WO2020261227A1 - Micellar nanoparticles and uses thereof - Google Patents

Micellar nanoparticles and uses thereof Download PDF

Info

Publication number
WO2020261227A1
WO2020261227A1 PCT/IB2020/056093 IB2020056093W WO2020261227A1 WO 2020261227 A1 WO2020261227 A1 WO 2020261227A1 IB 2020056093 W IB2020056093 W IB 2020056093W WO 2020261227 A1 WO2020261227 A1 WO 2020261227A1
Authority
WO
WIPO (PCT)
Prior art keywords
cationic carrier
micelle
aspects
carrier unit
moiety
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2020/056093
Other languages
English (en)
French (fr)
Inventor
Jin-Hyeob RYU
Yu Na Lim
Hyun Su Min
Han Seok Koh
Dae Hoon Kim
Hyun-Jeong CHO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biorchestra Co Ltd
Original Assignee
Biorchestra Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020227002029A priority Critical patent/KR102658962B1/ko
Priority to KR1020247009114A priority patent/KR20240039234A/ko
Priority to BR112021026365A priority patent/BR112021026365A2/pt
Priority to DK20831649.7T priority patent/DK3990028T3/da
Priority to US17/622,518 priority patent/US20220257790A1/en
Priority to MX2022000045A priority patent/MX2022000045A/es
Priority to CN202080057979.XA priority patent/CN114514038B/zh
Priority to JP2021577297A priority patent/JP7665540B2/ja
Priority to AU2020303447A priority patent/AU2020303447A1/en
Priority to PE2021002229A priority patent/PE20220902A1/es
Priority to CA3144333A priority patent/CA3144333A1/en
Application filed by Biorchestra Co Ltd filed Critical Biorchestra Co Ltd
Priority to EP20831649.7A priority patent/EP3990028B1/en
Priority to EP25172311.0A priority patent/EP4603589A3/en
Publication of WO2020261227A1 publication Critical patent/WO2020261227A1/en
Priority to US17/502,923 priority patent/US11839624B2/en
Priority to IL289258A priority patent/IL289258A/en
Anticipated expiration legal-status Critical
Priority to CONC2022/0000316A priority patent/CO2022000316A2/es
Priority to US18/503,748 priority patent/US20240173348A1/en
Priority to JP2025064597A priority patent/JP2025106480A/ja
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/107Emulsions ; Emulsion preconcentrates; Micelles
    • A61K9/1075Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542Carboxylic acids, e.g. a fatty acid or an amino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/045Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/07Retinol compounds, e.g. vitamin A
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/3533,4-Dihydrobenzopyrans, e.g. chroman, catechin
    • A61K31/355Tocopherols, e.g. vitamin E
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • A61K31/375Ascorbic acid, i.e. vitamin C; Salts thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41881,3-Diazoles condensed with other heterocyclic ring systems, e.g. biotin, sorbinil
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4415Pyridoxine, i.e. Vitamin B6
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/455Nicotinic acids, e.g. niacin; Derivatives thereof, e.g. esters, amides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A61K31/51Thiamines, e.g. vitamin B1
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/525Isoalloxazines, e.g. riboflavins, vitamin B2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/59Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • A61K31/5929,10-Secoergostane derivatives, e.g. ergocalciferol, i.e. vitamin D2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/59Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • A61K31/5939,10-Secocholestane derivatives, e.g. cholecalciferol, i.e. vitamin D3
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7135Compounds containing heavy metals
    • A61K31/714Cobalamins, e.g. cyanocobalamin, i.e. vitamin B12
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A61K47/183Amino acids, e.g. glycine, EDTA or aspartame
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/22Heterocyclic compounds, e.g. ascorbic acid, tocopherol or pyrrolidones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/58Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. poly[meth]acrylate, polyacrylamide, polystyrene, polyvinylpyrrolidone, polyvinylalcohol or polystyrene sulfonic acid resin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A61K47/6455Polycationic oligopeptides, polypeptides or polyamino acids, e.g. for complexing nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6907Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a microemulsion, nanoemulsion or micelle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants

