-allelic homo를 찾아서 이중으로 당이 제거된 식물체를 분류한 것이다.
도 38은 T1 세대 및 T2 세대의 생어-염기서열 분석결과를 통해 mono-allelic homo와 bi-allelic homo를 찾아서 삼중으로 당이 제거된 식물체를 분류한 것이다.
도 39 및 도 40은 α-1,3 푸코실트랜스퍼라제 유전자 및 ß-1,3 갈락토실트랜스퍼라제 유전자가 녹아웃된 담배로부터 생산된 트라스투주맙의 당패턴을 분석한 것이다.
도 41 및 도 42는 형질전환 식물로부터 수득한 트라스투주맙(GF003)의 당쇄 구조를 분석한 도면이다.
도 43은 형질전환 식물로부터 수득한 트라스투주맙(GF003)의 발현양을 확인한 도면이다. M: 단백질 크기 마커, P: 통과분획(pass fraction), W: 척분획(washing fraction), E: 용출 분획(elution fraction).
도 44는 형질전환 식물로부터 수득한 트라스투주맙(GF003)의 항체의존세포독성(ADCC) 효과를 확인한 도면이다.
이하, 본 발명을 상세히 설명한다.
형질전환 식물
본 발명의 일 측면은, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13)의 발현이 억제된 형질전환 식물을 제공한다.
상기 형질전환 식물이 베타 1,2-자일로실트랜스퍼라제(beta 1,2-xylosyltransferase, XylT12), 베타 1,3-갈락토실트랜스퍼라제(beta 1,3-galactosyltransferase, GalT13) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 발현이 추가적으로 억제된 것일 수 있다.
구체적으로, 상기 형질전환 식물은 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13)의 발현이 억제된 형질전환 식물일 수 있다. 상기 형질전환 식물은 베타 1,2-자일로실트랜스퍼라제의 발현이 추가적으로 억제된 것일 수 있으며, 이 경우, 상기 형질전환 식물은 알파 1,3-푸코실트랜스퍼라제 및 베타 1,2-자일로실트랜스퍼라제의 발현이 억제된 것일 수 있다. 상기 형질전환 식물은 베타 1,3-갈락토실트랜스퍼라제 의 발현이 추가적으로 억제된 것일 수 있으며, 이 경우, 상기 형질전환 식물은 알파 1,3-푸코실트랜스퍼라제 및 베타 1,3-갈락토실트랜스퍼라제의 발현이 억제된 것일 수 있다. 상기 형질전환 식물은 베타 1,2-자일로실트랜스퍼라제 및 베타 1,3-갈락토실트랜스퍼라제의 발현이 추가적으로 억제된 것일 수 있으며, 이 경우, 상기 형질전환 식물은 알파 1,3-푸코실트랜스퍼라제, 베타 1,2-자일로실트랜스퍼라제 및 베타 1,3-갈락토실트랜스퍼라제의 발현이 억제된 것일 수 있다.
상기 알파 1,3-푸코실트랜스퍼라제는 NbFucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494) 및 NbFucT13_4(Niben101Scf17626)일 수 있다. 상기 NbFucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494) 및 NbFucT13_4(Niben101Scf17626)는 각각 서열번호 70, 71, 72 및 73로 표시되는 염기서열에 의해 코딩되는 것일 수 있다.
이때, 상기 형질전환 식물은 NbFucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494) 및 NbFucT13_4(Niben101Scf17626)을 코딩하는 유전자에 상보적으로 결합하는 sgRNA 및 크리스퍼 연관 단백질의 복합체를 이용하여 알파 1,3-푸코실트랜스퍼라제의 발현이 억제되도록 제작된 것일 수 있다.
상기 NbFucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494) 및 NbFucT13_4(Niben101Scf17626)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA는 서열번호 17 내지 36 중 어느 하나로 표시되는 염기서열을 포함하는 것일 수 있다. 상기 sgRNA가 타겟으로 하는 부분은 도 4 내지 도 5a, 5b, 5c 및 표 6을 참고할 수 있다.
상기 베타 1,2-자일로실트랜스퍼라제는 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)일 수 있다. 상기 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)는 각각 서열번호 75 및 76으로 표시되는 아미노산 서열을 포함하는 것일 수 있다. 상기 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)는 각각 서열번호 77 및 78로 표시되는 염기서열에 의해 코딩되는 것일 수 있다.
이때, 상기 형질전환 식물은 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA 및 크리스퍼 연관 단백질의 복합체를 이용하여 베타 1,2-자일로실트랜스퍼라제의 발현이 억제되도록 제작된 것일 수 있다.
상기 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA는 서열번호 57 내지 62 중 어느 하나로 표시되는 염기서열을 포함하는 것일 수 있다. 상기 gRNA가 타겟으로 하는 부분은 도 31a 내지 도 31c 및 표 13을 참고할 수 있다.
상기 베타 1,3-갈락토실트랜스퍼라제는 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)일 수 있다. 상기 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)는 각각 서열번호 79 및 80으로 표시되는 아미노산 서열을 포함하는 것일 수 있다. 상기 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)는 각각 서열번호 81 및 82로 표시되는 염기서열에 의해 코딩되는 것일 수 있다.
이때, 상기 형질전환 식물은 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA 및 크리스퍼 연관 단백질의 복합체를 이용하여 베타 1,3-갈락토실트랜스퍼라제의 발현이 억제되도록 제작된 것일 수 있다.
상기 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA는 서열번호 63 내지 69 중 어느 하나로 표시되는 염기서열을 포함하는 것일 수 있다. 상기 gRNA가 타겟으로 하는 부분은 도 32a 내지 도 32c 및 표 13을 참고할 수 있다.
상기 식물은 담배, 애기장대, 옥수수, 벼, 대두, 카놀라, 알팔파, 해바라기, 수수, 밀, 목화, 땅콩, 토마토, 감자, 상추 및 고추로 이루어진 군에서 선택되는 어느 하나로부터 유래된 것일 수 있다. 구체적으로 상기 식물은 담배일 수 있다.
상기 형질전환 식물은 형질전환된 식물은 목적 단백질을 코딩하는 유전자를 포함하는 발현벡터가 추가적으로 도입된 것일 수 있다. 구이때, 상기 목적 단백질을 코딩하는 유전자는 서열번호 3으로 표시되는 염기서열; 및 서열번호 4로 표시되는 염기서열을 포함할 수 있다.
상기 발현벡터는 숙주세포(host cell)에서 목적하는 단백질을 발현할 수 있는 벡터로서, 폴리뉴클레오티드(유전자) 삽입물이 발현될 수 있도록 작동가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 작제물을 의미한다.
본 발명에서 사용하는 용어 "작동가능하게 연결된(operably linked)"이란, 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질 또는 RNA를 코딩하는 핵산 서열이 기능적으로 연결(functional linkage)되어 있는 것으로, 발현조절 서열에 의해 유전자가 발현될 수 있도록 연결된 것을 의미한다.
본 발명에서 사용하는 용어 "발현조절 서열(expression control sequence)"이란, 특정한 숙주세포에서 작동가능하게 연결된 폴리뉴클레오티드 서열의 발현을 조절하는 DNA 서열을 의미한다. 그러한 조절 서열은 전사를 실시하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열, 개시 코돈, 종결 코돈, 폴리아데닐화 시그널 및 인핸서 등을 포함할 수 있다.
상기 발현조절 서열과 기타 유전자 발현에 필수적인 요소들은 숙주로 하는 식물에서 유래한 것이거나 식물에서의 발현에 최적화된 것이 바람직하다. 예를 들어 식물 유전자의 프로모터 또는 식물을 숙주로 하거나 식물에서 발현가능한 유전자의 프로모터를 본 발명에 따른 식물 코돈 최적화 재조합 유전자에 작동가능하게 연결하여 발현벡터에 삽입할 수 있다.
식물에서 유래한 프로모터로는 당업계에서 통상적으로 이용되는 것이면 어느 것이나 선택하여 사용할 수 있으나, 예를 들어 리불로스-1,6-비스포스페이트(RUBP) 카르복실라제 소형 서브유닛(ssu), 베타-콘글리시닌 프로모터, 파세올린 프로모터, ADH(알콜 데히드로게나제) 프로모터, 충격 프로모터, ADF(액틴 해중합 인자) 프로모터 및 조직 특이 프로모터 등을 제한없이 사용할 수 있다. 또한, 박테리아에서 유래한 옥토파인 중합효소(synthase) 프로모터, 노팔린 중합효소 프로모터, 만노파인 중합효소 프로모터, 및 바이러스에서 유래한 컬리플라워 모자이크 바이러스(CaMV)의 35S 및 19S 프로모터 등을 사용할 수 있다.
또한, 프로모터 외에 전사 효율을 높일 수 있는 인핸서 등 부가적인 발현 조절 서열을 추가적으로 포함할 수 있다. 상기 프로모터는 모든 식물세포에서 계속적으로 유전자를 발현시키는 구성적 프로모터이거나, 특정한 식물의 조직/기관에서만 또는 특정한 식물의 발달 시기에만 유전자를 발현시키거나 빛, 호르몬 등의 특정 자극이나 환경에 의해 프로모터 활성을 갖는 유도성 프로모터일 수 있다.
식물에서의 발현을 위한 발현벡터는 아그로박테리움 바이너리 벡터를 사용할 수 있다. 상기 "바이너리 벡터(binary vector)"는 아그로박테리움으로 매개되는 형질전환에서, 종양 유발 유전자인 Ti 플라스미드(tumor inducible plasmid, Ti plasmid)를 두 개의 플라스미드로 분리한 것으로서, 재조합 유전자를 식물의 유전체로 이동시키는데 필요한 LB(left border)와 RB(right border) 서열을 갖는 플라스미드와 재조합 유전자를 이동시키는데 필요한 단백질을 암호화하는 플라스미드로 분리한 벡터를 의미한다.
변형된 당쇄를 갖는 목적 단백질
본 발명의 다른 측면은, 푸코스(fucose), 자일로스(xylose), 갈락토스(galactose) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 잔기가 포함되지 않은, 변형된 당쇄를 갖는 목적 단백질을 제공한다.
이때, 상기 목적 단백질은 항체일 수 있고, 구체적으로 트라스투주맙일 수 있다. 상기 트라스투주맙은 서열번호 1로 표시되는 아미노산 서열로 이루어진 중쇄 및 서열번호 2로 표시되는 아미노산 서열로 이루어진 경쇄를 포함하는 것일 수 있다.
상기 변형된 당쇄는 푸코스(fucose), 자일로스(xylose), 갈락토스(galactose) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 잔기가 포함되지 않을 수 있다. 구체적으로, 상기 변형된 당쇄는 푸코스를 포함하지 않는 것일 수 있다. 상기 변형된 당쇄는 푸코스 및 자일로스; 푸코스 및 갈락토스를 포함하지 않는 것일 수 있다. 상기 변형된 당쇄는 푸코스, 자일로스 및 갈락토스를 포함하지 않는 것일 수 있다.
또한, 상기 변형된 당쇄는 3개, 7개 또는 8개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함할 수 있다. 구체적으로, 상기 변형된 당쇄는 , ,, , 또는 형태일 수 있으며, 이때, 상기 는 만노스이고, 상기 는 N-아세틸글루코사민이며, 상기 는 자일로스이다.
상기 목적 단백질은 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물로부터 생산되는 것일 수 있다. 상기 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물은 형질전환 식물에서 상술한 바와 동일하다.
변형된 당쇄를 갖는 목적 단백질(예컨대, 트라스투주맙)을 유효성분으로 포함하는 약학 조성물
본 발명의 다른 측면은, 상기 변형된 당쇄를 갖는 목적 단백질을 유효성분으로 포함하는 암 예방 또는 치료용 약학 조성물을 제공한다. 상기 변형된 당쇄를 갖는 목적 단백질은 상술한 바와 동일하다.
상기 목적 단백질은 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물로부터 생산되는 것일 수 있다. 상기 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물은 형질전환 식물에서 상술한 바와 동일하다.
상기 약학 조성물은 3개, 5개, 7개 또는 8개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 이중 안테나 형태의 당쇄를 갖는 항체의 총량을 100%로 하였을 때, 푸코스(fucose) 잔기가 없는 항체의 양이 99% 이상이고, 상기 당쇄 내에 갈락토스(galactose)의 양이 1% 이하인, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13)의 발현이 억제된 형질전환 식물로부터 생산된 목적 단백질을 포함하는 것일 수 있다.
상기 약학 조성물은 3개, 5개, 7개, 8개 또는 9개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 이중 안테나 형태의 당쇄를 갖는 항체의 총량을 100%로 하였을 때, 푸코스(fucose) 및 갈락토스(galactose) 잔기가 없는 항체의 양이 95% 이상이고, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13) 및 베타 1,3-갈락토실트랜스퍼라제(beta 1,3 galactosyltransferase, GalT13)의 발현이 억제된 형질전환 식물로부터 생산된 목적 단백질을 포함하는 것일 수 있다.
상기 약학 조성물은 3개, 5개 또는 8개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 이중 안테나 형태의 당쇄를 갖는 항체의 총량을 100%로 하였을 때, 푸코스(fucose) 및 자일로스(xylose) 잔기가 없는 항체의 양이 95% 이상이고, 상기 당쇄 내에 갈락토스(galactose)의 양이 1% 이하인, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13) 및 베타 1,2-자일로실트랜스퍼라제(beta 1,2 xylosyltransferase, XylT12)의 발현이 억제된 형질전환 식물로부터 생산된 목적 단백질을 포함하는 것일 수 있다.
상기 암은 위암, 간암, 폐암, 대장암, 유방암, 전립선암, 난소암, 췌장암, 자궁경부암, 갑상선암, 후두암, 급성 골수성 백혈병, 뇌종양, 신경모세포종, 망막 모세포종, 두경부암, 침샘암 및 림프종으로 구성된 군으로부터 선택되는 어느 하나인 것일 수 있다.
상기 약학 조성물은 약학적으로 허용되는 담체를 추가로 포함할 수 있다. 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있고, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소 투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다.
상기 약학 조성물의 제형은 상술한 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여 시에는 정제, 트로키, 캡슐, 엘릴시르, 서스펜션, 시럽, 웨이퍼 등의 형태로 제조될 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조될 수 있다.
약학 조성물은 암 또는 그들의 전이를 치료하거나 암의 성장을 억제하기 위해 약학적으로 효과적인 양으로 투여될 수 있다. 암 종류, 환자의 연령, 체중, 증상의 특성 및 정도, 현재 치료법의 종류, 치료 회수, 투여 형태 및 경로 등 다양한 요인에 따라 달라질 수 있으며, 해당 분야의 전문가들에 의해 용이하게 결정될 수 있다.
상기 약학 조성물은 상기한 약리학적 또는 생리학적 성분과 함께 투여되거나 순차적으로 투여될 수 있으며, 또한 추가의 종래의 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 이러한 투여는 단일 또는 다중 투여일 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
본 명세서에서 사용된 용어 "투여"는 어떠한 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미하며, 상기 약학적 조성물은 목적 조직에 도달할 수 있는 한 어떠한 경로를 통해서도 투여될 수 있다. 이러한 투여 방법으로 복강내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 경구 투여, 국소 투여, 비강내 투여, 폐내 투여 또는 직장내 투여 등을 들 수 있으나, 이에 한정되는 것은 아니다. 다만 경구 투여시, 단백질은 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화 하는 것이 바람직할 수 있다.
변형된 당쇄를 갖는 항체의 생산 방법
본 발명의 또 다른 측면은, i) 서열번호 3으로 표시되는 염기서열; 및 서열번호 4로 표시되는 염기서열을 포함하는 유전자를 상기 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물에 도입하는 단계; ii) 상기 형질전환 식물을 재배하는 단계; 및 iii) 상기 재배한 형질전환 식물로부터 트라스투주맙을 회수하는 단계를 포함하는 변형된 당쇄를 갖는 항체를 생산하는 방법을 제공한다.
상기 형질전환 식물은 상술한 바와 동일하다.
상기 i) 단계는 형질전환 식물에 목적 단백질을 코딩하는 유전자를 포함하는 발현벡터를 도입하는 단계이다. 구체적으로, 상기 식물을 형질전환시키는 방법은 당업계에 공지된 식물의 형질전환 방법을 제한 없이 사용할 수 있다. 당업자는 숙주로 선택한 식물의 특성을 고려하여 특정 식물에 적절한 공지의 형질전환 방법을 선택하여 실시할 수 있다. 이때, 상기 목적 단백질은 항체일 수 있으며, 구체적으로 트라스투주맙일 수 있다.
