WO2021040473A1 - 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법 - Google Patents

혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법 Download PDF

Info

Publication number
WO2021040473A1
WO2021040473A1 PCT/KR2020/011581 KR2020011581W WO2021040473A1 WO 2021040473 A1 WO2021040473 A1 WO 2021040473A1 KR 2020011581 W KR2020011581 W KR 2020011581W WO 2021040473 A1 WO2021040473 A1 WO 2021040473A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hsa
lift
downward
nanovesicle
Prior art date
Application number
PCT/KR2020/011581
Other languages
English (en)
French (fr)
Inventor
성학준
윤정기
Original Assignee
주식회사 뉴메이스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 뉴메이스 filed Critical 주식회사 뉴메이스
Priority to EP20856044.1A priority Critical patent/EP4024048A4/en
Priority to JP2022513207A priority patent/JP2022546423A/ja
Priority to CN202080059655.XA priority patent/CN114269368A/zh
Priority to US17/636,159 priority patent/US20220290098A1/en
Publication of WO2021040473A1 publication Critical patent/WO2021040473A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0607—Non-embryonic pluripotent stem cells, e.g. MASC
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/554—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being a biological cell or cell fragment, e.g. bacteria, yeast cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/65—MicroRNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/32—Cardiovascular disorders
    • G01N2800/323—Arteriosclerosis, Stenosis