Definitions

  • Polynucleotides do not readily permeate the cellular membrane due to the charge repulsion between the negatively charged membrane and the high negative charge on the polynucleotide. As a result, polynucleotides have poor bioavailability and uptake into cells, typically less than 1% (Dheur et al, Nucleic Acid Drug Dev., 9:522 (1999); Park et al, J Controlled Release, 93: 188 (2003)). Since most polynucleotides are generally above 5,000 Da, they cannot readily diffuse through cellular membranes and uptake into cells is limited primarily to pinocytotic or endocytotic processes.
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefmic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(a- hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises:
  • the water-soluble polymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.
  • the nucleoside analog comprises Locked Nucleic Acid (LNA); 2'-0-alkyl-RNA; 2'-amino-DNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'-MOE), or any combination thereof.
  • LNA Locked Nucleic Acid
  • 2'-0alkyl-RNA 2'-amino-DNA
  • 2'-fluoro-DNA arabino nucleic acid
  • ANA arabino nucleic acid
  • INA intercalating nucleic acid
  • cEt constrained ethyl nucleoside
  • 2'-OMe 2'-0-methyl nucleic acid
  • the nucleic acid comprises a nucleotide sequence having 5 to 30 nucleotides in length. In some aspects, the nucleotide sequence is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some aspects, the nucleotide sequence has a backbone, which comprises a phosphodiester linkage, a phosphotriester linkage, a methylphosphonate linkage, a phosphoramidate linkage, a phosphorothioate linkage, and combinations thereof. In some aspects, the cationic carrier unit further comprises a targeting moiety, which is linked to the water soluble polymer optionally via a linker.
  • the present disclosure also provides a method to improve cognitive function in a subject suffering from a neurodegenerative disease comprising administering a therapeutically effective amount of a micelle disclosed herein to the subject.
  • the micelle comprises a cationic carrier unit targeting LAT1 and a payload comprising an antisense oligonucleotide targeting miRNA-485-3p, e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a fragment, variant, or derivative thereof.
  • the fragment comprises 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 18.
  • the variant has at least 70% sequence identity to SEQ ID NO: 18.
  • the derivative comprises at least one sugar modification and/or at least one backbone modification.
  • the exemplary carrier units comprise an optional tissue-specific targeting moiety, water soluble polymer, and cationic or anionic carrier unit (which can, respectively, interact with anionic or cationic payloads).
  • the cationic/anionic carrier and anionic/cationic payload are not tethered and interact electrostatically.
  • the cationic/anionic carrier and anionic/cationic payload are tethered and interact electrostatically.
  • the adjuvant moiety that can be between the water-soluble polymer and cationic/anionic carrier, or terminally after the cationic/anionic carrier, is not depicted in the drawing.
  • FIG. 2 shows an alternative method for loading neutral payload using the carrier units of the present disclosure in which the neutral payload (e.g a hydrophobic therapeutic agent) is covalently attached to an adapter, which in turn can interact electrostatically with the cationic or anionic carrier moiety of the carrier unit.
  • the neutral payload e.g a hydrophobic therapeutic agent
  • the example presented includes a cationic carrier moiety, which can interact electrostatically with anionic payloads, e.g., nucleic acids such as antisense oligonucleotides targeting a gene, e.g, miRNA (antimirs).
  • anionic payloads e.g., nucleic acids such as antisense oligonucleotides targeting a gene, e.g, miRNA (antimirs).
  • AM can be located between WP and CC.
  • the CC and AM components are portrayed in a linear arrangement for simplicity. However, as exemplified in FIG. 4, CC and AM can be arranged in a scaffold fashion.
  • FIG. 11 shows LAT1 expression levels in vivo in different mouse tissues.
  • FIG. 16 shows brain accumulation of anti-miRNA loaded micelles of the present disclosure (ASO-MDS) compared to naked anti-miRNA administration (naked ASO).
  • ASO-MDS anti-miRNA loaded micelles of the present disclosure
  • naked ASO naked anti-miRNA administration
  • FIG. 23A shows that ASO-MDS delivery improves cognitive function (Y maze) in 5XFAD mice.
  • FIG. 23B shows that ASO-MDS delivery improves cognitive function (passive avoidance test) in 5XFAD mice.
  • ASO left mice
  • ASO-MDS Cy5.5 labeled anti-microRNA loaded micelle
  • downstream refers to a nucleotide sequence that is located 3’ to a reference nucleotide sequence.
  • downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
  • Calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g, gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared.
  • Suitable software programs are available from various sources, and for alignment of both protein and nucleotide sequences.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • MAFFT Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g, a fraction) of a composition of the present disclosure from a sample containing contaminants.
  • an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount.
  • an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity.
  • the isolated composition is enriched as compared to the starting material from which the composition is obtained. This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material.
  • the term "linked” as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • miRNA or “miR” or “microRNA” are used interchangeably and refer to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. Names of miRNAs and their sequences related to the present disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression. Conversely, targeting miRNAs via molecules comprising a miRNA binding site (generally a molecule comprising a sequence complementary to the seed region of the miRNA) can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.
  • a miRNA binding site generally a molecule comprising a sequence complementary to the seed region of the miRNA
  • mismatch refers to one or more nucleobases (whether contiguous or separate) in an oligomer nucleobase sequence that are not matched to a target pre- mRNA according to base pairing rules. While perfect complementarity is often desired, some aspects can include one or more but preferably 6, 5, 4, 3, 2, or 1 mismatches with respect to the target pre-mRNA. Variations at any location within the oligomer are included. In certain aspects, antisense oligomers of the disclosure include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunits of the 5' and/or 3' terminus. In certain aspects, one, two, or three nucleobases can be removed and still provide on-target binding.
  • Nucleic acid refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.
  • RNA molecules phosphate ester polymeric form of ribonucleosides
  • deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine
  • DNA molecules or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi -synthetic DNA.
  • a "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein.
  • the term "pharmaceutical composition” refers to one or more of the compounds described herein, such as, e.g ., a micelle of the present disclosure, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically-acceptable carriers and excipients.
  • a pharmaceutical composition is to facilitate administration of preparations of micelles to a subject.
  • polynucleotide refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single- stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • DNA triple-, double- and single-stranded deoxyribonucleic acid
  • RNA triple-, double- and single- stranded ribonucleic acid
  • polyribonucleotides containing D-ribose
  • D-ribose polyribonucleotides
  • tRNA rRNA
  • hRNA hRNA
  • siRNA mRNA
  • polymers containing normucleotidic backbones for example, polyamide (e.g ., peptide nucleic acids "PNAs”) and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
  • PNAs peptide nucleic acids
  • a polynucleotide can be, e.g., an oligonucleotide, such as an antisense oligonucleotide.
  • the oligonucleotide is an RNA.
  • the RNA is a synthetic RNA.
  • the synthetic RNA comprises at least one unnatural nucleobase.
  • all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g, all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g, 5-methoxyuridine).
  • polypeptide polypeptide
  • peptide protein
  • protein polymers of amino acids of any length.
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • polypeptide refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly, disulfide linkages are found in multichain polypeptides.
  • the term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to 50 amino acids long, e.g, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • prevent refers partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment.
  • prophylactic refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • a “prophylaxis” refers to a measure taken to maintain health and prevent or delay the onset of a bleeding episode, or to prevent or delay symptoms associated with a disease or condition.
  • similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the amino acids are compared, e.g, according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
  • the phrase "subject in need thereof includes subjects, such as mammalian subjects, that would benefit from administration of a micelle of the disclosure, e.g, to improve hemostasis.
  • systemic administration means the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
  • therapeutically effective amount is the amount of reagent or pharmaceutical compound comprising a micelle of the present disclosure that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a "prophylactically effective amount” as prophylaxis can be considered therapy.
  • Carrier units of the present disclosure comprise a water-soluble biopolymer moiety (e.g, PEG) and a charged carrier moiety.
  • the charged carrier moiety is cationic (e.g, a polylysine), whereas in other aspects the charged carrier moiety is anionic (e.g, a polyglutamic acid) as exemplified in FIG. 1.
  • Carrier units of the present disclosure can be used to deliver charged payloads (e.g, therapeutic or diagnostic agents).
  • Carrier units with a cationic charged carrier moiety can be used for the delivery of anionic payloads, e.g, polynucleotides.
  • Carrier units with an anionic charged carrier moiety can be used for the delivery of cationic payloads, e.g, positively charged small molecule drugs. See FIG. 1.
  • the resulting carrier unit:payload complex is amphipathic, having a hydrophilic
  • head comprising the water-soluble biopolymer moiety and a hydrophobic "tail” comprising the charged carrier moiety electrostatically bound to the payload.
  • Carrier unit:payload complexes can self-associate, alone or in combination with other amphipathic molecules, to yield micelles in which the payload is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent.
  • micelles of the present disclosure encompasses not only classic micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes. Given that polymersomes comprise a luminal space, it is to be understood that all the disclosures related to the "core" of classic micelles are equally applicable to the luminal space in polymersomes comprising carrier units of the present disclosure.
  • the micelles of the present disclosure can comprise payload molecules attached to carrier units of the present disclosure and payload molecules in the luminal space of the micelle (e.g, the lumen of a polymersome).
  • the payload attached to the carrier units and the payload in the luminal space are the same.
  • the payload attached to the carrier units and the payload in the luminal space are different.
  • the carrier units of the present disclosure can also comprise an adjuvant moiety covalently linked to the charged carrier moiety.
  • the adjuvant moiety can serve a dual purpose: it can provide charges for the electrostatic interaction with the payload and/or can have, e.g, a therapeutic, a co-therapeutic effect, or positively affect the homeostasis of the target cell or target tissue.
  • the payload is not covalently linked to the carrier unit.
  • the payload can be covalently linked to the carrier unit, e.g, a linker such as cleavable linker.
  • the present disclosure provides cationic carrier units of Schema I or Schema II
  • the present disclosure also provides anionic carrier units of Schema III or Schema
  • the present disclosure also provides cationic and anionic carrier units of Schemas
  • AM is an adjuvant moiety
  • L3 is an optional linker that can be cleavable
  • (i) / is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200;
  • m is an integer between 1 to 150, e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150; and,
  • the micelle of the present disclosure comprises a first type of cationic carrier units conjugated to a vitamin, e.g., vitamin B3, a second type of cationic carrier units conjugated to a sulfanyl group (e.g., alkanethiols or alkyl thiols); and a third type of cationic carrier units that are a free base.
  • a vitamin e.g., vitamin B3
  • a second type of cationic carrier units conjugated to a sulfanyl group e.g., alkanethiols or alkyl thiols
  • a third type of cationic carrier units that are a free base.
  • the cationic carrier unit comprises:
  • the vitamin B3 unit are introduced into the side chains of the CC moiety, e.g, by a coupling reaction between NH 2 groups in the lysines and COOH groups of vitamin B3, in the presence of suitable conjugation reagents, for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • suitable conjugation reagents for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • the PPG is a Star PPG.
  • Star PPGs have 10 to 100 PPG chains emanating from a central core group.
  • the PPG is a Comb PPGs .
  • Comb PPGs have multiple PPG chains normally grafted onto a polymer backbone.
  • the cationic carrier comprises one or more basic amino acids (e.g, lysine, arginine, histidine, or a combination thereof). In some aspects, the cationic carrier comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46,
  • the cationic carrier
  • the cationic carrier unit comprises about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 900, about 200 to about 800, about 200 to about 700, about 200 to about 600, about 200 to about 500, about 200 to about 400, about 200 to about 300, about 300 to about 1000, about 300 to about 900, about 300 to about 800, about 300 to about 700, about 300 to about 600, about 300 to about 500, about 300 to about 400, about 400 to about 1000, about 400 to about 900, about 400 to about 800, about 400 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 600, about 600 to about 1000, about 600 to about 900, about 600 to about 800, about 600 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 600, about 600
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P) is about 1.3 to about 1.7, e.g., about 1.5.
  • a role of the cationic carrier moiety is to neutralize negative charges on the payload (e.g, negative changes in the phosphate backbone of an antisense oligonucleotide) via electrostatic interaction, in some aspects (e.g, when the payload is a nucleic acid such as an antimir), the length of the cationic carrier, number of positively charged groups on the cationic carrier, and distribution and orientation of charges present on the cationic carrier will depend on the length and charge distribution on the payload molecule.
  • the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4- aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl -alanine, L-trans-4- aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4- guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolysine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof.
  • the cationic carrier comprises a polymer or copolymer comprising at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63,
  • the cationic carrier moiety binds to a single payload molecule. In other aspects, a cationic carrier moiety can bind to multiple payload molecules, which may be identical or different.
  • A is tryptophan or phenylalanine
  • B is a cationic carrier moiety, e.g., lysine, wherein,
  • (i) / is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200;
  • m is an integer between 1 to 150, e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150; and,
  • n is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200; and wherein wherein Y 1 is C, N, O, or S, and Y 2 is C, N O, or S, and n is 1 or 2.
  • X can be -SH (e.g., sulfanyl group, alkanethiols or alkyl thiols).
  • the micelle of the present disclosure comprises one type of cationic carrier units conjugated to a vitamin, e.g., vitamin B3, and another type of cationic carrier units conjugated to a sulfanyl group (e.g., alkanethiols or alkyl thiols).
  • cationic carrier units of the present disclosure used for the treatment of disease or conditions related to low serotonin levels comprise tryptophan as an adjuvant moiety.
  • an adjuvant moiety can modulate a tumor microenvironment in a subject with a tumor, for example, by inhibiting or reducing hypoxia in the tumor microenvironment.