식물의 형질전환 방법으로는, 예를 들어, 발현벡터를 포함하는 리포좀과 식물 원형질체를 융합하는 방법, PEG를 이용하여 발현벡터를 식물 원형질체로 주입하는 방법, 발현벡터의 식물세포로의 직접주입법, 미세입자충격법, 유전자총, 전기천공법(electroporation), 바이러스를 이용한 형질전환법, 진공을 이용한 형질전환법(vaccum infiltration method), 화아침지법(floral meristem dippingmethod) 등을 사용할 수 있다. 바람직하게는, 상기 식물을 형질전환시키는 방법은 아그로박테리움을 이용한 형질전환 방법을 사용할 수 있다.
상기 '아그로박테리움을 이용한 형질전환 방법'은 식물의 뿌리와 줄기에 종양을 일으키는 토양의 그람 음성 세균인 아그로박테리움을 이용하여 식물세포에 외부 유전자를 전달하는 방법이다. 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens), 아그로박테리움 리조게네스(Agrobacterium rhizogenes) 등의 아그로박테리움에서 발견되는 종양 유발 플라스미드(tumor-inducing plasmid, Ti plasmid)의 T-DNA(transfer DNA)가 식물의 유전체(genome)에 삽입되는 현상을 이용한 방법이다. 아그로박테리움을 이용한 형질전환에서는 식물에 도입하려는 외부 유전자(exogenous DNA)와 T-DNA(외부 유전자의 양쪽 가장자리에 위치하는 LB와 RB 서열)를 포함하는 바이너리 플라스미드(또는 바이너리 벡터) 및 T-DNA가 식물 유전체에 삽입되도록 하는 보조 플라스미드(helper plasmid)의 두 가지 플라스미드로 이루어진 바이너리 시스템을 이용하는 것이 일반적이다. 아그로박테리움을 이용한 형질전환 방법은 잎, 줄기, 뿌리 등 다양한 식물의 조직에 사용할 수 있으며, 어린 조직이 형질전환이 잘되는 경향이 있다.
본 발명에서의 아그로박테리움을 이용한 형질전환 방법을 이용하여 재조합 단백질을 일시적으로 발현(transient expression)할 수도 있고, 안정적 발현(stable expression)할 수도 있다.
일시적인 발현을 위해서는 식물의 일부, 예를 들어 식물의 잎을 재조합 발현벡터를 포함하는 아그로박테리움으로 감염시켜 형질전환하고, 목적하는 단백질이 충분히 발현될 수 있는 시간이 지난 뒤 식물에서 감염된 부분을 수득할 수 있다.
안정적 발현을 위하여 식물의 세포나 조직을 배양하여 아그로박테리움으로 감염시켜 형질전환한 뒤, 추가 배양하여 적합한 형질전환체를 선별하고 재분화 과정을 거친 뒤, 완전한 구조를 갖는 형질전환 식물체로 배양할 수 있다. 상기 형질전환 식물체에서 종자를 수득하고 발아시킴으로써 다음 세대에서도 안정적으로 형질전환 식물을 수득할 수 있다.
상기 ii) 단계는 상기 형질전환 식물을 재배하는 단계이다.
상기 식물을 재배하는 단계는 식물을 형질전환한 후, 목적하는 바에 부합하는 양의 단백질을 발현하는 시간 동안 식물의 성장에 필요한 빛, 온도, 습도 등의 환경 조건과 물, 무기염류, 영양소, 호르몬 등 식물 성장에 필요한 요소들을 제공하는 것을 의미한다.
식물에서 분리된 세포, 조직 또는 이들의 배양물을 형질전환한 경우, 상기 물, 영양소, 무기염류, 생장조절제 등 식물 조직 배양에 필요한 요소들은 배양 배지(culture media)를 통해 전달될 수 있다. 또한 유도성 프로모터를 이용하여 식물에서 본 발명에 따른 EC-SOD을 발현시킨 경우, 상기 유도성 프로모터를 활성화하는데 필요한 해당 자극, 예를 들어 빛, 열 또는 호르몬 등을 가하면서 재배할 수 있다.
상기 iii) 단계는 재배한 형질전환 식물을 수득하고, 이로부터 목적 단백질을 분리 및 회수하는 단계이다.
상기 식물을 수득하는 것은 형질전환되어 목적하는 단백질을 과발현하는 식물의 전체 또는 일부를 수득하는 것을 의미한다. 상기 목적 단백질을 과발현하는 뿌리, 줄기, 잎 등의 형질전환된 부분 또는 형질전환 식물의 종자를 수득하는 것일 수 있으며, 식물세포나 조직의 배양물, 예를 들어 재조합 유전자로 형질전환된 캘러스나 원형질체 등을 수득하는 것일 수도 있다.
또한, 형질전환 식물로부터 목적 단백질을 분리 및 회수하는 방법은 상기 수득한 형질전환 식물을 분쇄하고 여과함으로써 트라스투주맙을 추출할 수 있다. 구체적으로, 크로마토그래피 등의 공지의 방법으로 여과하여 목적 단백질을 고순도로 분리해낼 수 있다. 목적 단백질을 추출하기 위하여 식물을 냉동, 건조시키는 등의 전처리를 할 수 있다. 본 발명에 따른 목적 단백질을 과발현하는 형질전환체 담배를 대량으로 급속 증식하여 목적 단백질을 대량 생산할 수 있다.
본 발명의 또 다른 측면은, 상기 변형된 당쇄를 갖는 목적 단백질을 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료하는 방법을 제공한다. 이때, 상기 목적 단백질은 항체일 수 있으며, 구체적으로, 트라스투주맙일 수 있다.
상기 개체는 인간을 포함하는 포유류일 수 있으며, 인간이 아닌 동물일 수 있다. 상기 "인간이 아닌 동물"이라는 용어는 모든 척추동물로서, 인간이 아닌 영장류, 양, 개, 고양이, 말, 소, 닭, 양서류, 파충류 등과 같은 포유동물 및 비(非) 포유동물을 포함할 수 있다. 또한, 상기 개체는 상기 변형된 당쇄를 갖는 트라스투주맙을 투여하여 질환이 경감, 억제 또는 치료될 수 있는 상태이거나 암 질환을 앓고 있는 개체를 의미한다.
상기 투여는 어떠한 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미하며, 투여방법 및 투여경로는 약학 조성물에서 상술한 바와 동일하다.
본 발명의 또 다른 측면은, 암을 예방 또는 치료하기 위한 상기 변형된 당쇄를 갖는 목적 단백질의 용도를 제공한다. 이때, 상기 목적 단백질은 항체일 수 있으며, 구체적으로, 트라스투주맙일 수 있다.
본 발명의 또 다른 측면은, 암의 예방 또는 치료용 약제를 제조하기 위한 상기 변형된 당쇄를 갖는 목적 단백질의 용도를 제공한다. 이때, 상기 목적 단백질은 항체일 수 있으며, 구체적으로, 트라스투주맙일 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
I. 비푸코실화된 담배(
N
.
benthamiana
) 제조
실시예 1.
담배의 5개의 알파-1,3-푸코실트랜스퍼라제 동정
5개의 NbFucT13의 게놈 DNA를 NCBI(https://blast.ncbi.nlm.nih.gov/Blast.cgi) 및 Sol Genomics Network(https://solgenomics.net;(Fernandez-Pozo et al., 2015))에서 블라스팅하여 담배에서 동정한 후에 시퀀싱하였다.
구체적으로, NbFucT13_1은 7개의 엑손(검은 박스) 및 6개의 인트론(흰 박스)을 포함하는 7,280 bp의 길이를 가지며, 코딩 영역 1,503 bp의 cDNA로 스플라이싱되어 500개의 아미노산으로 번역된다. 또한, NbFucT13_2는 7개의 엑손 및 6개의 인트론을 포함하는 7,728 bp의 길이를 가지며, 코딩 영역 1,500 bp의 cDNA로 스플라이싱되어 499개의 아미노산으로 번역된다. NbFucT13_3은 7개의 엑손 및 6개의 인트론을 포함하는 6,600 bp의 길이를 가지며, 코딩 영역 1,545 bp의 cDNA로 스플라이싱되어 514개의 아미노산으로 번역된다. NbFucT13_4는 7개의 엑손 및 6개의 인트론을 포함하는 13,774 bp의 길이를 가지며, 코딩 영역 1,545 bp의 cDNA로 스플라이싱되어 514개의 아미노산으로 번역된다. NbFucT13_5는 단일 엑손을 포함하는 2,312 bp의 길이를 가지며, 코딩 영역 1,535 bp의 cDNA로 전사되어 509개의 아미노산으로 번역된다. 인트론(검은선)은 NbFucT13_1, NbFucT13_2, NbFucT13_3 및 NbFucT13_4에 보존되어 있지만, 상기 인트론은 NbFucT13_5에는 존재하지 않았다(도 1).
5개의 NbFucT13, 5개의 LsFucT13, 및 2개의 Arabidopsis FUT11 및 FUT12를 갖는 계통수를 도 2에 나타내었다. 5개의 NbFucT13a는 LsFucT13 및 Arabidopsis FUT와 구별되었다. 2개의 NbFucT13_1 및 NbFucT13_2를 그룹화 하고 나머지 NbFucT13_3, NbFucT13_4, 및 NbFucT13_5를 그룹화 하였다. NbFucT13_1 단백질은 NbFucT13_2, NbFucT13_3, NbFucT13_4, 및 NbFucT13_5와 각각 88%, 77%, 78%, 및 73% 단백질 동일성을 가졌다. NbFucT13_2는 NbFucT13_3, NbFucT13_4, 및 NbFucT13_5와 각각 71%, 72%, 및 72% 단백질 동일성을 가졌다. NbFucT13_3은 NbFucT13_4 및 NbFucT13_5와 각각 95% 및 89% 단백질 동일성을 가졌다. NbFucT13_4는 NbFucT13_5와 각각 91% 단백질 동일성을 가졌다. 5개의 NbFucT13은 5개의 LsFucT13 단백질과 41% 내지 69%의 동일성을 가졌고, 2개의 Arabidopsis FUT 단백질과 60% 내지 67%의 동일성을 가졌다(하기 표 1 참조).
실시예 2.
NbFucT13
의 전사 측정
5개의 NbFucT13의 정량적인 전사 측정을 위해, NbFucT13_1 및 NbFucT13_2에 대한 5' 비번역 영역(UTR)을 증폭하도록, NbFucT13_3 및 NbFucT13_4에 대해 3' UTR 영역을 증폭하도록 프라이머 쌍을 설계하였다. NbFucT13_5에 대해 단일 엑손 상에서 증폭하도록 프라이머 쌍을 설계하였다. 모든 프라이머를 각각의 유전자 발현을 나타내는 유전자 특이적 영역 상에 설계하였다. 5개의 NbFucT13에 대해 설계한 프라이머는 하기 표 2에 나타내었다.
상기 표 2에 기재된 프라이머들을 이용하여 5개의 NbFucT13의 정량적인 전사를 측정하였다. 구체적으로, QIAzol Lysis Reagent(Cat NO. 79306, QIAGEN)를 사용하여 제조사의 매뉴얼에 따라 조직 식물에서 총 RNA를 분리하였다. 2 ㎍의 전체 RNA를 사용하여 RevertAid RT Reverse Transcription Kit(Cat NO. K1691, Molecular Biology, Thermo fisher)를 사용하여 역전사 과정을 수행한 후, 1차 가닥의 DNA의 실시간 정량적 PCR(RT-qPCR) 분석을 수행하였다.
정량적 PCR은 20 ㎕의 부피로 KAPA SYBR® FAST qPCR Master Mix(2X) Kit(Cat NO. KK4601, KAPABiosystems)를 사용하여 StepOnePlus™ Real-Time PCR System Upgrade(Cat No. 4379216, Applied Biosystems)로 96-웰 블록에서 수행하였다. 반응을 각 수행마다 3회 중복하여 실시하였고, 적어도 2개 이상의 생물학적 복제를 포함시켰다. 절대 정량은 개별 유전자를 함유하는 cDNA의 연속 희석의 증폭에 의해 생성된 표준 곡선을 사용하여 수행하였다. 상이한 샘플에서 각 유전자의 전사 수준을 내부 대조군 PP2A mRNA에 대해 표준화하였다.
그 결과, 5개의 NbFucT13 전사체는 뿌리, 줄기, 4주령 잎, 6주령 잎, 및 꽃에서 보편적으로 존재하였다(도 3). 이때, 두드러진 발현 패턴 없이 상이한 조직에서 일관되게 발현되는 전사체 수준을 기준으로 하였고, 5개의 NbFucT13 모두 전사 활성이었다.
실시예 3.
NbFucT13
를 타겟으로 하는 sgRNA의 설계 및 벡터 제작
고도로 보존된 엑손 서열을 정렬하여 CRISPR/Cas9 RNP의 결합 부위인 sgRNA 표적 영역을 동정하였다. DNA-프리 게놈 편집 방법을 사용하기 위해, 3개의 sgRNA가 5개의 NbFucT13이 녹아웃 시킬 수 있도록 sgRNA를 설계하였다(도 4).
PFT1 sgRNA는 5개의 NbFucT13 중 엑손 4에 표적되며, 20 bp의 PFT1은 NbFucT13_1 및 NbFucT13_2와 완전히 일치하지만, PFT1은 NbFucT13_3 및 NbFucT13_4에서 PFT1 표적 부위의 PAM 서열의 20번째 상류에서 "G"에서 "C"로의 하나의 불일치를 갖고, 붉은색의 단일 뉴클레오티드 다형성(SNP)으로 인해 NbFucT13_5에서 PFT1 표적 부위의 PAM 서열의 5번째 및 20번째 상류에서 "T"에서 "C"로 및 "G"에서 "C"로의 2개의 불일치를 갖는다(도 4).
PFT2 sgRNA는 5개의 NbFucT13 중 엑손 5에 표적되며, 20 bp의 PFT2는 NbFucT13_1 및 NbFucT13_2와 완전히 일치하지만, PFT2는 NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에서 PTF2 표적 부위의 PAM 서열의 8번째 및 18번째 상류에서 "T"에서 "A"로 및 "C"에서 "A"로의 2개의 불일치를 갖는다.
PFT3 sgRNA는 5개의 NbFucT13 중 엑손 3에 표적되며, 20 bp의 PFT3은 NbFucT13_1 및 NbFucT13_2와 완전히 일치하지만, PFT3은 NbFucT13_3 및 NbFucT13_4의 PFT3 표적 부위에 5개의 불일치를 갖고, NbFucT13_5의 PFT3 표적 부위에 4개의 불일치를 갖는다. 아그로박테리움(Agrobacterium)-매개 게놈 편집 방법을 사용하여, 5-유전자-편집된 계통 사이에서 혼동을 방지하기 위해 6개의 sgRNA를 DNA-프리 방법의 3개의 sgRNA와 다르게 설계하였다.
AFT1 및 AFT2는 NbFucT13_1의 엑손 1을 표적하고(도 5a), AFT3 및 AFT4는 FucT13_2의 엑손 1을 표적하고(도 5b), AFT5 및 AFT6은 NbFucT13_3, NbFucT13_4, 및 NbFucT13_5의 엑손 1을 표적하였다(도 5c). 6개의 sgRNA를 모두 일렬로(tandemly) 배열된 tRNA-표적 20 bp-sgRNA 스캐폴드 시스템으로 제작하였고, 골든-게이트 클로닝 시스템을 사용하여 각각의 일렬의 tRNA-sgRNA를 또 다른 일렬의 tRNA-sgRNA와 결합시켰다. 6개의 일렬 반복을 AtU6 프로모터 아래에 배치하였다(도 6).
실시예 4. SpCas9 및 FnCpf1 제조
실시예 4.1. pET28a-SpCas9-BPNLS 또는 pET28a-FnCpf1-BPNLS의 BL21 수용 세포(competent cell)로의 형질전환
먼저, SpCas9는 플라스미드 벡터, pET28a-SpCas9(S. pyogenic Cas9) 및 pET28a-FnCpf1(Francisella novicida Cpf1)을 E. coli 균주 BL21 DE3에 형질전환시켰다. 그 후, 상기 균주가 충분히 배양되었을 때, 균주를 파쇄하고, His6-태그를 이용해 정제하였다. 이때, 발현 가능한 플라스미드 벡터는 N-말단 His6-태그 및 SpCas9의 1 내지 1368 번째 아미노산 서열을 코딩하는 염기서열이 포함된다.
