WO2021101049A1 - 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법 - Google Patents

단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법 Download PDF

Info

Publication number
WO2021101049A1
WO2021101049A1 PCT/KR2020/012411 KR2020012411W WO2021101049A1 WO 2021101049 A1 WO2021101049 A1 WO 2021101049A1 KR 2020012411 W KR2020012411 W KR 2020012411W WO 2021101049 A1 WO2021101049 A1 WO 2021101049A1
Authority
WO
WIPO (PCT)
Prior art keywords
temperature
reaction vessel
nucleic acid
real time
target nucleic
Prior art date
Application number
PCT/KR2020/012411
Other languages
English (en)
French (fr)
Inventor
원병연
김수성
안재운
임윤태
박상현
박재호
Original Assignee
주식회사 유진셀
주식회사 바디텍메드
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 유진셀, 주식회사 바디텍메드 filed Critical 주식회사 유진셀
Priority to EP20889629.0A priority Critical patent/EP4063520A4/en
Priority to US17/777,108 priority patent/US20230007924A1/en
Publication of WO2021101049A1 publication Critical patent/WO2021101049A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/101—Temperature
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/173—Nucleic acid detection characterized by the use of physical, structural and functional properties staining/intercalating agent, e.g. ethidium bromide

Definitions

  • the present invention relates to a method for detecting and quantifying a target nucleic acid in real time and at high speed using a single signal fluorescent material.
  • PCR polymerase chain reaction
  • the reactants containing samples usually require dozens of repetitive heating and cooling.
  • one of the important factors determining the total reaction time in the PCR reaction is the time it takes to heat the reaction to a predetermined temperature or to cool it to a predetermined temperature.
  • each step of the PCR reaction for heating and cooling is performed while being maintained at a specific temperature for a certain period of time, and the temperature change section due to the transition from one step to the next step is not considered in the reaction.
  • the time required for the total PCR reaction is increased because time such as a temperature change section is required.
  • the target sequence in order to detect a specific nucleic acid by PCR reaction, the target sequence must be amplified and the internal control sequence must also be amplified. This is required as a step to determine whether the target sequence is not included in the actual sample sample, or whether the amplification reaction has not been properly performed due to a problem in the PCR reaction when the target sequence is not detected.
  • a target sequence and an internal control sequence can be distinguished by using a probe material modified with a fluorescent material of a different wavelength, but this cannot be distinguished when only a fluorescent signal of a single wavelength can be measured.
  • KR Patent Publication No. 10-2016-0126092 discloses a technique for detecting a plurality of target sequences using only a single type of label in one reaction vessel using different detection temperatures.
  • the above document uses a single type of labeling material, but since it uses two types of probes for detecting two nucleic acids with different detection temperatures, a single signal fluorescent substance is used in fact that two types of labeling substances are used. It does not disclose a technique for distinguishing a target sequence from an internal control sequence using only.
  • the present invention is to provide a method for amplifying and quantifying nucleic acids in real time and at high speed.
  • the present invention not only can confirm whether false negatives occur through the internal control sequence under continuous temperature control, but also detect multiple targets at a single wavelength in real time and at high speed using a single signal fluorescent material and amplify curves
  • the present invention was completed by confirming that the measurement and the melting curve measurement can be performed.
  • the present invention relates to a method for detecting and quantifying a target nucleic acid in real time and at high speed by measuring fluorescence at a single wavelength.
  • DNA denaturation, annealing, and DNA synthesis of the target sequence and the internal control sequence are repeated using a PCR reaction solution containing a single signal fluorescent substance and a primer pair that specifically binds to the target sequence.
  • (b) It provides a method for detecting and quantifying a target nucleic acid in real time, including measuring a fluorescence signal at predetermined time intervals from the start of heating for DNA denaturation to the time when DNA denaturation is completed.
  • the single signal fluorescent material in step (a) may be an intercalating dye.
  • the intercalating dye does not bind to single-stranded DNA (ssDNA), but emits fluorescence when it binds to double-stranded DNA (dsDNA) formed by synthesizing DNA after primer binding (annealing). It is done. Therefore, the intercalating dye can quantify the amplification product by measuring the fluorescence signal in the annealing or DNA synthesis step.
  • the intercalating dye may be used to quantify the amplification product of the internal control sequence due to the nonspecific nature of binding to all nucleic acid sequences, or to determine whether the PCR reaction is false negative by using the melting temperature (Tm).
  • the intercalating dye may be SYBR Green I, SYBR Gold, YoYo, Evagreen, or LCGreen, but is not limited thereto.
  • the dye may be a SYBR-based intercalating dye.
  • the pair of primers specifically binding to the target sequence in step (a) may be represented by the nucleic acid sequences of SEQ ID NOs: 1 and 2:
  • R is A or G.
  • the primer is used for initiation of the PCR reaction, and refers to an oligonucleotide or polynucleotide that hybridizes complementarily to a template DNA.
  • the primers for the PCR reaction are a pair of forward primers (or sense primers) selected from the same sense strand as the direction of the genetic code of the nucleic acid molecule to be amplified, and reverse primers (or antisense primers) selected from the antisense strands complementary to the sense strands. Can be used.
  • the internal control sequence amplified together with the target sequence may be designed to have a lower melting temperature (Tm) than the amplification product of the target sequence.
  • the internal control sequence may be included for the purpose of removing false negatives of the PCR reaction. For example, if the target sequence is not detected after the PCR reaction, it is essential to check whether the target sequence is not included in the sample sample or the PCR reaction has not been properly performed. Accordingly, the internal control sequence is a sequence that should always be detected, and if the internal control sequence is not detected after the PCR reaction, it should be determined that the PCR reaction has not been properly performed.
  • the melting refers to the separation of double-stranded DNA (dsDNA) into single-stranded DNA (ssDNA) as the temperature increases, and accordingly, the intensity of fluorescence changes with time. It is called the melting curve.
  • the melting temperature (Tm) refers to the midpoint in the melting curve and the temperature at which 50% of double-stranded DNA (dsDNA) is separated into single-stranded DNA (ssDNA). That is, the melting temperature Tm is a temperature at which the fluorescence signal rapidly decreases, and the melting temperature is a temperature at which fluorescence emitted from the intercalating dye is hardly detected.
  • the PCR reaction solution includes not only the above-described single signal fluorescent substance and the primer pair specifically binding to the target sequence, but also DNA polymerase and dNTP (deoxynucleotide mixture) required for the PCR reaction.
  • a buffer solution or magnesium chloride (MgCl 2 ) may be included.
  • the continuous temperature control in step (a) may be performed in an apparatus capable of performing a PCR reaction of a kinetic paradigm.
  • the device may be a real-time PCR device.
  • the real-time PCR device refers to a device capable of amplifying a nucleic acid having a specific nucleic acid sequence and measuring and analyzing the occurrence and degree of a PCR amplification product in real time.
  • PCR reactions can be divided into equilibrium and kinetic paradigms according to the state of temperature.
  • the PCR reaction of the equilibrium paradigm it is a method that has been mainly used in the past, and the steps of DNA denaturation, annealing, and DNA synthesis for nucleic acid amplification are maintained at a specific temperature for a certain period of time, and the temperature according to the transition from one step to the next. The interval of change is not taken into account in the response.
  • each step for nucleic acid amplification occurs over a specific temperature.
  • temperature control is continuously performed. Accordingly, the reaction rate of each step such as DNA denaturation, annealing, and DNA synthesis is only dependent on temperature, and more than one reaction, such as annealing and DNA synthesis, may occur simultaneously in a temperature change section.
  • the method according to the present invention comprises a DNA denaturation step performed at a first temperature; And a temperature control method in a nucleic acid amplification reaction in which annealing and/or DNA synthesis steps performed at the second temperature are repeated several times.
  • the continuous temperature control controls
  • Heating the reaction vessel to a first temperature by contacting the reaction vessel containing the PCR reaction solution with a heating block
  • the first temperature refers to a temperature at which DNA denaturation is performed
  • the second temperature refers to a temperature at which annealing and/or DNA synthesis is performed. That is, only annealing may be performed at the second temperature, or annealing and DNA synthesis may be simultaneously performed. In this case, heating the reaction vessel to a first temperature and cooling to a second temperature may be repeated several times. In this case, when only annealing is performed at the second temperature, cooling the reaction vessel may further include a step of allowing the reaction vessel to stand at a fourth temperature for a predetermined period of time for DNA synthesis.
  • Heating the reaction vessel to a first temperature by contacting the reaction vessel containing the PCR reaction solution with a heating block kept constant at a first temperature
  • the first temperature is a temperature at which DNA denaturation is performed
  • a third temperature is a temperature at which annealing is performed
  • the second temperature is a temperature at which DNA synthesis is performed.
  • DNA denaturation, annealing, and DNA synthesis steps are represented by one cycle.
  • the step of heating the reaction vessel to the first temperature includes contacting the reaction vessel containing the PCR reaction solution with a heating block maintained at a specific temperature for a certain period of time so that the reaction solution reaches a desired denaturation temperature. It can be heated for a predetermined period of time so that it can be used. In this case, the heating block may maintain a temperature of 90°C or higher.
  • the step of cooling the reaction vessel to a second temperature includes moving the reaction vessel or one of the heating blocks in a specific direction to separate the reaction vessel from the heating block, and then the separated reaction vessel reaches the desired cooling temperature. It may be cooled by contacting with the artificial air flow generated from the blowing fan for a predetermined period of time.
  • the temperature of the reaction solution in the reaction vessel can be controlled to reach a desired temperature.
  • the temperature of the reaction solution may be adjusted to repeat the temperature range of a specific range.
  • the artificial air flow may be wind at room temperature.
  • the room temperature may vary depending on the environment, but the speed of the wind may be controlled by attaching a thermometer for measuring the outside temperature to the device and adjusting the rpm of the fan that generates the wind.
  • a thermometer for measuring the outside temperature to the device and adjusting the rpm of the fan that generates the wind.
  • the speed of the wind can affect the cooling time.
  • the time required to cool the reaction solution heated for DNA denaturation to the annealing and/or DNA synthesis temperature is the speed of the wind blown toward the reaction vessel.
  • the cooling time can be determined by the general formula:
  • t is the time required for cooling
  • v is the speed of the wind.
  • the temperature is based on the reaction solution or reactant contained in the reaction vessel.
  • the temperature of the reaction vessel due to the nature of the PCR reaction, it may be considered that there is no difference between the temperature of the reaction vessel and the temperature of the reaction solution, considering the material of the general PCR tube, which has a volume of about 1 to 50 ⁇ l, and has excellent heat transfer.
  • the temperature of the reaction vessel can be understood as the temperature of the reaction solution.
  • the method according to the invention can be carried out using an apparatus such as that shown in FIGS. 1 and 2.
  • a heating block (2) that maintains heating at a high temperature of a metal material in which a hole is formed in the shape of the reaction vessel so that the bottom of the reaction vessel (1) can completely contact the heating block (2), and wind (artificial air flow) (4)
  • a device in which the blowing fan 3 designed to provide) is located above the heating block can be used.
  • the reaction vessel (1) containing the reaction solution is heated for DNA denaturation, it contacts the heating block (2) and is heated, and then moves upward, and is cooled by contacting each of the winds (4) generated from the blowing fan (3).