  • the adjuvant moiety comprises, e.g, an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • each of G 1 and G 2 is independently H, an aromatic ring, or 1-10 alkyl, or Gi and G 2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises an amino acid. In some aspects, the adjuvant moiety comprises
  • the vitamin is vitamin B3 (also known as niacin or nicotinic acid).
  • the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 vitamin B3.
  • the adjuvant moiety comprises about 10 vitamin B3.
  • the adjuvant moiety comprises about 7 vitamin B3.
  • the adjuvant moiety comprises about 8 vitamin B3. In some aspects, the adjuvant moiety comprises about 9 vitamin B3. In some aspects, the adjuvant moiety comprises about 10 vitamin B3.In some aspects, the adjuvant moiety comprises about 11 vitamin B3. In some aspects, the adjuvant moiety comprises about 12 vitamin B3. In some aspects, the adjuvant moiety comprises about 13 vitamin B3. In some aspects, the adjuvant moiety comprises about 14 vitamin B3. In some aspects, the adjuvant moiety comprises about 15 vitamin B3. In some aspects, the adjuvant moiety comprises about 20 vitamin B3. In some aspects, the adjuvant moiety comprises about 25 vitamin B3. In some aspects, the adjuvant moiety comprises about 30 vitamin B3.
  • Niacin is a precursor of the coenzymes nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP) in vivo.
  • NAD converts to NADP by phosphorylation in the presence of the enzyme NAD+ kinase.
  • NADP and NAD are coenzymes for many dehydrogenases, participating in many hydrogen transfer processes.
  • NAD is important in catabolism of fat, carbohydrate, protein, and alcohol, as well as cell signaling and DNA repair, and NADP mostly in anabolism reactions such as fatty acid and cholesterol synthesis.
  • High energy requirements (brain) or high turnover rate (gut, skin) organs are usually the most susceptible to their deficiency.
  • Niacin produces marked anti-inflammatory effects in a variety of tissues - including the brain, gastrointestinal tract, skin, and vascular tissue - through the activation of NIACR1. Niacin has been shown to attenuate neuroinflammation and may have efficacy in treating neuroimmune disorders such as multiple sclerosis and Parkinson's disease. See Offermanns & Schwaninger (2015) Trends in Molecular Medicine 21 :245-266; Chai et al (2013) Current Atherosclerosis Reports 15:325; Graff et al. (2016) Metabolism 65: 102-13; and Wakade & Chong (2014) Journal of the Neurological Sciences 347:34-8, which are herein incorporated by reference in their entireties.
  • B is a cationic carrier moiety, e.g., lysine, and
  • l is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200;
  • m is an integer between 1 to 150, e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150; and,
  • n is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200.
  • the carrier units of the present disclosure comprise: wherein X is vitamin B3;
  • A is a targeting moiety
  • B is a cationic carrier moiety, e.g., lysine, and
  • l is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200;
  • m is an integer between 1 to 150, e.g., about 2 and about 10, about 10 and about 20, about
  • X 2 is SH.
  • the cationic carrier unit comprises a targeting moiety, which is linked to the water-soluble polymer optionally via a linker.
  • targeting moiety refers to a biorecognition molecule that binds to a specific biological substance or site.
  • the targeting moiety is specific for a certain target molecule (e.g ., a ligand targeting a receptor, or an antibody targeting a surface protein), tissue (e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g, liver, brain, or endothelium), or facilitate transport through a physiological barrier (e.g, a peptide or other molecule that may facilitate transport across the brain blood barrier or plasma membrane).
  • a certain target molecule e.g ., a ligand targeting a receptor, or an antibody targeting a surface protein
  • tissue e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g, liver, brain, or endothelium
  • a physiological barrier e.g, a peptide or other molecule that may facilitate transport across the brain blood barrier or plasma membrane.
  • a targeting moiety can be coupled to a cationic carrier unit, and therefore, to the external surface of a micelle, whereas the micelle has the payload entrapped within its core.
  • the targeting moiety is a targeting moiety capable of targeting the micelle of the present disclosure to a tissue.
  • the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.
  • the tissue is cancer tissue, e.g, liver cancer, brain cancer, kidney cancer, lung cancer, ovary cancer, pancreas cancer, thyroid cancer, breast cancer, stomach cancer, or any combination thereof.
  • the tissue is liver.
  • the targeting moiety targeting liver is cholesterol.
  • the targeting moiety targeting liver is a ligand that binds an asialoglycoprotein receptor targeting moiety.
  • the asialoglycoprotein receptor targeting moiety comprises a GalNAc cluster.
  • the GalNAc cluster is a monovalent, divalent, trivalent, or tetravalent GalNAc cluster.
  • the tissue is pancreas.
  • the targeting moiety targeting pancreas comprises a ligand targeting anb3 integrin receptors on pancreatic cells.
  • the targeting moiety comprises an arginylglycylaspartic acid (RGD) peptide sequence (L-Arginyl-Glycyl-L-Aspartic acid; Arg-Gly-Asp).
  • the tissue is a tissue in the central nervous system, e.g., neural tissue.
  • the targeting moiety targeting the central nervous system is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 Small-neutral Amino Acid Transporter 1
  • SLC7A5 is a transporter for both the uptake of large neutral amino acids and a number of pharmaceutical drugs.
  • LAT1 can transport drugs such as L-dopa or gabapentin.
  • a targeting moiety comprises glucose, e.g., D-glucose, which can bind to Glucose transporter 1 (or GLUT1) and cross BBB.
  • GLUT1 also known as solute carrier family 2, facilitated glucose transporter member 1 (SLC2A1), is a uniporter protein that in humans is encoded by the SLC2A1 gene.
  • SLC2A1 facilitated glucose transporter member 1
  • GLUT1 facilitates the transport of glucose across the plasma membranes of mammalian cells. This gene encodes a major glucose transporter in the mammalian blood-brain barrier.
  • An acetylcholinesterase inhibitor is the inhibitor that inhibits acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia and neuromuscular junctions, which are rich in acetylcholine receptors.
  • Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors; the other being butyryl-cholinesterase inhibitors.
  • a targeting moiety is GABA, which can bind to GABA receptors to cross BBB.
  • GABA receptors are a class of receptors that respond to the neurotransmitter gamma-aminobutyric acid (GABA), the chief inhibitory compound in the mature vertebrate central nervous system.
  • GABAA and GABAB There are two classes of GABA receptors: GABAA and GABAB.
  • GABAA receptors are ligand-gated ion channels (also known as ionotropic receptors); whereas GABAB receptors are G protein-coupled receptors, also called metabotropic receptors.
  • a targeting moiety comprises tyrosine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises lysine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises glutamine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises phenylalanine, which can bind to GABA receptors, LAT1, CNS reverse transcriptase inhibitors, and/or dopamine (DA) receptors and cross BBB.
  • Dopamine receptors are a class of G protein-coupled receptors that are prominent in the vertebrate central nervous system (CNS). Dopamine receptors activate different effectors through not only G-protein coupling, but also signaling through different protein (dopamine receptor-interacting proteins) interactions.
  • the neurotransmitter dopamine is the primary endogenous ligand for dopamine receptors.
  • Dopamine receptors are implicated in many neurological processes, including motivation, pleasure, cognition, memory, learning, and fine motor control, as well as modulation of neuroendocrine signaling. Abnormal dopamine receptor signaling and dopaminergic nerve function is implicated in several neuropsychiatric disorders. Thus, dopamine receptors are common neurologic drug targets; antipsychotics are often dopamine receptor antagonists while psychostimulants are typically indirect agonists of dopamine receptors.
  • a targeting moiety comprises isoleucine, which can bind to CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises Glutathione, which can bind to GSH transporter and cross BBB.
  • a targeting moiety comprises Glutathione-Met, which can bind to GSH transporter and cross BBB.
  • a targeting moiety comprises Urea/Thiourea, which can bind to Nitric oxide synthase (NOS) and bind to BBB.
  • a targeting moiety comprises NAD+/NADH, which is capable of crossing BBB by REDOX mechanism.
  • a targeting moiety comprises purine and can cross BBB.
  • the amino acid is valine, leucine, and/or isoleucine. In some aspects, the amino acid is tryptophan and/or tyrosine. In some aspects, the amino acid is tryptophan. In other aspects, the amino acid is tyrosine.
  • the LAT1 ligand is [1] 1-Phenylalanine, [2] o-Sarcolysin, [3] m-
  • the LAT1 ligand is a LAT1 -targeting prodrug shown below .
  • A is tryptophan or phenylalanine
  • B is a cationic carrier moiety, e.g., lysine wherein,
  • l is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200;
  • m is an integer between 1 to 150, e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150; and,
  • n is an integer between about 1 and about 200; e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150, about 150 and about 160, about 160 and about 170, about 170 and about 180, about 180 and about 190, or about 190 and about 200;
  • X is and n is 1 or 2; Y 1 is C, N, O, or S, and Y 2 is C, N O, or S, and n is 1 or 2, e.g., vi tamin B3.
  • A is tryptophan or phenylalanine
  • B is a cationic carrier moiety, e.g., lysine, wherein,
  • (iii) k is an integer between 1 to 150, e.g., about 2 and about 10, about 10 and about 20, about 20 and about 30, about 30 and about 40, about 40 and about 50, about 50 and about 60, about 60 and about 70, about 70 and about 80, about 80 and about 90, about 90 and about 100, about 100 and about 110, about 110 and about 120, about 120 and about 130, about 130 and about 140, about 140 and about 150; and,
  • a ligand When applied to the micelles of the present disclosure a ligand includes an antigen or hapten that is capable of being bound by, or to, its corresponding antibody or fraction thereof. Also included are viral antigens or hemagglutinins and neuraminidases and nucleocapsids including those from any DNA and RNA viruses, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses and viroids; any bacterial antigens including those of gram-negative and gram-positive bacteria, Acinetobacter , Achromobacter ,
  • Other substances that can function as ligands for targeting a micelle of the present disclosure are certain vitamins (i.e. folic acid, B12), steroids, prostaglandins, carbohydrates, lipids, antibiotics, drugs, digoxins, pesticides, narcotics, neuro-transmitters, and substances used or modified such that they function as ligands.
  • the targeting moiety comprises a protein or protein fragment (e.g, hormones, toxins), and synthetic or natural polypeptides with cell affinity.
  • Ligands also include various substances with selective affinity for ligators that are produced through recombinant DNA, genetic and molecular engineering. Except when stated otherwise, ligands of the instant disclosure also include ligands as defined in U.S. Pat. No. 3,817,837, which is herein incorporated by reference in its entirety. ii. Ligators
  • a ligator functions as a type of targeting moiety defined for this disclosure as a specific binding body or "partner" or “receptor,” that is usually, but not necessarily, larger than the ligand it can bind to.
  • a ligator can be a specific substance or material or chemical or “reactant” that is capable of selective affinity binding with a specific ligand.
  • a ligator can be a protein such as an antibody, a nonprotein binding body, or a "specific reactor.”
  • the targeting moiety is an antibody or a molecule comprising an antigen binding fragment thereof.
  • the antibody is a nanobody.
  • the antibody is an ADC.
  • antibody-drug conjugate and “ADC” are used interchangeably and refer to an antibody linked, e.g, covalently, to a therapeutic agent (sometimes referred to herein as agent, drug, or active pharmaceutical ingredient) or agents.
  • the targeting moiety is an antibody-drug conjugate.
  • Other ligators also include enzymes, especially cell surface enzymes such as neuraminidases, plasma proteins, avidins, streptavidins, chalones, cavitands, thyroglobulin, intrinsic factor, globulins, chelators, surfactants, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.
  • enzymes especially cell surface enzymes such as neuraminidases, plasma proteins, avidins, streptavidins, chalones, cavitands, thyroglobulin, intrinsic factor, globulins, chelators, surfactants, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.
  • Targeting moieties also include various substances such as any proteins, protein fragments or polypeptides with affinity for the surface of any cells, tissues or microorganisms that are produced through recombinant DNA, genetic and molecular engineering.
  • the targeting moiety directs a micelle of the present disclosure to a specific tissue (i.e., liver tissue or brain tissue), to a specific type of cell (e.g ., a certain type of cancer cells), or to a physiological compartment or physiological barrier (e.g., the BBB).
  • tissue i.e., liver tissue or brain tissue
  • a specific type of cell e.g a certain type of cancer cells
  • a physiological compartment or physiological barrier e.g., the BBB
  • a cationic carrier unit disclosed herein can comprise, as shown, e.g, in FIG. 3, one or more linkers.
  • linker refers to a peptide or polypeptide sequence (e.g, a synthetic peptide or polypeptide sequence), or a non-peptide linker for which its main function is to connect two moieties in a cationic carrier unit disclosed herein.
  • cationic carrier units of the present disclosure can comprise at least one linker connecting a tissue-specific targeting moiety (TM) with a water soluble polymer (WS), at least one linker connecting a water-soluble biopolymer (WP) with cationic carrier (CC) or an adjuvant moiety (AM), at least one linker connecting a cationic carrier (CC) with an adjuvant moiety (AM), or any combination thereof.
  • two or more linkers can be linked in tandem.
  • each of the linkers can be the same or different.
  • linkers provide flexibility to the cationic carrier unit.
  • Linkers are not typically cleaved; however, in certain aspects, such cleavage can be desirable.
  • a linker can comprise one or more protease-cleavable sites, which can be located within the sequence of the linker or flanking the linker at either end of the linker sequence.
  • the peptide linker can comprise at least about 110, at least about
  • the peptide linker can comprise at least about 200, at least about
  • the peptide linker can comprise between 1 and about 5 amino acids, between 1 and about 10 amino acids, between 1 and about 20 amino acids, between about 10 and about 50 amino acids, between about 50 and about 100 amino acids, between about 100 and about 200 amino acids, between about 200 and about 300 amino acids, between about 300 and about 400 amino acids, between about 400 and about 500 amino acids, between about 500 and about 600 amino acids, between about 600 and about 700 amino acids, between about 700 and about 800 amino acids, between about 800 and about 900 amino acids, or between about 900 and about 1000 amino acids.
  • the linker is a glycine/serine linker.
  • the peptide linker is glycine/serine linker according to the formula [(Gly)n-Ser]m where n is any integer from 1 to 100 and m is any integer from 1 to 100.
  • the glycine/serine linker is according to the formula [(Gly)x-Sery]z (SEQ ID NO: 1) wherein x in an integer from 1 to 4, y is 0 or 1, and z is an integers from 1 to 50.
  • the peptide linker comprises the sequence Gn, where n can be an integer from 1 to 100.
  • the sequence of the peptide linker is GGGG (SEQ ID NO: 2).
  • the peptide linker can comprise the sequence (GlyAla)n (SEQ ID NO: 1]
  • the peptide linker can comprise the sequence (GlyGlySer)n (SEQ ID NO: 4), wherein n is an integer between 1 and 100
  • the peptide linker comprises the sequence (GGGS)n (SEQ ID NO:
  • the peptide linker comprises the sequence (GGS)n(GGGGS)n (SEQ ID NO: 6).
  • n can be an integer from 1-100.
  • n can be an integer from one to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
  • linkers include, but are not limited to, GGG, SGGSGGS (SEQ ID NO:
  • the linker is a poly-G sequence (GGGG)n (SEQ ID NO: 12), where n can be an integer from 1-100.
  • the peptide linker is synthetic, i.e., non-naturally occurring.
  • a peptide linker includes peptides (or polypeptides) (e.g natural or non-naturally occurring peptides) which comprise an amino acid sequence that links or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids to which it is not naturally linked or genetically fused in nature.
  • the peptide linker can comprise non-naturally occurring polypeptides which are modified forms of naturally occurring polypeptides (e.g., comprising a mutation such as an addition, substitution or deletion).
  • the peptide linker can comprise non-naturally occurring amino acids.
  • the peptide linker can comprise naturally occurring amino acids occurring in a linear sequence that does not occur in nature.