1일차에는 상기 제조한 pET28a-SpCas9-BPNLS 또는 pET28a-FnCpf1-BPNLS를 수용 BL21 RosettaTM2(DE3) pLysS(Novagen, Madison, WI) 세포(Agilent, Santa Clara, CA)에 화학적으로 형질전환하였다. 10 ng의 플라스미드 DNA를 50 ㎕의 해동시킨 수용 세포에 처리하고 얼음에서 30분 동안 배양하였다. 그 후, 42℃ 온도에서 1분 동안 배양하여 세포에 열충격(heat-shock)을 가하고, 600 ㎕의 SOC 배지를 세포에 첨가하고 진탕배양기에서 37℃ 온도에서 1시간 동안 배양물을 배양하였다. 50 ㎍/㎖/ℓ의 카나마이신이 포함된 LB 한천 상에 50 ㎕의 배양물을 분주하였다. 상기 플레이트를 37℃ 온도에서 하룻밤 동안 배양하였다.
실시예 4.2. 세포 배양
2일차에는 연속 희석(원래, 1,000Х, 100,000Х 희석)된 3개의 25-㎖ 종균 배양물을 진탕(baffled) 플라스크에서 하룻밤 동안 배양하여 성장시켰다. 한천 플레이트로부터 1개의 콜로니를 선택하여 50 ㎍/㎖/ℓ의 카나마이신을 포함하는 25 ㎖의 LB배지에 접종하였다(원래). 그 후, 25 ㎕을 50 ㎍/㎖/ℓ의 카나마이신을 포함하는 새로운 25 ㎖의 LB배지로 옮겼다(1,000 희석). 250 ㎕을 50 ㎍/㎖/ℓ의 카나마이신을 포함하는 새로운 25 ㎖의 LB배지로 옮겼다(100,000 희석). 예비 배양물을 진탕배양기에서 30℃ 또는 37℃ 온도, 250 rpm 조건에서 하룻밤 동안 배양하였다.
실시예 4.3. SpCas9 또는 FnCpf1 단백질 생성
10 ㎖의 예비 배양물을 사용하여 21개의 진탕 플라스크 내의 50 ㎍/㎖/ℓ의 카나마이신이 보충된 500 ㎖의 사전 가온된 LB배지에 접종하였다. 세포를 2×500 ㎖의 총 배양 부피로 한번에 발현시켰다. 배양물을 진탕배양기에서 37℃ 온도 및 200 rpm 조건에서 배양하면서 600 nm 파장에서의 광학 밀도(O.D.값)를 매 시간마다 측정하여 세포 성장을 모니터링하였다. 0.6 내지 0.7의 O.D값에서, 온도를 18℃로 낮추고 500 ㎕의 0.5 M IPTG(isopropyl-β-D-1-thiogalactopyranoside)를 각각의 플라스크에 첨가하고 20시간 동안 진탕 배양하였다.
실시예 4.4. 세포 재현탁
세포 배양액을 500 ㎖의 튜브 넣고 4,000 rpm 조건에서 30분 동안 원심분리하였다. 상청액을 제거하고, 1 ℓ의 세포 배양액에서 세포 펠릿 당 25 ㎖의 용균 완충액(20 mM Tris-HCl(pH 8.0), 0.5 NaCl, 5 mM 이미다졸, 1 mM 1,4-디티오트레이톨(DTT), 및 1 mM 페닐메틸설포닐 플루오라이드(PMSF))을 사용하여 세포 펠릿을 재현탁하였다. 재현탁한 세포 펠릿은 추가 정제하여 바로 사용하거나, 액체 질소 내에서 급속 냉각하여 SpCas9 또는 FnCpf1 정제 과정까지 -80℃ 온도에서 보관하였다.
실시예 4.5 세포 용균
초음파분산기를 사용하여 재현탁된 세포 펠릿을 용균하였다. 이때, 세포 현탁물을 초음파분산기에서 40%의 진폭으로 1분 동안 3회 내지 4회 분쇄시켜 세포가 완전히 용균되도록 하였다. 세포 현탁물은 얼음 위에서 용균되었으며, 용균물을 얼음 위에서 보관되었다.
실시예 4.6. 파편(debris) 제거
그 후, 용균물을 50 ㎖ Nalgene Oak Ridge 튜브 내에서 4℃ 온도 및 15,000 rpm(~30,000Хg) 조건에서 60분 동안 원심분리하였다. 그 후, 상청액을 수집하여 1 ㎛ 및 0.45 ㎛의 2개의 연결된 주사기 필터로 여과하고 여과물을 수집하였다.
실시예 4.7. 결합 완충액 및 용리 완충액 제조
먼저, 결합 완충액(20 mM Tris-HCl(pH 8.0), 0.5 M NaCl, 5 mM 이미다졸, 및 1 mM DTT)을 제조하였다. 또한, 용리 완충액(20 mM Tris-HCl(pH 8.0), 0.5 M NaCl, 500 mM 이미다졸, 및 1 mM DTT)을 제조하였다. Histrap-HP 친화 컬럼으로 정제하였다.
이때, 모든 크로마토그래피 단계는 4℃ 온도에서 수행하였다. 20 ㎖의 정제된 용균물을 수퍼루프 상에 한번에 탑재하였다. 단백질이 부착된 컬럼을 결합 완충액(20 mM Tris-HCl(pH 8.0), 0.5 M NaCl, 5 mM 이미다졸) 중에서 평형된 FPLC 시스템에 부착하였다. 흡광도가 다시 기준선에 거의 도달할 때까지 50 ㎖의 세척 완충액으로 5 ㎖/분으로 세척하였다. 50 ㎖의 용리 완충액(20 mM Tris-HCl(pH 8.0), 0.5 M NaCl, 500 mM 이미다졸)으로 용리하였다. Histrap-HP 컬럼을 사용하는 다음 단계에서 유속을 5 ㎖/분으로 설정하고 압력 한계를 0.3 MPa로 설정하였다. 2개의 5 ㎖ 분획을 수집하였다.
실시예 4.8. HisTrap-HP 친화성 컬럼을 이용한 His-단백질 정제
50 ㎖ 주사기를 Histrap-HP 컬럼에 연결하였다. Histrap-HP 컬럼을 10 컬럼 부피의 증류수로 세척하였다. 새로운 50 ㎖ 주사기로 교체하고, 이를 Histrap-HP 컬럼에 연결하였다. Histrap-HP 컬럼을 10 컬럼 부피의 결합 완충액으로 평형화하였다. 주사기 피스톤을 눌러서 유속 및 FPLC 유속(5 ㎖/분)을 조정하였다. 새로운 50 ㎖ 주사기로 교체하고, 이를 Histrap-HP 컬럼에 연결하였다. 10 ㎖의 여과물을 50 ㎖ 주사기에 탑재하였다. 주사기 피스톤을 눌러서 유속 및 FPLC 유속(5 ㎖/분)을 조정하였다. 유속 통과물을 수집하여 His-단백질 손실을 관찰하였다. 새로운 50 ㎖ 주사기로 교체하고, 이를 Histrap-HP 컬럼에 연결하였다. 컬럼을 10 컬럼 부피의 결합 완충액으로 세척하였다. 새로운 50 ㎖ 주사기로 교체하고, 이를 Histrap-HP 컬럼에 연결하였다. 5 컬럼 부피의 용리 완충액을 첨가하였다. 5 ㎖의 용리물마다 분획화하였다. 새로운 50 ㎖ 주사기로 교체하고, 이를 Histrap-HP 컬럼에 연결하였다. 컬럼을 10 컬럼 부피의 결합 완충액으로 세척하였다.
실시예 4.9. His-정제된 SpCas9 또는 FnCpf1 단백질 탈염
10 ㎖의 분획을 53 ㎖ HiPrep 탈염 컬럼을 사용하여 10 ㎖의 저장 완충액(20 mM HEPES, 150 mM KCl, 1 mM DTT, pH7.5, 10 %(v/v) 글리세롤, 1 mM DTT)으로 탈염하였다. 이때, DTT는 사용 직전에 첨가되었다. 그 후, SDS-PAGE를 사용하여 피크 분획을 분석하였다. 브래드포드(Bradford) 분석을 이용하여 단백질 농도를 추정하였다.
실시예 4.10. 농축
용리된 SpCas9 또는 FnCpf1 단백질을 30 kDa Amicon(Millipore)을 사용하여 농축하고, 실험에 요구되는 농도가 되도록 하였다. 이때, SpCas9 또는 FnCpf1 단백질은 침전없이 3 ㎎/㎖ 내지 7 ㎎/㎖까지 농축될 수 있다. 농도는 1 ㎎/㎖이 280 nm 파장에서 0.76의 흡광도를 갖는다(120,450/Mcm의 계산된 흡광 계수를 기초로 함)는 가정에 기초하여 결정하였다.
실시예 5. sgRNA 전사
실시예 5.1. 단일 가닥 sgDNA의 이량체화
sgRNA 전사를 위한 주형을 생성하기 위하여, T7(5'-TAATACGACTCACTATA-3') 프로모터 서열, PAM이 없는 20개 염기의 표적 부위, 및 상보적 영역을 함유하는 유전자 특이적 올리고뉴클레오티드를 tracrRNA 꼬리의 역-상보체를 코딩하는 일정한 올리고뉴클레오티드에 어닐링시켰다. ssDNA 오버행을 T4 DNA 중합효소(M0203S, NEB)로 채우고, 생성된 sgRNA 주형을 QIAquick PCR 정제 키트(28104, QIAGEN)를 사용하여 정제하였다. sgRNA는 MEGAshortscript™ T7 Transcription Kit(A1335, ThermoFisher)를 사용하여 전사시켰다. 이어서 모든 sgRNA를 DNase로 처리하고 MEGAclear™ Transcription Clean-Up Kit(A1908, ThermoFisher)로 처리하였다. Microplate Reader System(FLUOstar Omega, BMG LABTECH)을 사용하여 RNA 농도를 정량화하였다.
구체적으로, SpCas9는 단일 올리고뉴클레오티드 사슬 내의 crRNA 및 tracrRNA 분자의 필수 부분이 결합된 키메라 sgRNA로 프로그램화될 수 있다(Jinek et al., 2012). 생성된 sgRNA는 이의 상류에 T7 중합효소 결합 부위 및 이의 하류에 Cas9 단백질 결합 부위를 갖는 20-mer 표적 특이적 서열을 포함하였다. 유전자 특이적 표적화 서열의 설계는 웹 도구 CHOPCHOP(http://chopchop.cbu.uib.no)를 사용하여 수행하였다. 상기 sgRNA를 어떠한 불일치도 없이 코딩 영역 내를 표적화하도록 설계하였으며, 서열은 바람직하게는 5'-말단에 GG를 포함하고 있었다. 상기 서열은 이의 PAM 모티프로서 NGG가 뒤따랐다. 이중-RNA 가이드를 사용하는 경우, crRNA 가이드는 5'-말단 20-nt 스페이서 서열과, 이어서 3'-말단에 불변의 76-nt 가이드 RNA 스캐폴드로 이루어져 있다(5'-XXXXXXXXXXXXXXXXXXXX-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC -3').
실시예 5.2. Cas9 sgRNA에 대한 전사 주형 제조
표적 특이적 sgRNA 서열을 이의 5'-말단에 17-mer T7 프로모터 영역, 및 이의 3'-말단에 23-mer gRNA 스캐폴드 어닐링 영역과 함께 합성하였으며, 상기 올리고뉴클레오티드의 총 길이는 60-mer가 되도록 하였다. 전사된 sgRNA가 이의 3'-말단에 gRNA 결합 영역을 갖도록 하기 위해, 80-mer gRNA 스캐폴드 서열을 또한 따로 합성하였다. 이어서, 60-mer 및 80-mer 올리고뉴클레오티드를 써모사이클러(thermocycler)를 사용하여 함께 어닐링하고, 완성된 dsDNA를 T4 DNA 중합효소 및 주형으로서 어닐링된 이량체화된 올리고뉴클레오티드를 사용하여 합성하였다.
실시예 5.3. SpCas9 sgRNA에 대한 전사 주형의 대안적인 제조
T7 프로모터 및 가이드 RNA 스캐폴드를 포함하는 플라스미드를 제작하였다. 골든 게이트 클로닝 방법으로 2개의 BsaI 유형 IIS 제한 효소에 의해 T7 프로모터와 가이드 RNA 스캐폴드 사이에 위치한 2개의 BsaI 부위(A↓TAGGTGAGACCGCAGGTCTCG↓GTTTT)의 중앙에 표적의 20 bp의 이중 가닥 올리고뉴클레오티드만을 클로닝하였다. 순방향 단일 올리고뉴클레오티드는 표적 20 nt 앞에 5′-TAGG-3′오버행을 포함해야 하고, 역방향 단일 뉴클레오티드는 역방향 표적 20 nt 앞에서 5′-CAAA-3′로 시작해야 한다. 둘 모두 1 피코몰의 순방향 및 역방향 단일 올리고뉴클레오티드를 45 ㎕의 증류수 중에 혼합하고, 이를 0.2 ㎖ PCR 튜브에 옮기고, 써모사이클러에 의해 95℃ 온도에서 5분 및 55℃ 온도에서 10분 어닐링(annealing)하고, 어닐링된 올리고뉴클레오티드를 얼음 위에 두었다. 그 결과, 이량체화된 올리고뉴클레오티드를 사용하여 2개의 플랭킹 서열인 5-CCTA-3′및 5′-GTTT-3′을 갖는 선형 플라스미드 내로 클로닝하였다. 완성된 작제물을 주형으로서 sgRNA를 합성하는데 사용하였다.
실시예 5.4. FnCpf1 crRNA에 대한 전사 주형 제조
T7 프로모터 및 가이드 RNA 스캐폴드를 포함하는 플라스미드를 제작하였다. 골든 게이트 클로닝 방법으로 2개의 BsaI 유형 IIS 제한 효소에 의해 가이드 RNA 스캐폴드의 말단에 표적의 20 bp 이중 가닥 올리고뉴클레오티드만을 클로닝하였다. 이때, 순방향 단일 올리고뉴클레오티드는 표적 20 nt 앞에 5′-AGAT-3′오버행을 포함해야 하고, 역방향 단일 뉴클레오티드는 역방향 표적 20 nt 앞에서 5′-AAAA-3′으로 시작해야 한다. 둘 모두 1 피코몰의 순방향 및 역방향 단일 올리고뉴클레오티드를 45 ㎕의 증류수 중에 혼합하고, 이를 0.2 ㎖ PCR 튜브에 옮기고, 써모사이클러에 의해 95℃ 온도에서 5분 및 55℃ 온도에서 10분 어닐링하고, 어닐링된 이중가닥 올리고뉴클레오티드(dsODN)를 얼음 위에 두었다. 그 결과, 이량체화된 올리고뉴클레오티드를 사용하여 2개의 플랭킹 서열인 5′-ATCT-3′ 및 5′-TTTT-3′을 갖는 선형 플라스미드 내로 클로닝하였다. 완성된 작제물을 주형으로서 sgRNA를 합성하는데 사용하였다.
실시예
5.5. FnCpf1 crRNA에 대한 전사 주형의 대안적인 제조
T7 프로모터 앞에 5 nt 오버행, 19 nt T7 프로모터, 및 20 nt 표적 스페이서 서열로 이루어진 2개의 63 nt 단일 가닥 올리고뉴클레오티드를 합성하였다. 둘 모두 10 ㎕의 200 nmol의 순방향 및 역방향 단일 올리고뉴클레오티드를 혼합하고, 20 ㎕의 혼합물을 0.2 ㎖ PCR 튜브에 옮기고, 써모사이클러에 의해 95℃ 온도에서 5분 및 55℃ 온도에서 10분 어닐링하고, 어닐링된 dsODN을 얼음 위에 두었다.
