WO2020227166A1 - Compositions useful in treatment of metachromatic leukodystrophy - Google Patents
Compositions useful in treatment of metachromatic leukodystrophy Download PDFInfo
- Publication number
- WO2020227166A1 WO2020227166A1 PCT/US2020/031207 US2020031207W WO2020227166A1 WO 2020227166 A1 WO2020227166 A1 WO 2020227166A1 US 2020031207 W US2020031207 W US 2020031207W WO 2020227166 A1 WO2020227166 A1 WO 2020227166A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vector
- seq
- raav
- harsa
- certain embodiments
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/02—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0085—Brain, e.g. brain implants; Spinal cord
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/06—Sulfuric ester hydrolases (3.1.6)
- C12Y301/06001—Arylsulfatase (3.1.6.1)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/106—Primate
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0306—Animal model for genetic diseases
- A01K2267/0318—Animal model for neurodegenerative disease, e.g. non- Alzheimer's
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14151—Methods of production or purification of viral material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14171—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
Definitions
- Metachromatic Leukodystrophy is a monogenic autosomal recessive sphingolipid storage disease caused by mutations in the gene encoding the lysosomal enzyme ARSA (Von Figura et al, 2001; Gieselmann and Krageloh-Mann, 2010). ARSA deficiency leads to accumulation of its natural substrates, which are sulfated galactosphingolipids
- Sulfatides (galactosylceramide-3-O-sulfate and galactosylsphingosine-3-O-sulfate), commonly referred to as sulfatides. Sulfatides accumulate within the lysosomes of oligodendrocytes, microglia, and certain types of neurons in the Central Nervous System (CNS), in addition to Schwann cells and macrophages in the Peripheral Nervous System (PNS) (Peng and Suzuki, 1987).
- CNS Central Nervous System
- PPS Peripheral Nervous System
- sulfatide storage also occurs in visceral organs; most notably, the kidney, liver (Toda et al, 1990), and gallbladder (Rodriguez-Waitkus et al, 2011; McFadden and Ranganathan, 2015).
- MLD patients typically have ARSA enzyme activity that is 0-10% of control values in synthetic substrate -based assays.
- ARSA mutation carriers who have a single mutated ARSA allele and one normal allele, are clinically unaffected and usually have ARSA enzyme activity that is approximately 10% of control values, while asymptomatic individuals with pseudodeficiency (PD, another genetically distinct form of ARSA deficiency) alleles have ARSA enzyme activity that is approximately 10-20% of healthy controls (Gomez-Ospina, 2017).
- MLD multi-dethelial disease
- three forms of MLD can be distinguished based on age of symptom onset that span a broad continuous spectrum of disease severity: a rapidly progressive severe late infantile form, a juvenile form, and a late onset slowly progressive adult form comprising 50-60%, 20-30%, and 15-20% of MLD diagnoses, respectively (Gomez-Ospina, 2017, Wang et al, 2011).
- Infantile MLD is considered an orphan disease.
- Late infantile MLD has an onset before 30 months of age and is the most severe form of the disease.
- the late infantile form has a uniform clinical presentation and a rapidly progressive, predictable disease course.
- Juvenile MLD is characterized by an age of onset between the age of 30 months and 16 years with a median age of onset of 6 years 2 months (Kehrer et al, 201 la) to 10 years (Mahmood et al, 2010), depending on the study.
- early juvenile MLD a subset of juvenile MLD patients has been described, referred to as early juvenile MLD, who have a clinical onset ⁇ 6 years of age and who have a similar, although less rapid, initial disease evolution compared to children with late infantile MLD (Biffi et al., 2008; Chen et al., 2016;
- the early juvenile and late infantile phenotypes are collectively referred to as early onset MLD (Sessa et al., 2016).
- early onset MLD Sessa et al., 2016
- behavioral issues, attention deficit, or cognitive decline usually develops first, sometimes in combination with gait disturbances.
- HSCT Hematopoietic Stem Cell Transplantation
- ULB umbilical cord blood
- allogeneic peripheral blood stem cells or allogeneic bone marrow
- MLD the number of cells that are transplanted into the body.