Definitions

  • the present invention relates to a method for diagnosing and treating arteriosclerosis using nanovesicles targeting blood flow changes.
  • Atherosclerosis is a leading cause of death, but current diagnostic methods do not yet detect its early pathogenic signs associated with an irreversible cascade.
  • Conventional prevention and treatment options aimed at low cholesterol levels, blood pressure or plaque formation are widely used, although a substantial risk of disease progression remains.
  • the occurrence of disturbed blood flow which is an early arteriosclerotic event that occurs from bifurcation, bent areas or peripheral to stenosis, leads to dysfunction of endothelial cells (EC).
  • EC endothelial cells
  • the EC In normal blood flow, the EC is aligned in the direction of blood flow and maintains anti-inflammatory and anti-thrombotic function.
  • atherosclerosis vortex, activates EC dysfunction with increased inflammatory and thrombotic events, ultimately leading to atherosclerosis.
  • the vortex-targeted Theragnostic which can be proposed as a promising solution to this fatal chronic disease, must be thoroughly proven.
  • MSC Mesenchymal stem cells
  • VSMC Vascular smooth muscle cells
  • MSC-derived nanovesicles have emerged as therapeutic nanocarriers with improved in vivo circulation time capable of promoting cell interactions as well as having cell-originated anti-inflammatory and pre-regenerative properties.
  • Recent alternative engineering approaches can physically disrupt cells through micropore filtration and induce self-assembly of the resulting cell membrane fragments and internal contents, thereby producing cell-derived nanovesicles with a yield of more than 100 times higher.
  • Vortex formation is one of the fastest atherosclerotic events, which increases endothelial permeability and subsequent monocyte recruitment.
  • An object of the present invention is to provide a stem cell-derived nanovesicle and a method for producing the same, which exhibits a peptide targeting the eddy current site causing arteriosclerosis on the surface.
  • Another object of the present invention is to provide a preventive, diagnostic and therapeutic use of the nanovesicles for arteriosclerosis.
  • the present invention provides a stem cell-derived nanovesicle that displays a peptide targeting a disturbed blood flow site on the surface.
  • the present invention also comprises the step of obtaining a nanovesicle displaying a vortex site targeting peptide on the surface from a stem cell transfected with a vector in which the coding sequence of the signal peptide-vortex site targeting peptide-transmembrane protein is sequentially inserted. It provides a method of manufacturing the above nanovesicles.
  • the present invention also provides a composition for diagnosing arteriosclerosis comprising the above nanovesicles.
  • the present invention also provides a composition for preventing or treating arteriosclerosis comprising the above nanovesicles.
  • the present invention also provides a method of treating arteriosclerosis comprising administering to a subject a therapeutically effective amount of the above nanovesicles.
  • the present invention provides a stem cell-derived nanovesicle, which is an anti-arteriosclerosis diagnostic treatment platform using a peptide capable of targeting a vortex region, wherein the nanovesicles are similar to those of mesenchymal stem cells, and are strong anti-inflammatory and It can be used as a new diagnostic treatment that can prevent the onset of arteriosclerosis by providing an endothelial repair effect.
  • Figure 1a shows the mechanism of operation of PREY/MSC-derived nanovesicles (PMSC-NV) and a schematic diagram of PREY peptide display, specifically the vortex site-targeting peptide (PREY) is selected from phage display screening, specifically designed It is displayed outside the MSC membrane (PMSC) through transfection and expression of the plasmid.
  • PMSC-NV PREY/MSC-derived nanovesicles
  • PREY vortex site-targeting peptide
  • FIG. 1b shows that PMSC-derived NV (PMSC-NV) is produced through a continuous extrusion process using a membrane controlled to a series of micropore sizes, and PMSC-NV contains the same transmembrane and intracellular components as PMSC. I did it.
  • Figure 1c shows that the partial coronary artery ligation (PCL) model is used in the in vivo test, and PMSC-NV is administered intravenously and is circulated throughout the body to target the vortex area, thereby improving their diagnostic treatment performance. Test.
  • PCL partial coronary artery ligation
  • FIG. 2A is a schematic diagram of the design of a plasmid for expressing PREY on the outer layer of an MSC membrane.
  • GFP Green fluorescence protein: inner membrane signal
  • transmembrane protein-v5 tag outer membrane signal
  • Figure 2b is a pair of three types of transmembrane proteins (CD86, CD105 and CD271) and two types of hMSC (ASC and BMSC), FACS (x-axis: GFP + cells / y-axis: V5 tag + cells). This is the result of quantitatively comparing the transfection efficiency. At this time, since the CD271-ASC pair has the highest transfection efficiency, it was previously selected.
  • Figure 2c is a PREY-CD271 plasmid dose-dependent apoptosis using Alexa Fluor 488-conjugated Annexin V 30 minutes after transfection (0X: electroporation without plasmid and 1X, 2X: 100, 200 ng plasmid/10 5 cells).
  • Figure 2d is a result of visualization in PMSC after transfection of PREY-CD271-v5 tag plasmid with ASC, and the positions of GFP (green inner membrane signal) and PREY-v5 tag (red outer membrane signal), respectively. It indicates that it is mainly observed outside and inside the cell membrane.
  • 2E is a result of measuring the size and shape distribution of PMSC-NV using a transmission electron microscope (TEM), and the yellow dotted line represents the film of PMSC-NV.
  • TEM transmission electron microscope
  • 2F is a result of analysis of transfection expression and cell membrane protein CD9 by Western blot.
  • Figure 2g is a result of analysis using a miRNA array whether or not the internal miRNA components are preserved.
  • FIG. 3 shows a schematic diagram of a vector design for expressing a PREY fusion protein, wherein the sequence gene of the PREY fusion protein is inserted into a common CMV promoter backbone together with an ampicillin resistance gene for cloning.
  • Figure 4a is a fluorescence image showing the transfection efficiency of the 1 ⁇ plasmid in BMSC and ASC, respectively, 24 hours after transfection of PREY-CD271 plasmid in order to examine the transfection efficiency according to the hMSC type (blue: DAPI staining Nuclear).
  • Figure 4b is a result of measuring the number of viable cells according to the transfection capacity (0X, 0.5X, 1X, 2X) of the PREY-CD271 plasmid in BMSC and ASC, the number of viable cells in ASC is higher, so hMSC type was selected. (*p ⁇ 0.05 BMSC vs ASC, #p ⁇ 0.05 vs 0X BMSC, $p ⁇ 0.05 vs 0X ASC).
  • 4C is a result of FACS analysis of transfection efficiency according to the capacity (0.5X, 1X, 2X) of the PREY-CD271 plasmid in ASC.
  • PREY-CD271 is a result of confocal imaging showing the expression of PREY-CD271, and expression of PREY-CD271 can be confirmed through the expression of GFP and PREY-V5 tags in the cell membranes of adjacent ASCs (blue: DAPI stained nuclei).
  • Figure 7a is a diagram showing the anti-inflammatory effect of monocytes activated by BMSC (BMSC-NV) or MSC-NV (no PREY transfection) treatment derived from ASC (ASC-NV), monocytes are MSC -Absorbs MV and shows anti-inflammatory and phagocytosis inhibition.
  • BMSC-NV BMSC-NV
  • MSC-NV no PREY transfection
  • 7B is an imaging result obtained by visualizing RAW264.7 cells and MSC-NV using DiO (green) and DiI (red), respectively, showing that both MSC-NV types are efficiently internalized in macrophages (blue: DAPI stained nuclei).
  • Figure 7c is a result of measuring the expression of anti-inflammatory (IL-10 and IL-13) and pro-inflammatory markers (IL-1 ⁇ and TNF- ⁇ ) mRNA when LPS was treated in mouse Raw 264.7 cells through qRT-PCR. to be.
  • 7D is a result of a dot blot assay using conditioned medium, showing that the amount of black dots in the lower right corner of each type of anti-inflammatory cytokine decreased in the group treated with nanovesicles.
  • the upper left black dot (indicated by a solid circle) shows that the amount of anti-inflammatory cytokines in the test medium was similar in all groups.
  • Figure 7e is a result of analyzing phagocytosis activity by measuring the amount of internalized E. coli particles (green), showing that there is no significant difference between all MSC-NV types, and the panel below shows Oil Red O staining of OX-LDL.
  • the ox-LDL uptake decreased in all NV treatment groups except for the BMSC-NV group, and the chart below is a quantitative result.
  • Figure 8a is a diagram showing the vascular protective effect of EC due to the treatment of MSC-NV (no PREY transfection) derived from BMSC (BMSC-NV) or ASC (ASC-NV), MSC-NV provides EC protection And inhibition of monocyte recruitment indicates that EC dysfunction is restored by MSC-NV absorption.
  • MSC-NV no PREY transfection
  • BMSC-NV BMSC-NV
  • ASC-NV ASC-NV
  • 8B is an imaging result obtained by visualizing iMAEC (immortalized mouse EC) and MSC-NV using DiO (green) and DiI (red), respectively, showing that both MSC-NV types are efficiently internalized to iMAEC (blue : DAPI stained nuclei).
  • Figure 8c is a result of measuring the expression level of the EC dysfunction marker (E-selectin, ICAM-1 and VCAM-1) genes through qRT-PCR, shows that the expression of each gene is reduced by all MSC-NV treatment. .
  • 8D is an image obtained by analyzing the protein expression of VCAM-1 (green) in iMAEC by immunostaining and a quantitative analysis result thereof (blue: DAPI stained nuclei).
  • 8E is a result showing the vascular protective effect by BMSC-NV or ASC-NV treatment with respect to rupture of EC angiogenesis induced by cyclosporine A (CyA) treatment, showing that there is no significant difference between the two MSC-NV types. (*P ⁇ 0.05 vs. LPS/saline treatment group).
  • FIG. 9 is an analysis of the pre-angiogenic effect of MSC-NV in response to EC angiogenesis disturbance by CyA treatment, showing an image staining HUVEC with calcein AM and a quantitative analysis result of vasculature factors ( Saline treatment group vs. *p ⁇ 0.05).
  • Figure 11 is a photograph showing before (left) and after (right) ligation in a mouse PCL model, three of the four LCA branches (ECA: external coronary artery, ICA: internal coronary artery, and OA: occipital artery) are 10- 0 It is ligated using nylon suture, showing that the gastric thyroid artery (STA) is not ligated.
  • ECA external coronary artery
  • ICA internal coronary artery
  • OA occipital artery
  • Figure 13a shows the diagnostic treatment effect of PMSC-NV in the vortex site in the mouse PCL model.
  • Vivotrack680-labeled MSC-NV and PMSC-NV were administered intravenously to systemic circulation 3 days after PCL surgery was performed on the mouse. Then, after 24 hours, the result of analyzing the in vivo distribution of MSC-NV, PMSC-NV and PMSC in the whole mouse body through the in vivo imaging system (IVIS).
  • IVIS in vivo imaging system
  • Figure 13b is to confirm the distribution of MSC-NV, PMSC-NV, and PMSC through an in vivo imaging system (IVIS) in RCA (control) and LCA (ligated) collected after performing the experiment in the same manner as in Figure 13a. This is the result of quantitative analysis (*p ⁇ 0.05 between groups).
  • IVIS in vivo imaging system
  • 13C is an image result of analyzing the expression of filamine A protein in the collected RCA and LCA, and the coexistence of MSC-NV and PMSC-NV by immunostaining, and the result of quantitative analysis thereof (*p ⁇ 0.05 and * between groups. p ⁇ 0.001).
  • 13D shows the result of H&E staining of LCA 14 days after PCL surgery (top row) and the inhibition of neovascularization by PMSC-NV treatment through quantitative analysis of the neointimal structure parameter, and the collected LCA (blue: DAPI stained nuclei) through immunostaining of CD68 (middle row) and VCAM-1 (lower row), showing the mobilization of macrophages by EC.
  • the white line represents the inner boundary of the media layer facing the inner membrane (*p ⁇ 0.05 vs. saline treatment group).
  • FIG. 15 is an image showing accelerated atheroma formation in LCA of ApoE KO and normal mice (balb/c) fed an atherosclerotic diet 14 days after ligation and results of quantitative analysis thereof. Mice fed an atherosclerotic diet but not ligation showed no visible atheroma formation in LCA (ND: undetectable).
  • 16 shows the results of H&E staining of mouse organs (lung, liver, heart and spleen) 11 days after treatment with MSC-NV or PMSC-NV in a PCL mouse model.
  • Ultrasound images showing occlusion (bottom) are shown (yellow arrows: top and bottom of the ligation).
  • 17B is a result showing the formation of vortex in the distal region of the ligation point of LCA in contrast to the one-way laminar flow in the normal and RCA groups through Doppler ultrasound images (yellow arrow: blood flow direction).
  • 17C is an image result showing the expression of filamine A in the inner cortex in RCA and LCA.
  • 17D to 17G are results of intravenous administration of NV on the 3rd day after PCL surgery in pigs, and blood vessels were collected and analyzed 24 hours later, the collected LCA (FIGS. 17D and 17E) and the aortic arch (FIG. 17F and FIG. 17g) Results showing effective PMSC-NV targeting of the vortex site in the pig model through IVIS and immunostaining in the (natural vortex formation region) (inter-group ***p ⁇ 0.001).
  • Fig. 18 shows the results of IVIS imaging of RCA and LCA (induced vortex) (left) and aortic arch (natural vortex) (right) 24 hours after PMSC-NV treatment in a porcine PCL model.
  • Figure 19a is a microfluidic model in order to analyze the PMSC-NV targeting efficiency of human arterial EC under eddy flow, human coronary artery endothelial cells (hCAEC) were adhered and cultured and cultured under unidirectional laminar flow or vortex for 1 day after 12 hours. It shows the process of processing with NV for 1 hour.
  • hCAEC human coronary artery endothelial cells
  • FIG. 19C is a result of immunostaining to analyze the alignment of hCAEC through the expression of filamine A (green) as well as F-actin (red).
  • 19D is a result of quantitatively analyzing F-actin alignment in the flow direction based on the result of FIG. 19C.
  • FIG. 19e is a result of quantitatively analyzing the expression level of filamine A in the cytoplasm under vortex based on the results of FIG. 19c (between groups *p ⁇ 0.05).
  • FIG. 19F is a result of quantitatively analyzing the in vitro targeting efficiency of MSC-NV and PMSC-NV for hCAEC for hCAEC in the eddy region by measuring the NV fluorescence intensity based on the result of FIG. 19C (between groups ***p ⁇ 0.001).
  • 19G is a result of confirming PREY targeting of filamine A by quantitatively analyzing the coexistence of NV and filamine A based on the results of FIG. 19C (***p ⁇ 0.001 between groups).
  • the present invention relates to a stem cell-derived nanovesicle that displays a peptide targeting a disturbed blood flow site on the surface.
  • the present invention is a signal peptide-vortex site targeting peptide-transmembrane protein-green fluorescent protein (GFP) in a stem cell transfected with a vector in which the coding sequence is sequentially inserted, a nanoparticle that displays a vortex site targeting peptide on the surface. It provides a method of manufacturing the above nanovesicles, including the step of obtaining a vesicle.
  • GFP signal peptide-vortex site targeting peptide-transmembrane protein-green fluorescent protein
  • distal blood flow refers to abnormal and irregular blood flow due to the structural characteristics of blood vessels, and is an event of early arteriosclerosis that causes dysfunction of vascular endothelial cells.
  • NV novesicle
  • the present invention provides a stem cell-derived nanovesicle functionalized with a peptide targeting a vortex region (see FIGS. 1A to 1C).
  • the vortex site targeting peptide may be selected from the group consisting of SEQ ID NO: 1 to 5. More specifically, SEQ ID NO: 1 is a PREY peptide having an amino acid sequence of GSPREYTSYMPH, SEQ ID NO: 2 is a Myoferlin peptide having an amino acid sequence of SPREYTSYMPH, SEQ ID NO: 3 is Eyes absent homolog 1 having an amino acid sequence of SLSSYNGSALAS isoform 2 peptide, SEQ ID NO: 4 is a zinc finger protein having an amino acid sequence of ACNTGSPYEC, partial peptide SEQ ID NO: 5 is a Calsyntenin 1, isoform CRA_b peptide having an amino acid sequence of ACTPSFSKIC.
  • the nanovesicle of the present invention makes it easier to check the expression of the vortex site targeting peptide, and the expression ratio of the vortex site targeting peptide is determined through GFP/v5tag FACS sorting in the cell stage before nanovesicle extraction. You can increase it.
  • nanovesicles compared to liposomes, nanovesicles contain a therapeutic substance that inhibits arteriosclerosis derived from stem cells. This has advantages in terms of stability and risk of side effects compared to other chemical drugs.
  • patient-derived autologous stem cells can be used, they are free from immune responses, and in particular, nanovesicles derived from mesenchymal stem cells are cells that are free against host-immune rejection, and the surface markers of the mesenchymal stem cells remain unchanged. Since PMSC-NV possessed also has such characteristics, there is also a possibility for tagging, and the possibility was partially confirmed through preclinical experiments using mice and pigs in the present invention.
  • the mesenchymal stem cells are expected to be free from macrophages compared to liposomes due to the host-immune rejection avoidance mechanism, which is expected to lead to increased targeting efficiency.
  • the nanovesicle is a stem cell transfected with a vector in which the coding sequence of signal peptide-vortex site targeting peptide-transmembrane protein (TMP)-green fluorescent protein (GFP) is sequentially inserted using a known transformation technique. Can be separated through size-controlled extrusion.
  • TMP signal peptide-vortex site targeting peptide-transmembrane protein
  • GFP green fluorescent protein
  • a plasmid DNA designed to generate NV through physical cell crushing and subsequent self-assembly is used, functionalized to display a PREY peptide targeting a vortex site to the outside of the MSC membrane.
  • a plasmid having an external N-terminal-promoter-signal peptide-PREY-v5 tag-TMP-GFP-internal C-terminal structure is constructed (see Figs. 2A to 2G, Fig. 3).
  • the signal peptide may induce localization of the PREY peptide to the outside of the cell membrane, and may inactivate the induced signal through cleavage.
  • the v5 tag and GFP can be used to monitor the location and expression level of PREY.
  • GFP inside the cell membrane, v5 tag and PREY peptide outside the cell membrane are expressed.
  • transmembrane protein TMP
  • TMP transmembrane protein
  • the transmembrane protein may be an exosome marker such as CD86 or a mesenchymal stem cell marker such as CD105 and CD271.
  • N-terminus and C-terminus of the protein must face in opposite directions with the cell membrane interposed therebetween.
  • CD271 having high transfection efficiency can be used.
  • Signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea) and Signal peptide R (BKU008396, Korea Human Gene Bank, Republic of Korea) may be used, but are not limited thereto.
  • the coding sequence of the signal peptide-vortex site targeting peptide-transmembrane protein-green fluorescent protein is a nucleic acid sequence, and the nucleic acid is used in the broadest sense, single-stranded (ss) DNA, double-stranded (ds) DNA , cDNA, (-)-RNA, (+)-RNA, dsRNA, etc. Preferably, it is double-stranded DNA.
  • DNA when DNA is selected as the coding sequence of the signal peptide-vortex site targeting peptide-transmembrane protein, it can be used in the form of being inserted into an expression vector.
  • vector refers to a nucleic acid molecule capable of carrying another nucleic acid linked to itself.
  • plasmid which is a circular double-stranded DNA loop that can ligate additional DNA segments.
  • viral vector capable of ligating additional DNA segments into the viral genome.
  • some vectors are capable of self-replicating within the host cell (eg, bacterial vectors and episomal mammalian vectors having a bacterial origin of replication).
  • Other vectors e.g., non-episomal mammalian vectors
  • vectors are capable of directing the expression of genes to which they are operably linked.
  • a vector is referred to as “recombinant expression vector” (or simply “expression vector”).
  • expression vectors useful in recombinant DNA techniques are usually in the form of plasmids, and since plasmids are the most commonly used vector types, “plasmids” and “vectors” can be used interchangeably.
  • the present invention provides other viral vectors (e.g., adenovirus vectors, adeno-associated virus (AAV) vectors, herpes virus vectors, retroviral vectors, lentiviral vectors, baculovirus vectors) that provide equivalent functions. It also includes a form of expression vector.
  • AAV adeno-associated virus
  • a lentiviral vector can be used. Transformation includes any method of introducing a nucleic acid into an organism, cell, tissue or organ, and as known in the art, it can be performed by selecting an appropriate standard technique according to the host cell. These methods include electroporation, protoplasm fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, agitation using silicon carbide fibers, agrobacteria mediated transformation, PEG, dextran sulfate, lipofectamine, etc. However, it is not limited to this.
  • the stem cells may be stem cells derived from at least one tissue selected from the group consisting of bone marrow, umbilical cord, umbilical cord blood, placenta, blood, skin, adipose tissue, nerve tissue, liver, pancreatic biliary tract, muscle and amniotic membrane; Mesenchymal stem cells; Embryonic stem cells; Alternatively, induced pluripotent stem cells, etc. may be used.
  • stem cells containing miRNAs such as miR-21, miR-132, miR-10, miR-146, miR-143 and let 7 having anti-atherosclerotic properties may be used.
  • adipose-derived stem cells having high transfection efficiency and low apoptosis rate may be used.
  • the nanovesicles of the present invention are extruded while sequentially changing 10 ⁇ m, 5 ⁇ m, and 400 nm porous membranes for stem cells transfected with a vector expressing PREY peptide. You can get it.
  • a uniform distribution of nanovesicle diameters having an average of about 47.2 ⁇ 12.1 nm and about 83.7 ⁇ 20.6 nm, respectively, can be obtained. It is smaller than 14.9 ⁇ 2.0 ⁇ m in diameter.
  • the nanovesicle of the present invention retains intracellular components even after extrusion compared to the intracellular components of stem cells, and anti-atherosclerotic miRNAs such as miR-21, miR-132, miR-10, miR-146, It is characterized by an increase in the levels of miR-143 and let 7 upon extrusion.