실시예 5.6. PCR 증폭에 의한 sgRNA에 대한 dsDNA 주형의 증폭
sgRNA 합성을 위한 전사 주형을 적절한 PCR 프라이머(순방향 프라이머는 5′-AATTCTAATACGACTCACTATAGG-3′이고, 이는 T7 프로모터 서열 앞에 추가의 5개의 AATTC를 포함하고, 역방향 프라이머는 sgRNA 스캐폴드 5′-GCACCGACTCGGTGCCACTT-3′의 말단에 있음)를 사용하여 플라스미드 또는 합성 올리고뉴클레오티드 주형으로부터 PCR 증폭을 할 수 있다. 다량의 dsDNA 주형을 PCR 수행으로 간단하게 수득하였다. Q5® 중합효소를 전사 주형을 증폭하는데 사용하였다. PCR 증폭물은 DNA 전기영동을 수행하여 농도를 예측하고 증폭물 크기를 T7 RNA 전사 합성에서 사용하기 전에 확인하였다. 이때, PCR 혼합물은 전사 반응에서 적어도 10X로 희석하는 경우 바로 사용할 수 있다. 그러나, 정제된 PCR 증폭물을 사용하는 것이 수율이 더 좋다. PCR 증폭물을 상업용 정제(clean-up) 키트 지침에 대한 프로토콜에 따라 정제할 수 있다. PCR 조건을 하기 표 3 및 표 4에 나타내었다.
실시예 5.7. T7 RNA 중합효소에 의한 sgRNA 전사
일반적으로, 1.4 ㎛(1 ㎍의 120 bp PCR 증폭물 또는 어닐링된 dsODN)을 20 ㎕ 시험관 내 전사 반응에서 사용하였다. 이때, 1 ㎍ 주형을 사용하는 것이 1 ㎍/㎕ 초과의 고농도로 100 ㎍ sgRNA를 회수하는데 결정적으로 필요하다.
RNase 오염을 피하기 위해 장갑을 끼고 뉴클레아제가 없는 튜브 및 시약을 사용하였다. 반응은 전형적으로 20 ㎕이지만 필요에 따라 증가할 수 있다. 반응은 뉴클레아제가 없는 마이크로원심분리 튜브 또는 PCR 스트립 튜브에서 구성하였다.
MEGA short script T7 전사 키트 또는 HiScribe™ T7 High Yield RNA 합성 키트의 성분을 해동 및 혼합하여 마이크로원심분리에서 펄스-스핀하여 튜브의 바닥에 용액을 수집하였으며, 그 후, 얼음 위에 두었다.
하기 표 5에 기재된 조건으로 PCR 반응액을 제조하였다.
상기 PCR 반응액을 완전히 혼합하고 마이크로원심분리기에서 펄스 스핀하였다. 최대 수율을 위해 37℃ 온도에서 4시간 이상(O/N 가능) 배양하였다. 이때, 16시간 동안 반응물을 배양하는 것이 안전하다. sgRNA의 양은 4시간 내에 충분히 합성될 수 있으며, 샘플의 증발을 방지하기 위해 써모사이클러에서 배양하였다. DNase를 처리하여 DNA 주형을 제거한 후, 주형 DNA를 제거하기 위해, 20 ㎕의 뉴클레아제가 없는 물을 각각의 20 ㎕ 반응물에 첨가하고, 이어서 2 ㎕의 DNase I(RNase 없음)을 첨가하고, 37℃ 온도에서 15분 동안 배양하였다.
실시예 5.8. sgRNA 정제 (1)
15분 후에, 전사 생성물을 MEGAclean-up 키트를 통해 정제하였다. 정제된 생성물을 새로운 1.5 ㎖ 튜브에 옮겨 100 ㎕의 용리 용액을 첨가하였다. 그 후, 350 ㎕의 결합 용액 농축물을 샘플에 첨가하였다. 피펫팅으로 혼합하고, 250 ㎕의 100% 에탄올을 샘플에 첨가하고 피펫팅으로 혼합하였다. MEGAclean-up 키트의 매뉴얼에 따라, 혼합한 샘플을 스핀-다운 컬럼/2 ㎖에 옮겼다. 12,000 rpm 조건에서 1분 동안 원심분리하였다. 스핀-다운된 용액을 제거하고, 500 ㎕의 세척 용액을 첨가한 후, 다시 12,000 rpm 조건에서 1분 동안 원심분리하였다. 다시 한번, 스핀-다운된 용액을 제거하고, 500 ㎕의 세척 용액을 첨가한 후, 12,000 rpm 조건에서 1분 동안 원심분리 하였다. 스핀-다운된 용액을 제거하고, 스핀-컬럼/2 ㎖ 튜브를 12,000 rpm 조건에서 1분 동안 원심분리하였다. 스핀-컬럼만 새로운 1.5 ㎖ 튜브에 옮겼다. 50 ㎕의 물을 스핀-컬럼/1.5 ㎖ 튜브에 각각 첨가하였다. 스핀-컬럼/1.5 ㎖ 튜브를 70℃ 온도의 힛-블록 위에 10분 동안 반응시켰다. 10분 후에, 스핀-컬럼/1.5 ㎖ 튜브를 12,000 rpm 조건에서 1분 동안 원심분리 하였다. 50 ㎕의 물을 스핀-컬럼/1.5 ㎖ 튜브에 각각 추가로 첨가하였다. 스핀-다운된 용액에서 sgRNA의 농도를 측정하였다.
실시예 5.9. sgRNA 정제 (2)
15분 후에, 전사 생성물을 에탄올 침전에 의해 정제하였다. 에탄올 침전은 sgRNA 농축뿐만 아니라 100 nt 미만의 소형 RNA에도 적용할 수 있다. FnCpf1 crRNA 크기는 100 nt보다 훨씬 작은 66 nt이며, 이는 MEGAclean-up 키트를 사용하기 위한 최소 크기이다. PCR 증폭물의 1/10 부피의 3M 소듐 아세테이트를 PCR 증폭물에 첨가하고, 샘플을 거꾸로 뒤집어서 부드럽게 혼합하였다. 100% 에탄올을 각각의 샘플 튜브에 첨가하였다. 샘플 튜브를 -20℃ 온도에서 30분 동안 배양하였다. 침전된 sgRNA를 4℃ 온도 및 14,000 rpm(16,900Хg) 조건에서 10분 동안 원심분리하였다. 상청액을 제거하고 sgRNA 펠릿을 200 ㎕의 70% 에탄올로 세척하였다. 1분 동안 원심분리하고, 상청액을 제거하고 sgRNA 펠릿을 5분 동안 공기중에서 건조시켰다. sgRNA 펠릿을 50 ㎕의 RNase가 없는 물에 용해시켰다. 260 nm 파장에서의 자외선 흡광도를 측정하여 RNA 농도를 결정하였다.
실시예 6. CRISPR/Cas9을 이용한 형질감염 후 식물 재생
원형질체가 시험관 내 소식물체(plantlet)의 4주령의 5번째 내지 8번째 잎에서 나왔다. CRISPR/Cas9 형질감염 후, 원형질체를 저-용융 한천 배지에 고정시켰다. 고정된 원형질체가 포매(embedding) 후 5일차에 번식하여 마이크로캘러스가 형성되었다(도 7; a). 마이크로캘러스를 2,4-D 및 BAP 식물호르몬을 함유하는 1/2 B5 배지에서 계대배양 하였다(도 7; b 내지 d). 포매 후 3 개월차에 39개의 캘러스 표면에 17개의 녹색 싹이 나타났다(도 7; e). 17개의 녹색 싹은 포매 후 4개월차에 소식물체로 변하였으며, 17개의 소식물체는 포매 후 5개월차에 식물 호르몬이 없는 1/2 MS 배지에 뿌리를 내렸다(도 7; f). 17개의 소식물체가 편집된 NbFucT13 유전자를 포함하고 있는지 여부를 시험하였다.
구체적으로, 먼저, 녹아웃 작제물은 카나마이신 및 히그로마이신에 대한 양성 선별을 위한 항생제 내성 유전자 카세트, Cas9 카세트 및 일렬 폴리시스트로닉 tRNA-gRNA 카세트를 포함하였다. 인간 코돈 최적화된 Cas9 유전자를 pCAMBIA1300 플라스미드 내로 클로닝하여 Cas9 단백질이 발현되도록 하였다. AtUbi(Arabidopsis thaliana ubiquitin 10) 프로모터를 사용하여 담배에서 hCas9 발현을 유도하였다. 담배 세포에서 Cas9 단백질의 핵 위치화(localization)를 용이하게 하기 위해, 이연(bipartite)(KRPAATKKAGQAKKKK) 핵 위치화 신호를 hCas9 개방형 판독 틀의 아미노 및 카복실 말단에 각각 추가하였다. 6개의 gRNA를 pCAMBIA-Cas9에 삽입하였으며, gRNA가 A.thaliana U6 프로모터의 제어 하에 발현되었다. gRNA가 N.benthamiana 유전자 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4 및 NbFucT13_5를 표적화하도록 설계하였다.
담배(Nicotiana benthamiana) 종자를 0.4% 히포클로라이트 용액에서 1분 동안 멸균시키고, 증류수로 3회 세척하고, 2% 수크로스가 보충된 0.5ХGamborg B5 고체 배지에 뿌렸다. B5 배지에서 성장한 4주령 잎을 효소(1.5% 셀룰로스 R10, 0.3% 마세로자임 R10, 0.5 M 만니톨, 8 mM CaCl2, 5 mM MES [pH 5.7], 0.1% BSA)로 4시간 동안 25℃ 온도에서 어두운 곳에서 반응시켰다.
둥근 바닥 튜브에서 100×g에서 6분 동안 원심분리하여 원형질체를 수집하기 전에 혼합물을 여과하였다. 재현탁된 원형질체를 W5(154 mM NaCl, 125 mM CaCl22H2O, 5 mM KCI, 2 mM MES [pH5.7]) 용액으로 세척하고, 100Хg 조건에서 6분 동안 원심분리하여 펠릿화 하였다. 마지막으로, 원형질체를 MMG(0.4 M 만니톨, 15 mM MgCl2, 4 mM MES [pH 5.7]) 용액에 재현탁하고 혈구계수기를 사용하여 현미경으로 계수하였다. 원형질체를 MMG 용액의 1Х106 원형질체/㎖의 밀도로 희석하고 PEG-매개 형질감염 전에 4℃ 온도에서 적어도 30분 동안 안정화시켰다.
2Х105 원형질체 세포를 시험관 내-전사된 sgRNA(20 ㎍)와 미리 혼합한 Cas9 단백질(10 ㎍)로 형질감염시켰다. 형질감염 전에, Cas9 단백질을 1Х NEB 완충액 3 중에서 sgRNA와 혼합하고 실온에서 10분간 배양하였다. 200 ㎕ MMG 용액에 재현탁된 원형질체 혼합물을 10 ㎕ 내지 20 ㎕의 RNP 복합체 및 210 ㎕ 내지 220 ㎕의 제조한 PEG(0.2M 만니톨, 40% w/v PEG-4000, 100 mM CaCl2) 용액과 혼합하고 25℃ 온도에서 15분간 배양하였다.
실온에서 15분 배양한 후, 840 ㎕ 내지 880 ㎕의 W5 용액을 첨가하여 형질전환을 중단시켰다. 이어서, 원형질체를 실온에서 100×g 조건에서 2분간 원심분리하여 펠릿을 수집하고, 1 ㎖의 세척 완충액을 첨가하여 100×g 조건에서 2분간 추가로 원심분리하여 한번 더 세척하였다. 원형질체의 밀도를 1×105/㎖로 조정한 후, 이를 변형 PIM(B5 배지 1.58 g, 수크로오스 103 g, 2,4-D 0.2 ㎎, BAP 0.3 ㎎, MES 0.1 g, CaCl22H2O 375 ㎎, NaFe-EDTA 18.35 ㎎ 및 숙신산 나트륨 270 ㎎) 배지에서 배양하였다.
RNP-형질감염된 세포를 PIM 배지에 재현탁시켰다. 세포를 PIM 배지와 2.4% 아가로스의 1:1 용액과 혼합하여 2.5Х105 세포/㎖의 배양 밀도로 만들었다. 아가로스에 포매된 원형질체를 6-웰 플레이트에 플레이팅하고, 액체 PIM 배양 배지 1 ㎖를 깔고, 25℃ 온도에서 배양하였다. 7일 후에, 액체 배지를 새로운 배양 배지로 교체하였다. 배양물을 빛(14 h 명 [50 ㎛ol m-2 s-1] 및 10 h 암)으로 옮기고 25℃ 온도에서 배양하였다. 3주 동안 배양한 후, 수십 밀리미터 직경으로 자란 마이크로-캘러스를 30 g/ℓ 수크로스, 0.6% 식물 한천, 0.2 ㎎/ℓ의 α-나프탈렌아세트산(NAA), 0.3 ㎎/ℓ BAP로 보충된 MS 재생 배지로 옮겼다. 재생 배지에서 약 4주 후에 다수의 싹의 유도가 관찰되었다.
전체 식물을 재생시키기 위해, 증식되고 신장된 부정지(adventitious shoot)를 신선한 재생 배지로 옮겨 25℃ 온도에서 빛(14 h 명 [150 ㎛ol m2 s1] 및 10 h 암)에서 4주 내지 6주간 배양하였다. 뿌리 유도를 위해, 길이가 약 3 ㎝ 내지 5 ㎝인 소식물체를 잘라서 마젠타 용기 내의 고체 호르몬이 없는 1X MS 배지에 옮겼다. 부정지에서 발달한 소식물체를 순응시켜 포팅 토양에 이식하고, 25℃ 온도의 성장 챔버에서 유지시켰다.
모든 식물을 장일(14-h 명/10-h 암 광주기)조건 하에서 25℃ 온도에서 150Em-2s-1 LED 빛 아래서 성장시켰다.
아그로박테리움-매개 게놈 편집 방법에 아그로박테리움과 공동-배양한 1 cm 사각형의 잎 외식편을 사용하였다(도 8; a). 공동-배양한 외식편을 2회 또는 3회의 한천 플레이트 교체를 통해 6주 동안 25 ㎎/ℓ 히그로마이신 하에 계대배양하고, 이어서 새로운 싹이 생성되었다(도 8; b). 새로운 싹을 절반 강도의 MS 배지로 옮기고 용기 내에서 소식물체로 성장시켰다(도 8; c). 소식물체를 포트에 옮기고 종자가 수확될 때까지 유지시켰다(도 8; d).
구체적으로, 8주령 담배 식물의 잎을 수확하고 50%(v/v) NaCl2로 1분간 멸균하였다. 이어서 잎을 멸균수로 4회 세척하였다. 멸균된 잎을 1 cm 사각형으로 절단하고, O.D값이 0.6인 액체 형질전환 배지(1X Murashige and Skoog 염기성 염 혼합물, 3% 수크로스, 2.0 ㎎/ℓ BAP, 0.2 ㎎/ℓ NAA, pH 5.8)에서 희석된 pCAMBIA-Cas9-gRNA를 함유하는 예비-배양한 아그로박테리움과 함께 실온에서 10분 동안 배양하였다. 사각형 잎을 이어서 어두운 곳에서 실온에서 고체 형질전환 배지(1X Murashige and Skoog 염기성 염 혼합물, 3% 수크로스, 2.0 ㎎/ℓ BAP, 0.2 ㎎/ℓ 1%(w/v) 식물 한천, pH 5.8)에 두었다.
2일 후에, 사각형 잎을 선별 유도 배지(1X Murashige and Skoog 염기성 염 혼합물, 3% 수크로스, 2.0 ㎎/ℓ BAP, 0.2 ㎎/ℓ NAA, 1%(w/v) 식물 한천, 25 ㎎/ℓ 히그로마이신, 200 ㎎/ℓ 티멘틴, pH 5.8)로 옮겼다. 5주 후에, 캘러스 조직을 선별 유도 배지로 옮겼다. 캘러스로부터 싹을 절단하고 뿌리 유도 배지(1X Murashige and Skoog 염기성 염 혼합물, 3% 수크로스, 1%(w/v) 식물 한천, 25 ㎎/ℓ 히그로마이신, 200 ㎎/ℓ 티멘틴® 멸균 티카실린 다이소듐 및 클라불산 포타슘, pH 5.8)로 옮겼다. 뿌리가 있는 형질전환 식물을 흙으로 옮겼다. 6주 내지 7주 후에, 형질전환 식물로부터 종자를 수집하였다. 이때, 모든 식물을 장일(14-h 명/10-h 암 광주기)조건 하에서 25℃ 온도에서 150Em-2s-1 LED 빛 아래서 성장시켰다.