- BMT Bone marrow transplant
- GvHD graft versus host disease
- Umbilical Cord Blood (UCB) transplantation provides an alternative to BMT with the advantage of quicker availability, lower risk of GvHD, lower mortality, higher rates of full-donor chimerism, and better correction of enzymatic defect (Batzios and Zafeiriou, 2012; Martin et al, 2013).
- BMT is not widely available in Europe. Brain engraftment is slow, often taking many months for cells to engraft, migrate to the CNS, differentiate, and restore enzyme levels.
- physiological enzyme levels achieved with HSCT may not be sufficient to correct the deficit throughout the CNS. This may explain why transplant is not efficacious in rapidly progressive early onset MLD, and may not correct or stabilize all aspects of the disease even when performed pre-symptomatically (de Hosson et al, 2011; Martin et al,
- These cell therapies have shown considerable clearance of sulfatide storage in animal models (Patil and Maegawa, 2013), but are still untested in humans.
- HSC-GT gene therapy
- an intra- cerebrally delivered lentiviral gene therapy is also recruiting patients with any form of MLD (NCT03725670).
- Enzyme replacement therapy is now the Standard of Care (SOC) for several Lysosomal Storage Diseases (LSDs) (Sands, 2014) and relies on the ability of cells to take up infused enzyme via mannose-6-phosphate receptors (Ghosh et al, 2003).
- SOC Standard of Care
- LSDs Lysosomal Storage Diseases
- ERT reduces sulfatide storage in the kidneys, peripheral nerves, and CNS in Arsa -/- mice (Matzner et al., 2005).
- Warfarin is an anti-coagulant that has been tested as a substrate-reducing agent in a small cohort of late infantile MLD patients. There was no beneficial effect on urinary sulfatide levels or levels of the brain biomarkers N-acetylaspartate and myo inositol (Patil and Maegawa, 2013).
- rAAV replication-defective adeno-associated virus
- Arylsulfatase A gene for example, Metachromatic Leukodystrophy, i.e., MLD, or ARSA pseudodeficiency
- the rAAV is desirably replication-defective and carries a vector genome comprising inverted terminal repeats (ITR) and a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell.
- ITR inverted terminal repeats
- hARSA functional human Arylsulfatase A
- the rAAV further comprises an AAVhu68 capsid in which the vector genome is packaged.
- the vector genome is entirely exogenous to the AAVhu68 capsid, as it contains no AAVhu68 genomic sequences.
- the functional hARSA has a signal peptide and a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2.
- the native hARSA signal peptide is used, e.g., aa 1 to aa 18 of SEQ ID NO: 2.
- the signal peptide is aa 1 to aa 20 of SEQ ID NO: 4.
- the functional hARSA has an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4.
- the hARSA coding sequence is about 95% to 100% identical to nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1.
- the hARSA-coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3.
- the hARSA coding sequence encodes a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2.
- the hARSA coding sequence encodes a sequence of SEQ ID NO: 2 or SEQ ID NO: 4.
- the regulatory sequences comprise one or more of the following: a regulatory element derived from the chicken b-actin (BA) promoter and human
- CMV IE cytomegalovirus immediate-early enhancer
- rBG rabbit b- globin
- Poly A polyadenylation signal derived from the rBG gene
- the vector genome has a sequence of nucleotide (nt)
- the rAAV or a composition comprising the rAAV is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation (for example, MLD) and/or to delay progression of a disease associated with an ARSA mutation (for example, MLD).
- MLD a disease associated with an ARSA mutation
- MLD delay progression of a disease associated with an ARSA mutation
- a production system useful for producing the rAAV is provided.
- cells which comprise a nucleic acid sequence encoding an AAVhu68 capsid protein are cultured, a vector genome as described herein and sufficient AAV rep junctions and helper functions to permit packaging of the vector genome into the AAV capsid.
- a vector which is useful for treating a disease associated with an ARSA mutation (for example, MLD) in a subject in need thereof.
- the vector carries a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell.
- hARSA-coding sequence is about 95% to 100% identical to SEQ ID NO: 1.
- the function hARSA protein has an amino acid sequence of SEQ ID NO: 2.
- the hARSA coding sequence is SEQ ID NO: 1.
- the vector or a composition comprising the vector is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation (for example, MLD), and/or to delay progression of a disease associated with an ARSA mutation (for example, MLD).