  • heating and cooling of the reaction solution can be achieved with a very simple operation. That is, during heating, the reaction vessel is mounted on the heating block to perform rapid heating, and at the same time, the opening/closing block blocks the blowing nozzle to block cooling by the cooling wind, or, if necessary, the wind may be continuously generated. In addition, during cooling, the heating block is separated from the reaction vessel to stop heating, and the opening/closing block is separated from the blowing nozzle to open the blowing nozzle, so that rapid cooling can be achieved by the cooling wind.
  • the reaction vessel may be changed according to the configuration of the apparatus in which the method according to the present invention is implemented, for example, a 100 ⁇ l or 200 ⁇ l tube, a capillary tube, a microfluidic channel or a thin film chamber may be used. It is not limited thereto.
  • the first temperature refers to a temperature required to separate double-stranded DNA into single-stranded DNA in a nucleic acid amplification reaction
  • the first temperature is the composition of the base constituting the DNA, such as G/C composition ratio, total It can be determined by various factors such as the length and the concentration of the salt contained in the buffer, and this can be selected at an appropriate temperature by a person skilled in the art.
  • the first temperature may be 90° C. or higher and 90 to 100° C., but is not limited thereto.
  • the heating block used to heat the reaction vessel to the first temperature may be one to maintain the first temperature. That is, since the heating block does not require temperature change, the reaction speed can be increased.
  • the heating block may be selected using a method known in the art, for example, a peltier, a resistive heater, a heating oil, a specific temperature wind, or a high or low temperature Liquid or the like may be used, but is not limited thereto.
  • the method of the present invention in the same PCR reaction conditions (tube and volume) as the conventional PCR method (e.g., PCR reaction of an equilibrium paradigm), the method of the present invention is a conventional PCR method (e.g., PCR reaction of an equilibrium paradigm). Compared to, it is possible to perform a PCR reaction quickly.
  • the method of the present invention can be applied to different PCR reaction conditions (tube and volume), and the method of the present invention includes a conventional PCR method (eg, a Peltier-based temperature control method with one existing heating/cooling source) and In comparison, PCR reactions can be performed quickly.
  • the method according to the present invention may have a different ramping rate (the degree of temperature change per second), which is a volume change through an experiment or a ramping according to the material characteristics of the reaction container.
  • the heating/cooling time can be determined by obtaining the rate.
  • the step of heating the reaction vessel to the first temperature includes contacting the reaction vessel and the heating block for a predetermined period of time, in which the temperature of the reaction solution contained in the reaction vessel is brought into contact with the heating block. It means the time to reach a temperature sufficient for denaturation of the double-stranded DNA of the reaction solution.
  • the predetermined time may be determined according to the volume of the reaction solution, and may be determined as an appropriate time by a person skilled in the art.
  • the reaction vessel and the heating block are separated from each other. In this process, the heating block or reaction vessel may be moved.
  • the heating block may be lowered, or the reaction vessel may be raised while the heating block is fixed.
  • the distance between the heating block and the reaction vessel separated from the heating block is limited if the total reaction time is minimized according to the time required for movement, and if it is an appropriate distance for the wind provided from the excursion fan to contact the reaction vessel according to the position of the blower. It is not.
  • the reaction vessel is separated from the distance at which the reaction vessel does not affect the temperature of the heating block, that is, the air around the heating block heated by the heating block, and the wind provided for cooling directly reaches the heating block and
  • the contact may be a gap that does not affect the temperature maintenance of the heating block.
  • the interval may be 0.5 cm to 2 cm.
  • the separated reaction vessel may be exposed to an artificial air flow for a predetermined period of time for cooling.
  • the artificial air flow is wind at room temperature through a fan-type device equipped with a motor, such as a general cooling fan, a blower fan, a cross fan, or an air compressor. It may be provided, but is not limited thereto.
  • the step of cooling the reaction vessel may be performed by moving the reaction vessel upward to a predetermined position so that the position of the heating block is fixed and the reaction vessel and the heating block are separated. .
  • annealing and DNA synthesis may be performed simultaneously in one step, or DNA denaturation, annealing and DNA synthesis reactions may be performed separately.
  • DNA denaturation, annealing, and DNA synthesis are each individually performed, it may further include the step of allowing the cooled reaction vessel to stand at room temperature for a predetermined period of time after cooling the reaction vessel.
  • the present invention can detect and quantify a target nucleic acid by performing the step (b) of measuring a fluorescence signal at a specific time point while performing a PCR reaction under continuous temperature control. More specifically, the step (b) is to measure the fluorescence signal at regular time intervals from the start of heating to the time when DNA denaturation is completed, and select the fluorescence signal measured at the time point Tx among the measured fluorescence signal values, and the The fluorescence signal measured at the time point Tx refers to the fluorescence signal measured at the point when the temperature reaches a temperature higher than the melting temperature of the amplification product for the internal control sequence.
  • the fluorescence signal (signal B) measured at the start of heating includes the fluorescence signal of the amplification product for the target sequence and the fluorescence signal of the amplification product for the internal control sequence, and the fluorescence signal measured at the time point Tx (signal A ) May include only the fluorescence signal of the amplification product for the target sequence.
  • the predetermined time interval for measuring the fluorescence signal may be 0.5 to 1 second, but is not limited thereto.
  • the Tx time point may vary depending on the melting temperature (Tm) of the internal control sequence. That is, since the Tx time point can be determined according to the target sequence to be detected, it can be applied universally. This is due to the temperature control method through time control suggested in the present invention, that is, since the present invention can control the signal measurement temperature by controlling the measurement point, even if the target sequence is different and the Tm value of the PCR product is different, If only the Tx time point can be determined, the target nucleic acid can be detected and quantified. In the case of a conventional probe, such as a TaqMan probe, it is cumbersome to apply a probe suitable for the target sequence every time the target sequence is changed.
  • Tm melting temperature
  • the present invention may further include the step of confirming whether or not false negatives have occurred by checking whether the internal control sequence has been amplified.
  • the method according to the present invention can simultaneously analyze the amplification cuff and the melting curve through one reaction vessel and one PCR reaction. After PCR amplification is complete, the temperature is gradually raised after the last DNA denaturation step, and the melting curve indicating the trend of decreasing the fluorescence intensity of the fluorescent substance as the double-stranded DNA is separated into single-stranded DNA according to the thermal denaturation of the amplification product is analyzed. The amplification of the target sequence and the internal control sequence can be confirmed.
  • the melting curve one or more melting temperatures at which 50% of double-stranded DNA is separated into single-stranded DNA can be identified.Because the melting temperature represents a different temperature depending on the length or arrangement of the nucleic acid sequence, the difference in melting temperature can be determined. Through this, the amplification product for the target sequence and the amplification product for the internal control sequence can be distinguished. In other words, the amplification products of multiple target sequences can be distinguished by using the difference in melting temperature.
  • the present invention can detect and quantify nucleic acids in real time and at high speed by measuring a fluorescent signal from a light source of a single wavelength using a single signal fluorescent material under continuous temperature control, so that the structure is simple, compact, and lightweight. Can provide.
  • FIGS. 1A and 1B are schematic diagrams of the appearance of a PCR apparatus to which the method according to the present invention is applied, consisting of a reaction vessel 1, a heating block 2, and a blowing fan 3, and a reaction containing a reaction solution
  • the container 1 is moved so that it can contact the heating block 2 and the wind 5 generated from the blowing fan, respectively.
  • FIGS. 2A and 2B are schematic diagrams of a method in which heating and cooling are achieved in a PCR apparatus to which the method according to the present invention is applied, and the reaction vessel 1 moves to the heating block 2 and is brought into contact to heat the reaction solution. Then, the reaction vessel 1 moves in front of the blowing fan 3 and contacts the wind 5 generated from the blowing fan to cool the reaction solution.
  • FIG. 3 is a schematic diagram of a method of measuring the fluorescence of a PCR reaction and amplification product using a Bio-rad CFX 96 device.
  • 4 is an optical curve measured at 60° C. using a Bio-rad CFX96 apparatus, and is an amplification curve in which the amount of the fluorescence signal derived from the amplification product of the internal control and the fluorescence signal derived from the amplification product of the target sequence are summed.
  • FIG. 5 is an optical curve measured at 84° C. using a Bio-rad CFX96 device, and the amplified product of the internal control is denatured at a temperature of 79° C. or higher and does not exhibit fluorescence.
  • FIG. 5 is an optical amplification curve in which a fluorescence signal derived from an amplification product of an internal control sequence is removed from the amplification curve of FIG. 4, and is an amplification curve consisting only of a fluorescence signal derived from an amplification product of a target sequence.
  • FIG. 6 is a schematic diagram of a method of measuring fluorescence of a PCR reaction and amplification product using the apparatus to which the present invention is applied.
  • FIG. 7 is an optical curve consisting of data of the optical measurement sequence No. 1 using the apparatus to which the present invention is applied, and amplification in which the fluorescence signal derived from the amplification product of the internal control sequence and the fluorescence derived from the amplification product of the target sequence are combined It's a curve.
  • FIG. 8 is an optical curve composed of data of the 11th optical measurement sequence using the apparatus to which the present invention is applied, and is an amplification curve of a signal excluding a fluorescent signal derived from an amplification product of an internal control sequence in the amplification curve of FIG. 7, and a target It is an amplification curve consisting only of a fluorescent signal derived from the amplification product of the sequence.
  • a control material of the Quanti-HCV v1.0 kit was extracted and mixed with a PCR reaction solution.
  • 20 ⁇ l of a PCR reaction solution containing different concentrations of control IVT RNA was added to each strip of a reaction vessel connected to several PCR tubes, and the container lid was closed, and pre-denaturation (pre-denatured) for 1 minute in a heating block heated to 98°C. -denaturation) step was carried out.
  • the denaturation step was performed by contacting the heating block for 8 seconds, and an artificial air flow was provided by a blowing fan to cool for 9 seconds to perform annealing and DNA synthesis steps. This process was repeated 45 times to perform a PCR reaction, and specific PCR reaction solutions, PCR devices, and reaction conditions are shown in Table 1 below:
  • RNA extraction -Internal control gene and HCV RNA extraction Viral RNA extraction kit (SEF-016, Ugenecell, KR) PCR reaction vessel Bioplastic 0.1 mL tube strip(low profile) PCR amplification instrument ExAmplar(Ugenecell, KR) CFX 96 (Bio-rad, US) PCR reaction solution -PCR mixture: primer (forward: 5'- GTCTGCGGAACCGGTGAGTACA-3'/reverse: 5'- CGCRACCCAACRCTACTCGGCTA-3'; R is A or G, respectively)-Real MOD 2X RT-PCR enzyme mix (iNtRon, KR) PCR amplification conditions A. Reverse transcription (48°C, 15 minutes) B.
  • HCV target RNA was added to the reaction tube at 13 IU and 300 IU, respectively, and 10 IU of internal control RNA was added to all tubes. NC (negative control) to which HCV target RNA was not added was also tested. The fluorescence of the amplified product was measured through the optics of each amplifier.
  • an existing commercially available real-time PCR apparatus Bio-rad's CFX 96 was used. The PCR reaction using the Bio-rad's CFX 96 was performed as shown in FIG. 3 below, and the optical curve measured at 60°C is shown in FIG. 4 and the optical curve measured at 84°C is shown in FIG.
  • FIG. 6 The PCR reaction using the apparatus of the present invention was performed as shown in FIG. 6, and the optical curves according to this are shown in FIGS. 7 and 8, respectively, and FIG. 7 is a signal of the measurement sequence No. 1, and FIG. 8 is a signal of the measurement sequence No. 11. Consisted of signals.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