실시예 7.
NbFucT13
에 대한 게놈 편집된 계통의 스크리닝
5개의 NbFucT13은 고도로 보존된 코딩 영역을 가지고 있어서 NbFucT13 편집 효과를 모니터링하기 전에 프라이머가 특정 영역을 증폭하도록 설계할 때 어려움이 있었다. 유전자 특이적 프라이머를 표적 sgRNA 부위 및 충분한 SNP를 포함하여 각 유전자를 증폭하도록 설계하였고, 이는 5개의 NbFucT13을 구별할 수 있도록 한다(표 6).
DNA-프리 게놈 편집 방법을 적용하였을 때, 유전자 특이적 프라이머 쌍은 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에 대해 각각 2,978 bp, 3,434 bp, 4,393 bp, 1,028 bp, 및 1,664 bp를 증폭하였다(도 9). PCR 증폭물은 NbFucT13_1의 #37에서 다중 크기의 증폭물을 나타냈으며; NbFucT13_2의 #10, #33 및 #36에서 다중 크기의 증폭물을 나타냈고 NbFucT13_2의 #37에서 더 작은 크기의 증폭물을 나타냈다(도 9).
아그로박테리움-매개 게놈 편집 방법을 적용하였을 때, 유전자 특이적 프라이머 쌍은 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에 대해 각각 774 bp, 760 bp, 411 bp, 461 bp, 및 1,664 bp를 증폭하였다(도 10). PCR 증폭물은 16개의 형질전환 계통에서 #101 내지 #116의 다중 크기 증폭물을 나타냈다(도 10).
구체적으로, 상기 아그로박테리움-매개 게놈 편집 방법으로 형질전환시킨 식물체의 Q5 Hot Start High-Fidelity 2x Master Mix(NewEngland Biolabs)를 사용하여 게놈 DNA로부터 증폭힌 PCR 증폭물을 All in one Cloning Kit(Biofact, South Korea)를 사용하여 TA 벡터에 클로닝 하였다. 각각의 PCR 증폭물에 대해 클로닝된 TA 벡터의 양성의 15개의 콜로니를 시퀀싱 하였다.
실시예 8.
NbFucT13
에 대해 게놈 편집된 계통의 동정
시퀀싱 결과에 따라, 6개의 T0 계통 #8, #10, #27, #33, #36, 및 #37을 DNA-프리 게놈 편집 방법으로 유전자를 편집하였다. 그 결과를 하기 표 7에 나타내었다.
상기 표 7에 나타난 바와 같이, 계통 #8은 NbFucT13_1, NbFucT13_2, 및 NbFucT13_3에 대한 3중 KO 및 NbFucT13_4에 대한 이형접합체를 포함하였다(도 11). 계통 #10은 NbFucT13_2에 대한 단일 KO 및 NbFucT13_1, NbFucT13_3, 및 NbFucT13_4에 대한 3개의 이형접합체를 포함하였다(도 12). 계통 #27은 NbFucT13_3에 대한 단일 KO 및 NbFucT13_2에 대한 이형접합체를 포함하였다(도 13).
계통 #33은 NbFucT13_1 및 NbFucT13_2에 대한 2 중 KO 및 NbFucT13_3 및 NbFucT13_4에 대한 2개의 이형접합체를 포함하였다. 계통 #36은 계통 #10과 동일한 결과를 가졌다. 계통 #37은 NbFucT13_1, NbFucT13_2, 및 NbFucT13_3에 대한 3중 KO 및 NbFucT13_4에 대한 이형접합체를 가졌다(표 4). T1 세대에서, 계통 #27-4는 NbFucT13_3에 대한 단일 KO를 가졌고, 계통 #27-21은 NbFucT13_2 및 NbFucT13_3에 대해 2중 KO를 가졌다. 계통 #10-15는 NbFucT13_1 및 NbFucT13_2에 대한 2중 KO를 가졌고 계통 #10-8은 NbFucT13_1, NbFucT13_2, 및 NbFucT13_4에 대해 3중 KO를 가졌다. 계통 #37-26은 NbFucT13_1, NbFucT13_2, NbFucT13_3 및 NbFucT13_4에 대해 4중 KO를 가졌다(표 7).
구체적으로, 계통 #37-26은 NBFucT13_1, NBFucT13_2, NBFucT13_3, 및 NBFucT13_4에 대해 4개의 편집된 유전자를 포함하였다. 구체적으로, NBFucT13_1은 -709/+1, +1/+1의 쌍대립형질(biallelic) 돌연변이가 있음; NBFucT13_2는 -2/-592; -1/-593의 쌍대립형질 돌연변이가 있음; NBFucT13_3은 +1, -9의 쌍대립형질 돌연변이가 있음; NBFucT13_4는 +1, +1의 쌍대립형질 돌연변이가 있음; 한편, NbFucT13_5는 돌연변이가 없음; 이를 도 14에 나타내었다.
#101에서 #116까지의 16개의 T1 형질전환 계통을 아그로박테리움-매개 게놈 편집 방법으로 유전자를 편집하였다(표 8 및 도 15 내지 도 19).
계통 #101은 NbFucT13_1 및 NbFucT13_5에 대한 2중 KO 및 NbFucT13_2, NbFucT13_3 및 NbFucT13_4에 대한 3개의 이형접합체를 가졌다. 계통 #102는 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4 및 NbFucT13_5에 대한 4중 KO를 가졌다. 계통 #4는 NbFucT13_1에 대한 단일 KO 및 NbFucT13_2, NbFucT13_3 및 ㅍ5에 대한 3개의 이형접합체를 가졌다.
계통 #107은 NbFucT13_1, NbFucT13_3 및 NbFucT13_5에 대한 3중 KO 및 NbFucT13_2 및 NbFucT13_4에 대한 2개의 이형접합체를 가졌다. 계통 #108은 NbFucT13_1, NbFucT13_2, NbFucT13_3 및 NbFucT13_4에 대한 4중 KO 및 NbFucT13_4에 대한 1개의 이형접합체를 가졌다. 계통 #109는 NbFucT13_1 및 NbFucT13_2에 대한 2중 KO 및 NbFucT13_3, NbFucT13_4 및 NbFucT13_5에 대한 3개의 이형접합체를 가졌다. 계통 #111은 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4 및 NbFucT13_5에 대한 4중 KO를 가졌다. 계통 #112는 NbFucT13_1, NbFucT13_3, NbFucT13_4 및 NbFucT13_5에 대한 4중 KO 및 NbFucT13_2에 대한 1개의 이형접합체를 가졌다. 계통 #113은 NbFucT13_1, NbFucT13_4 및 NbFucT13_5에 대한 3중 KO 및 NbFucT13_2 및 NbFucT13_3에 대한 2개의 이형접합체를 가졌다. 계통 #114는 NbFucT13_1 및 NbFucT13_3에 대한 2중 KO 및 NbFucT13_2, NbFucT13_4 및 5에 대한 3개의 이형접합체를 가졌다. 계통 #15는 NbFucT13_4 및 5에 대한 2중 KO 및 NbFucT13_1, NbFucT13_2 및 NbFucT13_3에 대한 3개의 이형접합체를 가졌다. 계통 #116은 NbFucT13_1에 대한 단일 KO 및 NbFucT13_2, NbFucT13_3, NbFucT13_4 및 NbFucT13_5에 대한 4개의 이형접합체를 가졌다.
실시예 9. 고도로 상동인
NbFucT13
에서 편집된 서열 복잡성
3개의 sgRNA를 DNA-프리 게놈 편집 방법으로 담배의 원형질체에 한번에 형질감염시켰다. 각각의 sgRNA는 생어-염기서열 분석(Sanger-sequencing)을 기준으로 다른 게놈 편집 효율성을 나타냈다(표 9).
상기 표 9에 나타난 바와 같이, PFT1은 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에서 각각 29%, 37%, 22%, 9%, 및 0%의 편집 효율을 가졌다. PFT2는 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에서 각각 17%, 14%, 11%, 7%, 및 0%의 편집 효율을 가졌다.
PFT3은 NbFucT13_1, NbFucT13_2, NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에서 각각 12%, 22%, 0%, 0%, 및 0%의 편집 효율을 가졌다. PFT1은 3개의 sgRNA 중에서 가장 높은 게놈 편집 효율을 보였으며, NbFucT13_3 및 NbFucT13_4의 스페이서 중 20번째에서 1 bp 불일치를 갖는 19 bp의 일치는 22% 및 9 %의 편집 효율을 나타냈지만, NbFucT13_5의 스페이서 중 5번째 및 20번째에서 2 bp의 불일치를 갖는 18 bp의 일치는 0%의 효율을 나타냈다.
6개의 sgRNA를 아그로박테리움-매개 게놈 편집 방법으로 N.benthamiana의 잎 외식편에 형질전환시켰다. 각각의 sgRNA는 생어-염기서열 분석 기준으로 다른 게놈 편집 효율성을 나타냈다(표 10).
상기 표 10에 나타난 바와 같이, AFT1 및 AFT2는 NbFucT13_1에서만 80% 및 27%의 편집 효율을 나타냈다. AFT3은 NbFucT13_1 및 NbFucT13_2에서 각각 8% 및 37%의 편집 효율을 나타냈다. AFT4는 NbFucT13_1 및 NbFucT13_2에서 각각 25% 및 26%의 편집 효율을 나타냈다. AFT5는 NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에서 각각 46%, 42%, 및 72%의 편집 효율을 나타냈다. AFT6은 NbFucT13_3, NbFucT13_4, 및 NbFucT13_5에서 각각 58%, 44%, 및 71%의 편집 효율을 나타냈다.
실시예 10. RGEN(RNA-guided engineered nucleases)으로 유전자 변이 효율 검증
하기 표 11과 같이 타겟 PCR 증폭물을 제외한 Cas9 단백질과 sgRNA, NEB3.1 버퍼를 PCR 튜브에 넣어 주었다. 이때, Cas9과 sgRNA는 1:1.2의 분자비로 처리하였다.
그 후, 상온에서 10분 동안 배양한 후, RNP 복합체에 타겟 PCR 증폭물을 넣어주었다. 37℃ 온도에서 1시간 배양한 후, DNA 염색약을 이용해 아가로스겔(agarose gel)에 로딩한 후 전기영동하여 결과를 확인하였다. 식물세포에 형질도입될 때 RNP 복합체 조합 두 가지(A와 B)로 한 후, 시간별로 세포를 확인하였다.
그 결과, 유전자 편집 효율은 잘리지 않은 밴드의 강도로 알 수 있으며, 각 밴드 위에 숫자로 유전자 편집 효율을 %로 표시하였다(도 20 및 도 21). 먼저, A 조합(set A)에서는 NbFucT13_1 유전자의 경우 72시간에 29%의 유전자 편집을 보이며, NbFucT13_3 유전자의 경우 48시간에 35%, NbFucT13_4 유전자에서는 24시간의 22%의 유전자 편집을 나타내었다. 또한, B 조합(set B)에서는 NbFucT13_1 유전자의 경우 24시간에 28%의 유전자 편집을 보이며, NbFucT13_3 유전자의 경우는 48시간에 42%, NbFucT13_4 유전자의 경우 72시간에 20% 의 유전자 편집을 나타내었다. 이를 통해, A 조합과 B 조합의 차이는 나타나지만 전체적인 유전자 편집 효율은 20% 내지 30%로 나타나며. 현재 사용했던 타겟 sgRNA가 in vivo, 즉 생체 내에서도 유전자 편집 효과를 나타낼 수 있는 것을 확인하였다.
II. 비푸코실화된 담배(
N
.
benthamiana
)로부터 생산된 트라스투주맙
실시예 11.
NbFucT13
에 대해 게놈 편집된 계통으로부터 생산된 트라스투주맙 당쇄 분석
총 단백질의 N-글리칸 프로파일을 매트릭스-보조 레이저 탈착 이온화(MALDI)-비행 시간형(TOF) 질량 분석(MS)으로 결정하였다. 구체적으로, Nb wt 식물 및 NbFT KO 식물(#37)의 동결된 잎을 막자사발과 막자를 이용하여 분쇄하였다. 2 부피의 포스페이트 완충된 염수 용액(GE Healthcare Life Sciences, USA)을 분말에 첨가하고 반복적으로 교반하며 10분 동안 혼합하였다. 이어서, 혼합물을 4℃ 온도에서 20분 동안 원심분리하고, 상청액을 회수하였다. 상청액을 Minisart RC4 주사기 필터(0.45 ㎛, Sartorius Stedim Lab Ltd, UK)를 사용하여 여과하고, VIVASPIN 500 농축기(30 kDa, PES, Sartorius Stedim Lab Ltd, UK)를 사용하여 농축하였다. 여과물 중의 총 가용성 단백질의 양을 브래드포드 분석으로 측정하였다.
50 ㎍의 TSP를 37℃ 온도에서 16시간 동안 PNGase A(10 U, NEB, USA)와 반응시켰다. 방출된 N-글리칸을 Extract-Clean SPE 카트리지(S* Pure Pte Ltd., Singapore)를 사용하여 다음과 같이 추출하였다: 카트리지를 10 ㎖의 용액 I(80% 아세토니트릴, 0.1% 트리플루오로아세트산)로 활성화시키고 10 ㎖의 물로 세척하였다. N-글리칸 혼합물을 카트리지 상에 탑재하고, 10 ㎖의 물로 세척하고, 1 ㎖의 용액 II(25% 아세토니트릴, 0.075% 트리플루오로아세트산)로 용리하였다. 용리된 N-글리칸을 고속 진공(HyperVAC-MAX, Labex, South Korea)을 사용하여 건조시켰다.
건조된 N-글리칸을 65℃ 온도에서 3시간 동안 2-아미노벤즈아미드(2-AB, Sigma-Aldrich, USA)로 표지하고, 표지된 N-글리칸을 Bond Elut-CN 카트리지(Agilent technologies, USA)를 사용하여 다음과 같이 추출하였다: 카트리지를 1 ㎖의 용액 I(25% 아세토니트릴)로 활성화시키고 1 ㎖의 용액 II(96% 아세토니트릴)로 세척하였다. 표지된 N-글리칸을 카트리지 상에 탑재하고, 2 ㎖의 용액 II로 세척하고, 용액 III(60% 아세토니트릴)으로 용리하였다. 용리된 N-글리칸을 고속 진공을 사용하여 건조시키고, 물에 용해시키고, 양성 반사기(reflectron) 모드를 사용하여 MALDI-TOF 질량 분석기(ultraflex III, Bruker Daltonics, Germany)로 분석하였다. 이때, 아세토니트릴 및 물을 Millipore(USA)로부터 구입하고, 2-AB 및 트리플루오로아세트산을 Sigma-Aldrich(USA)로부터 각각 구입하였다.
그 결과, Nbwt에서 N-글리칸의 MALDI-TOF MS 분석은 7개의 주요 N-글리칸, MUX, MUFX, MMXF, GnMx/mGnX, GnMXF/mGnXF, Gn, 및(FA)GnXF/Gn(FA)XF의 존재를 나타냈다(도 22; a). #37 식물에서, MUX, MMX, 및 GnMX/mGnX의 3개의 주요 피크가 검출되었다(도 22; b). 푸코스와 자일로스가 Nbwt의 N-글리칸에서 검출되었다. 식물 #37의 N-글리칸에서 푸코스는 검출되지 않았고, 자일로스는 검출되었다. 재조합 트라스투주맙은 Nbwt와 계통 #37에서 일시적으로 발현되었다.
실시예 12.
NbFucT13
에 대해 게놈 편집된 계통으로부터 생산된 트라스투주맙의 세포-매개 세포독성(ADCC) 분석
정제된 트라스투주맙/Nbwt 및 트라스투주맙/#37을 항체-의존 세포-매개 세포독성(ADCC) 검정법에 의해 양성 대조군으로서 트라스투주맙을 사용하여 약물 효능에 대해 조사하였다.