  • the peptide linker can comprise a naturally occurring polypeptide sequence.
  • the linker comprises a non-peptide linker.
  • the linker consists of a non-peptide linker.
  • the non-peptide linker can be, e.g, maleimido caproyl (MC), maleimido propanoyl (MP), methoxyl polyethyleneglycol (MPEG), succinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (SMCC), m- maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), succinimidyl 4-(p- maleimidophenyl)butyrate (SMPB), N-succinimidyl(4-iodoacetyl)aminobenzonate (SIAB), succinimidyl 6-[3-(2-pyridyldithio)-propionamide]hexanoate (LC-SPDP), 4- succinimidyloxycarbonyl-
  • MC maleimido caproyl
  • Linkers can be introduced into polypeptide sequences using techniques known in the art (e.g, chemical conjugation, recombinant techniques, or peptide synthesis). Modifications can be confirmed by DNA sequence analysis.
  • the linkers can be introduced using recombinant techniques.
  • the linkers can be introduced using solid phase peptide synthesis.
  • a cationic carrier unit disclosed herein can contain simultaneously one or more linkers that have been introduced using recombinant techniques and one or more linkers that have been introduced using solid phase peptide synthesis or methods of chemical conjugation known in the art.
  • the linker comprises a cleavage site.
  • Payloads contemplated in the present disclosure include but are not limited to therapeutic drugs, e.g, prodrugs, anticancer drugs, antineoplastic drugs, antifungal drugs, antibacterial drugs, antiviral drugs, cardiac drugs, neurological drugs, and drugs of abuse; alkaloids, antibiotics, bioactive peptides, steroids, steroid hormones, polypeptide hormones, interferons, interleukins, narcotics, nucleic acids including antisense oligonucleotides, pesticides and prostaglandins.
  • therapeutic drugs e.g, prodrugs, anticancer drugs, antineoplastic drugs, antifungal drugs, antibacterial drugs, antiviral drugs, cardiac drugs, neurological drugs, and drugs of abuse
  • alkaloids e.g, antibiotics, bioactive peptides, steroids, steroid hormones, polypeptide hormones, interferons, interleukins, narcotics, nucleic acids including antisense oligonucleotides, pesticides and
  • Biologically active molecules also include any toxins including aflatoxins, ricins, bungarotoxins, irinotecan, ganciclovir, furosemide, indomethacin, chlorpromazine, methotrexate, cevine derivatives and analogs including veratrines, and veratridine, among others.
  • Biologically active molecules also include but are not limited to, various flavone derivatives and analogs including dihydroxyflavones (chrysins), trihydroxyflavones (apigenins), pentahydroxyflavones (morins), hexahydroxyflavones (myricetins), flavyliums, quercetins, fisetins; various antibiotics including derivatives and analogs such as penicillin derivatives (i.e. ampicillin), anthracy clines (i.e.
  • doxorubicin doxorubicin, daunorubicin, mitoxantrone), butoconazole, camptothecin, chalcomycin, chartreusin, chrysomicins (V and M), chloramphenicol, chlorotetracyclines, clomocyclines, cyclosporins, ellipticines, filipins, fungichromins, griseofulvin, griseoviridin, guamecyclines, macrolides (i.e.
  • amphotericins i.e., kacidin-group antibiotics (i.e., kacidin-group antibiotics).
  • meso-chlorin e6 monoethylenediamine Mce6
  • various steroidal compounds such as cortisones, estradiols, hydrocortisone, testosterones, prednisolones, progesterones, dexamethasones, beclomethasones and other methasone derivatives, other steroid derivatives and analogs including cholesterols, digitoxins, digoxins, digoxigenins; various coumarin derivatives and analogs including dihydroxycoumarins (esculetins), dicumarols, chrysarobins, chrysophanic acids, emodins, secalonic acids; various dopas, derivatives and analogs including dopas, dopamines, epinephrines, and norepinephrines (arterenols); various antineoplastic agents or cell growth inhibitors such as cisplatins and
  • Other biologically active molecules include, but are not limited to, diphenyl hydantoin, adiphenine, anethole, aspirin, azopropazone, bencyclane, chloralhydrate, chlorambucil, chlorpromazine, chlorogenin, cinnamic acid, clofibrate, coenzyme A, cyclohexyl anthranilate, diazepam, flufenamic acid, fluocinolone acetonide, flurbiprofen, guaiazulene, ibuprofen, indican, indomethacin, iodine, ketoprofen, mefanamic acid, menadione, metronidazole, nitrazepam, phenytoin, propylparaben, proscillaridin, quinolone, thalidomide, thiamine dilaurylsulphate, thiopental, triamcinolone
  • Other biologically active molecules are anti-viral drugs, nucleic acids and other anti-viral substances including those against any DNA and RNA viruses, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picomaviruses, poxviruses, reoviruses, thabdoviruses, rhinoviruses, togaviruses and viriods; any anti -bacterial drugs, nucleic acids and other anti-bacterial substances including those against gram-negative and grampositive bacteria, Acinetobacter , Achromobacter , Bacteroides, Clostridium , Chlamydia , enterobacteria, Haemophilus , Lactobacillus , Neisseri
  • the nucleic acid comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA (TD), antimir (antagomir), small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.
  • the biologically active molecule comprises a short hairpin RNAs (shRNAs).
  • the biologically active molecule comprises an miRNA or a miRNA inhibitor (antimiR).
  • the biologically active molecule (payload) can be 10-30 nucleotides in length, for example from 14-25 nucleotides in length.
  • the biologically active molecule (payload) has a length of 16-30 nucleotides, 18-25 nucleotides, particularly 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
  • the miRNA inhibitors are oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or modifications thereof.
  • the miRNA antagonists are antimir.
  • Antimirs are a specific class of miRNA inhibitors that are described, for example, in US2007/0213292 to Stoffel et al.
  • Antimirs are RNA-like oligonucleotides that contain various modifications for RNase protection and pharmacologic properties such as enhanced tissue and cellular uptake. Antimirs differ from normal RNA by having complete 2'-O-methylation of sugar, phosphorothioate backbone and a cholesterol-moiety at 3'-end.
  • the nucleic acids are phosphodiester antisense oligonucleotides, and any oligonucleotides where the sugar-phosphate "backbone” has been derivatized or replaced with “backbone analogues” such as with phosphorothioate, phosphorodithioate, phosphoroamidate, alkyl phosphotriester, or methylphosphonate linkages.
  • the biologically active molecule is an antimir.
  • antimir refers to molecules (e.g synthetically generated molecules) that are used to neutralize microRNA (miRNA) function in cells for desired responses. miRNA are complementary sequences (approx. 20-22bp) to mRNA that are involved in the cleavage of RNA or the suppression of the translation.
  • antimirs also called anti- miRNA oligonucleotides, AMOs, or antagomirs
  • AMOs anti- miRNA oligonucleotides
  • antagomirs can be used as further regulation as well as for therapeutic for certain cellular disorders. This regulation can occur through a steric blocking mechanism as well as hybridization to miRNA.
  • These interactions within the body between antimirs and a miRNA can be for therapeutics in disorders in which over/under expression occurs or aberrations in miRNA lead to coding issues.
  • Some of the miRNA linked disorders that are encountered in the humans include cancers, muscular diseases, autoimmune disorders, and viruses.
  • antimirs can be manipulated to affect the binding affinity and potency of the antimir.
  • the 2'-sugar of the antimirs can be modified to be substituted with fluorine and various methyl groups, almost all with an increase in binding affinity.
  • some of these modified 2' -sugar antimirs lead to negative effects on cell growth.
  • Modifying the 5'-3' phosphodiester backbone linkage to a phosphorothioate (P-S) backbone linkage is also known to have an effect on target affinity. Using the P-S mutation was shown to decrease the Tm of the oligonucleotide, which leads to a lower target affinity.
  • a final requirement for antimirs is mismatch specificity and length restrictions.
  • antimirs Due to miRNAs in the same families sharing "seed" (shared) sequences and differ by only a couple of additional nucleotides; one antimir can potentially target multiple miRNA sequences.
  • One or more examples of antimirs or miRNA sequences are shown in the following table.
  • the payload is a polynucleotide comprising a nucleotide sequence having 5 to 30 nucleotides in length.
  • the polynucleotide has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • the nucleotide sequence has 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
  • the payload (e.g ., antimir) is a nucleotide sequence targeting hsa- miR-485, e.g., hsa-miR-485-3p.
  • the hsa-miR-485-3p has the sequence GUCAUACACGGCUCUCCUCUCU (SEQ ID NO: 17).
  • the payload (e.g, antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGC CGUGUAUGAC (SEQ ID NO: 18), wherein U can be optionally T.
  • the payload (e.g, antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), wherein the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches.
  • the payload (e.g, antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), wherein the nucleotide sequence has one or two mismatches.
  • the payload (e.g, antimir) is a nucleotide sequence targeting the seed sequence of has-miR-485-3p (UCAUACA; SEQ ID NO: 19).
  • the payload (e.g ., antimir) is a nucleotide sequence comprising UCAUACA (SEQ ID NO: 19), wherein U can be optionally T (complement of the seed), wherein the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10 to 25, 10 to 24, 10 to 23, 10 to 22, 10 to 21, 10 to 20, 10 to 19, or 10 to 18) in length.
  • the payload is a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 23), 5'-GUGUAUGA-3' (SEQ ID NO: 24), 5'- CGUGUAUGA-3' (SEQ ID NO: 25), 5'-CCGUGUAUGA-3' (SEQ ID NO: 26), 5'- GCCGUGUAUGA-3' (SEQ ID NO: 27), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 28), 5'- GAGCCGUGUAUGA-3' (SEQ ID NO: 29), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 30), 5'- GAGAGCCGUGUAUGA-3' (SEQ ID NO: 31), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 32), 5' - AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 33), 5'-GAGGAGAGCCGUGUAUGA-3'
  • GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 36); 5'-UGUAUGAC-3' (SEQ ID NO: 37), 5'-GUGUAUGAC-3' (SEQ ID NO: 38), 5'-CGUGUAUGAC-3' (SEQ ID NO: 39), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 40), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 41), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 42), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 43), 5'- AGAGCCGUGUAUGAC-3' (SEQ ID NO: 44), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 45), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 46), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 47), 5'-GAGGAGAGCCGUGUAUGAC-3' (
  • the payload is a nucleotide sequence comprising 5'-TGTATGA-
  • GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 76), 5'-AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 77), or 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 78).
  • the payload (e.g ., antimir) is a nucleotide sequence targeting hsa- miR-204, e.g., has-miR-204-5p.
  • the has-miR-204-5p is shown at TABLE 1 as
  • the payload (e.g, antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of
  • the payload e.g, antimir
  • the payload is a nucleotide sequence comprising, consisting essentially of, or consisting ofAGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can be optionally T and wherein the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches.
  • the payload (e.g, antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can be optionally T and wherein the nucleotide sequence has one or two mismatches.
  • the payload (e.g, antimir) is a nucleotide sequence targeting the seed sequence of has-miR-204-5p (UCCCUUU; SEQ ID NO: 2i).
  • the payload (e.g, antimir) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement of the seed), wherein U can be optionally T and wherein the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g, 10 to 25, 10 to 24, 10 to 23, 10 to 22, 10 to 21, 10 to 20, 10 to 19, or 10 to 18) in length.
  • the payload (e.g, antimir) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement to the seed), wherein the nucleotide sequence comprises one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' terminus of the complement of the seed sequence and/or one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' terminus of the complement of the seed sequence.
  • the nucleotide sequence comprises one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' terminus of the complement of the seed sequence and/or one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' terminus of the
  • a polynucleotide of the present disclosure e.g ., an antimir, e.g., an miR485 antimir
  • the polynucleotides of the present disclosure are chemically modified, the polynucleotides can be referred to as "modified polynucleotides.”
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g, a pentose or ribose) or a derivative thereof in combination with an organic base (e.g, a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase").
  • a sugar molecule e.g, a pentose or ribose
  • an organic base e.g, a purine or pyrimidine
  • nucleobase also referred to herein as “nucleobase”
  • a polynucleotide of the present disclosure is chemically modified.
  • chemical modification or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.
  • a polynucleotide of the present disclosure can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation
  • the polynucleotide of the present disclosure e.g ., an antimir
  • Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine, or uracil. Any combination of base/sugar or linker can be incorporated into polynucleotides of the present disclosure.
  • TD polynucleotide sequences set forth in the instant application will recite “T”s in a representative DNA sequence but where the sequence represents RNA, the "T”s would be substituted for "U”s.
  • TD polynucleotide sequences set forth in the instant application will recite “T”s in a representative DNA sequence but where the sequence represents RNA, the "T”s would be substituted for "U”s.
  • TD’s of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units.
  • the polynucleotide e.g., an antimir, e.g, an miR485 antimir
  • the polynucleotide includes a combination of at least two (e.g, 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.
  • the nucleobases, sugar, backbone linkages, or any combination thereof in a polynucleotide are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100%.
  • an antimir e.g, an miR485 antimir
  • the chemical modification is at nucleobases in a polynucleotide of the present disclosure (e.g, an antimir, e.g, an miR485 antimir).
  • the at least one chemically modified nucleoside is a modified uridine (e.g, pseudouridine (y), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1y), 1-ethyl-pseudouridine (e1y), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g ., 5-methyl-cytidine (m5C)) a modified adenosine (e.g, 1- methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G)
  • a modified uridine e
  • the polynucleotide of the present disclosure is uniformly modified (e.g, fully modified, modified throughout the entire sequence) for a particular modification.
  • a polynucleotide can be uniformly modified with the same type of base modification, e.g, 5-methyl-cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C).
  • m5C 5-methyl-cytidine
  • a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.
  • nucleobases in a polynucleotide of the present disclosure are modified nucleobases.
  • the payload can comprise a "polynucleotide of the present disclosure” (for example comprising an antimir, e.g., an miR485 antimir), wherein the polynucleotide includes any useful modification to the linkages between the nucleosides.
  • a polynucleotide of the present disclosure for example comprising an antimir, e.g., an miR485 antimir, wherein the polynucleotide includes any useful modification to the linkages between the nucleosides.
  • Such linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH 3 )- CH 2 -CH 2 -, oli
  • the present disclosure also includes a micelle comprising (i) a nucleotide sequence (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length) and (ii) a cationic carrier unit described herein.
  • a nucleotide sequence e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length
  • a cationic carrier unit described herein described herein.
  • compositions generally comprise a cationic carrier unit and/or micelle of the present disclosure and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject.
  • Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • the micelles described herein are co-administered with one or more additional therapeutic agents, in a pharmaceutically acceptable carrier.
  • the pharmaceutical composition comprising the micelles described herein is administered prior to administration of the additional therapeutic agent(s).
  • the pharmaceutical composition comprising the micelles described herein is administered after the administration of the additional therapeutic agent(s).
  • the pharmaceutical composition comprising the micelles described herein is administered concurrently with the additional therapeutic agent(s).