  • the nanovesicle of the present invention is characterized in that it exhibits an anti-inflammatory effect by increasing gene expression of anti-inflammatory cytokines when treated with macrophages activated by LPS treatment.
  • the formation of foam cells of macrophages due to the absorption of oxidized LDL is an important part of the development of arteriosclerosis because changes in the phenotype and internal growth of VSMC are induced as a result. This result suggests that nanovesicles can prevent the arteriosclerosis process.
  • endothelial cells predominantly express E-selectin, ICAM-1, and VCAM-1 when dysfunction is activated. Since inflammatory cells are mobilized, measuring the gene expression of these markers is all up-regulated by LPS treatment, but when nanovesicles are treated, they are significantly down-regulated, and nanovesicles exhibit an endothelial cell repair effect. In addition, for CyA treatment in HUVEC, nanovesicles improve pre-endothelial cell repair and pre-angiogenic effects.
  • the nanovesicles of the present invention are reduced to the expression level of the control group, which does not have a noticeable toxic effect in the heart, lungs, liver and spleen after systemic circulation.
  • the present invention also provides a composition for preventing, diagnosing and treating arteriosclerosis comprising the above nanovesicles.
  • composition for preventing or treating arteriosclerosis of the present invention may include an active ingredient constituting a composition suitable for prophylactic, diagnostic or therapeutic use in in vitro, in vivo or ex vivo, and an active or inactive pharmaceutically acceptable carrier. have.
  • the pharmaceutically acceptable carrier is mixed with nanovesicles, such as protein excipients including phosphate buffered saline solution, serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, etc.
  • protein excipients including phosphate buffered saline solution, serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, etc.
  • HSA human serum albumin
  • rHA recombinant human albumin
  • gelatin casein, etc.
  • carrier may include a buffer or a pH adjuster, typically the buffer is a salt prepared from an organic acid or base.
  • Representative buffer solutions include organic acid salts such as citric acid salt, ascorbic acid salt, gluconic acid salt, carbonic acid salt, tartaric acid salt, succinic acid salt, acetic acid salt, or phthalic acid salt; Tris, tromethamine hydrochloride or phosphate buffer.
  • organic acid salts such as citric acid salt, ascorbic acid salt, gluconic acid salt, carbonic acid salt, tartaric acid salt, succinic acid salt, acetic acid salt, or phthalic acid salt
  • Tris tromethamine hydrochloride or phosphate buffer.
  • dextreates e.g.
  • cyclodextrins such as 2-hydroxypropyl-quadrature, -cyclodextrin), polyethylene glycol, antioxidants, anti- Polymeric properties such as charging agents, surfactants (eg, polysorbates such as “TWEEN 20” and “TWEEN 80”), lipids (eg, phospholipids, fatty acids), steroids (eg cholesterol) and chelating agents (eg, EDTA) Includes excipients/additives. Anti-freeze agents or depressants may also be included.
  • surfactants eg, polysorbates such as “TWEEN 20” and “TWEEN 80”
  • lipids eg, phospholipids, fatty acids
  • steroids eg cholesterol
  • chelating agents eg, EDTA
  • composition for preventing, diagnosing or treating arteriosclerosis of the present invention may be prepared in various appropriate formulations.
  • Formulations and carriers suitable for parenteral administration such as, for example, intraarterial (in joint), intravenous, intramuscular, intradermal, intraperitoneal, intranodal and subcutaneous routes include antioxidants, buffers, bacteriostatic agents, and formulations.
  • aqueous and non-aqueous sterile suspensions that may contain solutes, and suspending agents, solubilizing agents, thickening agents, stabilizing agents, and preservatives, which will render the blood and isotonic of the intended recipient.
  • Intravenous or intraperitoneal administration is the preferred method.
  • the dose of cells administered to a subject is an amount effective to achieve the desired beneficial therapeutic response in the subject over time.
  • it may be carried out in such a way that a blood sample is obtained from an individual prior to injection, and then stored and used for subsequent analysis and comparison.
  • at least about 10 4 to 10 6 and typically 1 ⁇ 10 8 to 1 ⁇ 10 10 cells can be injected intravenously or intraperitoneally to a 70 kg patient over approximately 60 to 120 minutes.
  • the nanovesicles of the present invention can be applied to LD-50 according to the cell type (or other toxicity measurement method) and side effects according to the cell type at various concentrations. It is administered in a determined ratio.
  • Administration can be administered at one time or in several divided doses.
  • the nanovesicles of the present invention can supplement treatment for other specific conditions using known conventional therapies including cytotoxic agents, nucleotide analogs and biological response modifiers.
  • biological response modifiers can be optionally added to treatment with the nanovesicles of the present invention.
  • the present invention also provides a method for treating arteriosclerosis comprising administering to a subject a therapeutically effective amount of the above nanovesicles.
  • the individual may be a mammal such as a dog, cat, rat, mouse, or human, but is not limited thereto.
  • the plasmid that externally expresses and localizes PREY in the cell membrane consists of an external N-terminal-promoter-signal peptide-PREY-V5-TMP-GFP-internal C-terminus.
  • a signal peptide Signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea) or Signal peptide R (BKU008396, Korea Human Gene Bank, Republic of Korea) is used.
  • the signal peptide induces localization of the PREY peptide outside the cell membrane;
  • V5 tag and GFP monitor the location and expression level of PREY.
  • the expression vector was cloned according to the manufacturer's instructions using the NEB Gibson Assembly kit (New England Biolabs, MA). Each type of signal peptide and transmembrane protein was separately amplified through PCR using the following template: Signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea), Signal peptide R (BKU008396, Korea Human Gene Bank, Republic) of Korea), CD86, CD105 and truncated CD271 (LNGFR) for NGFR (Addgene plasmid #27489; Addgene, MA).
  • Vector components were inserted into the Cas9-digested p3S-Cas9-HN (Addgene plasmid #104171) backbone with plasmid synthesis (Macrogen, Republic of Korea). PCR amplification and Gibson cloning were performed according to this procedure. All primers and plasmids are listed in Tables 1 and 2.
  • Plasmid type and sequence (Signal peptide; PREY; V5 tag; Transmembrane protein; GS linker and EGFP) Plasmid Sequence (5' ⁇ 3') PREY-CD271-EGFP (1701 bp) ⁇ SEQ ID NO: 25> CCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACA
  • PREY transfection efficiency was compared with the two MSC types (ASC and BMSC), and the transmembrane through flow cytometry using FACSCanto (BD Bioscience, CA) with quantitative analysis on the 1st day after transfection.
  • the protein was compared among test candidates (CD86, CD105 and CD271).
  • test candidates CD86, CD105 and CD271.
  • cells were immunostained with anti-v5 tagged primary antibody (ab27671, Abcam, MA) and Alexa Fluor 647-conjugated secondary antibody (Jackson Immuno Research, PA).
  • transfected ASCs and BMSCs were harvested 30 minutes after transfection, immunostained with Alexa Fluor 488-conjugated Annexin V (Thermo Fisher Scientific, CA) and flow cytometric The analysis was carried out. The number of viable cells was also counted via trypan blue staining on day 1 after transfection.
  • the pellet was resuspended in PBS, filtered through a 0.20 ⁇ m syringe filter (Avantec, Japan), and stored at -70° C. until use.
  • the size and shape of PMSC-NV were measured by transmission electron microscopy (TEM; JEM-F200, JEOL, Japan) and dynamic light scattering (DLS; ELS-1000ZS, Otsuka Electronics, Japan).
  • RAW264.7 cells were seeded in 24-well plates (5 ⁇ 10 5 cells/well). The pro-inflammatory activation of RAW264.7 cells was induced by treatment with LPS (Sigma-Aldrich; 100 ng/mL) for 24 hours and then ASC-NV or BMSC-NV (10 ⁇ g/mL) treatment for 24 hours. To visualize cellular uptake, RAW264.7 cells and NV were labeled with DiO and DiI (Invitrogen, CA), respectively, and imaged with a confocal microscope (LSM780; Zeiss, Germany). For qRT-PCR analysis, cells were harvested 24 hours after NV treatment. The primer sequences for IL-10, IL-1 ⁇ , IL-6 and TNF- ⁇ are listed in Table 3.
  • Cell supernatant was collected according to the manufacturer's instructions for cytokine analysis using mouse inflammatory antibody arrays (ab133999, Abcam).
  • the anti-phagocytic effect of MSC-NV was measured according to the manufacturer's instructions using the VybrantTM Phagocytosis Assay Kit (V6694, Molecular Probes, OR). Images were obtained through a confocal microscope, and fluorescence intensity was measured using a VarioskanTM LUX multimode microplate reader (Thermo Fisher Scientific, MA).
  • Target gene Primer sequence (5' ⁇ 3') SEQ ID NO. GAPDH Forward ATG TGT CCG TCG TGG ATC TGA 28 Reverse TGC CTG CTT CAC CAC CTT CT 29 IL-10 Forward ACT GGC ATG AGG ATC AGC AG 30 Reverse CTC CTT GAT TTC TGG GCC AT 31 IL-1 ⁇ Forward GCC ACC TTT TGA CAG TGA TGA G 32 Reverse ATC AGG ACA GCC CAG GTC AA 33 IL-13 Forward ATG GCC TCT GTA ACC GCA AG 34 Reverse TCC TCA TTA GAA GGG GCC GT 35 TNF- ⁇ Forward CCT GTA GCC CAC GTC GTA GC 36 Reverse AGC AAT GAC TCC AAA GTA GAC C 37 VCAM1 Forward AGT TGG GGA TTC GGT TGT TC 38 Reverse CAT TCC TTA CCA CCC CAT TG 39 E-selectin Forward CCA GAA TGG CGT CAT GGA 40 Reverse TAA
  • iMAEC (ATCC, VA) was seeded into a 24-well plate (1 ⁇ 10 5 cells/well), followed by LPS (100 ng/mL) treatment for 24 hours. Subsequently, ASC-NV, BMSC-NV or PMSC-NV (10 ⁇ g/mL) was treated for an additional 24 hours. To visualize cellular uptake, iMAEC and NV were labeled with DiO and DiI, respectively, and imaged through a confocal microscope. For qRT-PCR analysis, iMAEC was collected 24 hours after NV treatment. The primer sequences of E-selectin, ICAM-1 and VCAM-1 are listed in Table 3.
  • iMAEC was immunostained with VCAM-1 antibody (ab134047, Abcam), and imaged through a confocal microscope with quantitative analysis using ImageJ.
  • NV 10 ⁇ g/mL
  • CyA 25 ⁇ g/mL; Santa Cruz Biotechnology, CA
  • HUVEC Longza
  • Matrigel BD Biosciences, MA
  • mice After LCA exposure, three of the four branches of LCA (ECA, ICA, OA) were ligated with 10-0 polyamide sutures and the STA was left unligated. Then, the incision was sutured with a 6-0 silk suture. Then, the mice were monitored and supplied with an atherosclerotic diet (Research Diets, NJ), and MSC-NV, PMSC, or PMSC-NV was intravenously administered 3 days after ligation.
  • the in vivo PMSC-NV targeting efficiency of the vortex area was measured in a mouse PCL model through IVIS imaging (PerkinElmer, WA) and histological analysis 24 hours after injection of the test group. MSC and NV groups were labeled with VivoTrack 680 (PerkinElmer) for 30 minutes and injected into the PCL model. Subsequently, IVIS imaging was performed under respiratory anesthesia with isoflurane. Then, the mice were sacrificed, their LCAs, RCAs and major organs were harvested to perform ex vivo IVIS imaging and histological analysis. Tissue sections of LCA and RCA were immunostained with anti-pilamine A antibody (ab51217, Abcam), and the corresponding fluorescence intensity was quantified using ImageJ software.
  • Neointima structural factors neointima to neointima + lumen area ratio, neointima to medium area ratio and neointima area
  • corresponding fluorescence intensity were quantitatively analyzed using ImageJ. .
  • RCA was left without ligation as a normal group.
  • the blood flow pattern was observed by ultrasound (S22V; SonoScape Medical Corp., China).
  • Vivotrack680-labeled MSC-NV or PMSC-NV was injected intravenously through the ear vein (1 mg/pig) 3 days after ligation, and pigs were sacrificed on day 1 or 21 after injection.
  • RCA, LCA and aortic arches were collected for ex vivo IVIS and histological analysis. Their tissue sections were immunostained with anti-pilamine A antibody and anti-CD31 antibody (sc-1506, Santa Cruz Biotechnology, CA), followed by fluorescence imaging with ImageJ analysis.
  • the microfluidic device was prepared with polydimethylsiloxane (PDMS, Dow Corning, MI) by soft lithography, and a glass cover slip ( VWR, PA) and placed in a polystyrene box (Ted Pella Inc., CA). The device was sterilized with 70% ethanol and washed with PBS. Subsequently, the channels were coated with 50 ⁇ g/mL of collagen I (Corning, MA) at 37° C. for 1 hour.
  • PDMS polydimethylsiloxane
  • MI polydimethylsiloxane
  • VWR glass cover slip
  • PBS polystyrene box
  • the channels were coated with 50 ⁇ g/mL of collagen I (Corning, MA) at 37° C. for 1 hour.
  • hCAEC Human coronary artery endothelial cells
  • hAEC human aortic endothelial cells
  • MA PhD Ultra syringe pump
  • Vortex was generated through repeated cycles of injecting and removing the medium at flow rates of 22.5 ⁇ l/min (10 dyne/cm 2 ) and 20 ⁇ l/min (9 dyne/cm 2 ), respectively.
  • NV 10 ⁇ g/mL
  • NV uptake into human ECs in each test group was quantitatively analyzed using ImageJ.
  • tissue section was treated with a blocking solution (5% fetal bovine serum albumin (Millipore, MD) + 0.3% triton X-100 (Sigma-Aldrich)) for 1 hour at room temperature.
  • Primary antibodies were anti-v5 tag antibodies (ab27671, Abcam), anti-VCAM-1 (ab134047, Abcam), anti-CD68 (ab125212, Abcam), anti-Filamin A (ab51217, Abcam) and anti-CD31 (sc -1506, Santa Cruz Biotechnology, CA, USA). These antibodies were diluted 1:100 and treated in PBS, and then the subsequent secondary antibodies were diluted 1:200 and treated in PBS.
  • the sample was dissolved in RIPA buffer (Sigma-Aldrich) to obtain total protein, and the concentration of the protein was measured using the Brafford assay (Sigma-Aldrich).
  • the protein extract was electrophoresed on a 10% (w/v) SDS-PAGE gel and then transferred onto a nitrocellulose membrane.
  • the primary antibody anti-v5 tag (ab27671, Abcam), anti- Incubated with CD271 (345102, Biolegend, CA), anti-GFP (ab32146, Abcam), anti-CD9 (ab92726, Abcam) and anti- ⁇ -actin (ab8227, Abcam).
  • the secondary antibodies goat anti-mouse IgG(H+L)-HRP conjugate and goat anti-rabbit IgG(H+L)-HRP conjugated antibodies (all manufactured by Vector Laboratories) were prepared according to the manufacturer's instructions. Applied accordingly. The signal was visualized according to the manufacturer's instructions using CL Plus Western Blotting Detection Kit (Amersham Biosciences, UK) and analyzed using a LAS-3000 image reader (Fujifilm, Japan).
  • Quantitative data are expressed as mean ⁇ standard deviation (stdev). The results were statistically analyzed by one-way variance analysis (ANOVA) with Turkey's significant difference post hoc test using SigmaPlot 12.0 (Systat Software, Inc., California, USA).
  • the targeting peptide PREY was displayed externally by expressing a specifically designed plasmid throughout the MSC membrane (PMSC: PREY-expressing human MSC).
  • the plasmid is designed to express the PREY extracellular domain with the signal peptide at the N-terminus, so that the signal peptide can induce the external localization of the PREY extracellular domain from the MSC membrane and inactivate the induced signal through cleavage.
  • TMP transmembrane proteins
  • the dose of the PREY-CD271 plasmid was increased, the expression level increased in a dose-dependent manner, while the cell viability after the transfection of the 2 ⁇ dose decreased sharply (FIGS. 2C, 4A to 4C ).
  • the plasmid dose was determined as 1 ⁇ (1 ⁇ g PREY-plasmid per 1 ⁇ 10 6 cells). Comparing the number of cells killed with Annexin V+, there were more viable ASCs than BMSCs after transfection, indicating that ASCs are a more suitable source than PREY transfections (FIGS. 2C, 4A to 4C ).
  • the V5 tag was immunostained when next to PREY in the sequence (external N-terminal-promoter-signal peptide-PREY-V5-TMP-GFP-internal C-terminal). Since neither of the two formats worked to clearly obtain both types of information, the attached (Fig. 5) and suspended (Fig. 2D, Fig. 1A to Fig. 1C) forms of PMSCs were used to determine the expression level and location of PREY, respectively. Used to measure.
  • PREY was highly expressed along the cell membrane as indicated by the v5 tag and GFP signal, indicating successful transfection.
  • confocal images confirm PREY display outside the cell membrane by showing the appearance of the v5 tag (red) and GFP (green) signals outside and inside the MSC membrane boundary, respectively. I did.
  • PMSC-NV PMSC was sequentially extruded through a series of polycarbonate microporous membranes, gradually decreasing the pore diameter to 10 ⁇ m to 5 ⁇ m and finally to 0.4 ⁇ m (Fig. 1b).
  • the TEM results (Fig. 2e) show a uniform distribution of PMSC-NV diameters with an average of 47.2 ⁇ 12.1 nm.
  • intact preservation and exosome properties (CD9) of PREY-peptide (GFP and v5 tags) during transfection and NV extrusion were measured through Western blot analysis (FIG. 2F, FIG. 6).
  • miRNA serves as an important therapeutic agent, and the majority are delivered by exosomes. Since NV is essentially exosome-like, the miRNA contents of PMSC-NV, MSC-NV, and PMSC were profiled by miRNA arrays (Fig. 2G and Tables 4 and 5, Fig. 6).
  • the transfection (MSC-NV vs. PMSC-NV) and extrusion process (PMSC vs. PMSC-NV) altered the expression levels by at least 2 times for 2.72 and 6.71% of the total miRNA, demonstrating the preservation of intracellular contents during their production. do.
  • miRNA name Rate of change Adjustment form miRNA name Rate of change Adjustment form hsa-miR-21-5p 17.321 lift hsa-miR-3195 5.080 Downward hsa-miR-140-5p 10.011 lift hsa-miR-106b-3p 4.296 Downward hsa-miR-7641 9.352 lift hsa-miR-3663-3p 3.766 Downward hsa-miR-337-5p 8.283 lift hsa-miR-345-5p 3.375 Downward hsa-miR-4443 8.228 lift hsa-miR-3178 3.057 Downward hsa-miR-4726-5p 7.288 lift hsa-miR-3687 3.035 Downward hsa-miR-132-3p 4.383 lift hsa-miR-8063 2.958 Downward hsa-miR-376c-3
  • miRNA name Rate of change Adjustment form miRNA name Rate of change Adjustment form hsa-miR-21-5p 11.055 lift hsa-miR-3162-5p 8.520 Downward hsa-miR-132-3p 10.252 lift hsa-miR-4298 8.288 Downward hsa-miR-4521 9.785 lift hsa-miR-6778-5p 6.988 Downward hsa-miR-337-5p 7.805 lift hsa-miR-1973 5.582 Downward hsa-miR-1260b 7.468 lift hsa-miR-3911 5.221 Downward hsa-miR-27b-5p 7.120 lift hsa-miR-7107-5p 5.104 Downward hsa-miR-1260a 7.045 lift hsa-miR-21-5p 11.055 lift hsa-miR-3162-5p 8.520
  • BMSC-NV and ASC-NV were tested before PREY transfection (Fig. 7A).
  • Mouse monocytes/macrophages (RAW264.7 cells) were treated with MSC-NV to inhibit their inflammatory response.
  • Effective cellular uptake of MSC-NV by activated macrophages was confirmed by visualizing cells and MSC-NV with DiO and DiI, respectively (Fig. 7b). Both ASC-NV and BMSC-NV were similarly absorbed by activated macrophages.
  • BMSC-NV The anti-inflammatory activity of BMSC-NV, ASC-NV and PMSC-NV was analyzed by qRT-PCR (Fig. 7c), dot blot cytokine array (Fig. 7d) and phagocytosis assay (Fig. 7e).
  • Anti-inflammatory interleukin-10 (IL-10) and IL-13 gene expression is upregulated, but pro-inflammatory markers (IL-1 ⁇ , TNF- ⁇ ) are not, which is an anti-inflammatory of macrophages by MSC-NV. It indicates that the potential is maintained even after release from the MSC.
  • EC-recovery effect of MSC-NV treatment was tested by activating pro-inflammatory dysfunction of immortalized mouse aortic endothelial cells (iMAEC) by LPS treatment (FIG. 8A).
  • iMAEC immortalized mouse aortic endothelial cells
  • FIG. 8B Effective internalization of both ASC-NV and BMSC-NV to activated iMAEC was visualized by labeling with DiO and DiI, respectively.
  • DiO and DiI DiI
  • Cyclosporin A (CyA) treatment is known to inhibit angiogenic EC activity, thereby preventing angiogenesis. Therefore, after culturing human umbilical vein endothelial cells (HUVEC) in Matrigel, CyA and NV were treated together at 2 hours (FIG. 9) or 12 hours (FIG. 8E) after seeding to transfer MSC (BMSC vs. ASC)-NV. -Angiogenesis (Fig. 9) and pre-EC repair effect (Fig. 8e) were tested. Subsequently, the vasculature factors of HUVECs (ie, junction, master segment, total length and number of extreme nodes) were measured.
  • HUVECs human umbilical vein endothelial cells
  • MSC-NV treatment improved the pre-EC recovery and pre-angiogenic effects of HUVECs in response to CyA treatment regardless of the MSC source.
  • CyA treatment was performed at 12 and 2 hours, respectively, after seeding (FIG. 10).
  • the diagnostic treatment efficiency of PMSC-NV was measured in a mouse PCL model.
  • LCA left coronary artery
  • ECA external coronary artery
  • ICA internal coronary artery
  • OA occipital artery
  • IVIS in vivo imaging system
  • Vivotrack680-labeled MSC-NV or PMSC-NV was administered intravenously through the ear vein and systemically circulated for 3 days after ligation.
  • RCA, LCA and aortic arches were taken as tissue samples from normal, induced vortex and natural vortex sites 24 hours or 21 days after NV injection, respectively.
  • Natural vortices form in the aortic arch because of the curvature and branch structure.
  • PMSC-NV accumulates more in the distal region of the ligation point of LCA, which is an index of pathogenic remodeling, but was not observed in RCA (Fig. 17D, Fig. 18 left).
  • the IVIS fluorescence distribution of PMSC-NV showed a higher correlation with the eddy current region compared to MSC-NV, and showed an effective targeting function of PREY (Fig. 17F, Fig. 18 right), compared to MSC-NV. It was supported by the greater coexistence of CD31 (FIGS. 17E and 17G) by PMSC-NV.
  • ECs were subjected to normal (10 dyne/cm 2 ) or vortex (10 dyne/cm 2 and -9 dyne/cm 2 with 1 dne pulse) prior to MSC-NV treatment. Exposed (Fig. 19a-c). It was confirmed that the EC exposed to the normal flow was aligned in the flow direction, but not the EC exposed to the vortex (FIG. 19D). In addition, filamine A expression increased under vortex (Fig. 19e), whereas F-actin expression was similar between normal flow and EC exposed to vortex (Fig. 19f).
  • microfluidic model demonstrates that the signal of PMSC-NV increases in eddy current conditions (Figure 20) due to high coexistence with filamine A compared to normal flow conditions, thus demonstrating the diagnostic therapeutic potential of PMSC-NV in clinical interpretation. I found it out.
  • the stem cell-derived nanovesicle using the peptide capable of targeting the eddy current according to the present invention is an anti-arteriosclerosis diagnostic treatment platform that provides a strong anti-inflammatory and pre-endothelial repair effect similar to that of mesenchymal stem cells, As a new diagnostic treatment that can prevent and treat arteriosclerosis, it is expected to be useful in the related medical industry.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)