구체적으로, 분석 하루 전날 타겟세포(target cell, T)인 SKBR3 암세포주(ATCC)를 1×104 cells/100 ㎕/well로 필요한 샘플 수를 고려하여 96-웰-플레이트(SPL, South Korea)에 분주하였다. 다음날, 효과세포(effector cell)인 Jurkat T세포주의 세포수를 측정하여 E:T=15:1의 비율이 되도록 10% low IgG FBS-RPMI1640에 재분주하였다. 이때, FBS는 분석에 영향을 줄 수 있으므로, low IgG FBS를 사용하였으며, 히그로마이신(hygromycin) 및 G418 항생제는 SKBR3 암세포주를 죽일 수 있으므로 사용하지 않았다. 구체적으로, E:T=15:1의 비율이 되도록 효과세포인 jurkat T세포를 1.5×105 cells을 처리하기 위해 1.5×106 cells/㎖로 10% low IgG FBS-RPMI1640에 재분주하였다.
96-웰-플레이트의 각 웰의 배지를 제거하고 Jurkat T세포에 시판되는 트라스투주맙(Herceptin, Avastin; Roche, Switzerland), 상기 실시예 11에서 Nbwt에서 분리한 트라스투주맙 및 NbFT KO 식물(#37)에서 분리한 트라스투주맙 10 ㎍/㎖로부터 시작하여 연속 희석시켜 15:1(1.5Х106/㎖: 이펙터 세포, 1Х105/㎖: 표적 세포; 최종 부피: 100 ㎕)의 E/T 비율로 첨가하였다.
96-웰-플레이트에 있던 SKBR3 암세포주의 배지를 제거하고, jurkat T세포와 상기 각각의 트라스투주맙의 총 부피가 100 ㎕가 되도록 하여 SKBR3 암세포주에 넣어주었다. Bio-Glo™ 루시퍼라제 시약(Promega, USA)을 첨가하기 전에 5% CO2의 가습 대기에서 37℃ 온도에서 하룻밤 동안 배양하였다. 다음 날, 각 웰당 70 ㎕의 Bio-Glo™ 루시퍼라제 시약을 첨가하여 FLUO star Omega Plate 계수기(PerkinElmer, USA)를 사용하는 발광값(luminescence)을 상대 루시퍼라제 단위(RLU)로 표시하였다. GraphPAD PRISM 프로그램을 사용하여 IC50의 농도 값을 구하였다.
그 결과, 트라스투주맙, 트라스투주맙/Nbwt, 및 트라스투주맙/#37에서 IC50은 4 ng/㎖, 11 ng/㎖, 및 1 ng/㎖이었다. 정제된 트라스투주맙/#37은 ADCC 검정법에서 다른 트라스투주맙들보다 높은 항체의존세포독성 효과를 나타내는 것을 확인하였다(도 23).
실시예 13. 트라스투주맙 유전자의 식물 코돈 최적화
서열번호 3 및 4에 해당하는 유전자는 식물에서 이종 단백질의 발현을 개선시키기 위해 코돈 최적화된 염기서열로서, 하기 방법을 통해 코돈 최적화하였다.
서열번호 1로 표시되는 아미노산 서열로 이루어진 중쇄 및 서열번호 2로 표시되는 아미노산 서열로 이루어진 경쇄를 포함하는 트라스투주맙의 아미노산 서열로부터 기계적으로 얻은 염기서열에 대한 코돈 사용량, 아미노산 별 코돈 빈도를 CAIcal SERVER를 이용하여 분석하였다. 그 후, 식물의 대표 모델식물인 애기장대와 담배의 레퍼런스 유전자에 대한 코돈 분석하고, 그 결과를 트라스투주맙의 분석결과와 비교하여 레퍼런스의 코돈 분석 결과와 비슷해지도록 하나하나의 코돈을 최적화하였다.
구체적으로, 하나의 아미노산을 암호화하는 코돈에 대하여 유전자 내에 편중되어 있는 코돈을 GC 함유율과 희귀코돈 빈도를 고려하여 서열을 최적화하였다. 최종적으로, 플라스미드 재조합 시 사용될 제한효소 인식부위가 있는지 확인 후, 코돈을 변형하고 전체 아미노산 서열이 바뀌지 않았는지 확인하였다.
실시예 14. 식물에 최적화된 재조합 유전자를 포함하는 재조합 유전자 제조
코돈 최적화된 유전자의 염기서열을 IDT(Integrated DNA Technologies, Inc.)에 합성을 의뢰하여 기본적인 클로닝 벡터에 재조합된 플라스미드를 수득하였다.
실시예 15. 유전자를 포함하는 재조합 벡터 제조
합성되어 얻은 플라스미드를 Bsa I 제한효소를 첨가하여 트라스투주맙의 중쇄 유전자(서열번호 3)와 경쇄 유전자(서열번호 4)만을 아가로즈 젤 추출하였다. Bsa I으로 절단된 식물 발현벡터(pICH31070, pICH31180)에 각 유전자 절편을 T4 리가아제를 이용하여 연결하였다.
실시예 16. 발현벡터로 형질전환된 아그로박테리아 제조
트라스투주맙의 중쇄 유전자(서열번호 3)와 경쇄 유전자(서열번호 4)를 갖는 각각의 발현벡터(pICH31070, pICH31180)를 아그로박테리움 세포(GV3101)에 각각 형질전환 시킨 후 배지(YEP agar plate)에 도말하고 28℃ 온도에서 약 2일간 배양하였다. 그 후, 생성된 단일 콜로니를 액체 배지(YEP broth)에 접종하고 28℃ 온도에서 200 rpm 조건으로 약 2일간 전배양하였다. 전배양액을 새 액체 배지 양의 0.5% 비율로 접종하고 28℃ 온도에서 200 rpm 조건으로 O.D.값이 1.2 내지 1.8이 될 때까지 배양하였다.
실시예 17. 형질전환 식물세포를 이용한 트라스투주맙 생산
상기 진탕 배양한 형질전환 아그로박테리아를 함침용 완충용액(10 mM MES, pH 5.6, 10 mM MgSO4)을 첨가하여 O.D.값이 0.02가 되도록 희석하였다. 중쇄와 경쇄를 포함하는 희석된 형질전환 아그로박테리아를 1:1 비율로 섞고, 진공 챔버 내에서 이 혼합액에 담배 잎을 담궜다. 진공 챔버에 진공을 걸고 목표 압력에 도달한 후 압력을 풀어주어 담배 잎을 꺼내서 말렸다. 그 후, 말린 담배 잎을 24℃ 온도 및 상대습도 41% 조건의 전용 배양실에 넣었다. 침윤 7일 후에 조직을 회수하여 발현된 단백질의 양을 확인하였다.
실시예 18. 웨스턴 블랏을 통한 형질전환 식물세포로부터 생산된 트라스투주맙의 발현량 확인
상기 회수한 식물체를 액체질소로 냉동시킨 후 유리막대로 파쇄하였다. 그 후, 단백질 추출용 완충용액(50 mM Sodium phosphate, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.1%(v/v) Triton X-100)을 넣어 혼합하고 4℃ 온도에서 10분간 정치한 후, 4℃ 온도 및 13,000 rpm 조건으로 10분간 원심분리하여 상등액을 회수하였다.
회수한 상등액을 적정량 취하여 8% SDS-PAGE겔(80 V, 30 min / 120 V, 1 hr)에 약 1시간 30분 동안 전기영동하였다. 양성 대조군으로 시판중인 trastuzumab, Herceptin 0.5 ㎍을 사용하였다. 전기영동이 끝난 겔을 분리한 후, PVDF 멤브레인을 이용해 웨스턴 블롯팅하여 트라스투주맙의 발현양을 확인하였다(도 24). 도 24에서 PH와 TH는 각각 PVX vector:: trastuzumab HC- TMV vector:: trastuzumab LC 쌍과 TMV vector:: trastuzumab HC- PVX vector:: trastuzumab LC 쌍을 의미한다.
그 결과, 도 24 및 도 25에 나타난 바와 같이, 코돈 최적화된 염기서열이 발현되는 형질전환 식물체의 경우 트라스투주맙의 발현양이 대조군 대비 2.5배 이상 증가하였다. 특히, PVX vector:: trastuzumab HC- TMV vector:: trastuzumab LC 쌍의 경우 7배 내지 17배까지 발현양이 증가하는 것을 확인하였다. 반면, 코돈 최적화되지 않은 염기서열이 발현되는 형질전환 식물체의 경우 대조군에 비해 트라스투주맙의 발현양이 적었다.
실시예 19. 형질전환 식물세포로부터 생산된 트라스투주맙의 당쇄 분석
효소를 이용하여 당쇄를 트라스투주맙으로부터 분리하기 위해, 50 ㎍의 형질전환 식물세포로부터 생산된 트라스투주맙을 변성 완충액(0.1% RapiGest, 5 mM DTT, 20mM IAA)에 1 시간 반응시켰다. 피히아 파스토리스(Pichia pastoris) 에서 발현된 재조합 PNGase A(peptide N-glycosidase A; 5,000 units/㎖, New England BioLabs) 10 units를 가하고 혼합액을 37℃ 온도의 인큐베이터에서 16시간 동안 배양하였다.
PNGase A로 분리된 당쇄 함유 시료를 흑연 처리한 탄소 카트리지 SPE(Extract-clean SPE carbo; 충진량 150 ㎎, 카트리지 부피 4 ㎖)로 정제하였다. 0.1% 트리플루오로초산(TFA) 함유 80%(v/v) 아세토나이트릴(ACN) 10 ㎖로 활성화 시킨 후 초순수 10 ㎖로 세척하였다. 당쇄 함유 시료를 흘려 흡착시킨 후 카트리지 부피 수배의 초순수를 흘려주어 염을 제거하였다. N-당쇄는 25%(v/v) ACN과 0.075%(v/v) TFA로 당쇄를 용출시켜 원심식 증발기로 건조하였다.
아세트산(Acetic acid, Sigma-aldrich)과 DMSO(Sigma-aldrich)를 1:2 비율로 제조한 완충용액 100 ㎕ 에 5 ㎎ 2-AB(Anthanilamide, Sigma-aldrich)와 6 ㎎ sodium cyanoborohydride(Sigma-aldrich)를 완전히 용해시켜 형광표지 용액을 제조하였다. 건조된 당쇄시료에 10㎕ 의 형광표지 용액을 첨가하고 65℃ 온도에서 3시간 동안 배양하였다. Cyano 카트리지를 25% ACN으로 활성화 시킨 후 96% ACN 으로 세척하였다. 형광표지 된 당쇄시료를 흘려 흡착시킨 후 카트리지 부피 수배의 96% ACN을 흘려주었다. 60%(v/v) ACN으로 당쇄 용출 후 원심식 증발기로 건조하였다. 형광표지된 당쇄는 MALDI-TOF 양성 이온 모드로 질량 분광측정(UltraflexIII TOF/TOF, Bruker Daltonics)으로써 분석했다.
그 결과, 도 26 및 도 27에 나타난 바와 같이, 기존의 트라스투주맙(Herceptin)과 본 발명의 형질전환 식물세포로부터 생산된 트라스투주맙(GF003)의 당쇄 형태가 상이한 것을 확인하였다. 또한, 본 발명의 형질전환 식물세포로부터 생산된 트라스투주맙의 경우, 당쇄에 푸코스 잔기가 포함되어 있지 않은 것을 확인하였다.
실시예 20. 형질전환 식물세포로부터 생산된 트라스투주맙의 당쇄의 항암효과 확인:
in vivo
마우스(암컷, 7주)를 7일의 적응기간을 거친 후에 5×106 세포수의 인간 폐암세포주인 Calu-3 암세포(한국세포주은행)로 이종이식을 수행하였다. 종양의 크기가 100 ㎜3 내지 150 ㎜3에 도달할 때까지 관찰한 뒤 기존의 트라스투주맙(Herceptin)과 본 발명의 형질전환 식물세포로부터 생산된 트라스투주맙(GF003)의 항암효과를 비교하였다.
상기 제작한 Calu-3 암세포 이식 마우스를 5개 그룹(n=10)으로 분류하였다. PBS를 복강 내 투여받는 그룹을 음성대조군으로 설정하였으며, 기존의 트라스투주맙(Herceptin) 30 ㎎/㎏을 복강 내 투여받는 그룹을 양성대조군으로 설정하였다. 본 발명의 형질전환 식물세포로부터 생산된 트라스투주맙(GF003) 10 ㎎/㎏, 15 ㎎/㎏ 또는 30 ㎎/㎏을 복강 내 투여받은 그룹을 실험군으로 설정하였다. 상기 각 군의 마우스에 약물을 투여한 후 0일, 4일, 7일, 11일, 14일, 18일 22일 및 25일째에 종양의 크기를 측정하였다. 그 결과, 실험군 마우스 및 양성 대조군 마우스의 종양의 크기가 음성 대조군 마우스의 종양의 크기에 비해 현저하게 억제되는 것을 확인하였으며, 특히, 본 발명의 형질전환 식물세포로부터 생산된 트라스투주맙(GF003) 30 ㎎/㎏을 복강 내 투여받은 실험군의 경우 양성 대조군보다 종양의 크기가 감소하는 것을 확인하였다(도 28).
III. 비푸코실화, 비자일로실화 및/또는 비갈라토실화된 담배(
N
.
benthamiana
) 제조
실시예 21. 비푸코실화, 비자일로실화 및/또는 비갈락토실화된 담배 제조
2개의 XylT12 및 2개의 GalT13의 게놈 DNA를 Sol Genomics Network(https://solgenomics.net)에서 블라스팅하여 담배에서 동정한 후에 시퀀싱하였다.
구체적으로, NbXylT12_1(Niben101Scf04551)은 4개의 엑손(검은 박스) 및 3개의 인트론(흰 박스)을 포함하는 3632 bp의 길이를 가지며, 코딩 영역 1542 bp의 cDNA로 스플라이싱되어 513개의 아미노산으로 번역된다. 또한, NbXylT12_2(Niben101Scf04205)는 3개의 엑손 및 2개의 인트론을 포함하는 3426 bp의 길이를 가지며, 코딩 영역 1551 bp의 cDNA로 스플라이싱되어 516개의 아미노산으로 번역된다. NbGalT13_1(Niben101Scf04082)은 6개의 엑손 및 6개의 인트론을 포함하는 1878 bp의 길이를 가지며, 코딩 영역 1128 bp의 cDNA로 스플라이싱되어 375 개의 아미노산으로 번역된다. NbGalT13_2(Niben101Scf09597)는 7개의 엑손 및 6개의 인트론을 포함하는 3336 bp의 길이를 가지며, 코딩 영역 1104 bp의 cDNA로 스플라이싱되어 367개의 아미노산으로 번역된다(도 29).
실시예 22. 조직에 따른 5개의
NbFucT13,
2개의
NbXylT12
및 2개의
NbGalT13
의 상대적인 발현 패턴 분석
5개의 NbFucT13, 2개의 NbXylT12 및 2개의 NbGalT13의 정량적인 전사를 측정하기 위해, 프라이머를 각각의 유전자 발현을 나타내는 유전자 특이적 영역 상에 설계하였다. 2개의 NbXylT12 및 2개의 NbGalT13에 대해 설계한 프라이머는 하기 표 12에 나타내었다. 하기 표 12에 기재된 프라이머 및 상기 표 2에 기재된 프라이머를 이용하여 실시예 2와 동일한 방법으로 5개의 NbFucT13,
2개의 NbXylT12 및 2개의 NbGalT13의 정량적인 전사를 측정하였다.
그 결과, NbFucT13는 뿌리, 줄기, 4주령 잎, 6주령 잎 및 꽃에서 보편적으로 존재하였다. 두드러진 발현 패턴 없이 상이한 조직에서 일관되게 발현되는 전사체 수준을 기준으로 하였다. 또한, NbXylT12는 주로 뿌리, 6주령 잎 및 꽃에서 보편적으로 존재하였으며, NbGalT13는 주로 뿌리, 4주령 잎, 6주령 잎에서 보편적으로 존재하였다(도 30).
실시예 23. 다중 녹아웃 생성을 위한 sgRNA의 설계 및 선별
고도로 보존된 엑손 서열을 정렬하여 CRISPR/Cas9 RNP의 결합 부위인 sgRNA 표적 영역을 동정하였다. 이때, CHOPCHOP(https://chopchop.cbu.uib.no/) 사이트를 이용해서 sgRNA를 선별하였으며, IVT(in vitro DNA cleavage assay) 이용하여 sgRNA 활성을 검증하였다. 상기 선별된 sgRNA 및 활성 검증 결과를 하기 표 13에 나타내었다.