본 발명은 실시간 및 고속으로 핵산을 검출 및 정량하는 방법에 관한 것으로, 본 발명은 연속적인 온도 조절 하에서 단일 신호 형광 물질을 사용하여 단일 파장의 광원에서 형광 신호를 측정할 수 있어 구조가 단순하고 소형화 및 경량화된 실시간 고속 PCR 방법을 제공할 수 있다.

Description

단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법
본 발명은 단일 신호 형광 물질을 이용하여 실시간 및 고속으로 타겟 핵산을 검출하고 정량하는 방법에 관한 것이다.
PCR(polymerase chain reaction, 중합효소연쇄반응)은 생물학적 시료에서 특정 핵산을 선택적으로 증폭할 수 있는 기술로, DNA 변성(denaturation), 어닐링(annealing) 및 DNA 합성(extension) 단계로 이루어 진다. 이러한 PCR 과정에서 시료를 포함하는 반응물은 보통 수십 회의 반복적인 가열 및 냉각을 필요로 한다. 특히 PCR 반응에서 전체 반응 시간을 결정하는 중요한 요소 중 하나는 반응물을 소정의 온도로 가열 또는 소정의 온도로 냉각하는데 걸리는 시간이다. 종래에는 PCR 반응에서 가열 및 냉각을 위해 PCR 반응의 각 단계를 수행하기 위해 특정 온도에서 일정시간 유지되어 수행되며, 한 단계에서 다음 단계로의 전이에 따른 온도 변화 구간은 반응에 고려되지 않는다. 이 경우, 온도 변화 구간 등의 시간이 필수적으로 요구되어 총 PCR 반응에 소요되는 시간이 증가하게 되는 단점이 있다.
또한, PCR 반응에 의한 특정 핵산의 검출을 위해서는 타겟 서열이 증폭되어야 함과 동시에 내부 대조군 서열도 증폭되어야 한다. 이는 타겟 서열이 검출되지 않았을 경우, 실제 검체 시료에 타겟 서열이 포함되지 않은 것인지, 또는 PCR 반응에 문제가 있어서 증폭 반응이 제대로 수행되지 않은 것인지 확인하는 단계로서 요구된다.
한편, 실시간 PCR 장치의 경우, 단가 절감, 소형화 및 측정 시간 단축을 위해 단일 파장의 형광 신호만 측정할 수 있는 단점이 있다. 상기와 같이 단일 파장의 형광 신호만 측정할 수 있는 경우, 타겟 서열에 대한 증폭 산물의 형광 신호와 내부 대조군 서열에 대한 증폭 산물의 형광 신호를 동시에 측정할 수 없다. 일반적으로 각각 다른 파장의 형광 물질로 수식화된 프로브 물질을 사용하여 타겟 서열과 내부 대조군 서열을 구분할 수 있는데, 단일 파장의 형광 신호만을 측정할 수 있는 경우에는 이를 구분할 수 없다.
이러한 단점을 개선하기 위해, 단일 파장 형광 측정 모듈로 타겟 서열의 증폭과 내부 대조군 서열의 증폭을 구분할 수 있는 방법의 개발이 요구되고 있다. KR 공개특허 제10-2016-0126092호에서는, 상이한 검출 온도를 이용하여 하나의 반응 용기에서 단일 유형의 표지만으로도 복수의 타겟 서열을 검출하는 기술을 개시하고 있다. 그러나, 상기 문헌은 단일 유형의 표지 물질을 사용하기는 했으나, 검출 온도가 상이한 두 핵산을 검출하기 위한 2 종의 프로브를 사용하고 있어서 사실상 2종의 표지 물질을 사용하고 있다는 점에서 단일 신호 형광 물질만을 이용하여 타겟 서열과 내부 대조군 서열을 구분하는 기술은 개시하고 있지 못하다.
본 발명은 실시간 및 고속으로 핵산을 증폭하고 정량하는 방법을 제공하고자 하는 것이다.
본 발명자들은 고속 PCR 방법에 대해 연구하던 중, 동력 패러다임의 PCR 장치에서 단일 신호 형광 물질과 내부 대조군 서열을 함께 사용함으로써, 실시간 및 고속으로 핵산을 증폭하고 정량화하는 것이 가능함을 확인하였다.
연구 결과, 본 발명은 연속적인 온도 조절 하에서, 내부 대조군 서열을 통해 위음성의 발생 여부를 확인할 수 있을 뿐만 아니라, 단일 신호 형광 물질을 사용하여 실시간 및 고속으로 단일 파장에서 다수의 표적을 검출하고 증폭 커브 측정과 멜팅 커브 측정을 수행할 수 있음을 확인하여 본 발명을 완성하였다.
따라서, 본 발명은 단일 파장에서 형광을 측정하여 타겟 핵산을 실시간 및 고속으로 검출하고 정량하는 방법에 관한 것이다.
이하, 본 발명의 구성을 구체적으로 설명한다.
본 발명은,
(a) 연속적인 온도 조절 하에서,
단일 신호 형광 물질 및 타겟 서열에 특이적으로 결합하는 프라이머 쌍을 포함하는 PCR 반응 용액을 사용하여 타겟 서열 및 내부 대조군 서열의 DNA 변성(denaturation), 어닐링(annealing) 및 DNA 합성(extension) 과정을 반복 수행하는 단계; 및
(b) DNA 변성을 위한 가열 시작 시점부터 DNA 변성이 완료되는 시점까지 일정 시간 간격으로 형광 신호를 측정하는 단계를 포함하는 실시간으로 타겟 핵산을 검출하고 정량하는 방법을 제공한다.
본 발명에 있어서, 상기 (a) 단계에서 단일 신호 형광 물질은 인터칼레이팅 염료일 수 있다. 상기 인터칼레이팅 염료(intercalating dye)는 단일가닥 DNA(ssDNA)에는 결합하지 않고, 프라이머 결합(어닐링) 후, DNA가 합성(extension)되어 형성되는 이중나선 DNA(dsDNA)에 결합할 때 형광을 발광하게 된다. 따라서, 상기 인터칼레이팅 염료는 어닐링 또는 DNA 합성 단계에서 형광 신호를 측정하여 증폭 산물을 정량할 수 있다.
상기 인터칼레이팅 염료는 모든 핵산서열에 결합하는 비특이적인 특성으로 인해 내부 대조군 서열의 증폭 산물을 정량하거나, 융해 온도(Tm)를 이용하여 PCR 반응의 위음성 여부를 결정하는데 사용될 수 있다.
상기 인터칼레이팅 염료는 SYBR Green I, SYBR Gold, YoYo, Evagreen 또는 LCGreen일 수 있으나, 이에 제한되지 않는다.
한 구체예에서, 상기 염료는 SYBR 계열의 인터칼레이팅 염료일 수 있다.
본 발명에 있어서, 상기 (a) 단계에서 타겟 서열에 특이적으로 결합하는 프라이머 쌍은 SEQ ID NO: 1 및 2의 핵산 서열로 표시되는 것일 수 있다:
[SEQ ID NO: 1] 5'- GTCTGCGGAACCGGTGAGTACA -3'
[SEQ ID NO: 2] 5'- CGCRACCCAACRCTACTCGGCTA -3'
상기 SEQ ID NO: 2에서, R은 A 또는 G이다.
본 발명에서, 상기 프라이머는 PCR 반응의 개시를 위해 사용되는 것으로, 주형 DNA에 상보적으로 혼성화하는 올리고뉴클레오타이드 또는 폴리뉴클레오타이드를 의미한다. PCR 반응을 위한 프라이머는 증폭되는 핵산 분자의 유전자 코드 진행 방향과 동일한 센스 가닥으로부터 선택되는 정방향 프라이머(또는 센스 프라이머), 및 센스 가닥에 상보적인 안티센스 가닥으로부터 선택되는 역방향 프라이머(또는 안티센스 프라이머)의 쌍이 사용될 수 있다.
본 발명에 있어서, 상기 타겟 서열과 함께 증폭되는 내부 대조군 서열은 타겟 서열의 증폭 산물보다 낮은 융해 온도(Tm)를 갖도록 디자인된 것일 수 있다. 본 발명에서, 상기 내부 대조군 서열은 PCR 반응의 위음성을 제거하기 위한 목적으로 포함될 수 있다. 예컨대, PCR 반응 후에 타겟 서열이 검출되지 않은 경우, 검체 시료에 타겟 서열이 포함되지 않은 것인지 또는 PCR 반응이 제대로 수행되지 않은 것인지 확인하는 단계가 필수적이다. 이에, 상기 내부 대조군 서열은 항상 검출되어야 하는 서열로서, PCR 반응 후 상기 내부 대조군 서열이 검출되지 않은 경우에는 PCR 반응이 제대로 수행되지 않은 것으로 판단되어야 한다.