Abstract

본 발명은 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법에 관한 것으로, 보다 상세하게는, 본 발명은 와류 부위를 타겟팅할 수 있는 펩타이드를 이용하는 항-동맥경화 진단치료 플랫폼인 줄기세포 유래의 나노베지클을 제공하며, 상기 나노베지클은 중간엽 줄기세포와 유사한 강력한 항-염증 및 전-내피 복구 효과를 제공하여 동맥경화의 발병을 예방할 수 있는 새로운 진단치료제로 사용할 수 있다.

Description

혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법
본 발명은 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법에 관한 것이다.
동맥경화(Atherosclerosis)는 사망의 주요 원인이지만, 현 진단 방법은 비가역적 캐스케이드와 관련된 이의 조기 병인성 신호를 아직까지는 감지하지 못한다. 질병 진행의 실질적인 위험이 남아있긴 하나 낮은 콜레스테롤 수준, 혈압 또는 플라그 형성을 목표로 하는 종래의 예방 및 치료 옵션이 널리 사용되고 있다. 분기점, 구부러진 영역 또는 말초에서 협착까지 일어나는 조기 동맥경화 사건인 와류(disturbed blood flow)의 발생은 혈관내피세포(Endothelial cell: EC)의 기능장애를 초래한다. 정상 혈류에서, EC는 혈류 방향으로 정렬되며, 항-염증 및 항-혈전 기능을 유지한다. 대조적으로, 죽상 동맥 경화증, 와류는 증가된 염증 및 혈전성 사건과 함께 EC 기능장애를 활성화시켜 궁극적으로 동맥경화를 유발한다. 이 치명적인 만성 질환에 대한 유망한 해결책으로서 제시할 수 있는 와류를 타겟으로 하는 진단치료(Theragnostic)가 철저히 입증되어야 한다.
중간엽 줄기세포(Mesenchymal stem cell: MSC)는 면역 반응을 조절하고 혈관평활근세포(Vascular smooth muscle cell: VSMC)의 증식을 약화시켜 항-동맥경화 치료를 위한 치료적 약속을 유지하는 것으로 보고되어 있다. 그러나, 그들의 낮은 생존율 및 불충분한 타겟 효율은 임상적 적용을 위해 여전히 극복되어야 한다. MSC-유래 나노베지클은 세포-기원의 항-염증 및 전-재생 특성이 내재되어 있을 뿐 아니라 세포 상호작용을 촉진할 수 있는 향상된 생체 내 순환 시간을 갖는 치료 나노담체로서 등장하였다. 심혈관 질환, 신장 손상, 간 질환 및 신경 질환을 포함한 몇몇 치명적인 질환 및 손상에 대한 나노베지클-기반 치료법을 개발하고자 하는 시도에도 불구하고, 장기적이고 힘든 생산 공정에서 높은 수율로 크기 균일성 및 유효성분의 일관성을 유지하는 것은 여전히 도전이다. 최근의 대안적인 엔지니어링 접근법은 미세기공 여과를 통해 세포를 물리적으로 파쇄하고 생성된 세포막 조각 및 내부 내용물의 자가조립을 유도하여 세포 유래 나노베지클을 100배 이상의 높은 수율로 생산할 수 있다.
비가역적 캐스케이드는 동맥경화의 중요한 발병으로 이어지며 조기 진단 및 예방에 대한 충족되지 않은 필요성을 나타낸다. 와류 형성은 가장 빠른 동맥경화 사건 중 하나로 이는 내피 투과성 및 이어지는 단핵구 동원을 증가시킨다.
본 발명의 목적은 동맥경화를 유발하는 와류 부위에 타겟팅할 수 있는 펩타이드를 표면에 전시하는 줄기세포 유래의 나노베지클 및 이의 제조방법을 제공하는 것이다.
본 발명의 다른 목적은 상기 나노베지클의 동맥경화의 예방, 진단 및 치료적 용도를 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위하여, 본 발명은 와류(disturbed blood flow) 부위 타겟팅 펩타이드를 표면에 전시하는 줄기세포 유래의 나노베지클을 제공한다.
본 발명은 또한 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질의 코딩 서열이 순차적으로 삽입된 벡터로 트랜스펙션된 줄기세포에서 와류 부위 타겟팅 펩타이드를 표면에 전시하는 나노베지클을 얻는 단계를 포함하는 상기의 나노베지클의 제조방법을 제공한다.
본 발명은 또한 상기의 나노베지클을 포함하는 동맥경화의 진단용 조성물을 제공한다.
본 발명은 또한 상기의 나노베지클을 포함하는 동맥경화의 예방 또는 치료용 조성물을 제공한다.
본 발명은 또한 치료적 유효량의 상기의 나노베지클을 개체에 투여하는 단계를 포함하는 동맥경화의 치료방법을 제공한다.
본 발명은 와류 부위를 타겟팅할 수 있는 펩타이드를 이용하는 항-동맥경화 진단치료 플랫폼인 줄기세포 유래의 나노베지클을 제공하며, 상기 나노베지클은 중간엽 줄기세포와 유사한 강력한 항-염증 및 전-내피 복구 효과를 제공하여 동맥경화의 발병을 예방할 수 있는 새로운 진단치료제로 사용할 수 있다.
도 1a는 PREY/MSC-유래 나노베지클(PMSC-NV)의 작동 메커니즘 및 PREY 펩타이드 전시개략도를 나타낸 것으로, 구체적으로 와류 부위-타겟팅 펩타이드(PREY)는 파지 전시 스크리닝으로부터 선별되며, 특이적으로 설계된 플라스미드의 트랜스펙션 및 발현을 통해 MSC 막(PMSC)의 외부에 전시된다.
도 1b는 PMSC-유래 NV(PMSC-NV)는 일련의 미세기공 크기로 제어된 멤브레인을 이용한 연속 압출 공정을 통해 생산되며, PMSC-NV는 PMSC와 동일한 트랜스멤브레인 및 세포 내 성분들을 포함하는 것을 도시한 것이다.
도 1c는 부분 관상동맥 결찰(Partial carotid ligation: PCL) 모델이 인 비보 시험에 사용됨을 도시한 것으로, PMSC-NV를 정맥내로 투여하고, 전신으로 순환되도록 하여 와류 부위를 타겟팅함으로써 그들의 진단치료 성능을 시험한다.
도 2a는 MSC 막의 외층에 PREY를 발현시키기 위한 플라스미드 설계에 대한 개략도이다. GFP(Green fluorescence protein: 내막 신호)-트랜스멤브레인 단백질-v5 태그(외막 신호)-PREY를 설계하여 PREY의 발현 및 위치를 검증한다.
도 2b는 3종의 트랜스멤브레인 단백질(CD86, CD105 및 CD271)과 2종의 hMSC 타입(ASC 및 BMSC)이 쌍을 이루며, FACS(x-축: GFP+ 세포/ y-축: V5 tag+ 세포)를 통해 트랜스펙션 효율을 정량적으로 비교한 결과이다. 이때, CD271-ASC 쌍은 가장 높은 트랜스펙션 효율을 가지므로 미리 선택하였다.
도 2c는 트랜스펙션 30분 후 Alexa Fluor 488-컨쥬게이트된 Annexin V를 이용하여 PREY-CD271 플라스미드 용량-의존적 세포사멸(0X: 플라스미드 없이 전기천공 및 1X, 2X: 100, 200 ng plasmid/105 cells)을 평가한 결과이다.
도 2d는 GFP(녹색 내막 신호) 및 PREY-v5 태그(빨간색 외막 신호)의 위치는 PREY-CD271-v5 태그 플라스미드를 ASC로 트랜스펙션한 후 PMSC에서 시각화한 결과로서, 빨간색 및 녹색 신호는 각각 세포막의 외부 및 내부에서 주로 관찰됨을 나타낸다.
도 2e는 투과전자현미경(TEM)을 이용해 PMSC-NV의 크기 및 형태 분포를 측정한 결과이며, 노란색 점선은 PMSC-NV의 막을 나타낸다.
도 2f는 트랜스펙션의 발현 및 세포막 단백질 CD9을 웨스턴 블랏으로 분석한 결과이다.
도 2g는 내부 miRNA 성분의 보존 여부를 miRNA 어레이를 이용하여 분석한 결과이다.
도 3은 PREY 융합 단백질을 발현하기 위한 벡터 설계의 모식도를 나타낸 것으로, PREY 융합 단백질의 서열 유전자는 클로닝을 위해 앰피실린 내성 유전자와 함께 공통 CMV 프로모터 백본에 삽입한다.
도 4a는 hMSC 타입에 따른 트랜스펙션 효율을 알아보기 위해, PREY-CD271 플라스미드를 트랜스펙션하고 24시간 후에 각각 BMSC 및 ASC에서 1Х 플라스미드의 트랜스펙션 효율을 보여주는 형광 이미지이다(파란색: DAPI 염색된 핵).
도 4b는 BMSC 및 ASC에서 PREY-CD271 플라스미드의 트랜스펙션 용량(0X, 0.5X, 1X, 2X)에 따른 생존세포 수를 측정한 결과로서, ASC의 생존세포 수가 더 많으므로 hMSC 타입으로 선택하였다(*p < 0.05 BMSC 대 ASC, #p < 0.05 대 0X BMSC, $p < 0.05 대 0X ASC).
도 4c는 ASC에서 PREY-CD271 플라스미드의 용량(0.5X, 1X, 2X)에 따른 트랜스펙션 효율을 FACS로 분석한 결과이다.
도 5는 PREY-CD271의 발현을 보여주는 공초점 이미징 결과로서, 인접한 ASC의 세포막에서 GFP 및 PREY-V5 태그의 발현을 통해 PREY-CD271의 발현을 확인할 수 있다(파란색: DAPI 염색된 핵).
도 6은 트랜스펙션 후 ASC(PMSC-NV)로부터 NV를 압출하기 전후 샘플에 대하여 트랜스펙션의 발현 및 세포막 단백질 CD9 수준을 웨스턴 블랏으로 분석한 결과이다(MSC-NV: 트랜스펙션되지 않은 ASC로부터 NV 압출, *p < 0.05).
도 7a는 BMSC(BMSC-NV) 또는 ASC(ASC-NV) 유래 MSC-NV(PREY 트랜스펙션이 없음) 처리로 인해 활성화된 단핵구에 의한 항-염증 효과를 그림으로 도시한 것으로, 단핵구는 MSC-MV를 흡수하여 항-염증 및 식균 억제를 나타낸다.
도 7b는 RAW264.7 세포 및 MSC-NV를 각각 DiO(녹색) 및 DiI(빨간색)를 사용하여 시각화한 이미징 결과로서, 두 MSC-NV 타입 모두 대식세포에 효율적으로 내재화됨을 보여주는 결과이다(파란색: DAPI 염색된 핵).
도 7c는 qRT-PCR을 통해 마우스 Raw 264.7 세포에서 LPS를 처리하였을때, 항염증(IL-10 및 IL-13) 및 전염증성 마커(IL-1β 및 TNF-α) mRNA의 발현을 측정한 결과이다.
도 7d는 컨디션드 배지를 사용한 닷 블랏 어세이 결과로서, 각 타입의 항염증 사이토카인의 오른쪽 아래 검은색 도트의 양이 나노베지클을 처리한 그룹에서 줄어든 것을 보여준다. 왼쪽 위 검은색 도트 (실선 원형으로 표시)는 시험 배지에서 항염증 사이토카인의 양이 모든 그룹에서 비슷한 것을 보여준다.
도 7e는 내재화된 대장균 입자(녹색)의 양을 측정하여 식균 활성을 분석한 결과로서, 모든 MSC-NV 타입 간의 유의한 차이는 없음을 보여주며 아래 패널은 OX-LDL 의 Oil Red O staining을 한 결과로 BMSC-NV 그룹을 제외하고는 모든 NV 처리 그룹에서 ox-LDL uptake가 줄어든 것을 나타내며 아래 도표는 정량 결과이다.
도 8a은 BMSC(BMSC-NV) 또는 ASC(ASC-NV) 유래의 MSC-NV(PREY 트랜스펙션이 없음) 처리로 인한 EC의 혈관 보호 효과를 나타낸 그림으로, MSC-NV가 EC 보호를 제공하고 단핵구 동원을 억제함에 따라 MSC-NV 흡수에 의해 EC 기능장애가 복구됨을 나타낸다.
도 8b는 iMAEC(immortalized mouse EC) 및 MSC-NV를 각각 DiO(녹색) 및 DiI(빨간색)를 사용하여 시각화한 이미징 결과로서, 두 MSC-NV 타입 모두 iMAEC에 효율적으로 내재화됨을 보여주는 결과이다(파란색: DAPI 염색된 핵).
도 8c는 qRT-PCR을 통해 EC 기능 장애 마커(E-셀렉틴, ICAM-1 및 VCAM-1) 유전자의 발현수준을 측정한 결과로서, 모든 MSC-NV 처리에 의해 각 유전자의 발현이 감소됨을 보여준다.
도 8d는 iMAEC에서 VCAM-1(녹색)의 단백질 발현을 면역염색으로 분석한 이미지 및 이의 정량분석 결과이다(파란색: DAPI 염색된 핵).
도 8e는 사이클로스포린 A(CyA) 처리에 의해 유도되는 EC 맥관 형성의 파열에 대하여 BMSC-NV 또는 ASC-NV 처리에 의한 혈관 보호 효과를 보여주는 결과로서, 두 MSC-NV 타입 간에는 유의한 차이가 없음을 나타낸다(*p < 0.05 대 LPS/식염수 처리군).
도 9는 CyA 처리에 의한 EC 맥관 형성 방해에 대한 반응에서 MSC-NV의 전-혈관형성 효과를 분석한 것으로, 칼세인 AM으로 HUVEC를 염색한 이미지 및 맥관 구조 인자의 정량분석 결과를 나타낸 것이다(식염수 처리군 대 *p < 0.05).
도 10은 VCAM1 발현, 맥관 파열 및 항-혈관형성에 대한 반응에서 PMSC-NV의 전-EC 복구 효과를 보여주는 결과이다.
도 11은 마우스 PCL 모델에서 결찰 전(왼쪽) 및 후(오른쪽)를 보여주는 사진으로, 4개의 LCA 가지 중 3개(ECA: 외부 관상동맥, ICA: 내부 관상동맥 및 OA: 후두 동맥)는 10-0 나일론 봉합사를 사용하여 결찰되며, 위갑상선동맥(STA)은 결찰되지 않음을 보여준다.
도 12는 마우스 PCL 모델에서 도플러 초음파 이미징을 통해 LCA 후 결찰에서의 와류 형성의 검증 결과를 나타낸 것으로, RCA 이미지(상단)는 정상적인 맥동 층류를 보인 반면, LCA 이미지(하단)는 RCA 이미지와 비교하여 유속에서의 유의적인 감소와 함께 비정상적인 앞뒤로 움직이는 혈류를 나타낸다.
도 13a는 마우스 PCL 모델에서 와류 부위에서의 PMSC-NV의 진단치료 효과를 보여주는 것으로, Vivotrack680-표지된 MSC-NV 및 PMSC-NV를 마우스에 PCL 수술을 진행하고 3일 후에 전신 순환되도록 정맥 내 투여한 다음, 24시간 후에 생체 내 이미징 시스템(IVIS)을 통해 전체 마우스 신체에서 MSC-NV, PMSC-NV 및 PMSC의 생체 내 분포를 분석한 결과이다.
도 13b는 도 13a와 동일하게 실험을 진행한 후 채취된 RCA(대조군) 및 LCA(결찰된)에서 생체 내 이미징 시스템(IVIS)을 통해 MSC-NV, PMSC-NV 및 PMSC의 분포를 확인하고 이를 정량 분석한 결과이다(그룹 간의 *p < 0.05).
도 13c는 채취된 RCA 및 LCA에서 필라민 A 단백질의 발현, 및 MSC-NV 및 PMSC-NV와의 공존여부를 면역염색으로 분석한 이미지 결과 및 이의 정량분석 결과이다(그룹 간 *p < 0.05 및 *p < 0.001).
도 13d는 PCL 수술 후 14일에 LCA를 H&E 염색한 이미지 결과(상단 줄) 및 신생혈관내막 구조 파라미터의 정량분석을 통해 PMSC-NV 처리에 의한 신생혈관형성 억제를 나타내며, 채취된 LCA(파란색: DAPI 염색된 핵)에서 CD68(중간 줄) 및 VCAM-1(하단 줄)의 면역염색을 통해 EC에 의한 대식세포 동원을 보여주는 결과이다. 이때 흰색 선은 내막을 향한 미디어 층의 내부 경계를 나타낸다(*p < 0.05 대 식염수 처리군).
도 14는 PCL 마우스에 MSC-NV, PMSC-NV 및 PMSC를 각각 주사한 후 IVIS 시스템의 이미징(좌측)을 통해 주요 장기에서 생체분포를 분석한 이미지 결과 및 이의 정량분석 결과이다(HT: 심장, LG: 폐, LV: 간, SP: 비장 및 KN: 신장). 이때, 시험군 중 LG에서 PMSC-NV의 가장 낮은 형광 강도는 세포가 폐 모세관 포획(오른쪽)을 벗어날 수 있게 하는 PREY 및 NV의 상승적 역할을 나타낸다(그룹 간 *p < 0.001).
도 15는 결찰 후 14일에 동맥경화성 식이를 공급한 ApoE KO 및 정상 마우스(balb/c)의 LCA에서 가속화된 아테로마 형성을 나타낸 이미지 및 이의 정량분석 결과이다. 동맥경화성 식이를 공급받았지만 결찰을 받지 않은 마우스는 LCA에서 눈에 보이는 아테로마 형성을 보이지 않는다(ND: 검출 불가).
도 16은 PCL 마우스 모델에 MSC-NV 또는 PMSC-NV를 처리하고 11일 후에 마우스 장기(폐, 간, 심장 및 비장)를 H&E 염색한 결과를 나타낸 것이다.
도 17a는 스테인리스-스틸 막대(직경=0.9 mm)를 사용하여 LCA의 외과적 결찰을 유도해 돼지 PCL 모델을 제작하고 결찰 후 막대를 제거한 사진, 및 결찰 수술 후 정상 상태(위)와 LCA의 부분 폐색 상태(아래)를 보여주는 초음파 영상을 나타낸 것이다(노란 화살표: 결찰의 상단 및 하단).
도 17b는 도플러 초음파 이미지를 통해 정상 및 RCA 군에서의 한방향 층류와는 대조적으로 LCA의 결찰 점의 원위 영역에서 와류 형성을 보여주는 결과이다(노란색 화살표: 혈류 방향).
도 17c는 RCA 및 LCA에서 내피층의 필라민 A 발현을 보여주는 이미지 결과이다.
도 17d 내지 도 17g는 돼지에서 PCL 수술 후 3일째에 NV를 정맥 내로 투여하고 24시간 후에 혈관을 채취하여 분석한 결과로서, 채취된 LCA(도 17d 및 도 17e) 및 대동맥 궁(도 17f 및 도 17g) (자연 와류 형성 영역)에서 IVIS 및 면역염색을 통해 돼지 모델에서 와류 부위의 효과적인 PMSC-NV 타겟팅을 보여주는 결과이다(그룹 간 ***p < 0.001).
도 18은 돼지 PCL 모델에서 PMSC-NV 처리 후 24시간에 RCA 및 LCA(유도 와류)(좌측) 및 대동맥 궁(자연 와류)(우측)의 IVIS 이미징 결과를 나타내는 것이다.
도 19a는 미세유체 모델을 이용해 와류 하에서 인간 동맥 EC의 PMSC-NV 타겟팅 효율을 분석하기 위해, 인간 관상동맥 내피세포(hCAEC)를 부착배양하고 12시간 후에 1일 동안 한방향 층류 또는 와류 하에서 배양한 다음 1시간 동안 NV로 처리하는 과정을 보여주는 것이다.
도 19b는 정상(층) 흐름 및 와류 패턴을 플롯으로 나타낸 것이다.
도 19c는 필라민 A의 발현(녹색)뿐만 아니라 F-액틴의 발현(빨간색)을 통한 hCAEC의 정렬을 분석하기 위해 면역염색을 실시한 결과이다.
도 19d는 상기 도 19c의 결과를 바탕으로 흐름 방향으로의 F-액틴 정렬을 정량적으로 분석한 결과이다.
도 19e는 상기 도 19c의 결과를 바탕으로 와류 하에서 세포질 내 필라민 A의 발현수준을 정량적으로 분석한 결과이다(그룹 간 *p < 0.05).
도 19f는 상기 도 19c의 결과를 바탕으로 NV 형광 강도를 측정하여 와류 부위에서 hCAEC에 대한 MSC-NV 및 PMSC-NV의 인 비트로 타겟팅 효율을 정량적으로 분석한 결과이다(그룹 간 ***p < 0.001).
도 19g는 상기 도 19c의 결과를 바탕으로 NV와 필라민 A의 공존을 정량적으로 분석하여 필라민 A의 PREY 타겟팅을 확인한 결과이다(그룹간 ***p < 0.001).
도 20은 인 비트로 미세유체 모델을 이용하여 인간 대동맥 EC(hAEC)를 타겟으로 하는 PMSC-NV의 효율을 IVIS 이미징을 통해 분석한 결과이다.
이하 본 발명의 구성을 구체적으로 설명한다.
본 발명은 와류(disturbed blood flow) 부위 타겟팅 펩타이드를 표면에 전시하는 줄기세포 유래의 나노베지클에 관한 것이다.
또한, 본 발명은 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질-녹색형광단백질(GFP)의 코딩 서열이 순차적으로 삽입된 벡터로 트랜스펙션된 줄기세포에서 와류 부위 타겟팅 펩타이드를 표면에 전시하는 나노베지클을 얻는 단계를 포함하는 상기의 나노베지클의 제조방법을 제공한다.
본 명세서에서, “와류(disturbed blood flow)”는 혈관의 구조적 특성으로 인한 비정상적이고 불규칙한 혈류 흐름을 의미하며 혈관내피세포의 기능장애를 초래하는 조기 동맥경화의 사건이다.
본 명세서에서, “나노베지클(nanovesicle: NV)”은 인위적으로 세포를 필터에 통과시키는 방식으로 분쇄하여 자가조립에 의해 제조된 것을 의미하며, 세포에서 추출한 엑소좀(exosome)과는 상이한 것으로 이해된다.
본 발명은 와류 부위를 타겟팅하는 펩타이드로 기능화 된 줄기세포 유래의 나노베지클을 제공한다(도 1a 내지 도 1c 참조).
상기 와류 부위 타겟팅 펩타이드는 SEQ ID NO: 1 내지 5로 이루어진 군에서 선택될 수 있다. 더 구체적으로, SEQ ID NO: 1은 GSPREYTSYMPH의 아미노산 서열을 갖는 PREY 펩타이드, SEQ ID NO: 2는 SPREYTSYMPH의 아미노산 서열을 갖는 Myoferlin 펩타이드, SEQ ID NO: 3은 SLSSYNGSALAS의 아미노산 서열을 갖는 Eyes absent homolog 1 isoform 2 펩타이드, SEQ ID NO: 4는 ACNTGSPYEC의 아미노산 서열을 갖는 Zinc finger protein, partial 펩타이드 SEQ ID NO: 5는 ACTPSFSKIC의 아미노산 서열을 갖는 Calsyntenin 1, isoform CRA_b 펩타이드이다.
본 발명의 나노베지클은 종래의 와류 부위 타겟팅 펩타이드-리포좀에 비해 와류 부위 타겟팅 펩타이드 발현 확인이 용이한데, 나노베지클 추출 전 세포 단계에서의 GFP/v5tag FACS sorting을 통해 와류 부위 타겟팅 펩타이드 발현 비율을 높일 수 있다. 또한, 리포좀에 비해 나노베지클은 줄기세포로부터 유래한 동맥경화 억제 치료물질을 자체적으로 함유하고 있다. 이는 다른 화학 약물에 비해 안정성이나 부작용 위험 등에 대해서 장점을 가지고 있는 것이다. 또한, 환자 유래 자가 줄기세포를 사용할 수 있기 때문에 면역반응 등에서 자유로우며, 특히 중간엽 줄기세포 유래의 나노베지클은 숙주-면역 거부 반응에 대해 자유로운 세포이며, 그 중간엽 줄기세포의 표면 마커를 그대로 가지고 있는 PMSC-NV 역시 그러한 특징을 가지고 있으므로 타가이식에 대한 가능성도 있으며, 본 발명에서 마우스 및 돼지를 이용한 전임상 실험을 통해 그 가능성을 일부 확인하였다. 또한, 중간엽 줄기세포의 숙주-면역 거부 회피 기작으로 인해 리포좀에 비해 대식세포로부터 자유로울 것으로 예상되며, 이는 타게팅 효율 상승으로 이어질 것으로 기대된다.