그 결과, AXT1 내지 AXT6은 NbXylT12_1 및 NbXylT12_2의 엑손 1을 표적화하였다(도 31a 내지 도 31c). AGT1 내지 AGT5는 NbGalT13_1 및 NbGalT13_2의 엑손 1을 표적화하였으며, AGT6 및 AGT7은 NbGalT13_1 및 NbGalT13_2의 엑손 2를 표적화하였다(도 32a 내지 도 32c).
한편, pNGPJ0014 벡터는 pCAMBIA(Abcam)를 바탕으로 제작하였다. 상기 pNGPJ0014 벡터는 카나마이신(Kanamycin)과 히그로마이신(Hygromycin) 항생제에 의해 선별되도록 항생제에 대한 카세트를 가지며, Cas9과 합성된 폴리시스트로닉 tRNA-gRNA 카세트를 갔도록 제작하였다. 이때, Cas9은 애기장대 유비퀴틴 10 프로모터에 의해, tRNA-gRNA는 애기장대 유비퀴틴 6 프로모터에 의해 발현되도록 제작되었다. Cas9 단백질을 핵으로 전달하기 위해 Cas9의 N-말단에 SV40(PKKKRKV, 서열번호 70) 핵이행신호 서열과 C-말단에 Bipartite (KEPAATKKAGQAKKKK, 서열번호 71) 핵이행신호 서열을 추가하였다.
구체적으로, 3개의 sgRNA(AXT1 내지 AXT3)를 모두 일렬로(tandemly) 배열된 tRNA-표적 23bp-sgRNA 스캐폴드 시스템으로 제작하였고, 골든-게이트 클로닝 시스템을 사용하여 각각의 일렬의 tRNA-sgRNA를 또 다른 일렬의 tRNA-sgRNA와 결합시켰다. 3개의 일렬 반복을 AtU6 프로모터 아래에 배치하였다(도 33a). 또한, 3개의 sgRNA(AXT4 내지 AXT6)를 모두 일렬로(tandemly) 배열된 tRNA-표적 23/24bp-sgRNA 스캐폴드 시스템으로 제작하였고, 골든-게이트 클로닝 시스템을 사용하여 각각의 일렬의 tRNA-sgRNA를 또 다른 일렬의 tRNA-sgRNA와 결합시켰다. 3개의 일렬 반복을 AtU6 프로모터 아래에 배치하였다(도 33b). 나아가, 7개의 sgRNA(AGT1 내지 AGT3 및 AXT1 내지 AXT4)를 모두 일렬로(tandemly) 배열된 tRNA-표적 23bp-sgRNA 스캐폴드 시스템으로 제작하였고, 골든-게이트 클로닝 시스템을 사용하여 각각의 일렬의 tRNA-sgRNA를 또 다른 일렬의 tRNA-sgRNA와 결합시켰다. 7개의 일렬 반복을 AtU6 프로모터 아래에 배치하였다(도 33c). 또한, 3개의 sgRNA(AGT4 내지 AGT6)를 모두 일렬로(tandemly) 배열된 tRNA-표적 23bp-sgRNA 스캐폴드 시스템으로 제작하였고, 골든-게이트 클로닝 시스템을 사용하여 각각의 일렬의 tRNA-sgRNA를 또 다른 일렬의 tRNA-sgRNA와 결합시켰다. 3개의 일렬 반복을 AtU6 프로모터 아래에 배치하였다(도 33d).
실시예 24. 아그로박테리움 매개 형질감염 후 식물재생
먼저, 상기 실시예 23에서 제조한 발현벡터(pNGPJ0014)를 아그로박테리움 세포(GV3101)에 각각 형질전환 시킨 후, 배지(YEP agar plate)에 도말하고 28℃ 온도에서 약 2일간 배양하였다. 그 후, 생성된 단일 콜로니를 액체 배지(YEP broth)에 접종하고 28℃ 온도에서 200 rpm 조건으로 약 2일간 전배양하였다. 전배양액을 새 액체 배지 양의 0.5% 비율로 접종하고 28℃ 온도에서 200 rpm 조건으로 O.D.값값이 1.2 내지 1.8이 될 때까지 배양하였다. 상기 진탕 배양한 형질전환 아그로박테리아를 함침용 완충용액(10 mM MES, pH 5.6, 10 mM MgSO4)을 첨가하여 O.D.값이 0.02가 되도록 희석하였다.
구체적으로, 상기 6주령의 야생형 또는 계통 #37의 담배 잎을 이용하였으며, 먼저 잎 표면 소독은 0.1% Tween 20를 포함하는 20% Clorox에 10분간 담가두었다. 담궈둔 잎을 세척하기위해 0.1% Tween 20를 포함된 증류수로 4회 씻어 준비한 후, 잎 표면의 물기가 마르게 필터페이퍼로 덮어두었다. 상기 진탕배양한 아그로박테리아는 형질전환 배지(1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, pH5.8)를 이용해서 OD값이 0.6으로 맞춰 희석하였다. 표면소독이 된 잎을 사방 1 ㎝로 잘라서 미리 준비된 아그로박테리아 형질전환 배양액에 10분 담궈두었다. 그 후, 담궈둔 잎을 배지(1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, 1% Agar, pH5.8)로 옮겨 2일 동안 암배양하였다. 2일 후 항생제 배지(1MS, 3% Sucrose, 2mg/L 6-BA, 0.2mg/L NAA, 25mg/L Hygromycin, 200mg/L Timentin, 1% Agar, pH5.8) 로 옮겼으며, 항생제의 효율성을 유지하기 위해서 2주에 한 번씩 새로운 배지로 옮겨주었다. 캘러스가 생성되고 잎과 줄기들이 나오면 뿌리를 유도하는 배지(1MS, 3% Sucrose, Hygromycin, 200 mg/L Timentin, 1% Agar, pH5.8)로 옮겨주었다. 2-3주 뒤에는 뿌리가 유도되고, 큰 용기로 옮겨 4주 뒤에는 새로운 개체를 수득하였다(도 34).
실시예 26.
NbXylT12
및
NbGalT13
에 대해 추가 게놈 편집된 계통의 동정
상기 실시예 25에서 제조한 NbXylT12 및 NbGalT13에 대해 추가 게놈 편집된 계통에 대해 타겟 영역의 생어-염기서열 분석을 진행하였다. 상기 생거-시퀀싱은 gRNA 표적 영역을 20 ㎕ 부피에서 Q5 Hot Start High-Fidelity 2x Master Mix(NewEngland Biolabs)를 사용하여 제조사에 매뉴얼에 따라 게놈 DNA를 추출하였다. 상기 게놈 DNA 추출물로부터 타겟 영역의 유전자를 증폭하였다. 그 후, PCR 증폭물을 All in one Cloning Kit(Biofact, South Korea)를 사용하여 제조사에 매뉴얼에 따라 TA 벡터에 클로닝하였으며, 15-20개의 클론을 각각의 샘플에 대해 개별적으로 시퀀싱하였다.
상기 생어 염기서열 분석을 통해 각 T0 내지 T3 세대의 계통을 동정하여 하기 표 14 내지 표 16에 나타내었다. 이때, T1은 형질전환 식물체의 다음 세대를 의미하며, transformed plant 1 generation, 줄여서 T1으로 표기하였다.
상기 표 14에서 Background는 형질전환시 사용된 식물체의 유전자형을 나타내며, WT은 야생형을 나타내며, △FucT는 비푸코실화된 식물체를 나타낸다. 상기 표 14에 나타난 바와 같이 T0 세대에서는 단일 또는 이중 녹아웃(knock-out)을 생성하는 것을 확인하였다. 다만, 호모(homo) 라인으로 준비해야 T1 세대에서 다양한 식물체를 얻을 수 있었다.
상기 표 15에 나타난 바와 같이, T0 세대의 다음 세대인 T1 세대에서 이중부터 7중(septuple) 녹아웃을 생성하는 것을 확인하였다.
상기 표 16에 나타난 바와 같이, T1 세대의 다음 세대인 T2 및 T3 세대에서 8중(Octuple) 녹아웃을 생성하는 것을 확인하였다.
실시예 27.
NbXylT12
및
NbGalT13
에 대해 추가 게놈 편집된 계통의 유전형 검증
상기 실시예 26의 T1 세대의 생어-염기서열 분석결과를 통해 mono-allelic homo와 bi-allelic homo를 찾아서 정리하였다. 이를 통해, 이중 또는 삼중으로 당이 제거된 식물체를 나열하였다(도 35 내지 도 38). 이때, mono-allelic homo는 다음 세대에서도 지속적으로 같은 유전자 편집을 형태를 유지하면 유전되어 KO 식물체로 유지되는 식물체 계통을 의미한다.
구체적으로, 도 35에 나타난 바와 같이, 단일 또는 이중으로 당이 제거된 식물체가 분류되었으며, 각 유전자의 인델(indel)을 확인한 결과, β-1,2 자이로스 당 제거된 식물체의 mono-allelic homo 라인은 #405-18 및 #405-59이며, α1, 3- 푸코스와 β-1,2 자이로스 당이 제거된 식물체의 mono-allelic homo 라인은 없어서 #142-142-52을 T2 세대에서 얻을 수 있는 것을 확인하였다. 이때, 상기 인델이란, 유전자 편집에서 결실(deletion)과 삽입(insertion)이 이뤄지는데 이것을 총칭해서 인델이라고 표현하며, 인델 효율(indel efficiency)을 퍼센트로 나타내어 유전자 편집의 효율을 정한다.
또한, 도 36에 나타난 바와 같이, 단일 또는 이중으로 당이 제거된 식물체가 분류되었으며, 각 유전자의 인델을 확인한 결과, β-1,3 갈락토오스 당이 제거된 식물체의 mono-allelic homo 라인은 #103-38 이며, α1,3-푸코스와 β-1,3 갈락토오스 당이 제거된 식물체의 mono-allelic homo 라인은 #123-76, #123-81, #274-181 및 #274-186인 것을 확인하였다.
나아가, 도 37에 나타난 바와 같이, 이중으로 당이 제거된 식물체가 분류되었으며, 각 유전자의 인델을 확인한 결과, 자이로스와 β-1,3 갈락토오스 당이 제거된 식물체의 mono-allelic homo 라인은 T3 세대 #310-4-60-3 및 #310-4-60-69인 것을 확인하였다.
또한, 도 38에 나타난 바와 같이, 삼중으로 당이 제거된 식물체가 분류되었으며, 각 유전자의 인델을 확인한 결과, α-1,3 푸코스, β-1,2 자이로스 와 β-1,3 갈락토오스 당이 제거된 식물체의 mono-allelic homo 라인은 T2 세대 #276-113-8, #276-113-13, #276-113-29 및 #276-113-32인 것을 확인하였다.
실시예 28.
NbGalT13
에 대해 추가 게놈 편집된 계통을 이용한 트라스투주맙 생산 및 당쇄 분석
상기 실시예 25에서 제작된 비푸코실화 및 비갈락토실화된 담배를 이용하여 실시예 16 및 실시예 17과 동일한 방법으로 형질전환시켜 트라스투주맙을 생산하였다. 액체질소로 얼린 식물체(N.benthamiana) 잎을 막자사발에서 분쇄하여 회수한 후, 분말에 2배 부피의 인산 완충 용액(pH 7.2)을 첨가하고 혼합하였다. 얼음에서 10분 간 정치하고 원심분리하여(15,000×g, 20분, 4℃) 투명한 상층액을 1차 회수하였다. 남은 분말에 2배 부피의 인산 완충 용액(pH 7.2)을 추가로 첨가하고 상기 기술한 방법과 동일한 과정을 반복하여 상층액을 회수한 다음, 1차 회수한 상층액과 혼합하였다.
총 수용성 단백질(Total soluble protein)을 0.45 ㎛ 필터에 여과하여 큰 불용성 입자들을 제거한 후 농축하였다(30 kDa, 15,000×g, 30분, 4℃). 농축한 TSP를 초순수로 3회 반복 처리하여 인산 완충 용액을 초순수로 교체하고(30 kDa, 15,000×g, 30분, 4℃), 브래드포드 분석을 통해 단백질 양을 정량하였다.
상기 수득한 TSP 시료 50 ㎍을 변성 용액(0.1% RapiGest SF, 10 mM DTT)을 첨가하고 56℃ 온도에서 45분간 반응시킨 후, 요오드아세트아마이드(iodoacetamide, 20 mM)를 추가로 첨가하고 암조건(상온)에서 1시간 동안 반응시켰다. 그 후, 반응액에 당 절단 효소(2 ㎕, 5 U/㎕, PNGase A)를 첨가하고 37℃ 온도에서 하룻밤 동안 반응 시켰다. N-당사슬을 PGC 카트리지(Porous graphitize carbon SPE cartridge)를 사용하여 추출하고 진공 원심분리 방법으로 건조하였다.
건조된 N-당사슬에 10 ㎕의 형광 표지 용액(5 ㎎; 2-aminobezoic acid, 6 ㎎; sodium cyanoborohydride/100 ㎕ acetic acid & DMSO)을 첨가하고 65℃ 온도에서 3시간 동안 반응시켰다. 형광이 표지된 N-당사슬은 시아노 카트리지(Cyano SPE cartridge)를 사용하여 추출하고 진공 원심분리 방법으로 건조시켰다. 건조한 2-AB 표지된 N-당사슬은 20 ㎕ 초순수를 첨가하여 녹이고 질량분석기(Ultraflex III TOF/TOF, Bruker Daltonics)를 이용하여 분석하였다. 분석 조건은 하기 표 17에 나타내었다.
그 결과, 야생형에서 N-글리칸의 MALDI-TOF MS 분석은 8개의 N-글리칸(MUX, MUF, GnGnX2, GnGnX2F3, MMX2, MMX2F3, GnMX2/MGnX2 및 GnMX2F3/MGnX2F3)의 존재를 나타내었다. 구체적으로, 도 39에 나타난 바와 같이, α-1,3 푸코실트랜스퍼라제가 녹아웃된 #37 식물에서 MUF 및 GnGnX2F3는 검출되지 않았고, MUX 및 GnGnX2만이 검출되었다. 또한, ß-1,3 갈락토실트랜스퍼라제가 녹아웃된 #103 식물에서 MUX, MUF, GnGnX2 및 GnGnX2F3가 모두 검출되었다. 또한, α-1,3 푸코실트랜스퍼라제 및 ß-1,3 갈락토실트랜스퍼라제가 모두 녹아웃된 #123 및 #247 식물에서 MUF 및 GnGnX2F3는 검출되지 않았고, MUX 및 GnGnX2만이 검출되었다.
또한, 도 40에 나타난 바와 같이, α-1,3 푸코실트랜스퍼라제가 녹아웃된 #37 식물에서 MMX2F3 및 GnMX2F3/MGnX2F3는 검출되지 않았고, MMX2 및 GnMX2/MGnX2만이 높게 검출되었다. 또한, β-1,3 갈락토실트랜스퍼라제가 녹아웃된 #103 식물에서 MMX2, MMX2F3, GnMX2/MGnX2 및 GnMX2F3/MGnX2F3이 모두 검출되었다. 또한, α-1,3 푸코실트랜스퍼라제 및 β-1,3 갈락토실트랜스퍼라제가 모두 녹아웃된 #123 및 #247 식물에서 MUF 및 GnGnX2F3는 검출되지 않았고, MUX 및 GnGnX2만 검출되었다.
상기 결과를 통해, 비푸코실화된 담배에서는 푸코스가 존재하지 않고, 비갈락토실화된 담배에서는 갈락토스가 존재하지 않으며, 비푸코실화 및 비갈락토실화된 담배에서는 푸코스 및 갈락토스가 모두 존재하지 않음을 확인하였다.
실시예 29.
NbXylT12
및
NbGalT13
에 대해 추가 게놈 편집된 계통을 이용한 트라스투주맙 생산 및 당쇄 분석
상기 실시예 25에서 제조한 다양한 계통의 식물체를 실시예 16 및 실시예 17과 동일한 방법으로 형질전환시켜 트라스투주맙을 생산하였다. 그 후, 상기 실시예 28과 동일한 방법으로 당패턴을 분석하였다.
그 결과, 비푸코실화, 비자이로실화된 기주식물에서는 야생형 담배에서는 나타나지 않는 GnGn 형태의 단백질 구조로만 나타나며, 이것은 GF003 항체 단백질을 분석했을 때 95.3%로 야생형 31%에 배해 3배 높게 나타났다(도 41 및 도 42).