본 발명에 있어서, 상기 융해는 온도가 증가함에 따라 이중나선 DNA(dsDNA)가 단일가닥 DNA(ssDNA)로 분리되는 것을 말하며, 이에 따라 형광의 강도가 시간에 따라 변하게 되는데, 이러한 관계를 나타내는 그래프를 멜팅 커브라고 한다. 상기 융해 온도(Tm)는 멜팅 커브에서의 중간점, 및 이중나선 DNA(dsDNA)의 50%가 단일가닥 DNA(ssDNA)로 분리되는 온도를 의미한다. 즉, 융해 온도(Tm)는 형광 신호가 급격히 감소하는 온도이고, 융해 온도는 인터칼레이팅 염료에서 발광하는 형광이 거의 검출되지 않는 온도이다.
본 발명에 있어서, 상기 PCR 반응 용액은 앞서 기술한 단일 신호 형광 물질과 타겟 서열에 특이적으로 결합하는 프라이머 쌍뿐만 아니라, PCR 반응에 필요한 DNA 중합효소(DNA polymerase), dNTP(디옥시뉴클레오타이드 혼합물), 완충액(buffer solution) 또는 염화 마그네슘(MgCl 2)이 포함될 수 있다.
본 발명에 있어서, 상기 (a) 단계의 연속적인 온도 조절은 동력 패러다임(kinetic paradigm)의 PCR 반응을 수행할 수 있는 장치 내에서 수행될 수 있다. 상기 장치는 실시간 PCR 장치일 수 있다. 상기 실시간 PCR 장치는 특정 핵산서열을 갖는 핵산을 증폭함과 동시에 PCR 증폭 산물의 발생 유무 및 정도를 실시간으로 측정 및 분석할 수 있는 장치를 의미한다.
일반적으로, PCR 반응은 온도의 상태에 따라 평형(equilibrium) 및 동력(kinetic) 패러다임 방식으로 나눌 수 있다. 평형 패러다임의 PCR 반응의 경우, 종래에 주로 사용하던 방법으로, 핵산 증폭을 위한 DNA 변성, 어닐링 및 DNA 합성 단계는 특정 온도에서 일정시간 유지되어 수행되며, 한 단계에서 다음 단계로의 전이에 따른 온도 변화 구간은 반응에 고려되지 않는다. 반면, 본 발명과 같은 동력 패러다임의 PCR 반응은 핵산 증폭을 위한 각각의 단계가 특정 온도에 걸쳐서 일어나게 된다. 즉, 동력 패러다임의 경우 온도 조절이 연속적으로 이루어진다. 따라서, DNA 변성, 어닐링 및 DNA 합성과 같은 각 단계의 반응 속도는 온도에 의존적일 뿐, 온도 변화 구간에서 하나 이상의 반응, 예컨대 어닐링과 DNA 합성이 동시에 일어날 수 있다.
이에, 본 발명에 따른 방법은 제 1 온도에서 수행되는 DNA 변성 단계; 및 제 2 온도에서 수행되는 어닐링 및/또는 DNA 합성 단계를 수회 반복하는 핵산 증폭 반응에서의 온도 조절 방식을 이용하는 것이다.
한 구체예에서, 상기 연속적인 온도 조절은,
상기 PCR 반응 용액이 포함된 반응 용기를 가열 블록과 접촉시켜 상기 반응 용기를 제 1 온도로 가열시키는 단계, 및
상기 가열된 반응 용기와 가열 블록을 분리시킨 후 소정의 시간 동안 상기 분리된 용기를 인위적 공기 흐름에 노출시켜 상기 용기를 제 2 온도로 냉각시키는 단계를 포함하는 방법으로 수행될 수 있으며,
이때, 상기 제 1 온도는 DNA 변성이 수행되는 온도이고, 제 2 온도는 어닐링 및/또는 DNA 합성이 수행되는 온도를 의미한다. 즉, 상기 제 2 온도에서는 어닐링만 수행되거나, 어닐링과 DNA 합성이 동시에 수행될 수 있다. 이때, 상기 반응 용기를 제 1 온도로 가열시키는 단계 및 제 2 온도로 냉각시키는 단계는 수회 반복되어 수행될 수 있다. 이때, 제 2 온도에서 어닐링만 수행되는 경우, 반응 용기를 냉각시키는 단계에 이어 DNA 합성을 위해 상기 반응 용기를 제 4 온도에서 일정 시간 정치하는 단계를 추가로 포함할 수 있다.
다른 구체예에서, 상기 연속적인 온도 조절은,
상기 PCR 반응 용액이 포함된 반응 용기를 제 1 온도로 일정하게 유지되는 가열 블록과 접촉시켜 상기 반응 용기를 제 1 온도로 가열시키는 단계,
상기 가열된 반응 용기와 가열 블록을 분리시킨 후 소정의 시간 동안 상기 분리된 용기를 인위적 공기 흐름에 노출시켜 상기 용기를 제 3 온도로 냉각시키는 단계, 및
상기 냉각된 반응 용기를 가열 블록과 접촉시켜 제 2 온도로 가열시킨 후, 상기 반응 용기와 가열 블록을 분리시키는 단계를 포함하는 방법으로 수행될 수 있으며,
상기 제 1 온도는 DNA 변성이 수행되는 온도이고, 제 3 온도는 어닐링이 수행되는 온도이며, 제 2 온도는 DNA 합성이 수행되는 온도를 의미한다.
본 발명에 있어서, DNA 변성, 어닐링 및 DNA 합성 단계를 하나의 사이클로 나타낸다.
본 발명에 따른 방법에서, 제 1 온도로 반응 용기를 가열시키는 단계는, PCR 반응 용액이 담긴 반응 용기를 일정 시간 동안 특정 온도로 유지되는 가열 블록과 접촉시켜서 반응 용액이 목적하는 변성 온도에 도달할 수 있도록 소정의 시간 동안 가열시킬 수 있다. 이때 상기 가열 블록은 90℃ 이상의 온도를 유지하는 것일 수 있다. 이어서, 제 2 온도로 반응 용기를 냉각시키는 단계는, 반응 용기를 가열 블록과 분리시키기 위해 반응 용기 또는 가열 블록 중 하나를 특정 방향으로 이동시킨 후, 분리된 반응 용기가 목적하는 냉각 온도에 도달할 수 있도록 송풍 팬으로부터 발생한 인위적 공기 흐름과 소정의 시간 동안 접촉시켜서 냉각시킬 수 있다. 이때, 가열 블록과의 접촉 또는 송풍 팬으로부터 발생한 인위적 공기 흐름과의 접촉 시간을 조절함으로써, 반응 용기 내 반응 용액의 온도가 목적하는 온도에 도달할 수 있도록 제어할 수 있다. 이 과정을 반복하여, 반응 용액의 온도가 특정 범위의 온도 구간을 반복하도록 조절할 수 있다.
한 구체예에서, 상기 인위적 공기 흐름은 상온의 바람일 수 있다. 상기 상온의 온도는 환경마다 차이가 날 수 있지만, 장치에 외기 온도 측정 온도계를 부착해서 바람을 생성하는 팬의 rpm을 조절하여 바람의 속도를 제어할 수 있다. 또한, 실내에서 사용되는 경우, PCR의 온도 조건을 고려하면, 상온의 온도에 해당하는 20℃, 30℃ 바람 또는 그 이상의 온도인 35℃의 바람에서 반응 용기를 냉각시키는 시간에는 차이가 거의 나타나지 않았다. 그러나, 바람의 속도는 냉각 시간에 영향을 미칠 수 있다.
본 발명에서, DNA 변성을 위해 가열된 반응 용액을 어닐링 및/또는 DNA 합성 온도로 냉각시키는데 소요되는 시간, 즉 반응 용기가 인위적 공기 흐름에 노출되는 소정의 시간은 반응 용기를 향해 분사한 바람의 속도와 관계가 있으며, 냉각 시간은 다음의 일반식으로 결정할 수 있다:
Figure PCTKR2020012411-appb-img-000001
상기 일반식에서, t는 냉각에 소요되는 시간이며, v는 바람의 속도를 의미한다.
본 발명에서, 온도는 반응 용기에 담긴 반응 용액 또는 반응물을 기준으로 한다. 그러나, PCR 반응의 특성상, 그 부피가 약 1 내지 50 ㎕로 극미량이고, 열전달이 우수한 일반적인 PCR 튜브의 재질을 고려하면, 반응 용기의 온도와 반응 용액의 온도는 차이가 없는 것으로 여겨질 수 있다. 따라서, 달리 명시하지 않는 한, 반응 용기의 온도는 반응 용액의 온도로 이해될 수 있다.