  • the pharmaceutical carrier is added following micelle formation.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g, animals or humans) at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutacetate,
  • compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition is generally sterile and fluid to the extent that easy syringeability exists.
  • the carrier can be a solvent or dispersion medium containing, e.g. , water, ethanol, polyol (e.g, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, e.g, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal compounds, e.g. , parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic compounds e.g., sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride can be added to the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition a compound which delays absorption, e.g, aluminum monostearate and gelatin.
  • the pharmaceutical composition comprising micelles described herein is administered intravenously into a subject that would benefit from the pharmaceutical composition.
  • the composition is administered to the lymphatic system, e.g, by intralymphatic injection or by intranodal injection (see e.g, Senti et al, PNAS 105( 46): 17908 (2008)), or by intramuscular injection, by subcutaneous administration, by intratumoral injection, by direct injection into the thymus, or into the liver.
  • the pharmaceutical composition comprising micelles described herein is administered as a liquid suspension.
  • the pharmaceutical composition is administered as a formulation that is capable of forming a depot following administration. In certain preferred aspects, the depot slowly releases the micelles described herein into circulation, or remains in depot form.
  • compositions described herein comprise the micelles described herein and optionally a pharmaceutically active or therapeutic agent.
  • the therapeutic agent can be a biological agent, a small molecule agent, or a nucleic acid agent.
  • Dosage forms are provided that comprise micelles described herein.
  • the dosage form is formulated as a liquid suspension for intravenous injection.
  • the present disclosure also provides methods of treating a disease or condition in a subject in need thereof comprising administering a micelle of the present disclosure or a combination thereof to the subject, e.g, a mammal, such as human subject.
  • the present disclosure provides a method of treating a neurodegenerative disorder or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, or a pharmaceutical composition of the present disclosure.
  • the micelles of the present disclosure can administered via intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion.
  • the micelles of the present disclosure can be used concurrently with other medicaments or treatment suitable for the treatment of the diseases and conditions disclosed herein.
  • the present disclosure also provides methods to encapsulate a payload for delivery, comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g, an antimir) into a micelle of the present disclosure.
  • a payload e.g., an anionic payload such as a nucleic acid (e.g, an antimir) into a micelle of the present disclosure.
  • the present disclosure also provides methods to increase the resistance of a payload to degradation (e.g, nuclease-mediated degradation), comprising incorporating the payload, e.g, an anionic payload such as a nucleic acid (e.g, an antimir) into a micelle of the present disclosure.
  • a payload to degradation e.g, nuclease-mediated degradation
  • an anionic payload such as a nucleic acid (e.g, an antimir) into a micelle of the present disclosure.
  • the payload e.g, an antimir
  • the payload e.g, an antimir
  • an intracellular target e.g, the antimir can bind to a target microRNA and trigger RNAse H mediated degradation.
  • encapsulation of the payload in a micelle of the present disclosure can increase the resistance of the payload to degradation at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload (i.e., not in a micelle, e.g, free in solution).
  • encapsulation of the payload in a micelle of the present disclosure can increase the resistance of the payload to degradation at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11 -fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21 -fold, at least about 22-fold, at least about 23 -fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.
  • encapsulation of the payload in a micelle of the present disclosure can increase the stability (e.g., increase the resistance to nucleases) of the payload at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.
  • stability e.g., increase the resistance to nucleases
  • encapsulation of the payload in a micelle of the present disclosure can increase the stability (e.g., increase the resistance to nucleases) of the payload at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21 -fold, at least about 22-fold, at least about 23 -fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.
  • the present disclosure also provides methods to increase a payload’s plasma half- life comprising incorporating the payload, e.g, an anionic payload such as a nucleic acid (e.g, an antimir) into a micelle of the present disclosure.
  • an anionic payload such as a nucleic acid (e.g, an antimir)
  • encapsulation of the payload in a micelle of the present disclosure can increase the plasma half-life of the payload at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, at least about 1000%, at least about 1100%, at least about 1200%, at least about 1300%, at least about 1400%, at least about 1500%, at least about 1600%, at least about 1700%, at least about 1800%, at least about 1900%, or at least about 2000%,
  • the encapsulated payload is an antimir disclosed herein, e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18) wherein the encapsulation of the antimir in a micelle of the present disclosure increases the plasma half-life of the antimir at least about 10-fold, at least about 12-fold, at least about 14- fold, at least about 16-fold, at least about 18-fold, or at least about 20-fold compared to the plasma half-life of the free antimir.
  • an antimir disclosed herein e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18
  • encapsulation of a payload in a micelle of the present disclosure can increase the permeation, delivery, transit, or transport of the payload through a physiological barrier, e.g, the BBB or the plasma membrane, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.
  • a physiological barrier e.g, the BBB or the plasma membrane
  • encapsulation of a payload in a micelle of the present disclosure can increase the permeation, delivery, transit, or transport of the payload through a physiological barrier, e.g, the BBB or the plasma membrane, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21 -fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least
  • the micelles of the present disclosure can be used to target stem cells, e.g, to deliver therapeutic molecules (e.g, therapeutic polynucleotides) or gene therapy components.
  • the micelles of the present disclosure can be used to treat cancer.
  • micelles of the present disclosure can target a marker specific for a certain type of cancer, e.g, a glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer, and carry as payload a therapeutic molecule (e.g, a therapeutic polynucleotide, a peptide, or a small molecule).
  • the micelles of the present disclosure can be used to treat pancreatic cancer.
  • the targeting moiety directing the micelles of the present disclosure to pancreatic tissues is a cyclic RGD peptide.
  • the targeting moiety directing the micelles of the present disclosure to pancreatic tissues is a biomarker predominantly or exclusively expressed on the surface of normal or cancerous pancreatic cells.
  • the payload of the micelle of the present disclosure is an oligonucleotide targeting K-Ras, wherein the delivery of the payload to pancreatic tissue effectively reduces the expression of K- Ras.
  • the micelles of the present disclosure can be used to treat or ameliorate the symptoms of a neurodegenerative disease, e.g., Alzheimer’s disease.
  • the micelles of the present disclosure comprise a payload, e.g, an antimir, targeting a molecule overexpressed in Alzheimer’s disease neuronal tissue, e.g, miRNA-485-3p.
  • a micelle of the present disclosure e.g, a micelle comprising a LAT1 targeting moiety to effectively transport the micelle across the BBB and an antimir payload targeting miRNA-485-3p
  • administration of a micelle of the present disclosure can prevent or ameliorate symptoms of Alzheimer’s disease such as apoptosis, loss of mitochondrial function, or inflammation. See FIG. 24.
  • the present disclosure provides a method to reduce inflammation, e.g, neuroinflammation, in a subject suffering from a neurodegenerative disease (e.g, Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively reducing inflammation, e.g, neuroinflammation, in the subject.
  • the neuroinflammation is cortex inflammation.
  • the neuroinflammation is hippocampus inflammation.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g, an antimir of SEQ ID NO: 18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can decrease the level of neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the neuroinflammation compared to the level of neuroinflammation observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g, Alzheimer’s disease
  • the present disclosure provides a method to reduce amyloid plaque burden in a subject suffering from Alzheimer’s disease comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively reducing amyloid plaque burden in the subject.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g, an antimir of SEQ ID NO: 18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can decrease at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the amyloid plaque burden in the subject compared to the amyloid plaque burden observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g, Alzheimer’s disease
  • the present disclosure provides a method to recover and/or induce neurogenesis in a subject suffering from a neurodegenerative disease (e.g, Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively recovering and/or inducing neurogenesis in the subject.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g, an antimir of SEQ ID NO: 18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can recover and/or induce neurogenesis in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the level of neurogenesis observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g, Alzheimer’s disease
  • the present disclosure provides a method to improve cognitive function in a subject suffering from a neurodegenerative disease (e.g., Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively improving cognitive function in the subject.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g, an antimir of SEQ ID NO: 18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can increase the cognitive function of the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the cognitive function observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g, Alzheimer’s disease
  • kits, or products of manufacture comprising a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure and optionally instructions for use.
  • the kit or product of manufacture comprises a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure in one or more containers.
  • the kit or product of manufacture comprises a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure and a brochure.
  • the kit or product of manufacture comprises a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure and instructions for use.
  • a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure, or combinations thereof can be readily incorporated into one of the established kit formats which are well known in the art.
  • the kit or product of manufacture comprises a cationic carrier unit of the present disclosure in dry form in a container ( e.g ., a glass vial), and optionally a vial with a solvent suitable to hydrate the dry the cationic carrier unit, and optionally instructions for the hydration of the cationic carrier unit and the formation of micelles.
  • the kit or product of manufacture further comprises at least one additional container ( e.g ., a glass vial) with the micelle’s anionic payload (e.g., an antisense oligonucleotide).
  • the kit or product of manufacture comprises a cationic carrier unit of the present disclosure in a dry form and the micelle’s anionic payload also in dry form in the same container, or in different containers.
  • the kit or product of manufacture comprises a cationic carrier unit of the present disclosure in solution and the micelle’s anionic payload also in solution in the same container, or in different containers.
  • the kit or product of manufacture comprises a micelle of the present disclosure in solution, and instructions for use.
  • the kit or product of manufacture comprises a micelle of the present disclosure in dry form, and instructions for use (e.g, instructions for reconstitution and administration).
  • This synthesis step generated the water-soluble biopolymer (WP) and cationic carrier (CC) of a cationic carrier unit of the present disclosure (see FIG. 3).
  • Azido-poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring opening polymerization of Lys(TFA)-NCA with azido- PEG (N 3 -PEG).
  • N 3 -PEG 300 mg, 0.06 mmol
  • Lys(TFA)-NCA (1287 mg, 4.8 mmol) were separately dissolved in DMF containing 1M thiourea and DMF(or NMP).
  • Lys(TFA)-NCA solution was dropped into the N 3 -PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days.
  • the reaction bottles were purged with argon and vacuum.
  • N 3 -PEG-PLL 500 mg was dissolved in methanol (60 mL) and IN NaOH (6 mL) was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES for 4 times and distilled water. White powder of N 3 -PEG-PLL was obtained after lyophilization.
  • N 3 -PEG-PLL(Nic/SH) was synthesized by chemical modification of N 3 -PEG-PLL and nicotinic acid in the presence of EDC/NHS.
  • N 3 -PEG-PLL (372 mg, 25.8 mmol) and nicotinic acid (556.7 mg, 1.02 equiv. to NH2 of PEG-PLL) were separately dissolved in mixture of deionized water and methanol (1 : 1).
  • EDC ⁇ HCl 556.7 mg, 1.5 equiv. to NH 2 of N 3 -PEG-PLL
  • NHS 334.2 mg, 1.5 equiv. to NH2 of PEG-PLL
  • the reaction mixture was added into the N 3 -PEG-PLL solution.
  • the reaction mixture was maintained at 37 °C for 16 hours with stirring.
  • 3,3'-dithiodiproponic acid (36.8 mg, 0.1 equiv.) was dissolved in methanol, EDC ⁇ HCl (40.3 mg, 0.15 equiv.), and NHS (24.2 mg, 0.15 equiv.) were dissolved each in deionized water.
  • NHS and EDC ⁇ HCl were added sequentially into 3,3'-dithiodiproponic acid solution.
  • the mixture solution was stirred for 4 hours at 37 °C after adding crude N 3 -PEG-PLL(Nic) solution.
  • the mixture was dialyzed sequentially methanol, 50 % methanol in deionized water, deionized water
  • N 3 -PEG-PLL(Nic/SH) 130 mg, 6.5 mmol
  • alkyne modified phenyl alanine 5.7 mg, 4.0 equiv.
  • FIG. 4 shows the 1 H-NMR characterization of the carrier unit.
  • FIG. 4 shows the 1 H-NMR characterization of the carrier unit.
  • Example 2 Tris(3- hydroxypropyltriazolylmethyl)amine
  • Nano sized PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL(Nic) and miRNA.
  • PEG-PLL(Nic) was dissolved in HEPES buffer (10 mM) at 0.5 mg/mL concentration.
  • a miRNA solution (22.5 mM) in RNAse free water was mixed with the polymer solution at 2: 1 (v/v) ratio of miRNA to polymer.
  • the mixing ratio of polymer to anti-miRNA was determined by optimizing micelle forming conditions, i.e., ratio between amine in polymer (carrier of the present disclosure) to phosphate in anti-miRNA (payload).
  • the mixture of polymer (carrier) and anti-miRNA (payload) was vigorously mixed for 90 seconds by multi -vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • FIG. 9 shows particle size distribution of miRNA-loaded polyion complex micelles in PBS.
  • Anti-miRNA loaded micelles shows ⁇ 60 nm particle size with low PDI distribution which indicates the complex is a homogeneous particle.
  • the peak of the distribution, as shown in FIG. 9, was at 32 nm.
  • mice (10 mM of Anti-miRNA concentration) were stored at 4 °C prior to use.
  • MeO- or Phe- micelles were prepared using the same method, and different amounts of Phe- containing micelles (25% ⁇ 75%) were also prepared by mixing both polymers during micelle preparation.
  • LAT1 was selected as the target molecule to drive the micelles of the present disclosure across the BBB. As shown in FIG. 10, in humans, LAT1 was preferentially expressed in brain. FIG. 11 shows that in mice LAT1 was also expressed preferentially in brain tissue.
  • Cy 5.5 labeled phenylalanine or N 3 -Cy 5.5 (20 mg of Cy5.5 Cone.) was separately administrated via intracerebroventricular injection and the same volume of PBS was also injected as a control.
  • Anti-miRNA loaded polyion complex micelle i.e., micelles of the present disclosure
  • LAT1 antibodies to LAT1
  • Bio-distribution of anti-microRNA was measured using IVIS live animal imaging station. To compare the time dependent anti-microRNA distribution between naked RNA and RNA loaded micelle (ASO-MDS), both samples (10 mg of RNA concentration) were administrated to the mice via intramuscular injection. The fluorescence images of mice were obtained at a desired time using IVIS live animal imaging station and observed until 120 hr.
  • ASO-MDS RNA loaded micelle