실시예 30.
NbXylT12
및
NbGalT13
에 대해 추가 게놈 편집된 계통으로부터 생산된 트라스투주맙의 발현량 확인
상기 실시예 25에서 제조한 다양한 계통의 식물체를 실시예 16 및 실시예 17과 동일한 방법으로 형질전환시켜 트라스투주맙을 생산하였다. 그 후, 실시예 18과 동일한 과정의 전기영동을 이용해 트라스투주맙의 발현량을 확인하였다.
그 결과, 도 43에 나타난 바와 같이, 각 기주식물에서 모두 트라스투주맙이 잘 발현하는 것을 확인하였다.
실시예 31.
NbXylT12
및
NbGalT13
에 대해 추가 게놈 편집된 계통으로부터 생산된 트라스투주맙의 당쇄의 항암효과 확인:
in vitro
상기 실시예 29에서 생산한 트라스투주맙의 항체의존세포독성(antibody-dependent cellular cytotoxicity, ADCC)을 확인하기 위해, 분석 하루 전날 타겟세포(target cell, T)인 SKBR3 암세포주를 1×104 cells/100 ㎕/well로 필요한 샘플 수를 고려하여 96-웰-플레이트에 분주하였다.
효과세포(effector cell)인 jurkat T세포주의 세포수를 측정하여 E:T=15:1의 비율이 되도록 10% low IgG FBS-RPMI1640에 재분주하였다. 이때, FBS는 분석에 영향을 줄 수 있으므로, low IgG FBS를 사용하였으며, 히그로마이신(hygromycin) 및 G418 항생제는 SKBR3 암세포주를 죽일 수 있으므로 사용하지 않았다. 구체적으로, E:T=15:1의 비율이 되도록 효과세포인 jurkat T세포를 1.5×105 cells을 처리하기 위해 1.5×106 cells/㎖로 10% low IgG FBS-RPMI1640에 재분주하였다.
시판되고 있는 트라스투주맙(A-trastuzumab, B-trastuzumab) 및 실시예 28에서 생산한 각각의 트라스투주맙(GF003/△F, GF003/△FX, GF003/△FG, GF003/△X, GF003/△G, GF003/Nbwt)은 최고 농도 1 ㎍/㎖이 되게 하고, 1/3 연속 희석(serial dilution)하여 총 10가지 다른 농도로 처리되도록 설정하였다.
96-웰-플레이트에 있던 SKBR3 암세포주의 배지를 제거하고, jurkat T세포와 상기 각각의 트라스투주맙의 총 부피가 100 ㎕가 되도록 하여 SKBR3 암세포주에 넣어주었다. 이때, e-tube에 11.5×106 cells/㎖의 jurkat T세포 1 ㎖에 항체 1 ㎍을 넣고, 96-웰-플레이트에 200 ㎕를 넣었다. 그 후, 다음 9개 웰에 120 ㎕의 jurkat T세포를 넣고, 처음 1 ㎍/㎖ 농도인 웰에서 60 ㎕씩 순차적으로 희석하여 하여 총 10가지 농도의 항체가 들어있는 샘플을 준비하였다.
다음 날, 루시퍼라아제 기질 용액(Luciferase substrate solution)을 Multi-channel pipette을 이용하여, 60 ㎕/well을 넣고 CO2 인큐베이터에서 2분 동안 배양하였다. FLUO STAR OMEGA microplate reader에서 Luciferase assay protocol로 발광값(luminescence)를 측정하였으며, GraphPAD PRISM 프로그램을 사용하여 IC50의 농도 값을 구하였다.
그 결과, 도 44에 나타난 바와 같이, GF003/△FX(0.38 ng/㎖)가 표준폼인 A-trastuzumab(1.05 ng/㎖)에 비해 3배 가량 낮은 농도에서 항체의존세포독성 효과를 나타내는 것을 확인하였다.
Claims (28)
- 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13)의 발현이 억제된 형질전환 식물.
- 제1항에 있어서,상기 형질전환 식물이 베타 1,2-자일로실트랜스퍼라제(beta 1,2-xylosyltransferase, XylT12), 베타 1,3-갈락토실트랜스퍼라제(beta 1,3-galactosyltransferase, GalT13) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 발현이 추가적으로 억제된 것인, 형질전환 식물.
- 제1항에 있어서,상기 알파 1,3-푸코실트랜스퍼라제는 FucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494) 및 NbFucT13_4(Niben101Scf17626)인 것인, 형질전환 식물.
- 제1항에 있어서,상기 형질전환 식물은 FucT13_1(Niben101Scf01272), NbFucT13_2(Niben101Scf02631), NbFucT13_3(Niben101Scf05494) 및 NbFucT13_4(Niben101Scf17626)을 코딩하는 유전자에 상보적으로 결합하는 sgRNA 및 크리스퍼 연관 단백질의 복합체를 이용하여 제작된 것인, 형질전환 식물.
- 제2항에 있어서,상기 베타 1,2-자일로실트랜스퍼라제는 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)인 것인, 형질전환 식물.
- 제2항에 있어서,상기 형질전환 식물은 NbXylT12_1(Niben101Scf04551) 및 NbXylT12_2(Niben101Scf04205)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA 및 크리스퍼 연관 단백질의 복합체를 이용하여 제작된 것인, 형질전환 식물.
- 제2항에 있어서,상기 베타 1,3-갈락토실트랜스퍼라제는 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)인 것인, 형질전환 식물.
- 제2항에 있어서,상기 형질전환 식물은 NbGalT13_1(Niben101Scf04082) 및 NbGalT13_2(Niben101Scf09597)를 코딩하는 유전자에 상보적으로 결합하는 sgRNA 및 크리스퍼 연관 단백질의 복합체를 이용하여 제작된 것인, 형질전환 식물.
- 제1항에 있어서,상기 식물은 담배, 애기장대, 옥수수, 벼, 대두, 카놀라, 알팔파, 해바라기, 수수, 밀, 목화, 땅콩, 토마토, 감자, 상추 및 고추로 이루어진 군에서 선택되는 어느 하나로부터 유래된 것을 특징으로 하는, 형질전환 식물.
- 제1항에 있어서,상기 형질전환 식물은 목적 단백질을 코딩하는 유전자를 포함하는 발현벡터가 추가적으로 도입된 것인, 형질전환 식물.
- 제10항에 있어서,상기 목적 단백질을 코딩하는 유전자는 서열번호 3으로 표시되는 염기서열; 및 서열번호 4로 표시되는 염기서열을 포함하는 것인, 형질전환 식물.
- 푸코스(fucose), 자일로스(xylose), 갈락토스(galactose) 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 잔기가 포함되지 않은, 변형된 당쇄를 갖는 목적 단백질.
- 제12항에 있어서,상기 목적 단백질이 항체인 것인, 변형된 당쇄를 갖는 목적 단백질.
- 제13항에 있어서,상기 항체는 트라스투주맙인 것인, 변형된 당쇄를 갖는 목적 단백질.
- 제13항에 있어서,상기 항체는 서열번호 1로 표시되는 아미노산 서열로 이루어진 중쇄 및 서열번호 2로 표시되는 아미노산 서열로 이루어진 경쇄를 포함하는 것인, 변형된 당쇄를 갖는 목적 단백질.
- 제12항에 있어서,상기 변형된 당쇄는 3개, 7개 또는 8개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 것인, 변형된 당쇄를 갖는 목적 단백질.
- 제12항에 있어서,상기 목적 단백질은 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물로부터 생산되는 것인, 변형된 당쇄를 갖는 목적 단백질.
- 제14항에 따른 목적 단백질을 유효성분으로 포함하는 암 예방 또는 치료용 약학 조성물.
- 제19항에 있어서,상기 약학 조성물은 3개, 5개, 7개 또는 8개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 이중 안테나 형태의 당쇄를 갖는 목적 단백질의 총량을 100%로 하였을 때, 푸코스(fucose) 잔기가 없는 항체의 양이 99% 이상이고, 상기 당쇄 내에 갈락토스(galactose)의 양이 1% 이하인, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13)의 발현이 억제된 형질전환 식물로부터 생산된 목적 단백질을 포함하는 것을 특징으로 하는 것인, 약학 조성물.
- 제19항에 있어서,상기 약학 조성물은 3개, 5개, 7개, 8개 또는 9개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 이중 안테나 형태의 당쇄를 갖는 목적 단백질의 총량을 100%로 하였을 때, 푸코스(fucose) 및 갈락토스(galactose) 잔기가 없는 항체의 양이 95% 이상이고, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13) 및 베타 1,3-갈락토실트랜스퍼라제(beta 1,3 galactosyltransferase, GalT13)의 발현이 억제된 형질전환 식물로부터 생산된 목적 단백질을 포함하는 것을 특징으로 하는 것인, 약학 조성물.
- 제19항에 있어서,상기 약학 조성물은 3개, 5개 또는 8개의 만노스(manose) 잔기 및 2개 또는 4개의 N-아세틸글루코사민(GlcNAc) 잔기를 포함하는 이중 안테나 형태의 당쇄를 갖는 목적 단백질의 총량을 100%로 하였을 때, 푸코스(fucose) 및 자일로스(xylose) 잔기가 없는 항체의 양이 95% 이상이고, 상기 당쇄 내에 갈락토스(galactose)의 양이 1% 이하인, 알파 1,3-푸코실트랜스퍼라제(alpha 1,3 fucosyltransferase, FucT13) 및 베타 1,2-자일로실트랜스퍼라제(beta 1,2 xylosyltransferase, XylT12)의 발현이 억제된 형질전환 식물로부터 생산된 목적 단백질을 포함하는 것을 특징으로 하는 것인, 약학 조성물.
- 제19항에 있어서,상기 암은 위암, 간암, 폐암, 대장암, 유방암, 전립선암, 난소암, 췌장암, 자궁경부암, 갑상선암, 후두암, 급성 골수성 백혈병, 뇌종양, 신경모세포종, 망막 모세포종, 두경부암, 침샘암 및 림프종으로 구성된 군으로부터 선택되는 어느 하나인 것인, 약학 조성물.
- i) 서열번호 3으로 표시되는 염기서열; 및 서열번호 4로 표시되는 염기서열을 포함하는 유전자를 제1항의 알파 1,3-푸코실트랜스퍼라제의 발현이 억제된 형질전환 식물에 도입하는 단계; ii) 상기 형질전환 식물을 재배하는 단계; 및 iii) 상기 재배한 형질전환 식물로부터 항체를 회수하는 단계를 포함하는 변형된 당쇄를 갖는 항체의 생산방법.
- 제24항에 있어서,상기 형질전환 식물이 베타 1,2-자일로실트랜스퍼라제 유전자, 베타 1,3-갈락토실트랜스퍼라제 유전자 및 이들의 조합으로 이루어진 군으로부터 선택되는 어느 하나의 발현이 추가적으로 억제된 것인, 변형된 당쇄를 갖는 항체의 생산방법.
- 제14항의 변형된 당쇄를 갖는 목적 단백질을 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법.
- 암을 예방 또는 치료하기 위한 제14항의 변형된 당쇄를 갖는 목적 단백질의 용도.
- 암의 예방 또는 치료용 약제를 제조하기 위한 제14항의 변형된 당쇄를 갖는 목적 단백질의 용도.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2019-0150743 | 2019-11-21 | ||
| KR20190150743 | 2019-11-21 | ||
| KR20190168128 | 2019-12-16 | ||
| KR10-2019-0168128 | 2019-12-16 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2021101351A2 true WO2021101351A2 (ko) | 2021-05-27 |
| WO2021101351A3 WO2021101351A3 (ko) | 2021-07-22 |
| WO2021101351A9 WO2021101351A9 (ko) | 2021-09-02 |
Family
ID=75981393
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/016605 Ceased WO2021101351A2 (ko) | 2019-11-21 | 2020-11-23 | 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2021101351A2 (ko) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2395842T3 (es) * | 2006-01-17 | 2013-02-15 | Synthon Biopharmaceuticals B.V. | Composiciones y métodos para la humanización y optimización de N-glicanos en plantas |
| EP1878747A1 (en) * | 2006-07-11 | 2008-01-16 | greenovation Biotech GmbH | Glyco-engineered antibodies |
| CA2850571C (en) * | 2011-10-04 | 2021-01-05 | Icon Genetics Gmbh | Nicotiana benthamiana plants deficient in fucosyltransferase activity |
| MX367031B (es) * | 2012-11-01 | 2019-08-02 | Cellectis | Plantas para la produccion de proteinas terapeuticas. |
| EA038931B9 (ru) * | 2014-11-20 | 2022-02-18 | Йиссум Рисерч Дивелопмент Компани Оф Зе Хебрю Юниверсити Оф Иерусалим Лтд. | Композиции и способы получения полипептидов с модифицированным профилем гликозилирования в клетках растений |
| WO2016181357A1 (en) * | 2015-05-13 | 2016-11-17 | Zumutor Biologics, Inc. | Afucosylated protein, cell expressing said protein and associated methods |
-
2020
- 2020-11-23 WO PCT/KR2020/016605 patent/WO2021101351A2/ko not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021101351A3 (ko) | 2021-07-22 |
| WO2021101351A9 (ko) | 2021-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102171344B (zh) | 编码调节生物碱合成之转录因子的核酸序列及其在改良植物代谢中的应用 | |
| WO2011025242A2 (ko) | 번역 효율 증진용 dna 단편 및 이를 포함하는 재조합 벡터 | |
| WO2015167282A1 (en) | A novel method for glycosylation of ginsenoside using a glycosyltransferase derived from panax ginseng | |
| US20230029030A1 (en) | Nucleic acid encoding n-methylputrescine oxidase and uses thereof | |
| WO2016021973A1 (ko) | 캄필로박터 제주니 crispr/cas 시스템 유래 rgen을 이용한 유전체 교정 | |
| WO2015105273A1 (ko) | 식물체의 abcg14 단백질을 포함하는 사이토카이닌 수송 촉진용 조성물 | |
| WO2021187750A1 (ko) | 식물에서 목적 단백질을 대량생산하는 방법 | |
| WO2016036195A1 (ko) | 식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법 | |
| KR102348638B1 (ko) | 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도 | |
| WO2012134215A2 (ko) | 동물세포 발현벡터 | |
| WO2011071207A1 (ko) | 미량 원소 함량이 증가된 벼 품종 및 그의 용도 | |
| WO2021101351A9 (ko) | 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도 | |
| WO2022270788A1 (ko) | Qpt 유전자가 조작된 식물 세포 및 이의 이용 방법 | |
| WO2019135428A1 (ko) | Hy5 넉아웃 유전자로 형질전환시킨 소포체 스트레스 저항성 식물체 | |
| WO2025005684A1 (ko) | 닉카제 매개된 식물 dna의 염기 교정 | |
| WO2024191228A1 (ko) | 식물 특이적 n-글리칸이 제거된 당단백질을 생산하는 형질전환 식물체 및 이의 제조방법 | |
| WO2012093764A1 (ko) | Abc 수송체 단백질을 암호화하는 유전자를 포함하는 식물 종자의 크기 또는 종자 내 저장 지방의 함량 증가용 조성물 | |
| WO2023085582A1 (ko) | 식물에서 재조합 단백질 발현의 증진에 있어서 gb1 도메인 융합의 효과 | |
| WO2019031804A2 (ko) | 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터 | |
| WO2026101240A1 (ko) | 유전자의 고발현을 위한 코돈 최적화 기술 및 그의 활용 | |
| WO2010110591A2 (ko) | 환경 스트레스 유도성 프로모터 및 이의 용도 | |
| WO2013176401A1 (ko) | 모노리그놀 수송체 유전자들의 발현량을 변화시키는 재조합 벡터 및 리그닌 함량이 변화된 형질전환 식물 | |
| WO2024090815A1 (ko) | 식물로부터 인유두종 바이러스 유사 입자의 생산 | |
| WO2026059191A1 (ko) | 원형질체로부터 식물 재생 촉진용 조성물 및 방법 | |
| WO2025234585A1 (ko) | 알부민 융합을 이용한 난발현 재조합 단백질의 식물에서의 고수율 생산 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20888936 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20888936 Country of ref document: EP Kind code of ref document: A2 |









