한 구체예에서, 본 발명에 따른 방법은 도 1 및 2에 도시된 것과 같은 장치를 이용하여 수행될 수 있다. 구체적으로 반응 용기(1)의 밑 부분이 가열 블록과 완전히 접촉할 수 있도록 반응 용기의 모양대로 홀이 형성된 금속재의 고온으로 가열이 유지되는 가열 블록(2), 그리고 바람(인위적 공기 흐름)(4)을 제공할 수 있도록 고안된 송풍 팬(3)이 가열 블록 윗 쪽에 위치한 장치가 사용될 수 있다. 반응 용액이 담긴 반응 용기(1)가 DNA 변성을 위해 가열되는 단계에서 가열 블록(2)과 접촉하여 가열된 후에 윗 쪽으로 이동하여, 송풍 팬(3)으로부터 발생한 바람(4)과 각각 접촉하여 냉각될 수 있다. 이 경우 반응 용액의 가열 및 냉각이 매우 간단한 동작으로 달성될 수 있다. 즉, 가열시에는 반응 용기가 가열 블록에 장착되어 신속한 가열을 수행함과 동시에, 개폐 블록이 송풍 노즐을 막아 냉각용 바람에 의한 냉각을 차단하거나, 필요한 경우, 지속적으로 바람이 생성될 수도 있다. 아울러, 냉각시에는 가열 블록이 반응 용기로부터 분리되어 가열을 중단시킴과 동시에, 개폐 블록이 송풍 노즐로부터 분리되어 송풍 노즐이 개방됨으로써, 냉각용 바람에 의해 신속한 냉각이 이루어질 수 있다.
본 발명에 있어서, 상기 반응 용기는 본 발명에 따른 방법이 구현되는 장치의 구성에 따라 변경될 수 있으나, 예컨대 100㎕ 또는 200㎕의 튜브, 모세관 튜브, 미세유체 채널 또는 박막 챔버가 사용될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 제 1 온도는 핵산 증폭 반응에서 이중나선 DNA를 단일가닥 DNA로 분리하는데 요구되는 온도를 의미하며, 상기 제 1 온도는 DNA를 구성하는 염기의 조성, 예컨대 G/C 조성비, 전체 길이, 버퍼에 포함된 염의 농도 등과 같은 다양한 요인에 의해 결정될 수 있고, 이는 당업자에 의해 적절한 온도로 선택될 수 있다. 예컨대, 상기 제 1 온도는 90℃ 이상, 90 내지 100℃일 수 있으나, 이에 제한되지 않는다.
상기 제 1 온도로 반응 용기를 가열시키기 위해 사용되는 가열 블록은 제 1 온도를 유지하는 것일 수 있다. 즉, 상기 가열 블록은 온도 변화를 필요로 하지 않기 때문에 반응 속도를 높일 수 있다. 상기 가열 블록은 당업계의 공지된 방식을 이용하여 선택될 수 있으며, 예컨대 열전소자(peltier), 저항막 히터(resistive heater), 열선 코일(heating oil), 특정 온도의 바람, 또는 고온 또는 저온의 액체 등이 사용될 수 있으나 이에 제한되는 것은 아니다.
본 발명의 방법에 따르면, 종래의 PCR 방법(예컨대, 평형 패러다임의 PCR 반응)과 동일한 PCR 반응 조건(튜브 및 부피)에서, 본 발명의 방법은 종래의 PCR 방법(예컨대, 평형 패러다임의 PCR 반응)에 비해 신속하게 PCR 반응을 수행할 수 있다. 또한, 상이한 PCR 반응 조건(튜브 및 부피)에도 본 발명의 방법을 적용할 수 있으며, 본 발명의 방법은 종래의 PCR 방법(예컨대, 기존의 가열/냉각 소스가 하나인 펠티어 기반 온도 조절 방법)과 비교하여 신속하게 PCR 반응을 수행할 수 있다.
PCR 반응 조건에 있어서, 다른 용기 및 다른 부피가 적용되는 경우, 본 발명에 따른 방법은 ramping rate(초당 온도 변화 정도)가 달라질 수 있는데, 이는 실험을 통해 부피 변화 또는 반응 용기의 재질 특성에 따른 ramping rate를 획득하여 가열/냉각 시간을 결정할 수 있다.
본 발명에서, 상기 반응 용기를 제 1 온도로 가열시키는 단계는 반응 용기와 가열 블록을 일정 시간 동안 접촉시키는 것을 포함하는데, 이때 상기 일정 시간은 반응 용기에 담긴 반응 용액의 온도가 가열 블록과 접촉되어 반응 용액의 이중나선 DNA의 변성에 충분한 온도에 도달하는 시간을 의미한다. 이때, 상기 소정의 시간은 반응 용액의 부피에 따라 결정될 수 있으며, 당업자에 의해 적절한 시간으로 결정될 수 있다.
상기 반응 용기의 온도가 제 1 온도에 도달한 후, 상기 반응 용기와 가열 블록은 서로 분리된다. 이 과정에서 가열 블록 또는 반응 용기가 이동될 수 있다.
한 구체예에서, 상기 가열 블록이 하강하거나, 또는 가열 블록이 고정된 상태에서 반응 용기가 상승할 수 있다.
상기 가열 블록과 분리된 반응 용기의 간격은 이동에 소요되는 시간에 따라 총 반응 시간이 최소화되며, 송풍기의 위치에 따라 상기 반응 용기에 소풍 팬으로부터 제공되는 바람이 접촉되기에 적절한 간격이라면, 제한되는 것은 아니다. 예컨대, 상기 반응 용기가 가열 블록의 온도에 영향을 미치지 않는 거리, 즉 가열 블록으로 인해 가열된 가열 블록 주변의 공기로부터 상기 반응 용기가 분리되고, 냉각을 위해 제공되는 바람이 가열 블록에 직접 도달 및 접촉하여 가열 블록의 온도 유지에 영향을 주지 않는 간격일 수 있다.
한 구체예에서, 상기 간격은 0.5 cm 내지 2 cm일 수 있다.
본 발명에서, 상기 분리된 반응 용기는 냉각을 위해 인위적 공기 흐름에 소정의 시간 동안 노출시킬 수 있다. 이때 상기 인위적 공기 흐름은 상온의 바람으로 모터를 구비한 팬 타입의 장치, 예컨대 일반 냉각 팬(cooling fan), 송풍 팬(blower fan), 크로스 팬(cross fan) 또는 압축 분사기(air compressor)를 통해 제공될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 반응 용기를 냉각시키는 단계는, 상기 가열 블록의 위치가 고정되고, 상기 반응 용기와 가열 블록이 분리되도록 일정 위치까지 상기 반응 용기가 가열 블록의 위 방향으로 이동됨으로써 수행될 수 있다.
앞서 기술한 것과 같이, 본 발명의 방법은 어닐링 및 DNA 합성이 하나의 단계에서 동시에 수행되거나, DNA 변성, 어닐링 및 DNA 합성 반응이 개별적으로 수행될 수 있다. DNA 변성, 어닐링 및 DNA 합성이 각각 개별적으로 수행되는 경우, 반응 용기를 냉각시키는 단계 이후에 상기 냉각된 반응 용기를 상온에서 일정 시간 정치시키는 단계를 추가로 포함할 수 있다.
상기와 같이, 본 발명은 연속적인 온도 조절 하에서 PCR 반응을 수행하면서, 특정 시점의 형광 신호를 측정하는 (b) 단계를 수행하여 타겟 핵산을 검출하고 정량할 수 있다. 보다 구체적으로, 상기 (b) 단계는 가열 시작 시점으로부터 DNA 변성이 완료되는 시점까지 일정 시간 간격으로 형광 신호를 측정하되, 측정된 형광 신호 값 중 Tx 시점에서 측정된 형광 신호를 선택하는 것이며, 상기 Tx 시점에서 측정된 형광 신호는 내부 대조군 서열에 대한 증폭 산물의 융해 온도보다 높아지는 온도에 도달하는 시점에서 측정된 형광 신호를 의미한다. 이때, 가열 시작 시점에서 측정된 형광 신호(신호 B)는 타겟 서열에 대한 증폭 산물의 형광 신호와 내부 대조군 서열에 대한 증폭 산물의 형광 신호를 포함하고, 상기 Tx 시점에서 측정된 형광 신호(신호 A)는 타겟 서열에 대한 증폭 산물의 형광 신호만을 포함할 수 있다. 상기 (b) 단계에서, 형광 신호를 측정하는 일정 시간 간격은 0.5 내지 1초일 수 있으나, 이에 제한되는 것은 아니다.
상기 Tx 시점은 내부 대조군 서열의 융해 온도(Tm)에 따라 달라질 수 있다. 즉, 검출하고자 하는 타겟 서열에 따라 상기 Tx 시점이 결정될 수 있으므로, 범용적으로 적용할 수 있다. 이는 본 발명에서 제시한 시간 제어를 통한 온도 조절 방식에 의한 것으로, 즉, 본 발명은 상기 측정 시점을 조절하여 신호 측정 온도를 조절할 수 있기 때문에 타겟 서열이 달라져서 PCR 산물의 Tm값이 달라지더라도, 상기 Tx 시점만 결정할 수 있다면 타겟 핵산을 검출 및 정량할 수 있다. 종래와 같은 프로브, 예컨대 TaqMan 프로브의 경우, 타겟 서열이 달라질 때마다 타겟 서열에 맞는 프로브를 매번 적용시켜야 하는 번거로움이 있다.
또한, 본 발명은 내부 대조군 서열의 증폭 여부를 확인하여 위음성의 발생 여부를 확인하는 단계를 추가로 포함할 수 있다.