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Dispersion Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Nanotechnology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/IB2020/056093 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof Ceased WO2020261227A1 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
CA3144333A CA3144333A1 (en) 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof
BR112021026365A BR112021026365A2 (pt) 2019-06-26 2020-06-26 Nanopartículas micelares e usos das mesmas
DK20831649.7T DK3990028T3 (da) 2019-06-26 2020-06-26 Micellære nanopartikler og anvendelse deraf
US17/622,518 US20220257790A1 (en) 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof
MX2022000045A MX2022000045A (es) 2019-06-26 2020-06-26 Nanoparticulas micelares y sus usos.
CN202080057979.XA CN114514038B (zh) 2019-06-26 2020-06-26 胶束纳米颗粒及其用途
JP2021577297A JP7665540B2 (ja) 2019-06-26 2020-06-26 ミセルナノ粒子及びその使用
AU2020303447A AU2020303447A1 (en) 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof
EP20831649.7A EP3990028B1 (en) 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof
KR1020227002029A KR102658962B1 (ko) 2019-06-26 2020-06-26 미셀 나노입자 및 이의 용도
KR1020247009114A KR20240039234A (ko) 2019-06-26 2020-06-26 미셀 나노입자 및 이의 용도
PE2021002229A PE20220902A1 (es) 2019-06-26 2020-06-26 Nanoparticulas micelares y sus usos
EP25172311.0A EP4603589A3 (en) 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof
US17/502,923 US11839624B2 (en) 2019-06-26 2021-10-15 Micellar nanoparticles and uses thereof
IL289258A IL289258A (en) 2019-06-26 2021-12-22 Micellar nanoparticles and their uses
CONC2022/0000316A CO2022000316A2 (es) 2019-06-26 2022-01-17 Nanopartículas micelares y sus usos
US18/503,748 US20240173348A1 (en) 2019-06-26 2023-11-07 Micellar nanoparticles and uses thereof
JP2025064597A JP2025106480A (ja) 2019-06-26 2025-04-09 ミセルナノ粒子及びその使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962867097P 2019-06-26 2019-06-26
US62/867,097 2019-06-26
US202063043693P 2020-06-24 2020-06-24
US63/043,693 2020-06-24