상기 나노베지클은 공지의 형질전환 기술을 이용하여 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질(TMP)-녹색형광단백질(GFP)의 코딩 서열이 순차적으로 삽입된 벡터로 트랜스펙션된 줄기세포를 크기-제어 방식의 압출을 통해 분리할 수 있다.
본 발명의 일 구체예에 따르면, 와류 부위를 타겟팅하는 PREY 펩타이드를 MSC 막의 외부에 전시하도록 기능화하고 물리적 세포 분쇄 및 이어지는 자가조립을 통해 NV를 생성하도록 설계된 플라스미드 DNA를 사용한다. 이를 위해 외부 N-말단-프로모터-시그널 펩타이드-PREY-v5 태그-TMP-GFP-내부 C-말단 구조의 플라스미드를 구축한다(도 2a 내지 도 2g, 도 3 참조). 상기 시그널 펩타이드는 PREY 펩타이드의 세포막 외부로의 국소화를 유도하고, 절단을 통해 유도 신호를 비활성화시킬 수 있다. 상기 v5 태그 및 GFP는 PREY의 위치 및 발현 수준을 모니터링하기 위해 사용할 수 있다. 본 발명의 일 구체예에 따르면, 세포막 안쪽에 GFP, 세포막 바깥에 v5 태그 및 PREY 펩타이드가 발현된다.
또한, 와류 부위 타겟팅 펩타이드 발현을 개선하기 위해 트랜스멤브레인 단백질(TMP)을 사용함으로써 와류 부위를 탐색 및 타겟팅하는 펩타이드의 능력을 극대화 시킬 수 있다. 따라서, 상기 트랜스멤브레인 단백질은,
i) 줄기세포 또는 나노베지클에서 발현하는 단백질일 수 있다. 예컨대, 상기 트랜스멤브레인 단백질은 CD86과 같은 엑소좀 마커, CD105 및 CD271와 같은 중간엽 줄기세포 마커 등을 사용할 수 있다.
ii) 단백질의 N-말단과 C-말단이 세포막을 사이에 두고 반대방향으로 향해 있어야 한다.
바람직하게는, 트랜스펙션 효율이 높은 CD271을 사용할 수 있다.
상기 시그널 펩타이드는 Signal peptide F(BKU002587, Korea Human Gene Bank, Republic of Korea) 및 Signal peptide R(BKU008396, Korea Human Gene Bank, Republic of Korea)을 사용할 수 있으나, 이에 제한되지는 않는다.
상기 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질-녹색형광단백질(GFP)의 코딩 서열은 핵산 서열로 상기 핵산은 가장 광의적인 의미로 사용되며, 단일가닥(ss) DNA, 이중가닥(ds) DNA, cDNA, (-)-RNA, (+)-RNA, dsRNA 등을 포괄한다. 바람직하게는 이중가닥 DNA이다.
바람직하게는, 상기 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질의 코딩 서열로 DNA를 선택하는 경우 발현 벡터에 삽입된 형태로 사용할 수 있다.
본 명세서에서, 용어 “벡터”는 자신에게 연결된 다른 핵산을 운반할 수 있는 핵산 분자를 말한다. 벡터의 한 타입으로 “플라스미드”가 있는데, 플라스미드란 추가의 DNA 분절을 결찰시킬 수 있는 원형의 이중 가닥 DNA 루프를 말한다. 벡터의 또 다른 타입으로는 추가적인 DNA 분절을 바이러스 게놈으로 결찰시킬 수 있는 바이러스 벡터가 있다. 일부 벡터는 숙주세포로 도입될 때 이 숙주세포 내에서 자가 복제할 수 있다(예를 들어, 박테리아 복제 기점을 갖는 박테리아 벡터 및 에피솜 포유동물 벡터). 다른 벡터(예를 들어, 비에피솜 포유동물 벡터)는 숙주세포로 도입될 때 숙주세포의 게놈으로 통합되어, 숙주 게놈과 함께 복제될 수 있다. 또한, 일부 벡터는 이들이 작동 가능하게 연결되어 있는 유전자의 발현을 지시할 수 있다. 본 명세서에서 이러한 벡터를 “재조합 발현 벡터”(또는 간단히, “발현 벡터”)라 한다. 일반적으로, 재조합 DNA 기법에 유용한 발현 벡터는 대개 플라스미드의 형태로 플라스미드가 가장 일반적으로 사용되는 벡터 타입이기 때문에, “플라스미드”와 “벡터”는 서로 교환하여 사용될 수 있다. 그러나, 본 발명은 동등한 기능을 제공하는 바이러스 벡터(예를 들어, 아데노바이러스 벡터, 아데노-관련 바이러스(AAV) 벡터, 헤르페스 바이러스 벡터, 레트로바이러스 벡터, 렌티바이러스 벡터, 바큘로바이러스 벡터)와 같은 다른 형태의 발현 벡터도 포함한다. 바람직하게는, 렌티바이러스 벡터를 사용할 수 있다. 형질전환은 핵산을 유기체, 세포, 조직 또는 기관에 도입하는 어떤 방법도 포함되며, 당 분야에서 공지된 바와 같이 숙주세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 전기천공(electroporation), 원형질 융합, 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 실리콘 카바이드 섬유 이용한 교반, 아그로박테리아 매개된 형질전환, PEG, 덱스트란 설페이트, 리포펙타민 등이 포함되나 이로 제한되지 않는다.
상기 줄기세포는 골수, 제대, 제대혈, 태반, 혈액, 피부, 지방조직, 신경조직, 간, 췌담도, 근육 및 양막으로 이루어진 군에서 선택된 1종 이상의 조직 유래의 줄기세포; 중간엽 줄기세포; 배아줄기세포; 또는 유도만능줄기세포 등을 사용할 수 있다. 바람직하게는, 항-동맥경화 특성을 갖는 miR-21, miR-132, miR-10, miR-146, miR-143 및 let 7과 같은 miRNA를 포함하는 줄기세포를 사용할 수 있다. 예컨대, 트랜스펙션 효율이 높고 세포사멸 비율이 낮은 지방 유래 줄기세포를 사용할 수 있다.
본 발명의 일 구체예에 따르면, 본 발명의 나노베지클은 PREY 펩타이드를 발현하는 벡터로 트랜스펙션된 줄기세포에 대해 10 ㎛, 5 ㎛ 및 400 nm의 다공성 멤브레인을 순차적으로 바꿔주면서 압출을 통해 얻을 수 있다. 본 발명의 일 구체예에 따르면, TEM 및 DLS 분석 결과, 각각 약 47.2±12.1 nm 및 약 83.7±20.6 nm의 평균을 갖는 나노베지클 직경의 균일한 분포를 얻을 수 있으며, 줄기세포의 DLS에서의 14.9±2.0 ㎛ 직경보다 작다.
본 발명의 나노베지클은 줄기세포의 세포 내 성분과 비교하여 압출 후에도 세포 내 성분들을 보유하고 있으며, 항-동맥경화 miRNA, 예컨대, miR-21, miR-132, miR-10, miR-146, miR-143 및 let 7의 수준이 압출 시 증가하는 것을 특징으로 한다.
본 발명의 나노베지클은 LPS 처리에 의해 활성화된 대식세포에 처리하면 항-염증성 사이토카인의 유전자 발현을 증가시켜 항-염증 효과를 나타내는 것을 특징으로 한다. 또한, 산화된 LDL의 흡수로 인한 대식세포의 거품세포 형성은 VSMC의 표현형 변화 및 내부성장이 결과적으로 유도되므로 동맥경화 발달의 중요한 부분이다. 이 결과는 나노베지클이 동맥경화 과정을 예방할 수 있음을 시사하는 것이다.
또한, iMAEC의 전-염증성 기능장애를 활성화시켜 나노베지클 처리에 의한 내피세포 복구 효과를 시험한 결과, 내피세포는 E-셀렉틴, ICAM-1 및 VCAM-1을 우세하게 발현하여 기능장애 활성화 시 염증 세포를 동원하므로 이들 마커의 유전자 발현을 측정하면 LPS 처리에 의해 모두 상향조절되나, 나노베지클을 처리하면 유의적으로 하향조절되어 나노베지클은 내피세포 복구 효과를 보인다. 아울러 HUVEC에서 CyA 처리에 대해 나노베지클은 전-내피세포 복구 및 전-혈관형성 효과를 향상시킨다.
또한, 마우스 및 돼지 PCL 모델에서 나노베지클의 와류 부위 타겟팅 효과를 시험한 결과, 와류 부위 타겟팅 펩타이드인 PREY 펩타이드는 와류 부위에서 과발현되는 필라민 A를 타겟으로 함을 알 수 있고, 동맥경화의 조기 진행을 예방하는 상승적 진단치료 효과를 확인할 수 있다. 아울러, 인 비트로 미세유체 모델에서 나노베지클은 필라민 A와 공존하며 와류 조건에서 증가하여 나노베지클의 진단치료적 잠재력을 입증한다.
또한, 본 발명의 나노베지클은 전신 순환 후 심장, 폐, 간 및 비장에서 눈에 띄는 독성 효과를 갖지 않는 대조군의 발현 수준으로 감소한다.
따라서, 본 발명은 또한 상기의 나노베지클을 포함하는 동맥경화의 예방, 진단 및 치료용 조성물을 제공한다.
본 발명의 동맥경화의 예방 또는 치료용 조성물은 인 비트로, 인 비보 또는 엑스 비보에서 예방, 진단 또는 치료적 용도에 적합한 조성물을 이루는 활성성분 및 활성 또는 무활성 약학적으로 허용가능한 담체를 포함할 수 있다.
상기 약학적으로 허용가능한 담체는 인산 완충화된 염수 용액, 인간 혈청 알부민(HSA) 등의 혈청 알부민, 재조합 인간 알부민(rHA), 젤라틴, 카세인 등을 포함하는 단백질 부형제와 같이, 나노베지클과 혼용가능한 임의의 약학적 담체를 포함한다. 담체, 안정화제 및 보강제의 예는, Martin REMINGTON'S PHARM. SCI, 18th Ed.(Mack Publ. Co., Easton (1995)) 및 the “PHYSICIAN'S DESK REFERENCE”, 58nd Ed., Medical Economics, Montvale, NJ. (2004)를 참조한다. 용어 “담체”는 완충액 또는 pH 조정제를 포함할 수 있으며, 전형적으로 완충액은 유기산 또는 염기로부터 제조된 염이다. 대표적인 완충액으로는 시트르산의 염, 아스코르브산의 염, 글루콘산의 염, 카본산의 염, 타르타르산의 염, 숙신산의 염, 아세트산의 염 또는 프탈산의 염 등의 유기산 염; 트리스, 트로메타민 하이드로클로라이드 또는 포스페이트 완충액을 포함한다. 추가적인 담체로, 폴리비닐피롤리돈, 피콜(폴리머 당), 덱스트레이트(예, 사이클로덱스트린, 예컨대 2-하이드록시프로필-쿼드러셔(quadrature), -사이클로덱스트린), 폴리에틸렌 글리콜, 항산화제, 항-대전제, 계면활성제(예, “TWEEN 20”및 “TWEEN 80” 등의 폴리소르베이트), 지질(예, 인지질, 지방산), 스테로이드(예, 콜레스테롤) 및 킬레이트제(예, EDTA) 등의 폴리머성 부형제/첨가제를 포함한다. 빙결 방지제 또는 강하제도 포함될 수 있다.
본 발명의 동맥경화의 예방, 진단 또는 치료용 조성물은 다양한 적정 제형으로 제조될 수 있다. 예를 들면, 동맥내(관절에서), 정맥내, 근육내, 피내, 복강내, 결절내(intranodal) 및 피하 경로와 같은 비경구 투여에 적합한 제형과 담체는 항산화제, 완충액, 정균제, 및 제형을 목적하는 수용자의 혈액과 등장으로 만들어 줄 용질, 및 현탁제, 용해제, 증점제, 안정화제, 및 방부제를 포함할 수 있는 수성 및 비수성의 멸균 현탁액을 포함한다. 정맥내 또는 복강 투여가 바람직한 방법이다. 개체에게 투여된 세포의 투여량은 시간의 경과에 따라 개체에서 목적하는 유익한 치료적 반응을 달성하기에 유효한 양이다. 예컨대, 주입 전에 개체로부터 혈액시료를 수득한 후 보관하여 후속적인 분석 및 비교에 사용하는 방식으로 실시될 수 있다. 일반적으로, 적어도 약 104 내지 106 및 전형적으로 1×108 내지 1×1010개의 세포를 70 kg의 환자에게 대략 60분 내지 120분에 걸쳐 정맥내 또는 복강내로 주입할 수 있다. 투여의 경우, 개체의 전반적 건강상태 및 체중을 고려하면서, 본 발명의 나노베지클을 세포의 타입에 따른 LD-50(또는 기타 독성 측정 방법) 및 다양한 농도에서의 세포의 타입에 따른 부작용에 의해 결정된 비율로 투여한다. 투여는 한번에 또는 여러 회 나누어 투여할 수 있다. 본 발명의 나노베지클은 세포독성제, 뉴클레오타이드 유사체 및 생물학적 반응 변형제를 포함하는 공지된 통상의 치료법을 사용하여 다른 특정 증상에 대한 치료를 보충할 수 있다. 유사하게, 생물학적 반응 변형제는 본 발명의 나노베지클에 의한 치료에 선택적으로 추가될 수 있다.
본 발명은 또한 치료적 유효량의 상기의 나노베지클을 개체에 투여하는 단계를 포함하는 동맥경화의 치료방법을 제공한다.
동맥경화의 치료방법에 사용되는 나노베지클 및 투여 방법은 상기에서 기술하였으므로, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
상기 개체는 개, 고양이, 랫트, 마우스, 인간 등의 포유동물일 수 있으나, 이에 제한하지는 않는다.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.
이하, 실시 예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 자명할 것이다.
<실시예 1> PREY 펩타이드-나노베지클(NV)의 제조 및 특성 규명
(PREY 발현을 위한 플라스미드 설계 및 클로닝)
세포막에서 PREY를 외부로 발현시키고 국소화하는 플라스미드는 외부쪽 N-말단-프로모터-시그널 펩타이드-PREY-V5-TMP-GFP-내부쪽 C-말단으로 구성된다. 시그널 펩타이드는 Signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea) 또는 Signal peptide R (BKU008396, Korea Human Gene Bank, Republic of Korea)을 사용한다. 플라스미드 서열에서, i) 시그널 펩타이드는 PREY 펩타이드의 세포막 외부로의 국소화를 유도하고; 및 ii) V5 태그 및 GFP는 PREY의 위치 및 발현 수준을 모니터링한다. 발현 벡터는 NEB Gibson Assembly kit(New England Biolabs, MA)를 사용하여 제조업체의 설명서에 따라 클로닝 하였다. 시그널 펩타이드 및 트랜스멤브레인 단백질의 각 타입은 다음의 주형을 이용한 PCR을 통해 별도로 증폭하였다: Signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea), Signal peptide R (BKU008396, Korea Human Gene Bank, Republic of Korea), CD86, CD105 및 잘린 CD271(LNGFR)에 대해서는 NGFR(Addgene plasmid #27489; Addgene, MA). 벡터 성분은 플라스미드 합성(Macrogen, Republic of Korea)과 함께 Cas9-digested p3S-Cas9-HN(Addgene plasmid #104171) 백본에 삽입되었다. 이 절차에 따라 PCR 증폭 및 깁슨 클로닝을 수행하였다. 모든 프라이머 및 플라스미드는 표 1 및 2에 나열된다.
클로닝에 사용된 프라이머 리스트
인서트 프라이머 명칭 서열 (5'→ 3') 주형 주석
CMV promoter backbone All pCMV Backbone_F<SEQ ID NO: 6> TAACTCGAGCATGCATCTAGAG p3S-Cas9-HN (A gift from Jin-Soo Kim; Addgene plasmid # 104171) linearized p3S-Cas9-HN plasmid without Cas9 Sequence
pCMV Backbone_R<SEQ ID NO: 7> GGTGGCAAGCTTGGGTCTCC
GS linker and EGFP All mEGFP_F<SEQ ID NO: 8> GAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCGTGAGCAAGGGCGAG pC015- dLwCas13a-NF (A gift from Feng Zhang ; Addgene plasmid # 91905) -
mEGFP_R<SEQ ID NO: 9> ATAGGGCCCTCTAGATGCATGCTCGAGTTATTACTTGTACAGCTCGTCCATG -
Signal peptide and PREY CD86 CD86 Signal_F<SEQ ID NO: 10> CTCACTATAGGGAGACCCAAGCTTGCCACCATGGATCCCCAGTGCACTAT NM_175862 (BKU002587, Korea Human Gene Bank) -
CD86_Signal_PREY_R<SEQ ID NO: 11> GTGAGGCATATAGGAGGTGTACTCGCGGGGACTGCCAGCTTGAATCTTCAGAGGAG -
CD271 NGFR Signal_F<SEQ ID NO: 12> CTCACTATAGGGAGACCCAAGCTTGCCACCATGGACGGGCCGCGCCT NGFR (A gift from Warren Pear ; Addgene plasmid # 27489) -
NGFR Signal_R<SEQ ID NO: 13> CATATAGGAGGTGTACTCGCGGGGACTGCCGGCACCTCCAAGGGACACCC -
CD105 CD105 Signal_F<SEQ ID NO: 14> CTCACTATAGGGAGACCCAAGCTTGCCACCATGGACCGCGGCACGCTCCC NM_001114753 (BKU008396, Korea Human Gene Bank) -
CD105 Signal_R<SEQ ID NO: 15> CATATAGGAGGTGTACTCGCGGGGACTGCCTGCAAGACTTGTGGGGCTGA -
PREY and V5 Tag All V5 tag_PREY_F<SEQ ID NO: 16> GGCAGTCCCCGCGAGTACACCTCCTATATGCCTCACGGCAAGCCCATCCCCAACCC Primer extension without template PREY and V5 tag
CD86 V5 tag_CD86_R<SEQ ID NO: 17> GCATGGCAGGTCTGCAGTCTCATTGAAATAGGTGCTGTCCAGGCCCAGCA V5 tag and 30bp homology with CD86 mature peptide
CD271 or CD105 V5 Full AS<SEQ ID NO: 18> GGTGCTGTCCAGGCCCAGCAGGGGGTTGGGGATGGGCTTGCC V5 tag anti sense
Mature peptide and GS linker CD86 CD86 MP_F<SEQ ID NO: 19> TATTTCAATGAGACTGCAGACCT NM_175862 (BKU002587) -
CD86 MP_Linker_R<SEQ ID NO: 20> TCCGCTTCCTCCTCCTCCGCTTCCACCTCCTCCAAAACATGTATCACTTTTGTCGCA -
CD271 V5_LNGFR_F<SEQ ID NO: 21> CCCAACCCCCTGCTGGGCCTGGACAGCACCAAGGAGGCATGCCCCACAG NGFR (Addgene plasmid # 27489) Mature peptide of truncated NGFR and 30bp homology with V5 Tag
LNGFR_Linker_R<SEQ ID NO: 22> CTCCGCTTCCTCCTCCTCCGCTTCCACCTCCTCCTCGATAAGCTTGGCTGCAGGT -
CD105 V5-CD105_F<SEQ ID NO: 23> CCCAACCCCCTGCTGGGCCTGGACAGCACCGAAACAGTCCATTGTGACCT NM_001114753 (BKU008396) Mature peptide of CD105 and 30bp homology with V5 Tag
CD105-GS_R<SEQ ID NO: 24> CTCCGCTTCCTCCTCCTCCGCTTCCACCTCCTCCTGCCATGCTGCTGGTGGAGC -
플라스미드의 종류 및 서열(Signal peptide; PREY; V5 tag; Transmembrane protein; GS linker 및 EGFP)
플라스미드 서열 (5'→3')
PREY-CD271-EGFP (1701 bp)<SEQ ID NO: 25> CCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
PREY-CD86-EGFP (1827 bp)<SEQ ID NO: 26> AAAGTTCGAAGACATCTTCATGCGACAAAAGTGATACATGTTTTGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
PREY-CD105-EGFP (2814 bp)<SEQ ID NO: 27> CAGCATGGCAGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
(트랜스펙션 효율 측정)
PREY 트랜스펙션 효율은 2종의 MSC 타입(ASC 및 BMSC)과 비교하여 트랜스펙션 후 1일에 정량적 분석과 함께 FACSCanto(BD Bioscience, CA)를 사용하여 유세포 분석(Flow cytometry)을 통해 트랜스멤브레인 단백질의 시험 후보물질(CD86, CD105 및 CD271) 중에서 비교하였다. 따라서, 세포는 항-v5 태그 1차 항체(ab27671, Abcam, MA) 및 Alexa Fluor 647-컨쥬게이트된 2차 항체(Jackson Immuno Research, PA)로 면역염색되었다. 플라스미드 용량 의존성 세포사멸을 평가하기 위해, 트랜스펙션된 ASC 및 BMSC를 트랜스펙션 후 30분에 채취하고, Alexa Fluor 488-컨쥬게이티드 된 Annexin V(Thermo Fisher Scientific, CA)로 면역염색하고 유세포 분석을 수행하였다. 트랜스펙션 후 1일째에 트립판 블루 염색을 통해 생존 세포 수를 또한 계수하였다.
(NV 압출)