본 발명에 따른 방법은 하나의 반응 용기 및 한 번의 PCR 반응을 통해 증폭 커프와 멜팅 커브를 동시에 분석할 수 있다. PCR 증폭이 끝난 후 마지막 DNA 변성 단계 이후에 온도를 점차 올려 증폭 산물의 열 변성에 따라 이중나선 DNA가 단일가닥 DNA로 분리되면서 상기 형광 물질의 형광 강도가 감소하는 추세를 표시하는 멜팅 커브를 분석하여 타겟 서열과 내부 대조군 서열의 증폭을 확인할 수 있다. 즉, 멜팅 커브를 통해 이중나선 DNA의 50%가 단일 가닥 DNA로 분리되는 하나 이상의 융해 온도를 확인할 수 있는데, 융해 온도는 핵산서열의 길이나 배열에 따라 다른 온도를 나타내기 때문에 융해 온도의 차이를 통해 타겟 서열에 대한 증폭 산물과 내부 대조군 서열에 대한 증폭 산물을 구분할 수 있다. 다시 말해서, 상기 융해 온도의 차이를 이용하여 다중 타겟 서열의 증폭 산물을 구분할 수 있다.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.
본 발명은 연속적인 온도 조절 하에서 단일 신호 형광 물질을 사용하여 단일 파장의 광원에서 형광 신호를 측정함으로써 실시간 및 고속으로 핵산을 검출 및 정량할 수 있으므로, 구조가 단순하고 소형화 및 경량화된 실시간 고속 PCR 방법을 제공할 수 있다.
도 1a 및 도 1b는 본 발명에 따른 방법이 적용되는 PCR 장치의 외관을 도식화한 것으로, 반응 용기(1), 가열 블록(2), 및 송풍 팬(3)으로 구성되며, 반응 용액이 담긴 반응 용기(1)가 가열 블록(2) 및 송풍 팬으로부터 발생한 바람(5)과 각각 접촉할 수 있도록 이동한다.
도 2a 및 도 2b는 본 발명에 따른 방법이 적용되는 PCR 장치에서 가열과 냉각이 달성되는 방법을 도식화한 것으로, 반응 용기(1)는 가열 블록(2)로 이동하고 접촉되어 반응 용액을 가열하고, 이어서 반응 용기(1)는 송풍 팬(3) 앞으로 이동하여 송풍 팬으로부터 발생한 바람(5)과 접촉하여 반응 용액을 냉각한다.
도 3은 Bio-rad CFX 96 장치를 사용하여 PCR 반응 및 증폭 산물의 형광을 측정하는 방법을 도식화한 것이다.
도 4는 Bio-rad CFX96 장치를 사용하여 60℃에서 측정한 광학 커브로, 내부 대조군의 증폭 산물에서 유래한 형광 신호와 타겟 서열의 증폭 산물에서 유래한 형광 신호의 양이 합쳐진 증폭 커브이다.
도 5는 Bio-rad CFX96 장치를 사용하여 84℃에서 측정한 광학 커브로, 내부 대조군의 증폭 산물은 79℃ 이상의 온도에서 변성되어 형광을 나타내지 않게 된다. 도 5는 도 4의 증폭 커브에서 내부 대조군 서열의 증폭 산물에서 유래한 형광 신호가 제거된 광학의 증폭 커브이며, 타겟 서열의 증폭 산물에서 유래한 형광 신호로만 구성된 증폭 커브이다.
도 6은 본 발명이 적용된 장치를 사용하여 PCR 반응 및 증폭 산물의 형광을 측정하는 방법을 도식화한 것이다.
도 7은 본 발명이 적용된 장치를 사용하여 광학 측정 1번 sequence의 데이터로 구성된 광학 커브로, 내부 대조군 서열의 증폭 산물에서 유래한 형광 신호와 타겟 서열의 증폭 산물에서 유래한 형광의 양이 합쳐진 증폭 커브이다.
도 8은 본 발명이 적용된 장치를 사용하여 광학 측정 11번 sequence의 데이터로 구성된 광학 커브로, 도 7의 증폭 커브에서 내부 대조군 서열의 증폭 산물에서 유래한 형광 신호를 제외한 신호의 증폭 커브이며, 타겟 서열의 증폭 산물에서 유래한 형광 신호로만 구성된 증폭 커브이다.
이하, 본 발명을 실시예를 통해 상세히 설명한다. 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다.
[실시예]
실시예 1: 타겟 핵산 검출 확인
1) HCV viral RNA 검출
HCV viral RNA를 검출하기 위해, Quanti-HCV v1.0 키트의 대조군 물질을 추출하여 PCR 반응 용액과 혼합하였다. 각각 다른 농도의 대조군 IVT RNA가 첨가된 PCR 반응 용액 20㎕를 여러 개의 PCR 튜브가 연결된 반응 용기 스트립에 각각 첨가하고, 용기 뚜껑을 닫은 후 98℃로 가열된 가열 블록에서 1분간 전-변성(pre-denaturation) 단계를 진행하였다. 이어서 가열 블록과 8초간 접촉하여 변성 단계를 수행하고, 송풍 팬에 의해 인위적 공기 흐름을 제공하여 9초간 냉각시켜 어닐링 및 DNA 합성 단계를 수행하였다. 이 과정을 45회 반복하여 PCR 반응을 수행하였으며, 구체적인 PCR 반응 용액, PCR 장치 및 반응 조건은 다음 표 1과 같다:
조건 본 발명 종래 기술
RNA 추출 -내부 대조군 유전자 및 HCV RNA 추출: Viral RNA 추출 키트(SEF-016, Ugenecell, KR)
PCR 반응 용기 Bioplastic 0.1 mL tube strip(low profile)
PCR 증폭 기기 ExAmplar(Ugenecell, KR) CFX 96 (Bio-rad, US)
PCR 반응 용액 -PCR mixture: 프라이머(정방향: 5'- GTCTGCGGAACCGGTGAGTACA-3'/역방향: 5'- CGCRACCCAACRCTACTCGGCTA-3'; R은 각각 A 또는 G)- Real MOD 2X RT-PCR enzyme mix(iNtRon, KR)
PCR 증폭 조건 A. 역전사(48℃, 15분)B. 최초변성(98℃, 5분)C. 가열(98℃(가열블록에 접촉), 15초)-가열 15초동안 0.8초 간격으로 신호 측정(sequence로 표시)D. 냉각(9초)E. 정치(12초)C-E: 45회 반복 A. 역전사(48℃, 15분)B. 최초변성(98℃, 5분)C. 가열(95℃, 20초)D. 증폭, 1차 광학 측정(60℃, 10초)E. 2차 광학 측정(84℃, 10초)C-E: 45회 반복
HCV 타겟 RNA를 각각 13 IU 및 300 IU씩 반응 튜브에 첨가하였으며, 내부 대조군 RNA 10 IU를 모든 튜브에 첨가하였다. HCV 타겟 RNA를 첨가하지 않는 NC (음성 대조군)도 함께 테스트하였다. 증폭 산물의 형광은 각각의 증폭기의 광학기를 통해서 측정하였다. 상기 실험에서, 종래의 PCR 방법과 비교하기 위해, 기존에 시판중인 real-time PCR 장치(Bio-rad사의 CFX 96)를 사용하였다. 상기 Bio-rad사의 CFX 96을 이용한 PCR 반응은 하기 도 3과 같이 수행하였으며, 60℃에서 측정한 광학 커브를 도 4에, 84℃에서 측정한 광학 커브를 도 5에 나타내었다.
본 발명의 장치를 이용한 PCR 반응은 도 6과 같이 수행하였으며, 이에 따른 광학 커브는 도 7 및 8에 각각 나타내었고, 상기 도 7은 측정 1번 sequence의 신호로, 도 8은 측정 11번 sequence의 신호로 구성되었다.
실험 결과, 도 4, 5 및 도 7, 8에서 비교할 수 있듯이, 종래의 real-time PCR 장치에서 사용하는 일반적인 신호 측정 방법을 통해 얻은 증폭 커브(도 4)에서는 타겟 서열 증폭에 의한 신호와 내부 유전자 서열 증폭에 의한 신호가 겹쳐져 있어서, 관심있는 타겟 서열의 신호만을 구분하기가 어려웠다. 이에, 타겟 서열의 신호만을 구분하기 위해 측정 온도를 조절하여 내부 유전자 서열 증폭에 의한 신호를 제거해야만 했다(도 5). 반면, 본 발명이 적용된 PCR 장치에서는 형광 신호의 측정 시점에 따라 내부 대조군 서열의 형광 신호를 제외할 수 있어 타겟 서열에 대한 증폭 산물의 형광 신호만을 검출하는 것이 가능함을 확인할 수 있었다(도 7 및 8).