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/502,923 Continuation US11839624B2 (en) 2019-06-26 2021-10-15 Micellar nanoparticles and uses thereof

Publications (1)

Publication Number Publication Date
WO2020261227A1 true WO2020261227A1 (en) 2020-12-30

Family

ID=74060198

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2020/056093 Ceased WO2020261227A1 (en) 2019-06-26 2020-06-26 Micellar nanoparticles and uses thereof

Country Status (14)

Country Link
US (3) US20220257790A1 (cg-RX-API-DMAC7.html)
EP (2) EP3990028B1 (cg-RX-API-DMAC7.html)
JP (2) JP7665540B2 (cg-RX-API-DMAC7.html)
KR (2) KR20240039234A (cg-RX-API-DMAC7.html)
CN (1) CN114514038B (cg-RX-API-DMAC7.html)
AU (1) AU2020303447A1 (cg-RX-API-DMAC7.html)
BR (1) BR112021026365A2 (cg-RX-API-DMAC7.html)
CA (1) CA3144333A1 (cg-RX-API-DMAC7.html)
CO (1) CO2022000316A2 (cg-RX-API-DMAC7.html)
DK (1) DK3990028T3 (cg-RX-API-DMAC7.html)
IL (1) IL289258A (cg-RX-API-DMAC7.html)
MX (1) MX2022000045A (cg-RX-API-DMAC7.html)
PE (1) PE20220902A1 (cg-RX-API-DMAC7.html)
WO (1) WO2020261227A1 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022075470A1 (ja) * 2020-10-09 2022-04-14 国立大学法人 東京大学 ニコチンアミド内包ミセル、及びニコチンアミド内包ミセルを含む妊娠高血圧症候群治療用組成物
US11542503B2 (en) 2019-06-17 2023-01-03 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microRNA
CN116963722A (zh) * 2020-12-30 2023-10-27 生物欧赛加有限责任公司 胶束纳米粒子及其用途
WO2024009268A1 (en) * 2022-07-07 2024-01-11 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof
EP4271363A4 (en) * 2020-12-30 2025-11-26 Biorchestra Co Ltd Micellar Nanoparticles and Their Uses

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117024749A (zh) 2019-06-28 2023-11-10 国立大学法人东京大学 蛋白质内包高分子胶束
US20230099372A1 (en) * 2020-02-07 2023-03-30 Biorchestra Co., Ltd. Use of mirna-485 inhibitors for treating tauopathy
US11761874B2 (en) * 2020-05-15 2023-09-19 Saudi Arabian Oil Company CMC-based method for surfactant concentration determination
CN115721608A (zh) * 2022-11-29 2023-03-03 陕西科技大学 一种靶向温度敏感性聚合物胶束、制备方法及应用
WO2024228118A1 (en) * 2023-05-01 2024-11-07 Biorchestra Co., Ltd. Mirna-485 inhibitors
WO2024228119A1 (en) * 2023-05-01 2024-11-07 Biorchestra Co., Ltd. Mirna-485 inhibitors
WO2025149946A1 (en) * 2024-01-10 2025-07-17 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof

Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3817837A (en) 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
WO2002044321A2 (en) 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
WO2005013901A2 (en) 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding rnas
WO2005023986A2 (en) 2003-09-04 2005-03-17 Isis Pharmaceuticals, Inc. Microrna as ligands and target molecules
WO2006093526A2 (en) 2004-07-21 2006-09-08 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a modified or non-natural nucleobase
WO2006112872A2 (en) 2004-08-04 2006-10-26 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
WO2007021896A2 (en) 2005-08-10 2007-02-22 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides for use in modulating micro rna and uses thereof
WO2007027775A2 (en) 2005-08-29 2007-03-08 Isis Pharmaceuticals, Inc. Methods for use in modulating mir-122a
WO2007027894A2 (en) 2005-08-29 2007-03-08 Isis Pharmaceuticals, Inc. Antisense compounds having enhanced anti-microrna activity
WO2007090073A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for the use in modulation of micrornas
US20070213292A1 (en) 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
WO2007112754A2 (en) 2006-04-03 2007-10-11 Santaris Pharma A/S Pharmaceutical compositions comprising anti-mirna antisense oligonucleotides
WO2008046911A2 (en) 2006-10-20 2008-04-24 Exiqon A/S Novel human micrornas associated with cancer
US7375078B2 (en) 2004-02-23 2008-05-20 Genentech, Inc. Heterocyclic self-immolative linkers and conjugates
WO2008074328A2 (en) 2006-12-21 2008-06-26 Exiqon A/S Microrna target site blocking oligos and uses thereof
WO2009020771A2 (en) 2007-08-06 2009-02-12 Alnylam Pharmaceuticals, Inc. Rnai agents comprising universal nucleobases
US20090156459A1 (en) * 2007-11-16 2009-06-18 Pharmain Corporation Cationic-Core Carrier Compositions for Delivery of Therapeutic Agents, Methods of Making and Using the Same
US20100178243A1 (en) * 2002-06-26 2010-07-15 Medigene Ag Novel method of stabilizing diagnostic and therapeutic compounds in a cationic carrier system
US8163708B2 (en) 2006-04-03 2012-04-24 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotide
US8404649B2 (en) 2010-09-24 2013-03-26 Ah Usa 42 Llc Isoxazoline oximes as antiparasitic agents
US8580756B2 (en) 2007-03-22 2013-11-12 Santaris Pharma A/S Short oligomer antagonist compounds for the modulation of target mRNA
US20140371292A1 (en) * 2011-08-10 2014-12-18 Ludwig-Maximilians-Universitat Munchen Method for the controlled intracellular delivery of nucleic acids
US9034837B2 (en) 2009-04-24 2015-05-19 Roche Innovation Center Copenhagen A/S Pharmaceutical compositions for treatment of HCV patients that are poor-responders to interferon
WO2017212007A1 (en) * 2016-06-09 2017-12-14 Curevac Ag Cationic carriers for nucleic acid delivery
US20180201928A1 (en) 2007-10-04 2018-07-19 Roche Innovation Center Copenhagen A/S Micromirs
US20180280516A1 (en) * 2009-09-09 2018-10-04 Pharmain Corporation Anionic-core composition for delivery of therapeutic agents, and methods of making and using the same

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5219564A (en) * 1990-07-06 1993-06-15 Enzon, Inc. Poly(alkylene oxide) amino acid copolymers and drug carriers and charged copolymers based thereon
WO2010005581A1 (en) * 2008-07-11 2010-01-14 Kareus Therapeutics, Llc Niacin compositions for reduction of amyloid beta peptide 42 (abeta 42) production and for treatment of alzheimer's disease (ad)
JP5622254B2 (ja) * 2009-03-31 2014-11-12 国立大学法人東京大学 二本鎖リボ核酸ポリイオンコンプレックス
CA2769162C (en) * 2009-07-31 2017-12-05 Ascendis Pharma As Biodegradable polyethylene glycol based water-insoluble hydrogels
US20120005765A1 (en) * 2010-07-01 2012-01-05 Saint Louis University Animal model for parkinson's disease
CN105792850A (zh) * 2013-12-05 2016-07-20 念·吴 聚合物-碳水化合物的缀合物的药物转递技术
JP2017512757A (ja) * 2014-02-24 2017-05-25 ウリゲン ファーマシューティカルズ、インコーポレイテッド 経口投与するためのペントサンポリ硫酸塩の組成物および使用の方法
WO2016086177A2 (en) * 2014-11-25 2016-06-02 Drexel University Compositions and methods for hiv quasi-species excision from hiv-1-infected patients
DK3378482T5 (da) * 2015-11-19 2024-09-30 Univ Nagoya City Public Univ Corp Formulering til administration af antitumorlægemiddel
WO2018053316A1 (en) 2016-09-15 2018-03-22 The Regents Of The University Of California Improved hybrid telodendrimers
RU2016146594A (ru) * 2016-11-28 2018-05-28 Общество С Ограниченной Ответственностью "Биофарм-Меморейн" Средство для лечения деменции различной этиологии
AU2017378427A1 (en) 2016-12-14 2019-06-20 Ligandal, Inc. Methods and compositions for nucleic acid and protein payload delivery
WO2018139759A1 (ko) * 2017-01-26 2018-08-02 주식회사 바이오오케스트라 마이크로 rna를 이용한 알츠하이머병 진단방법
WO2018144022A1 (en) 2017-02-03 2018-08-09 Farokhzad Omid C Particles as delivery systems
CN110156971A (zh) 2018-02-13 2019-08-23 上海时莱生物技术有限公司 一种两亲性嵌段共聚物及其制备方法和纳米胶束载药系统
US11857634B2 (en) 2018-04-20 2024-01-02 University of Pittsburgh—of the Commonwealth System of Higher Education Cationic amphiphilic polymers for codelivery of hydrophobic agents and nucleic acids
CN111632153B (zh) 2020-06-23 2023-02-24 宁夏医科大学 一种化学基因药物共载的靶向纳米递药系统及其制备方法
WO2022144811A1 (en) 2020-12-30 2022-07-07 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof
JP2024503303A (ja) 2020-12-30 2024-01-25 バイオーケストラ カンパニー, リミテッド ミセルナノ粒子及びその使用