트랜스펙션 후 3일에 인간 ASC(Promocell, Germany), BMSC(Lonza, Switzerland) 및 PMSC를 PBS로 2회 세척하고, 0.25% trypsin/EDTA로 탈착시켰다. 이어서, 나노베지클을 생성하기 위해, PBS에 녹인 세포 현탁액 1Х106 cells/mL을 압출 키트(Avanti Polar Lipids, AL)를 사용하여 10 ㎛, 5 ㎛ 및 400 nm 기공 크기의 폴리카보네이트 멤브레인 필터(Whatman, UK)를 순차적으로 바꿔주면서 6회 압출시켰다. 15,000 g에서 30분 동안 원심분리하여 NV를 수집하였다. 다음으로, 펠릿을 PBS에 재현탁시키고 0.20 ㎛ 주사기 필터(Avantec, Japan)를 통해 여과하고, 사용할 때까지 -70℃에서 보관하였다. PMSC-NV의 크기 및 형태는 투과전자현미경(TEM; JEM-F200, JEOL, Japan) 및 동적광산란(DLS; ELS-1000ZS, Otsuka Electronics, Japan)에 의해 측정되었다.
(인 비트로 항-염증 효과의 측정)
RAW264.7 세포를 24-웰 플레이트에 씨딩하였다(5×105 cells/well). RAW264.7 세포의 전-염증성 활성화는 24시간 동안 LPS(Sigma-Aldrich; 100 ng/mL) 처리 후 24시간 동안 ASC-NV 또는 BMSC-NV(10 ㎍/mL) 처리를 통해 유도되었다. 세포성 흡수를 시각화하기 위해, RAW264.7 세포 및 NV를 각각 DiO 및 DiI(Invitrogen, CA)로 표지하고, 공초점 현미경(LSM780; Zeiss, Germany)으로 영상화하였다. qRT-PCR 분석을 위해, NV 처리 후 24시간에 세포를 채취하였다. IL-10, IL-1β, IL-6 및 TNF-α의 프라이머 서열은 표 3에 나열되어 있다. 마우스 염증 항체 어레이(ab133999, Abcam)를 이용한 사이토카인 분석을 위해 제조업체 설명서에 따라 세포 상등액을 채취하였다. MSC-NV의 항-식균 효과는 VybrantTM Phagocytosis Assay Kit(V6694, Molecular Probes, OR)를 사용하여 제조업체의 설명서에 따라 측정하였다. 이미지는 공초점 현미경을 통해 얻고, 형광 강도는 VarioskanTM LUX multimode microplate reader(Thermo Fisher Scientific, MA)를 사용하여 측정하였다.
타겟 유전자 프라이머 서열 (5'→3') SEQ ID NO.
GAPDH Forward ATG TGT CCG TCG TGG ATC TGA 28
Reverse TGC CTG CTT CAC CAC CTT CT 29
IL-10 Forward ACT GGC ATG AGG ATC AGC AG 30
Reverse CTC CTT GAT TTC TGG GCC AT 31
IL-1β Forward GCC ACC TTT TGA CAG TGA TGA G 32
Reverse ATC AGG ACA GCC CAG GTC AA 33
IL-13 Forward ATG GCC TCT GTA ACC GCA AG 34
Reverse TCC TCA TTA GAA GGG GCC GT 35
TNF-α Forward CCT GTA GCC CAC GTC GTA GC 36
Reverse AGC AAT GAC TCC AAA GTA GAC C 37
VCAM1 Forward AGT TGG GGA TTC GGT TGT TC 38
Reverse CAT TCC TTA CCA CCC CAT TG 39
E-selectin Forward CCA GAA TGG CGT CAT GGA 40
Reverse TAA AGC CCT CAT TGC ATT GA 41
ICAM1 Forward CAA TTT CTC ATG CCG CAC AG 42
Reverse AGC TGG AAG ATC GAA AGT CCG 43
(인 비트로 전-EC 복구 효과의 평가)
iMAEC(ATCC, VA)를 24-웰 플레이트에 씨딩하고 나서(1×105 cells/well), 24시간 동안 LPS(100 ng/mL)를 처리하였다. 이어서, 추가로 24시간 동안 ASC-NV, BMSC-NV 또는 PMSC-NV(10 ㎍/mL)를 처리하였다. 세포 흡수를 시각화하기 위해, iMAEC 및 NV를 각각 DiO 및 DiI로 표지하고, 공초점 현미경을 통해 영상화하였다. qRT-PCR 분석을 위해, NV 처리 후 24시간에 iMAEC를 채취하였다. E-selectin, ICAM-1 및 VCAM-1의 프라이머 서열은 표 3에 나열하였다. iMAEC는 VCAM-1 항체(ab134047, Abcam)로 면역염색하고, ImageJ를 이용하여 정량적 분석과 함께 공초점 현미경을 통해 영상화하였다. NV(10 ㎍/mL) 및 CyA(25 ㎍/mL; Santa Cruz Biotechnology, CA)를 HUVEC(Lonza)에 처리하고 마트리젤(BD Biosciences, MA)에서 각각 2시간 및 24시간 동안 배양하여 항-혈관형성 및 맥관 파열에 대한 전-EC 복구 효과를 측정하였다. 이미지는 공초점 현미경을 통해 얻고 ImageJ를 이용하여 정량화하였다.
(마우스 PCL 모델)
모든 동물 연구는 연세대학교 의과대학의 기관 동물 관리 및 사용 위원회(IACUC)가 승인한 절차(2018-0044)에 따라 수행되었다. 수술 절차는 6주령 수컷 Balb/c(Orient Bio Inc, 대한민국) 또는 KOR-ApoE (shl)(SLC, Japan) 마우스로 수행되었다. PCL 수술을 위해, 자일라진(10 mg/kg) 및 졸레틸(50 mg/kg) 혼합물의 복강 내 주사를 통해 마취시켰다. 목을 면도하고, 베타딘을 이용하여 소독하였다. 이어서, 중간선 절개를 수행하였다(5 mm). LCA 노출 후, LCA의 4종의 가지 중 3개(ECA, ICA, OA)를 10-0 폴리아미드 봉합사로 결찰하고 STA는 결찰시키지 않은 상태로 두었다. 이어서, 절개부를 6-0 실크 봉합사로 봉합하였다. 그리고 나서, 마우스를 모니터링하고 동맥경화성 식이(Research Diets, NJ)를 공급하고, 결찰 후 3일에 MSC-NV, PMSC 또는 PMSC-NV를 정맥 투여하였다.
(마우스 PCL 모델에서 타겟팅 효율 및 항-동맥경화 효과의 측정)
와류 부위의 인 비보 PMSC-NV 타겟팅 효율은 시험군의 주사 후 24시간에 IVIS 이미징(PerkinElmer, WA) 및 조직학적 분석을 통해 마우스 PCL 모델에서 측정하였다. MSC 및 NV 군은 VivoTrack 680(PerkinElmer)으로 30분 동안 표지되고, PCL 모델에 주사되었다. 이어서, 이소플루란으로 호흡마취 하에서 IVIS 이미징을 수행하였다. 그리고 나서, 마우스를 희생시키고, 그들의 LCAs, RCAs 및 주요 장기들을 채취하여 엑스-비보 IVIS 이미징 및 조직학적 분석을 수행하였다. LCA 및 RCA의 조직 섹션은 항-필라민 A 항체(ab51217, Abcam)로 면역염색하고, 상응하는 형광 강도는 ImageJ 소프트웨어를 사용하여 정량화하였다. 조직 섹션은 또한 H&E로 염색하거나, 항-CD68 항체(ab125212, Abcam) 및 항-VCAM-1 항체(ab134047, Abcam)로 면역염색하였다. 신생혈관내막(Neointima) 구조 인자(신생혈관내막 대 신생혈관내막+루멘의 면적 비율, 신생혈관내막 대 배지의 면적 비율 및 신생혈관내막 면적) 또는 상응하는 형광 강도를 ImageJ를 사용하여 정량적으로 분석하였다.
(돼지 PCL 모델에서 타겟팅 효율의 측정)
PCL 수술은 25-30 kg 중량의 암컷 요크셔 돼지(XP bio, Republic of Korea)에서 이전 연구에 따라 수행하였다. 돼지에게 전 처치(premedication)로서 아트로핀(0.04 mg/kg), 자일라진(2 mg/kg) 및 아자페론(2 mg/kg)을 근육 내 주사하였다. 마우스는 알팍산(1 mg/kg)으로 마취하였고 수술 중 2% 이소플루란의 기관 내 삽관에 의해 이 상태로 유지되었다. 목은 베타딘을 사용하여 소독하고 이어서 중간선 피부 절개를 하였다. 멸균된 스테인리스-스틸 막대(외경=0.9 mm)를 LCA에 스페이서로 놓고 5-0 실크 봉합사와 함께 결찰하였다. 막대를 순차적으로 제거하고 봉합하여 절개를 막아 관상동맥의 80% 폐색을 유발하였다. RCA는 정상군으로서 결찰 없이 방치되었다. 혈류 패턴은 초음파(S22V; SonoScape Medical Corp., China)에 의해 관찰되었다. Vivotrack680-표지된 MSC-NV 또는 PMSC-NV를 결찰 후 3일에 귀 정맥(1 mg/pig)을 통해 정맥 내 주사하고, 돼지를 주사 후 1일 또는 21일에 희생시켰다. 엑스 비보 IVIS 및 조직학적 분석을 위해 RCA, LCA 및 대동맥 궁을 채취하였다. 이들의 조직 섹션은 항-필라민 A 항체 및 항-CD31 항체(sc-1506, Santa Cruz Biotechnology, CA)로 면역염색되었고, 이어서 ImageJ 분석과 함께 형광 이미징을 수행하였다.
(인 비트로 혈류 모델에서 인간 EC의 타겟팅 효율의 측정)
이전에 기술된 바와 같이(Sei, Y. J. et al. Sci Rep 7, 10019, 2017), 미세유체 장치는 소프트 리쏘그래피에 의해 폴리디메틸실록산(PDMS, Dow Corning, MI)으로 제조하고, 유리 커버 슬립(VWR, PA)과 결합시켜 폴리스티렌 박스(Ted Pella Inc., CA)에 넣었다. 장치는 70% 에탄올로 멸균하고, PBS로 세척하였다. 이어서 50 ㎍/mL의 콜라겐 I(Corning, MA)로 37℃에서 1시간 동안 채널을 코팅하였다. 인간 관상동맥 내피세포(hCAEC; Lonza) 또는 인간 대동맥 내피세포(hAEC; Lonza)를 12시간 동안 채널에(2×107 cells/mL로) 씨딩하였다. 각 장치의 배출구는 PhD Ultra 시린지 펌프(Harvard Apparatus, MA)에 연결되어 정상적인 배지 흐름 및 와류가 형성되도록 하였다. 정상적인 층류를 만들기 위해 22.5 ㎕/min의 배지를 10dyne/cm2의 전단 응력으로 관류시켰다. 와류는 각각 22.5 ㎕/min(10 dyne/cm2) 및 20 ㎕/min(9 dyne/cm2)의 유속으로 배지를 주사 및 제거하는 반복 사이클을 통해 생성하였다. 인간 EC를 어느 한쪽의 흐름 타입에 노출시킨 후, NV(10 ㎍/mL)를 37℃에서 1시간 동안 채널에 관류시켰다. 각 시험 군에서 인간 EC로의 NV 흡수는 ImageJ를 사용하여 정량적으로 분석되었다.
(qRT-PCR 및 miRNA 어레이)
총 RNA는 제조업체의 설명서에 따라 1 mL의 TRIzol 시약(Invitrogen)을 사용하여 각 샘플에서 추출되었다. RNA를 디에틸 피로카보네이트(DEPC) 워터에 녹이고, AccuPower CycleScript RT Premix(Bioneer, Republic of Korea)를 사용하여 cDNA를 합성하였다. 이어서, StepOnePlus real-time PCR system(Applied Biosystems, CA)에서 SYBR Green PCR mix(Thermo Fisher Scientific)로 PCR을 수행하였다. 글리세르알데히드 3-포스페이트 디하이드로게나아제(GAPDH)를 하우스키핑 유전자로 제공하고, 각 마커의 유전자 발현은 상대 정량화 방법 2-ㅿㅿCt를 사용하여 측정하였다. 프라이머 서열은 표 3에 나열하였다. 용해된 RNA는 miRNA 어레이(GeneChip 4.0 microRNA Microarray; Affimetrix, Japan)를 사용하여 제조업체의 설명서에 따라 프로파일링 하였다.
(세포 및 조직의 면역형광 염색)
세포 샘플을 4% 파라포름알데히드(Sigma-Aldrich)로 10분 동안 고정하고, 조직 샘플은 10% 파라포름알데히드로 3일 동안 고정하며 둘 다 실온에서 수행하였다. 고정된 샘플은 PBS로 세척하고 파라핀에 고정하여 조직 섹션을 만들었다. 이어서 일련의 자일렌 및 에탄올 용액(증류수 내에서 100%, 95%, 80%, 70% v/v)을 이용하여 그들을 수화시키고, 항원 복구를 위해 펩신 시약(Sigma-Aldrich)을 37℃에서 30분 동안 처리하였다. 다음으로, 조직 섹션에 블록킹 용액(5% 우태아혈청 알부민(Millipore, MD) + 0.3% triton X-100(Sigma-Aldrich))을 1시간 동안 실온에서 처리하였다. 1차 항체는 항-v5 태그 항체(ab27671, Abcam), 항-VCAM-1(ab134047, Abcam), 항-CD68(ab125212, Abcam), 항-Filamin A(ab51217, Abcam) 및 항-CD31(sc-1506, Santa Cruz Biotechnology, CA, USA)이다. 이들 항체는 1:100으로 희석하여 PBS에 처리하고, 이어서 후속 2차 항체를 1:200로 희석하여 PBS에 처리하였다. 2차 항체는 Alexa Fluor 594에 컨쥬게이트 된 항-마우스 항체, Alexa Fluor 594에 컨쥬게이트 된 항-토끼 항체, Alexa Fluor 488에 컨쥬게이트된 항-토끼 항체 및 Alexa Fluor　488에 컨쥬게이트 된 항-염소 항체(all from Jackson Laboratories)이다. 이어서, 샘플을 올려두고 4',6-diamidino-2-phenylindole(DAPI, Vector Laboratories, CA)를 함유하는 마운팅 용액으로 대비염색시켜 세포 핵을 시각화하였다.
(웨스턴 블랏 분석)
샘플을 RIPA 버퍼(Sigma-Aldrich)로 용해시켜 총 단백질을 수득하였으며, 단백질의 농도는 브래포드 어세이(Sigma-Aldrich)를 사용하여 측정하였다. 단백질 추출물을 10%(w/v) SDS-PAGE 젤에서 전기영동한 다음 니트로셀룰로오스 멤브레인 상으로 이동시켰다. 멤브레인을 5%(w/v) 스킴 밀크와 함께 TBST(20mM Tris, 0.9% NaCl, 0.1% 트윈20, pH 7.4)에서 차단한 후 1차 항체인 항-v5 태그(ab27671, Abcam), 항-CD271(345102, Biolegend, CA), 항-GFP(ab32146, Abcam), 항-CD9(ab92726, Abcam) 및 항-β-액틴(ab8227, Abcam)과 인큐베이션하였다. 이어서, 2차 항체인 염소 항-마우스 IgG(H+L)-HRP 컨쥬게이트 및 염소 항-토끼 IgG(H+L)-HRP 컨쥬게이트 된 항체(모두 Vector Laboratories사 제품임)를 제조업체의 설명서에 따라 적용하였다. 신호는 CL Plus Western Blotting Detection Kit(Amersham Biosciences, UK)를 사용하여 제조업체의 설명서에 따라 시각화하고 LAS-3000 이미지 리더(Fujifilm, Japan)를 사용하여 분석하였다.
(통계 분석)
정량적 데이터는 평균±표준 편차(stdev)로 표시된다. 결과는 SigmaPlot 12.0(Systat Software, Inc., California, USA)을 사용한 Turkey's significant difference post hoc test로 일원분산분석(ANOVA)에 의해 통계적으로 분석되었다.
<실험예 1> 막의 외부로의 RPEY 전시
NV가 와류 부위를 타겟팅할 수 있도록 하기 위해, 타겟팅 펩타이드인 PREY를 MSC 막(PMSC: PREY-발현 인간 MSC) 전체에 걸쳐 특이적으로 설계된 플라스미드를 발현시킴으로써 외부로 전시 하였다. 플라스미드는 N-말단에서 시그널 펩타이드와 함께 PREY 세포외 도메인을 발현하도록 설계됨으로써 시그널 펩타이드는 MSC 막으로부터 PREY 세포외 도메인의 외부 쪽 국소화를 유도하고 절단을 통해 유도 신호를 비활성화시킬 수 있다.
또한, PREY 발현을 개선하기 위한 3개의 트랜스멤브레인 단백질(TMP), 즉 엑소좀 마커(CD86) 및 MSC 마커(CD105 및 CD271)의 능력을 시험하였다. 이러한 방식으로 와류 부위를 탐색 및 타겟팅하는 PREY의 능력을 극대화 시켰다. PREY는 V5 태그와 연결한 다음 GFP(외부 N-말단-프로모터-시그널 펩타이드-PREY-V5 태그-TMP-GFP-내부 C-말단)와 연결되어 세포막 외부 및 내부에서 PREY의 국소화 및 발현 수준을 확인하였다(도 2a, 도 3).
3개의 트랜스멤브레인 단백질을 갖는 시험군 중에서 지방 유래 줄기세포(ASC) 및 골수 유래 줄기세포(BMSC) 모두 PREY-CD271(신장 성장 인자 수용체: NGFR)의 발현 수준이 PREY-CD86 및 PREY-CD105의 발현 수준보다 더 높아 우수한 트랜스펙션 효율을 나타냈다(도 2b, 도 4a 내지 도 4c). PREY-CD271 플라스미드의 용량이 증가한 경우, 발현 수준은 용량 의존적 방식으로 증가한 반면, 2Х 용량의 트랜스펙션 후 세포 생존능은 급격히 감소하였다(도 2c, 도 4a 내지 도 4c). 따라서, 세포 생존능과의 균형을 고려하여, 플라스미드 용량을 1×(1×106 세포 당 1 ㎍ PREY-플라스미드)로 결정하였다. Annexin V+로 죽은 세포 수를 비교하면, 트랜스펙션 후 BMSC보다 생존 가능한 ASC가 더 많았으며, 이는 ASC가 PREY 트랜스펙션 보다 적합한 공급원임을 나타내는 것이다(도 2c, 도 4a 내지 도 4c).
MSC 막에서 PREY의 외부 전시를 확인하기 위해, 서열에서 PREY 옆에 있을 때 V5 태그를 면역염색하였다(외부 N-말단-프로모터-시그널 펩타이드-PREY-V5-TMP-GFP-내부 C-말단). 두 가지 형식 중 어느 것도 두 가지 정보 타입을 모두 명확하게 얻게 작동하지 않았기 때문에 PMSC의 부착된(도 5) 및 현탁된(도 2d, 도 1a 내지 도 1c) 형태를 각각 PREY의 발현 수준 및 위치를 측정하기 위해 사용하였다.
부착성 형태에서, PREY는 v5 태그 및 GFP 신호에 의해 제시된 바와 같이 세포막을 따라 고도로 발현됨으로써 성공적인 트랜스펙션을 나타냈다. 젤라틴 하이드로겔에 세포를 삽입하여 현탁된 형태를 만들면, 공초점 이미지는 각각 MSC 막 경계 외부 및 내부에서 v5 태그(빨간색) 및 GFP(녹색) 신호의 외관을 나타냄으로써 세포막 외부에서의 PREY 전시를 확인하였다.
<실험예 2> 나노베지클의 압출 및 특성 규명
PMSC-NV를 생산하기 위해, 기공 직경을 10 ㎛ 내지 5 ㎛까지 및 마지막으로 0.4 ㎛으로 점차 줄여가면서 일련의 폴리카보네이트 미세기공 막을 통해 PMSC를 순차적으로 압출시켰다(도 1b). TEM 결과(도 2e)는 47.2±12.1 nm의 평균을 갖는 PMSC-NV 직경의 균일한 분포를 나타낸다. 또한, 트랜스펙션 및 NV 압출 동안 PREY-펩타이드(GFP 및 v5 태그)의 온전한 보존 및 엑소좀 특성(CD9)은 웨스턴 블랏 분석을 통해 측정하였다(도 2f, 도 6).
다음으로, MSC-NV, PMSC 및 PMSC-NV에서 내부 성분들을 비교하여 PREY 트랜스펙션 및 NV 압출 후 세포 내 성분들의 보존을 확인하였다. miRNA는 중요한 치료제로 제공하며, 대다수는 엑소좀에 의해 전달된다. NV는 본질적으로 엑소좀과 유사하므로, PMSC-NV, MSC-NV, 및 PMSC의 miRNA 내용물은 miRNA 어레이에 의해 프로파일링 되었다(도 2g 및 표 4 및 5, 도 6). 트랜스펙션(MSC-NV 대 PMSC-NV) 및 압출 공정(PMSC 대 PMSC-NV)은 총 miRNA의 2.72 및 6.71%에 대해 2배 이상 발현 수준을 바꾸어, 그들의 생산 동안 세포 내 내용물의 보존을 입증한다. 항-동맥경화 miRNA 중에서, miR-21, miR-132, miR-10, miR-146, miR-143 및 let 7의 수준은 압출 동안 증가하나, 다른 miRNA는 MSC로부터 NV 생산 동안 그들의 발현 수준을 유지하였다.
miRNA 명칭 변화율 조절양상 miRNA 명칭 변화율 조절양상
hsa-miR-21-5p 17.321 상향 hsa-miR-3195 5.080 하향
hsa-miR-140-5p 10.011 상향 hsa-miR-106b-3p 4.296 하향
hsa-miR-7641 9.352 상향 hsa-miR-3663-3p 3.766 하향
hsa-miR-337-5p 8.283 상향 hsa-miR-345-5p 3.375 하향
hsa-miR-4443 8.228 상향 hsa-miR-3178 3.057 하향
hsa-miR-4726-5p 7.288 상향 hsa-miR-3687 3.035 하향
hsa-miR-132-3p 4.383 상향 hsa-miR-8063 2.958 하향
hsa-miR-376c-3p 4.236 상향 hsa-miR-4634 2.843 하향
hsa-miR-19b-3p 3.558 상향 hsa-miR-7112-5p 2.840 하향
hsa-miR-503-5p 3.481 상향 hsa-miR-663b 2.661 하향
hsa-miR-196a-5p 3.366 상향 hsa-miR-3124-5p 2.549 하향
hsa-miR-15a-5p 3.178 상향 hsa-miR-4497 2.523 하향
hsa-miR-143-3p 3.091 상향 hsa-miR-7975 2.505 하향
hsa-miR-143-5p 2.750 상향 hsa-miR-3679-5p 2.490 하향
hsa-miR-629-5p 2.689 상향 hsa-miR-6127 2.450 하향