Claims (16)

  1. (a) 연속적인 온도 조절 하에서,
    단일 신호 형광 물질 및 타겟 서열에 특이적으로 결합하는 프라이머 쌍을 포함하는 PCR 반응 용액을 사용하여 타겟 서열 및 내부 대조군 서열의 DNA 변성(denaturation), 어닐링(annealing) 및 DNA 합성(extension) 과정을 반복 수행하는 단계; 및
    (b) DNA 변성을 위한 가열 시작 시점부터 DNA 변성이 완료되는 시점까지 일정 시간 간격으로 형광 신호를 측정하는 단계를 포함하는 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  2. 제1항에 있어서,
    상기 (a) 단계에서 단일 신호 형광 물질은 인터칼레이팅 염료(intercalating dye)인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  3. 제1항에 있어서,
    상기 (a) 단계에서 내부 대조군 서열은 PCR 반응의 위음성을 제거하기 위한 것인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  4. 제1항에 있어서,
    상기 (a) 단계에서 연속적인 온도 조절은
    상기 PCR 반응 용액이 포함된 반응 용기를 가열 블록과 접촉시켜 상기 반응 용기를 제 1 온도로 가열시키는 단계, 및
    상기 가열된 반응 용기와 가열 블록을 분리시킨 후 소정의 시간 동안 상기 분리된 용기를 인위적 공기 흐름에 노출시켜 상기 용기를 제 2 온도로 냉각시키는 단계를 포함하며,
    상기 제 1 온도는 DNA 변성이 수행되는 온도이고, 제 2 온도는 어닐링 및/또는 DNA 합성이 수행되는 온도인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  5. 제1항에 있어서,
    상기 (a) 단계에서 연속적인 온도 조절은
    상기 PCR 반응 용액이 포함된 반응 용기를 가열 블록과 접촉시켜 상기 반응 용기를 제 1 온도로 가열시키는 단계,
    상기 가열된 반응 용기와 가열 블록을 분리시킨 후 소정의 시간 동안 상기 분리된 용기를 인위적 공기 흐름에 노출시켜 상기 용기를 제 3 온도로 냉각시키는 단계, 및
    상기 냉각된 반응 용기를 가열 블록과 접촉시켜 제 2 온도로 가열시킨 후, 상기 반응 용기와 가열 블록을 분리시키는 단계를 포함하며,
    상기 제 1 온도는 DNA 변성이 수행되는 온도이고, 제 3 온도는 어닐링이 수행되는 온도이며, 제 2 온도는 DNA 합성이 수행되는 온도인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  6. 제4항 또는 제5항에 있어서,
    상기 반응 용기를 냉각시키는 단계에서, 상기 가열 블록의 위치는 고정되며, 상기 반응 용기와 가열 블록이 분리되도록 일정 위치까지 상기 반응 용기를 가열 블록의 위 방향으로 이동시키는 것인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  7. 제6항에 있어서,
    상기 반응 용기를 냉각시키는 단계에서, 인위적 공기 흐름은 지속적으로 제공되는 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  8. 제4항 또는 제5항에 있어서,
    상기 반응 용기를 냉각시키는 단계에서, 상기 반응 용기의 위치는 고정되며, 상기 반응 용기와 가열 블록이 분리되도록 일정 위치까지 가열 블록을 상기 반응 용기의 아래 방향으로 이동시키는 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  9. 제8항에 있어서,
    상기 반응 용기를 냉각시키는 단계에서, 인위적 공기 흐름은 상기 가열 블록이 상기 용기로부터 분리되었을 경우에만 제공되는 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  10. 제4항 또는 제5항에 있어서,
    상기 반응 용기를 냉각시키는 단계에서, 소정의 시간은 하기 일반식 1으로 결정되는 실시간으로 타겟 핵산을 검출하고 정량하는 방법:
    [일반식 1]
    Figure PCTKR2020012411-appb-img-000002
    상기 일반식 1에서, t는 소정의 시간을 의미하고, v는 인위적 공기 흐름의 속도이다.
  11. 제4항 또는 제5항에 있어서,
    상기 분리된 반응 용기와 가열 블록의 간격은 0.5 내지 2 cm인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  12. 제4항에 있어서,
    상기 제 2 온도에서 어닐링만 수행되는 경우, 제 2 온도로 냉각된 반응 용기를 가열 블록과 접촉시켜 상기 반응 용기를 제 4 온도로 가열시킨 후, 다시 상기 반응 용기와 가열 블록을 분리시키는 단계를 추가로 포함하고,
    상기 제 4 온도는 DNA 합성이 수행되는 온도인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  13. 제1항에 있어서,
    상기 (b) 단계는 가열 시작 시점으로부터 DNA 변성이 완료되는 시점까지 일정 시간 간격으로 형광 신호를 측정하되, 측정된 형광 신호 값 중 Tx 시점에서 측정된 형광 신호를 선택하는 것이며,
    상기 Tx 시점에서 측정된 형광 신호는 내부 대조군 서열에 대한 증폭 산물의 융해 온도보다 높아지는 온도에 도달하는 시점에서 측정된 형광 신호인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  14. 제13항에 있어서,
    상기 (b) 단계에서, 가열 시작 시점에서 측정된 형광 신호(신호 B)는 타겟 서열에 대한 증폭 산물의 형광 신호와 내부 대조군 서열에 대한 증폭 산물의 형광 신호를 포함하고,
    상기 Tx 시점에서 측정된 형광 신호(신호 A)는 타겟 서열에 대한 증폭 산물의 형광 신호만을 포함하는 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  15. 제1항에 있어서,
    상기 (b) 단계에서 일정 시간 간격은 0.5 내지 1초인 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
  16. 제1항에 있어서,
    상기 방법은 내부 대조군 서열의 증폭 여부를 확인하여 위음성의 발생 여부를 확인하는 단계를 추가로 포함하는 실시간으로 타겟 핵산을 검출하고 정량하는 방법.
PCT/KR2020/012411 2019-11-20 2020-09-15 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법 WO2021101049A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP20889629.0A EP4063520A4 (en) 2019-11-20 2020-09-15 METHOD FOR DETECTING AND QUANTIFYING TARGET NUCLEIC ACID IN REAL-TIME USING SINGLE-SIGNAL FLUORESCENT MATERIAL
US17/777,108 US20230007924A1 (en) 2019-11-20 2020-09-15 Method for detecting and quantifying target nucleic acid in real time using single signal fluorescent material