Patent Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3817837A (en) 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (cg-RX-API-DMAC7.html) 1986-01-30 1990-11-27 Cetus Corp
WO2002044321A2 (en) 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
US20100178243A1 (en) * 2002-06-26 2010-07-15 Medigene Ag Novel method of stabilizing diagnostic and therapeutic compounds in a cationic carrier system
WO2005013901A2 (en) 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding rnas
WO2005023986A2 (en) 2003-09-04 2005-03-17 Isis Pharmaceuticals, Inc. Microrna as ligands and target molecules
US7375078B2 (en) 2004-02-23 2008-05-20 Genentech, Inc. Heterocyclic self-immolative linkers and conjugates
WO2006093526A2 (en) 2004-07-21 2006-09-08 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a modified or non-natural nucleobase
WO2006112872A2 (en) 2004-08-04 2006-10-26 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US20070213292A1 (en) 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
WO2007021896A2 (en) 2005-08-10 2007-02-22 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides for use in modulating micro rna and uses thereof
WO2007027775A2 (en) 2005-08-29 2007-03-08 Isis Pharmaceuticals, Inc. Methods for use in modulating mir-122a
WO2007027894A2 (en) 2005-08-29 2007-03-08 Isis Pharmaceuticals, Inc. Antisense compounds having enhanced anti-microrna activity
WO2007090073A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for the use in modulation of micrornas
WO2007112754A2 (en) 2006-04-03 2007-10-11 Santaris Pharma A/S Pharmaceutical compositions comprising anti-mirna antisense oligonucleotides
WO2007112753A2 (en) 2006-04-03 2007-10-11 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
US8163708B2 (en) 2006-04-03 2012-04-24 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotide
WO2008046911A2 (en) 2006-10-20 2008-04-24 Exiqon A/S Novel human micrornas associated with cancer
WO2008074328A2 (en) 2006-12-21 2008-06-26 Exiqon A/S Microrna target site blocking oligos and uses thereof
WO2008091703A2 (en) 2007-01-24 2008-07-31 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro rna and uses thereof
US8580756B2 (en) 2007-03-22 2013-11-12 Santaris Pharma A/S Short oligomer antagonist compounds for the modulation of target mRNA
WO2009020771A2 (en) 2007-08-06 2009-02-12 Alnylam Pharmaceuticals, Inc. Rnai agents comprising universal nucleobases
US20180201928A1 (en) 2007-10-04 2018-07-19 Roche Innovation Center Copenhagen A/S Micromirs
US20090156459A1 (en) * 2007-11-16 2009-06-18 Pharmain Corporation Cationic-Core Carrier Compositions for Delivery of Therapeutic Agents, Methods of Making and Using the Same
US9034837B2 (en) 2009-04-24 2015-05-19 Roche Innovation Center Copenhagen A/S Pharmaceutical compositions for treatment of HCV patients that are poor-responders to interferon
US20180280516A1 (en) * 2009-09-09 2018-10-04 Pharmain Corporation Anionic-core composition for delivery of therapeutic agents, and methods of making and using the same
US8404649B2 (en) 2010-09-24 2013-03-26 Ah Usa 42 Llc Isoxazoline oximes as antiparasitic agents
US20140371292A1 (en) * 2011-08-10 2014-12-18 Ludwig-Maximilians-Universitat Munchen Method for the controlled intracellular delivery of nucleic acids
WO2017212007A1 (en) * 2016-06-09 2017-12-14 Curevac Ag Cationic carriers for nucleic acid delivery

Non-Patent Citations (27)

* Cited by examiner, † Cited by third party
Title
"DNA Cloning", vol. 1, 2, 1985
"Handbook Of Experimental Immunology", vol. I-IV, 1986, COLD SPRING HARBOR LABORATORY PRESS
"Oxford Dictionary Of Biochemistry And Molecular Biology", 2000, OXFORD UNIVERSITY PRESS
"The Dictionary of Cell and Molecular Biology", 1999, ACADEMIC PRESS
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, COLD SPRING HARBOR LABORATORY PRESS
CHAI ET AL., CURRENT ATHEROSCLEROSIS REPORTS, vol. 15, 2013, pages 325
CHIEN ET AL.: "Reevaluating the Substrate Specificity of the L-type Amino Acid Transporter (LAT1", J. MED. CHEM., vol. 61, 2018, pages 7358 - 73, XP055893348, DOI: 10.1021/acs.jmedchem.8b01007
CROOKE: "Antisense drug Technology: Principles, Strategies and Applications", 2007, CRC PRESS, pages: 154,155
DHEUR ET AL., NUCLEIC ACID DRUG DEV., vol. 9, 1999, pages 522
FRESHNEY: "Immunochemical Methods In Cell And Molecular Biology", 1987, COLD SPRING HARBOR LABORATORY
GEARY ET AL., J. PHARMACOL. EXP. THER., vol. 296, 2001, pages 890 - 897
GEIER ET AL.: "Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1", PROC. NATL. ACAD. SCI. USA, vol. 110, 2013, pages 5480 - 85
GRAFF ET AL., METABOLISM, vol. 65, 2016, pages 102 - 13
GRIFFITHS-JONES ET AL., NUCLEIC ACIDS RES., vol. 36, 2008, pages D109 - D111
JUO, PEI-SHOW: "Concise Dictionary of Biomedicine and Molecular Biology", 2002, CRC PRESS
LIEBER M ET AL.: "Establishment of a continuous tumor-cell line (panc-1) from a human carcinoma of the exocrine pancreas", INT. J. CANCER, vol. 15, 1975, pages 741 - 747
OFFERMANNSSCHWANINGER, TRENDS IN MOLECULAR MEDICINE, vol. 21, 2015, pages 245 - 266
OUDSHOM ET AL., BIOMATERIALS, vol. 27, 2006, pages 5471 - 5479
PARK ET AL., J CONTROLLED RELEASE, vol. 93, 2003, pages 188
PERBAL: "Transcription And Translation", 1984, ACADEMIC PRESS, INC., article "A Practical Guide To Molecular Cloning"
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1992, COLD SPRINGS HARBOR LABORATORY
SENTI ET AL., PNAS, vol. 105, no. 46, 2008, pages 17908
SINGHECKER: "Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1", INT. J. MOL. SCI., vol. 19, 2018, pages 1278
SUTERA ET AL.: "Small endogenous molecules as moiety to improve targeting of CNS drugs", EXPERT OPINION ON DRUG DELIVERY, DOI: 10.1080/17425247.2016.1208651, 2016
VAN LIER, J. E.: "Photodynamic Therapy of Neoplastic Disease", vol. 1, 1990, MACK PUBLISHING CO.
WAKADECHONG, JOURNAL OF THE NEUROLOGICAL SCIENCES, vol. 347, 2014, pages 34 - 8
WILMS, ACC. CHEM. RES., vol. 43, 2010, pages 129 - 41

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11542503B2 (en) 2019-06-17 2023-01-03 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microRNA
WO2022075470A1 (ja) * 2020-10-09 2022-04-14 国立大学法人 東京大学 ニコチンアミド内包ミセル、及びニコチンアミド内包ミセルを含む妊娠高血圧症候群治療用組成物
CN116963722A (zh) * 2020-12-30 2023-10-27 生物欧赛加有限责任公司 胶束纳米粒子及其用途
EP4271363A4 (en) * 2020-12-30 2025-11-26 Biorchestra Co Ltd Micellar Nanoparticles and Their Uses
WO2024009268A1 (en) * 2022-07-07 2024-01-11 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof

Also Published As

Publication number Publication date
US20220257790A1 (en) 2022-08-18
CN114514038A (zh) 2022-05-17
BR112021026365A2 (pt) 2022-05-10
US20220105123A1 (en) 2022-04-07
US11839624B2 (en) 2023-12-12
EP3990028B1 (en) 2025-06-04
KR20220068979A (ko) 2022-05-26
EP4603589A3 (en) 2025-11-19
DK3990028T3 (da) 2025-07-21
US20240173348A1 (en) 2024-05-30
CA3144333A1 (en) 2020-12-30
MX2022000045A (es) 2022-04-20
AU2020303447A1 (en) 2022-01-27
JP2025106480A (ja) 2025-07-15
CN114514038B (zh) 2024-08-06
JP2022538868A (ja) 2022-09-06
KR102658962B1 (ko) 2024-04-23
IL289258A (en) 2022-02-01
KR20240039234A (ko) 2024-03-26
JP7665540B2 (ja) 2025-04-21
PE20220902A1 (es) 2022-05-30
EP4603589A2 (en) 2025-08-20
EP3990028A1 (en) 2022-05-04
EP3990028A4 (en) 2023-08-09
CO2022000316A2 (es) 2022-04-29

Similar Documents

Publication Publication Date Title
US11839624B2 (en) Micellar nanoparticles and uses thereof
JP7504482B2 (ja) ハンチンチンmRNAをターゲティングするオリゴヌクレオチド化合物
US20240131048A1 (en) Micellar nanoparticles and uses thereof
US20250313835A1 (en) Micellar nanoparticles and uses thereof
US20240091151A1 (en) Micellar nanoparticles and uses thereof
WO2025149946A1 (en) Micellar nanoparticles and uses thereof
CN116963722A (zh) 胶束纳米粒子及其用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20831649

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3144333

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021577297

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021026365

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2022/0000316

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2020303447

Country of ref document: AU

Date of ref document: 20200626

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020831649

Country of ref document: EP

Effective date: 20220126

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112021026365

Country of ref document: BR

Free format text: APRESENTAR A TRADUCAO SIMPLES DA FOLHA DE ROSTO DA CERTIDAO DE DEPOSITO E DA CESSAO DAS PRIORIDADES US 62/867,097 E US 63/043,693 OU DECLARACAO CONTENDO, OBRIGATORIAMENTE, TODOS OS DADOS IDENTIFICADORES DESTAS CONFORME O ART. 15 DA PORTARIA 39/2021. O DOCUMENTO APRESENTADO NAO ESTA TRADUZIDO.

WWP Wipo information: published in national office

Ref document number: NC2022/0000316

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112021026365

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211223

WWE Wipo information: entry into national phase

Ref document number: 521431203

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 521431203

Country of ref document: SA

WWG Wipo information: grant in national office

Ref document number: 521431203

Country of ref document: SA

WWG Wipo information: grant in national office

Ref document number: 2020831649

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 783871

Country of ref document: NZ