hsa-miR-194-5p 2.549 상향 hsa-miR-6871-5p 2.442 하향
hsa-miR-30b-5p 2.521 상향 hsa-miR-4486 2.405 하향
hsa-miR-27a-3p 2.467 상향 hsa-miR-4750-5p 2.278 하향
hsa-miR-3131 2.466 상향 hsa-miR-6509-5p 2.221 하향
hsa-miR-7109-5p 2.442 상향 hsa-miR-4649-5p 2.158 하향
hsa-miR-30a-5p 2.424 상향 hsa-miR-6820-5p 2.156 하향
hsa-miR-152-3p 2.407 상향 hsa-miR-15b-5p 2.149 하향
hsa-miR-6837-5p 2.379 상향 hsa-miR-505-5p 2.145 하향
hsa-miR-1247-3p 2.370 상향 hsa-miR-378a-3p 2.136 하향
hsa-miR-379-5p 2.254 상향 hsa-miR-1343-5p 2.126 하향
hsa-miR-199a-5p 2.248 상향 hsa-miR-30d-5p 2.097 하향
hsa-let-7f-5p 2.246 상향 hsa-miR-486-5p 2.089 하향
hsa-miR-6876-5p 2.239 상향 hsa-miR-1469 2.082 하향
hsa-miR-642a-3p 2.221 상향 hsa-miR-6831-5p 2.025 하향
hsa-miR-1260b 2.195 상향
hsa-miR-210-3p 2.184 상향
hsa-let-7i-5p 2.181 상향
hsa-miR-452-5p 2.157 상향
hsa-miR-27b-3p 2.131 상향
hsa-miR-4521 2.128 상향
hsa-miR-3201 2.119 상향
hsa-miR-371b-5p 2.084 상향
hsa-miR-654-3p 2.081 상향
hsa-miR-4487 2.049 상향
hsa-miR-22-3p 2.039 상향
hsa-let-7c-5p 2.022 상향
압출 공정으로부터 2배 이상의 miRNA 변화(PMSC 대 PMSC-NV)
miRNA 명칭 변화율 조절양상 miRNA 명칭 변화율 조절양상
hsa-miR-21-5p 11.055 상향 hsa-miR-3162-5p 8.520 하향
hsa-miR-132-3p 10.252 상향 hsa-miR-4298 8.288 하향
hsa-miR-4521 9.785 상향 hsa-miR-6778-5p 6.988 하향
hsa-miR-337-5p 7.805 상향 hsa-miR-1973 5.582 하향
hsa-miR-1260b 7.468 상향 hsa-miR-3911 5.221 하향
hsa-miR-27b-5p 7.120 상향 hsa-miR-7107-5p 5.104 하향
hsa-miR-1260a 7.045 상향 hsa-miR-6782-5p 4.878 하향
hsa-miR-99b-3p 6.854 상향 hsa-miR-7847-3p 4.844 하향
hsa-miR-425-3p 5.547 상향 hsa-miR-6831-5p 4.763 하향
hsa-miR-10a-5p 5.071 상향 hsa-miR-6726-5p 4.708 하향
hsa-miR-214-5p 4.763 상향 hsa-miR-6068 4.695 하향
hsa-miR-7975 4.746 상향 hsa-miR-4656 4.567 하향
hsa-miR-15a-5p 4.745 상향 hsa-miR-6812-5p 4.230 하향
hsa-miR-378a-3p 4.567 상향 hsa-miR-485-3p 4.208 하향
hsa-miR-487a-5p 4.512 상향 hsa-miR-8089 4.136 하향
hsa-miR-27a-5p 4.421 상향 hsa-miR-4534 4.126 하향
hsa-miR-140-5p 4.360 상향 hsa-miR-3135b 4.065 하향
hsa-miR-500a-5p 4.265 상향 hsa-miR-6813-5p 4.014 하향
hsa-miR-7641 3.989 상향 hsa-miR-6808-5p 3.966 하향
hsa-miR-381-3p 3.901 상향 hsa-miR-4732-5p 3.920 하향
hsa-miR-378h 3.799 상향 hsa-miR-7111-5p 3.902 하향
hsa-miR-30a-5p 3.795 상향 hsa-miR-6848-5p 3.889 하향
hsa-miR-629-5p 3.739 상향 hsa-miR-4433-3p 3.768 하향
hsa-miR-452-5p 3.706 상향 hsa-miR-4433b-3p 3.750 하향
hsa-miR-196a-5p 3.677 상향 hsa-miR-6086 3.710 하향
hsa-miR-4487 3.663 상향 hsa-miR-6165 3.646 하향
hsa-miR-29b-1-5p 3.659 상향 hsa-miR-5189-3p 3.630 하향
hsa-miR-4454 3.457 상향 hsa-miR-1229-5p 3.532 하향
hsa-miR-93-3p 3.367 상향 hsa-miR-6763-5p 3.513 하향
hsa-miR-154-5p 3.333 상향 hsa-miR-619-5p 3.467 하향
hsa-miR-146a-5p 3.332 상향 hsa-miR-6861-5p 3.457 하향
hsa-miR-501-5p 3.243 상향 hsa-miR-150-3p 3.302 하향
hsa-miR-654-3p 3.232 상향 hsa-miR-3687 3.261 하향
hsa-miR-193b-5p 3.220 상향 hsa-miR-5739 3.122 하향
hsa-miR-18a-5p 3.208 상향 hsa-miR-1247-3p 3.119 하향
hsa-miR-339-3p 3.043 상향 hsa-miR-6820-5p 3.041 하향
hsa-miR-542-5p 3.014 상향 hsa-miR-6716-5p 3.038 하향
hsa-miR-299-3p 3.005 상향 hsa-miR-6775-5p 2.971 하향
hsa-miR-151a-3p 2.986 상향 hsa-miR-4749-5p 2.968 하향
hsa-miR-199a-5p 2.942 상향 hsa-miR-3679-5p 2.960 하향
hsa-miR-30b-5p 2.891 상향 hsa-miR-4728-5p 2.921 하향
hsa-miR-382-5p 2.879 상향 hsa-miR-6769b-5p 2.822 하향
hsa-miR-379-5p 2.842 상향 hsa-miR-7106-5p 2.805 하향
hsa-miR-187-5p 2.797 상향 hsa-miR-7845-5p 2.794 하향
hsa-miR-376c-3p 2.795 상향 hsa-miR-4669 2.783 하향
hsa-miR-4443 2.701 상향 hsa-miR-4459 2.761 하향
hsa-let-7i-5p 2.680 상향 hsa-miR-937-5p 2.730 하향
hsa-miR-31-3p 2.618 상향 hsa-miR-6776-5p 2.730 하향
hsa-miR-378c 2.604 상향 hsa-miR-6819-5p 2.668 하향
hsa-miR-143-3p 2.576 상향 hsa-miR-8063 2.590 하향
hsa-miR-99a-5p 2.574 상향 hsa-miR-1202 2.585 하향
hsa-miR-34a-5p 2.543 상향 hsa-miR-6771-5p 2.573 하향
hsa-miR-210-3p 2.533 상향 hsa-miR-7114-5p 2.557 하향
hsa-miR-93-5p 2.523 상향 hsa-miR-6127 2.557 하향
hsa-miR-22-3p 2.523 상향 hsa-miR-6871-5p 2.440 하향
hsa-miR-320e 2.515 상향 hsa-miR-6743-5p 2.434 하향
hsa-miR-345-5p 2.510 상향 hsa-miR-5006-5p 2.415 하향
hsa-miR-493-3p 2.508 상향 hsa-miR-663b 2.410 하향
hsa-miR-411-5p 2.503 상향 hsa-miR-4687-3p 2.409 하향
hsa-miR-28-3p 2.489 상향 hsa-miR-197-3p 2.387 하향
hsa-miR-130b-3p 2.487 상향 hsa-miR-149-3p 2.370 하향
hsa-miR-362-5p 2.464 상향 hsa-miR-7162-3p 2.359 하향
hsa-miR-130a-3p 2.388 상향 hsa-miR-6799-5p 2.342 하향
hsa-miR-320d 2.364 상향 hsa-miR-6779-5p 2.340 하향
hsa-miR-19b-3p 2.336 상향 hsa-miR-6794-5p 2.340 하향
hsa-miR-3651 2.333 상향 hsa-miR-4507 2.324 하향
hsa-miR-140-3p 2.320 상향 hsa-miR-6132 2.316 하향
hsa-miR-27a-3p 2.299 상향 hsa-miR-6785-5p 2.291 하향
hsa-miR-425-5p 2.269 상향 hsa-miR-7112-5p 2.279 하향
hsa-miR-503-5p 2.233 상향 hsa-miR-197-5p 2.267 하향
hsa-miR-4269 2.220 상향 hsa-miR-4505 2.262 하향
hsa-miR-127-3p 2.214 상향 hsa-miR-6075 2.253 하향
hsa-miR-4429 2.208 상향 hsa-miR-6756-5p 2.236 하향
hsa-miR-1273g-3p 2.206 상향 hsa-miR-4492 2.198 하향
hsa-miR-106a-5p 2.197 상향 hsa-miR-328-5p 2.171 하향
hsa-miR-27b-3p 2.158 상향 hsa-miR-6802-5p 2.168 하향
hsa-miR-125b-1-3p 2.154 상향 hsa-miR-6869-5p 2.160 하향
hsa-miR-195-5p 2.148 상향 hsa-miR-4758-5p 2.131 하향
hsa-miR-151a-5p 2.117 상향 hsa-miR-504-3p 2.121 하향
hsa-miR-30a-3p 2.115 상향 hsa-miR-3937 2.116 하향
hsa-miR-106b-3p 2.092 상향 hsa-miR-5572 2.092 하향
hsa-miR-532-5p 2.083 상향 hsa-miR-3620-5p 2.038 하향
hsa-miR-660-5p 2.080 상향 hsa-miR-3124-5p 2.028 하향
hsa-miR-138-5p 2.044 상향 hsa-miR-3141 2.026 하향
hsa-miR-20a-5p 2.043 상향 hsa-miR-4485 2.023 하향
hsa-miR-185-5p 2.031 상향 hsa-miR-4649-5p 2.002 하향
hsa-miR-152-3p 2.017 상향
<실험예 3> MSC-NV의 인 비트로 항-염증 효과
MSC 및 MSC에서 유래된 세포 내 내용물이 강력한 항-염증 효과를 나타내는 것은 잘 알려져 있다. 따라서, BMSC-NV 및 ASC-NV의 항-염증 효과는 PREY 트랜스펙션 전에 시험하였다(도 7a). 마우스 단핵구/대식세포(RAW264.7 cells)에 MSC-NV를 처리하여 그들의 염증 반응을 억제하였다. 활성화 대식세포에 의한 MSC-NV의 효과적인 세포성 흡수는 각각 DiO 및 DiI로 세포 및 MSC-NV를 시각화하여 확인하였다(도 7b). ASC-NV 및 BMSC-NV 둘 다 활성화 대식세포에 의해 유사하게 흡수되었다.
BMSC-NV, ASC-NV 및 PMSC-NV의 항-염증 활성은 qRT-PCR(도 7c), 닷 블랏 사이토카인 어레이(도 7d) 및 식균작용 어세이(도 7e)를 통해 분석하였다. 항-염증성 인터루킨-10(IL-10)과 IL-13 유전자 발현은 상향조절되나 전-염증성 마커(IL-1β, TNF-α)는 그렇지 않아, 이는 MSC-NV에 의한 대식세포의 항-염증성 잠재력이 MSC로부터 배출 후에도 유지됨을 나타낸다. 이들 결과는 또한 컨디션드 배지에서 분비된 사이토카인(도 7d) 및 모든 NV 처리군에서 세균성 성분들의 감소된 식균 활성(도 7e)으로 항염증효과를 나타내는 분석에 의해 지지되었다. 산화된 LDL의 uptake 정도를 Oil red O staining으로 (도 7e, 아래패널) BMSC-NV 를 제외한 모든 MSC-NV 에서 산화된 LDL uptake가 낮아진 것을 확인하였으며, 이는 ASC-NV 과 PMSC-NV 의 거품세포의 억제효과를 지지한다. 산화된 LDL의 흡수로 인한 대식세포의 거품세포 형성은 VSMC의 표현형 변화 및 내부성장이 결과적으로 유도되므로 동맥경화 발달의 중요한 부분이다. 이 결과는 MSC-NV가 동맥경화 과정을 예방할 수 있음을 시사하는 것이다.
<실험예 4> MSC-NV의 인 비트로 전-EC 복구 효과
LPS 처리에 의한 불멸화 마우스 대동맥 내피세포(iMAEC)의 전-염증성 기능장애를 활성화시켜 MSC-NV 처리의 EC-복구 효과를 시험하였다(도 8a). ASC-NV 및 BMSC-NV 둘 다 활성화된 iMAEC로의 효과적인 내재화는 각각 DiO 및 DiI로 표지하여 시각화하였다(도 8b). ASC-NV 및 BMSC-NV 간의 NV 흡수에서의 가시적인 차이는 없었다. EC는 E-셀렉틴, ICAM-1 및 VCAM-1를 우세하게 발현하여 기능장애 활성화 시 염증 세포를 동원한다. 따라서, iMAEC에서 이들 마커의 유전자 발현을 qRT-PCR에 의해 측정하면(도 8c), LPS 처리에 의해 모두 상향조절되나, 두 MSC-NV 타입으로 처리하고 심지어 처리하지 않아도 유의적으로 하향조절되어, 이는 두 MSC-NV 타입의 EC-복구 효과를 약속할 뿐만 아니라 100 ng/mL의 LPS에 의한 EC 기능장애의 효과적인 유도를 시사한다. 이 결과는 또한 VCAM-1이 최초 내피 기능장애 마커 중 하나이므로 면역염색으로부터 VCAM-1 단백질 발현에 의해서도 지지되었다(도 8d). 전-EC 복구 효과는 ASC-NV, BMSC-NV, 및 PMSC-NV 중에서 유의적인 차이는 없어(도 9 및 도 10), PREY 트랜스펙션이 MSC-NV의 치료적 효과를 손상시키지 않음을 시사한다.
사이클로스포린 A(CyA) 처리는 혈관형성 EC 활성을 억제하여 맥관 형성을 방해하는 것으로 알려져 있다. 따라서, 마트리젤에서 인간 제대 정맥 내피세포(HUVEC)를 배양한 후 씨딩 후 2시간(도 9) 또는 12시간(도 8e)에 CyA 및 NV를 함께 처리하여 MSC(BMSC 대 ASC)-NV의 전-혈관형성(도 9) 및 전-EC 복구 효과(도 8e)를 시험하였다. 이어서, HUVEC의 맥관 구조 인자(즉, 정션, 마스터 세그먼트, 총 길이 및 익스트림 노드의 수)를 측정하였다. 결과적으로, MSC-NV 처리는 MSC 소스와 상관없이 CyA 처리에 대한 반응으로 HUVEC의 전-EC 복구 및 전-혈관형성 효과를 향상시켰다. 또한, HUVEC에서 PMSC-NV의 전-EC 복구 및 전-혈관형성 효과의 일관성은 씨딩 후 각각 12시간 및 2시간에 CyA 처리 시 확인되었다(도 10).
<실험예 5> 인 비보 타겟팅 및 항-동맥경화 기능
PMSC-NV의 진단치료 효율은 마우스 PCL 모델에서 측정하였다. 4개의 왼쪽 관상동맥(LCA) 가지 중 3개인, 외부 관상동맥(ECA), 내부 관상동맥(ICA) 및 후두 동맥(OA)을 결찰시키면(도 11), 와류 형성이 도플러 초음파 이미징에 의해 확인되었다(도 12). 이어서, 결찰 후 3일 동안 MSC-NV, PMSC-NV, 및 PMSC를 꼬리 정맥을 통해 정맥 내로 주사하였다. 인 비보 이미징 시스템(IVIS)을 사용하여 주사 후 24시간에 그들의 생체 내 분포를 시각화하였다(도 13a-b, 도 14). PMSC-NV의 LCA-타겟팅 효율은 MSC-NV 또는 PMSC보다 더 좋았으며, 이는 PREY 및 NV가 세포의 폐 모세관 포획을 방해하여 와류 부위를 효과적으로 타겟팅하는 상승 작용 역할을 시사한다. 폐 모세관 포획은 전신성 세포 전달을 위한 주요 방해물이다. 본 발명자들의 이전 프로테오믹스 분석으로 PREY의 타겟 분자로서 필라민 A를 동정하였다. RCA 및 LCA를 채취하고 주사 후 24시간에 면역염색하였다(도 13c). 필라민 A 발현은 RCA에서보다 LAC에서 유의적으로 더 높았으며, 이는 PMSC 동원을 위해 와류 부위에서의 그것의 과발현을 확인시켜주는 것이다. NV를 Vivotrack680으로 표지한 시험군 중에서, PMSC-NV만 필라민 A와 함께 명백하게 함께 내재화되었다.
MSC-NV의 항-염증 및 전-EC 복구 효과(도 7a-e, 도 8a-e, 도 9 및 도 10) 및 PREY의 타겟팅 효율(도 13a-c)이 입증되었으므로, 그들의 조합(PMSC-NV)이 동맥경화의 조기 진행을 예방하는 상승적 진단치료 효과를 나타낼 수 있을 것이라는 가설을 세웠다. 본 실험의 이 부분을 위해 PCL 수술을 받은 ApoE KO 마우스를 사용하였다. 이 마우스 균주는 상응하는 정상 균주에 비해 더 공격적인 동맥경화 발생을 보여 주었기 때문이다(도 15). ApoE KO PCL 모델에서 NV 주사 후 11일에 LCA 및 RCA를 채취하면, PMSC-NV는 정상 대조군과 유사한 혈관 형태를 유지하면서 신생혈관형성을 효과적으로 방지하나, 다른 시험군은 명확한 치료 효과를 나타내지 않았다(도 13d 상단 열). 한편, PMSC는 용량이 효율적인 타겟팅을 허용하기에 충분하지 않기 때문에 PMSC-NV에 비해 신생혈관형성을 효과적으로 예방할 수 없었다(도 13b). CD68(도 13d 중간 열) 및 VCAM-1(도 13d 하단 열)의 단백질 발현은 각각 단핵구 동원 및 EC 활성화의 표시로서 측정되었다. PMSC-NV를 처리할 때, 이들의 발현 수준은 전신 순환 후 심장, 폐, 간 및 비장에서 눈에 띄는 독성 효과를 갖지 않는 대조군의 발현 수준으로 감소하였다(도 16). 대조적으로, 다른 시험군은 정상 대조군 및 PMSC-NV 군보다 마커의 발현이 유의하게 더 높았다.
<실험예 6> 인 비보 돼지 PCL 및 인 비트로 인간 EC 모델
전-임상의 큰 동물 모델로, 돼지 PCL 모델을 사용하여 이전에 확립된 방법에 따라 와류 부위에 대한 PMSC-NV의 타겟팅 효율을 확인하였다. 간단히 말해, 스테인리스-스틸 막대(직경=0.9mm)를 LCA(직경=4.5mm)로 단단히 결찰시키고 나서 제거하여(도 17a 상단) LCA의 70-80% 폐색을 유도하였다(도 17b 하단). 결찰된 LCA의 원위 부분에서 와류의 명확한 형성이 도플러 초음파 이미징에 의해 확인되었다(도 17b). 또한, 필라민 A는 RCA 보다 LCA의 내피에서 높게 발현되었다(도 17c). Vivotrack680-표지된 MSC-NV 또는 PMSC-NV를 귀 정맥을 통해 정맥 내로 투여하고 결찰 후 3일 동안 전신 순환시켰다. RCA, LCA 및 대동맥 궁은 각각 NV 주입 후 24시간 또는 21일에 정상, 유도 와류 및 자연 와류 부위로부터 조직 샘플로서 채취하였다. 자연 와류는 곡률과 가지 구조 때문에 대동맥 궁에서 형성된다. IVIS 이미지는 PMSC-NV가 병원성 리모델링의 지표인 LCA의 결찰 점의 원위 영역에 더 많이 축적되나, RCA에서는 관찰되지 않았다(도 17d, 도 18 좌측). 대동맥 궁 샘플에서 PMSC-NV의 IVIS 형광 분포는 MSC-NV와 비교하여 와류 부위와 더 높은 상관 관계를 보였으며, PREY의 효과적인 타겟팅 기능을 나타냈으며(도 17f, 도 18 우측), MSC-NV보다 PMSC-NV에 의한 CD31의 더 큰 공존(도 17e 및 도 17g)에 의해 지지되었다.
마지막으로, 와류 하에서 인간 관상동맥 EC(hCAEC; 도 19a-g) 및 인간 대동맥 EC(hAEC; 도 20)를 타겟으로 하는 PMSC-NV의 효율을 인 비트로 미세유체 모델을 사용하여 측정하였다. 이 미세유체 모델에서, 콜라겐-코팅된 유리 표면 상에 부착된 EC 단층은 펌핑 시스템에 의해 생성된 배지 흐름에 노출되었고, 이는 건강 또는 동맥경화 조건 하에서 혈류를 성공적으로 모방한다. 또한, 이 미세유체 시스템은 인 비보 실험에서 달성하기 어려운 PMSC-NV의 타겟팅 효율뿐만 아니라 타겟팅 부위의 정밀한 관찰이 가능하다. 혈관에서 건강한 상태 및 동맥경화 상태를 모방하기 위해, MSC-NV 처리 전에 EC를 정상(10 dyne/cm2) 또는 와류(1 dne 펄스와 함께 10 dyne/cm2 및 -9 dyne/cm2)에 노출시켰다(도 19a-c). 정상 흐름에 노출된 EC는 흐름 방향에 정렬되어 있음을 확인했지만 와류에 노출된 EC의 경우에는 그렇지 않았다(도 19d). 또한, 필라민 A 발현은 와류 하에서 증가한 반면(도 19e), F-액틴 발현은 정상 흐름 및 와류에 노출된 EC 사이에서 유사하였다(도 19f). 더 중요한 것은 미세유체 모델은 PMSC-NV의 신호가 정상 흐름 조건과 비교하여 필라민 A와의 높은 공존으로 와류 조건(도 20)에서 증가하여 임상 해석 시 PMSC-NV의 진단치료 잠재력을 입증한다는 사실을 밝혀냈다는 것이다.
이상, 본 발명내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다.
본 발명에 따른 와류 부위를 타겟팅할 수 있는 펩타이드를 이용하는 줄기세포 유래 나노베지클은 항-동맥경화 진단치료 플랫폼으로써 중간엽 줄기세포와 유사한 강력한 항-염증 및 전-내피 복구 효과를 제공하는바, 동맥경화의 발병을 예방하고 치료할 수 있는 새로운 진단치료제로써 관련 의료산업 분야에서 유용하게 이용될 수 있을 것으로 기대된다.