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0149391 2019-11-20
KR1020190149391A KR102107589B1 (ko) 2019-11-20 2019-11-20 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법

Publications (1)

Publication Number Publication Date
WO2021101049A1 true WO2021101049A1 (ko) 2021-05-27

Family

ID=70734254

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/012411 WO2021101049A1 (ko) 2019-11-20 2020-09-15 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법

Country Status (4)

Country Link
US (1) US20230007924A1 (ko)
EP (1) EP4063520A4 (ko)
KR (1) KR102107589B1 (ko)
WO (1) WO2021101049A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102107589B1 (ko) * 2019-11-20 2020-05-07 주식회사 유진셀 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법
KR20230163236A (ko) * 2022-05-23 2023-11-30 바디텍메드(주) 핵산증폭 검사시스템

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004506431A (ja) * 2000-08-11 2004-03-04 ユニバーシティ　オブ　ユタ　リサーチ　ファウンデーション 単一ラベルオリゴヌクレオチド・プローブ
US7537886B1 (en) * 1999-06-22 2009-05-26 Life Technologies Corporation Primers and methods for the detection and discrimination of nucleic acids
US20100075296A1 (en) * 2008-07-31 2010-03-25 Spartan Bioscience Inc. Thermal cycling by positioning relative to fixed-temperature heat source
KR20160126092A (ko) 2014-03-28 2016-11-01 주식회사 씨젠 상이한 검출 온도를 이용한 타겟 핵산 서열의 검출
KR20170080784A (ko) * 2015-12-30 2017-07-11 바이오코아 주식회사 단일 형광에 대해서 pcr의 다중신호를 측정하는 방법
KR20180090955A (ko) * 2017-02-03 2018-08-14 주식회사 유진셀 핵산증폭 반응의 온도조절 방법 및 그 용도
KR102107589B1 (ko) * 2019-11-20 2020-05-07 주식회사 유진셀 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110062659B (zh) * 2017-01-25 2021-11-23 (株)优真世 高速核酸扩增装置及核酸扩增反应的温度控制方法

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7537886B1 (en) * 1999-06-22 2009-05-26 Life Technologies Corporation Primers and methods for the detection and discrimination of nucleic acids
JP2004506431A (ja) * 2000-08-11 2004-03-04 ユニバーシティ　オブ　ユタ　リサーチ　ファウンデーション 単一ラベルオリゴヌクレオチド・プローブ
US20100075296A1 (en) * 2008-07-31 2010-03-25 Spartan Bioscience Inc. Thermal cycling by positioning relative to fixed-temperature heat source
KR20160126092A (ko) 2014-03-28 2016-11-01 주식회사 씨젠 상이한 검출 온도를 이용한 타겟 핵산 서열의 검출
KR20170080784A (ko) * 2015-12-30 2017-07-11 바이오코아 주식회사 단일 형광에 대해서 pcr의 다중신호를 측정하는 방법
KR20180090955A (ko) * 2017-02-03 2018-08-14 주식회사 유진셀 핵산증폭 반응의 온도조절 방법 및 그 용도
KR102107589B1 (ko) * 2019-11-20 2020-05-07 주식회사 유진셀 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
AHRBERG CHRISTIAN D., NEUŽIL PAVEL: "Doubling Throughput of a Real-Time PCR", SCIENTIFIC REPORTS, vol. 5, no. 1, 1 December 2015 (2015-12-01), XP055813181, DOI: 10.1038/srep12595 *
CHRISTIAN D. AHBERG, ANDREAS MANZ, PAVEL NEUZIL: "Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye", SCIENTIFIC REPORTS, vol. 5, pages 11479, XP055201930, DOI: 10.1038/srep11479 *
See also references of EP4063520A4

Also Published As

Publication number Publication date
EP4063520A4 (en) 2024-03-20
KR102107589B1 (ko) 2020-05-07
EP4063520A1 (en) 2022-09-28
US20230007924A1 (en) 2023-01-12

Similar Documents

Publication Publication Date Title
WO2021101049A1 (ko) 단일 신호 형광 물질을 이용한 실시간 타겟 핵산 검출 및 정량 방법
US8614061B2 (en) Combination of fluorescent dyes for the detection of nucleic acids
KR0171629B1 (ko) 증폭 생성물에 대한 빠른 분석
CN106399517B (zh) 一种多交叉恒温扩增结合金纳米生物传感的核酸检测技术
EP0892071A2 (en) Method of measuring melting temperature of nucleic acid
WO1996006187A1 (en) Nucleotide sequencing method
CN110317861B (zh) 一种检测病原体的试剂盒
Lee et al. A simple, low-cost, and rapid device for a DNA methylation-specific amplification/detection system using a flexible plastic and silicon complex
WO2014193198A1 (ko) 바이오 물질의 실시간 정량 및 정성 분석 방법
WO2019066238A9 (ko) 증폭 데이터 표시 방법 및 장치
CN110885904B (zh) 用于鉴别16种猪病病原冻干微芯片、试剂盒及方法
WO2022010238A1 (ko) 특정 인공 뉴클레오타이드 서열을 이용한 위양성 판단용 조성물 및 이를 이용한 위양성 판단 방법
CN112126587A (zh) 核酸检测芯片装置、核酸检测芯片及其制备方法
CN105755134B (zh) 一种内切酶介导的实时多交叉置换核酸扩增技术及应用
WO2013122319A1 (ko) 리가제 반응과 절단효소 증폭반응을 이용한 표적 유전자 또는 이의 돌연변이 검출방법
WO2022139061A1 (ko) 휴대용 rt-pcr 장치 및 이를 이용한 rt-pcr 측정 방법
KR102039785B1 (ko) 핵산증폭 반응의 온도조절 방법 및 그 용도
NL2031160B1 (en) Primer Set, Probe and Application for Distinguishing Brucella S2 Vaccine Strain from Wild Strain
CN111575386B (zh) 一种检测人y-snp基因座的荧光复合扩增试剂盒及应用
KR101919896B1 (ko) 단일 형광 채널 유전자증폭기기를 이용한 다중 핵산 검출 방법
WO2020242261A1 (en) Method for detecting target nucleic acid in sample
CA2485411A1 (en) Direct pcr quantification
US20240052433A1 (en) Device and assay for diagnosing tuberculosis and associated antibiotic resistances
NL2034274B1 (en) DETECTION METHOD OF MUTATION TYPE OF parC GENE OF MYCOPLASMA GENITALIUM AND KIT
US20240018568A1 (en) Microfluidic Analysis Device and Method for the Operation Thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20889629

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020889629

Country of ref document: EP

Effective date: 20220620