Claims (11)

  1. 와류(disturbed blood flow) 부위 타겟팅 펩타이드를 표면에 전시하는 줄기세포 유래의 나노베지클.
  2. 제1항에 있어서,
    와류 부위 타겟팅 펩타이드는 SEQ ID NO: 1 내지 5로 이루어진 군에서 선택되는, 나노베지클.
  3. 제1항에 있어서,
    나노베지클은 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질의 코딩 서열이 순차적으로 삽입된 벡터로 트랜스펙션된 줄기세포에서 유래한 것인, 나노베지클.
  4. 제3항에 있어서,
    트랜스멤브레인 단백질은 CD86, CD105, CD271, CD34 및 CD22로 이루어진 군에서 선택된 하나 이상인, 나노베지클.
  5. 제1항에 있어서,
    줄기세포는 골수, 제대, 제대혈, 태반, 혈액, 피부, 지방조직, 신경조직, 간, 췌담도, 근육 및 양막으로 이루어진 군에서 선택된 1종 이상의 조직 유래의 줄기세포; 중간엽 줄기세포; 배아줄기세포; 및 유도만능줄기세포 중 어느 하나인, 나노베지클.
  6. 시그널 펩타이드-와류 부위 타겟팅 펩타이드-트랜스멤브레인 단백질의 코딩 서열이 순차적으로 삽입된 벡터로 트랜스펙션된 줄기세포에서 와류 부위 타겟팅 펩타이드를 표면에 전시하는 나노베지클을 얻는 단계를 포함하는 제1항의 나노베지클의 제조방법.
  7. 제1항의 나노베지클을 포함하는 동맥경화의 진단용 조성물.
  8. 제1항의 나노베지클을 포함하는 동맥경화의 예방 또는 치료용 조성물.
  9. 제1항의 나노베지클을 개체에 투여하는 단계를 포함하는, 동맥경화의 진단방법.
  10. 제1항의 나노베지클을 개체에 투여하는 단계를 포함하는, 동맥경화의 예방 또는 치료방법.
  11. 제1항에 따른 나노베지클의, 동맥경화의 예방 또는 치료용도.
PCT/KR2020/011581 2019-08-30 2020-08-28 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법 WO2021040473A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP20856044.1A EP4024048A4 (en) 2019-08-30 2020-08-28 METHOD FOR DIAGNOSING AND TREATING ATHEROSCLERosis BY USING A NANOVESICLE TARGET SITE TO ALTER BLOOD FLOW
JP2022513207A JP2022546423A (ja) 2019-08-30 2020-08-28 血流変化部位ターゲッティングナノベシクルを用いた動脈硬化の診断および治療方法
CN202080059655.XA CN114269368A (zh) 2019-08-30 2020-08-28 利用血流变化位点靶向纳米囊泡的动脉硬化的诊断及治疗方法
US17/636,159 US20220290098A1 (en) 2019-08-30 2020-08-28 Method for diagnosing and treating atherosclerosis by using nanovesicle targeting site of change in blood flow

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0107218 2019-08-30
KR1020190107218A KR102255685B1 (ko) 2019-08-30 2019-08-30 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법

Publications (1)

Publication Number Publication Date
WO2021040473A1 true WO2021040473A1 (ko) 2021-03-04

Family

ID=74685234

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/011581 WO2021040473A1 (ko) 2019-08-30 2020-08-28 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법

Country Status (6)

Country Link
US (1) US20220290098A1 (ko)
EP (1) EP4024048A4 (ko)
JP (1) JP2022546423A (ko)
KR (1) KR102255685B1 (ko)
CN (1) CN114269368A (ko)
WO (1) WO2021040473A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023056430A1 (en) * 2021-10-01 2023-04-06 Abcellera Biologics Inc. Transgenic rodents for cell line identification and enrichment

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180003322A (ko) * 2016-06-30 2018-01-09 (주)아모레퍼시픽 성체줄기세포 유래의 엑소좀-모사 나노베지클을 포함하는 혈관 신생 촉진용 조성물

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180003322A (ko) * 2016-06-30 2018-01-09 (주)아모레퍼시픽 성체줄기세포 유래의 엑소좀-모사 나노베지클을 포함하는 혈관 신생 촉진용 조성물

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
"PHYSICIAN'S DESK REFERENCE", MEDICAL ECONOMICS, 2004
FUJITA YU, KADOTA TSUKASA, ARAYA JUN, OCHIYA TAKAHIRO, KUWANO KAZUYOSHI: "Clinical Application of Mesenchymal Stem Cell-Derived Extracellular Vesicle-Based Therapeutics for Inflammatory Lung Diseases", JOURNAL OF CLINICAL MEDICINE, vol. 7, no. 10, 355, 14 October 2018 (2018-10-14), pages 1 - 21, XP055787398, DOI: 10.3390/jcm7100355 *
GUPTA MUKESH K., LEE YUNKI, BOIRE TIMOTHY C., LEE JUNG-BOK, KIM WON SHIK, SUNG HAK-JOON: "Recent strategies to design vascular theranostic nanoparticles", NANOTHERANOSTICS, vol. 1, no. 2, 6 April 2017 (2017-04-06), pages 166 - 177, XP055787408, ISSN: 2206-7418, DOI: 10.7150/ntno.18531 *
HOFMEISTER LUCAS H., LEE SUE HYUN, NORLANDER ALLISON E., MONTANIEL KIM RAMIL C., CHEN WEI, HARRISON DAVID G., SUNG HAK-JOON ACS NA: "Phage-Display-Guided Nanocarrier Targeting to Atheroprone Vasculature", ACS NANO, vol. 9, no. 4, 13 March 2015 (2015-03-13), pages 4435 - 4446, XP055787394, DOI: 10.1021/acsnano.5b01048 *
KELLEY WILLIAM J., SAFARI HANIEH, LOPEZ-CAZARES GENESIS, ENIOLA-ADEFESO OMOLOLA: "Vascular‐targeted nanocarriers: design considerations and strategies for successful treatment of atherosclerosis and other vascular diseases", NANOMEDICINE AND NANOBIOTECHNOLOGY, vol. 8, no. 6, 19 May 2016 (2016-05-19), United States, pages 909 - 926, XP055787402, ISSN: 1939-5116, DOI: 10.1002/wnan.1414 *
MARTIN: "REMINGTON'S PHARM. SCI", 1995, MACK PUBL. CO.
See also references of EP4024048A4
SEI, Y. J. ET AL., SCI REP, vol. 7, 2017, pages 10019

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023056430A1 (en) * 2021-10-01 2023-04-06 Abcellera Biologics Inc. Transgenic rodents for cell line identification and enrichment

Also Published As

Publication number Publication date
CN114269368A (zh) 2022-04-01
KR20210026435A (ko) 2021-03-10
EP4024048A1 (en) 2022-07-06
JP2022546423A (ja) 2022-11-04
EP4024048A4 (en) 2023-12-20
KR102255685B1 (ko) 2021-05-25
US20220290098A1 (en) 2022-09-15

Similar Documents

Publication Publication Date Title
US11167044B2 (en) Regenerating functional neurons for treatment of disease in the nervous system
JP6199936B2 (ja) 骨髄間葉系および／または多能性幹細胞の血中動員による組織再生促進剤
US20230330268A1 (en) Materials and methods for delivering nucleic acids to cochlear and vestibular cells
US9913864B2 (en) Compositions and methods for cardiac tissue repair
WO2015194753A1 (ko) Cpne7 단백질을 포함하는 비치계 중간엽 줄기세포의 상아모세포로의 분화방법, 조성물 및 이를 이용한 치수조직 재생 및 상아질 지각과민증 치료용 약학적 조성물
US8309070B2 (en) Use of umbilical cord blood stem cells to treat ischemic event
WO2022097984A1 (ko) 3 차원 스페로이드형 세포 응집체 유래 세포외소포의 제조방법
WO2021040473A1 (ko) 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법
JP6474549B2 (ja) 幹細胞の培養産物の評価指標及びその利用
WO2022065919A1 (ko) 펩티드 핵산 복합체를 유효성분으로 함유하는 치매 예방 또는 치료용 조성물
CA2837898C (en) Method of treating the effects of stroke
US20220249570A1 (en) Nanovesicles from adult stem cells and its use for targeted therapy
WO2021125762A1 (ko) 혈뇌장벽 투과능을 가지는 펩티드 핵산 복합체를 유효성분으로 함유하는 치매 예방 또는 치료용 조성물
JP7193849B2 (ja) 虚血組織に集積するエクソソームおよびその製造方法
WO2020071652A1 (ko) 세포의 텔로미어를 신장시키는 방법
WO2020106097A1 (ko) 중간엽 줄기세포를 포함하는 지방 생성을 억제하기 위한 조성물
WO2019088772A2 (ko) 허혈성 심혈관 질환의 치료용 또는 예방용 약학 조성물
WO2021125841A1 (ko) 염기성 나선-고리-나선(basic helix-loop-helix; bhlh) 계열의 신경형성 전사인자 유전자가 도입된 성체 줄기세포주를 포함하는 동맥 투여용 약학적 조성물
WO2023038479A1 (ko) 생체분자의 안정적 발현 및 전달을 위한 플라스미드 플랫폼
WO2022235085A1 (ko) 3차원 스페로이드형 세포 응집체 유래 세포외소포를 포함하는 혈관신생촉진용 조성물
US20220378841A1 (en) Modified cells and related methods
Petrou Combined Cell and Gene Therapy towards the Treatment of Age-related Macular Degeneration and Diabetic Retinopathy
CN116585460A (zh) α1-抗胰蛋白酶与内源性大麻素受体2在药物中的应用
CA3235445A1 (en) Novel anellovector compositions and methods
JP2002532117A (ja) 任意に活性物質をコードする遺伝子が移入された哺乳類細胞の調製物、及びそれらを含有する調製物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20856044

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022513207

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020856044

Country of ref document: EP

Effective date: 20220330