- MLD a disease associated with an ARSA mutation
- MLD delay progression of a disease associated with an ARSA mutation
- a composition comprising a rAAV or a vector as described herein and an aqueous suspension media.
- the aqueous composition is provided which comprises a formulation buffer and the rAAV or vector as described.
- the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant.
- the formulation buffer comprises about 0.0005 % to about 0.001% surfactant.
- the composition is at a pH of 7.2 to 7.8.
- a method of treating a subject having a disease associated with an ARSA mutation for example, MLD
- ameliorating symptoms of a disease associated with an ARSA mutation for example, MLD
- delaying progression of a disease associated with an ARSA mutation for example, MLD
- the method comprises administrating an effective amount of a rAAV or a vector as described herein to a subject in need thereof.
- the vector or rAAV is administrable to a patient via an intra-cisterna magna injection (ICM), for example, CT-guided sub-occipital injection into the cisterna magna.
- ICM intra-cisterna magna injection
- a vector or a composition which is administrable to a patient having Metachromatic Leukodystrophy who is 7 years of age or younger, or who is 6 years of age or younger.
- the method involves delivering the rAAV or the vector to a human patient in a single dose.
- FIG. 1 provides the engineered hARSA coding sequence (SEQ ID NO: 1, i.e., nt 7 to nt 1527 of SEQ ID NO: 3 and nt 1968 to nt 3488 of SEQ ID NO: 5).
- FIG. 2 provides a linear map of the AAV.CB7.CI.hARSAco.rBG vector genome.
- the vector genome is to express an engineered version of human ARSA (hARSAco) under the control of the ubiquitous CB7 promoter.
- CB7 is composed of a hybrid between a CMV IE enhancer and a chicken BA promoter.
- ARSA arylsulfatase A
- BA b-actin
- CMV IE cytomegalovirus immediate-early
- ITR inverted terminal repeats
- PolyA polyadenylation
- rBG rabbit b- globin.
- FIG. 3 provides a linear map of the cis plasmid, termed
- cytomegalovirus immediate-early hARSAco, human arylsulfatase A (engineered); ITR, inverted terminal repeat; KanR, kanamycin resistance; Ori, origin of replication; PolyA, polyadenylation; rBG, rabbit b-globin.
- FIG. 4 provides a linear map of the trans plasmid pAAV2/hu68.KanR.
- AAV2 adeno- associated virus serotype 2
- AAVhu68 adeno-associated virus serotype hu68
- bp base pairs
- Cap capsid
- KanR kanamycin resistance
- Ori origin of replication
- Rep replicase.
- FIGs. 5A and 5B provide an adenovirus helper plasmid pAdDeltaF6(KanR).
- FIG. 5A shows derivation of the helper plasmid pAd ⁇ F6 from parental plasmid pBHGlO through intermediates pAd ⁇ F 1 and pAd ⁇ F5.
- FIG. 5B shows that the ampicillin resistance gene in pAd ⁇ F6 was replaced by the kanamycin resistance gene to generate pAd ⁇ F6(Kan).
- FIG. 6 provides a manufacturing process flow diagram for producing
- AAVhu68.hARSAco vector AAV, adeno- associated virus; AEX, anion exchange; CRL, Charles River Laboratories; ddPCR, droplet digital polymerase chain reaction; DMEM, Dulbecco’s modified Eagle medium; DNA, deoxyribonucleic acid; FFB, final formulation buffer; GC, genome copies; HEK293, human embryonic kidney 293 cells; ITFFB, intrathecal final formulation buffer; PEI, polyethylenimine; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TFF, tangential flow filtration; USP, United States Pharmacopeia; WCB, working cell bank.
- AAV adeno- associated virus
- AEX anion exchange
- CRL Charles River Laboratories
- ddPCR droplet digital polymerase chain reaction
- DMEM Dulbecco’s modified Eagle medium
- DNA deoxyribonucleic acid
- FFB
- FIG. 7 provides a manufacturing process Flow Diagram for AAVhu68.hARSAco vector.
- Ad5 adenovirus serotype 5
- AUC analytical ultracentrifugation
- BDS bulk drug substance
- BSA bovine serum albumin
- CZ Crystal Zenith
- ddPCR droplet digital polymerase chain reaction
- El A early region 1A (gene)
- ELISA enzyme-linked immunosorbent assay
- FDP filled drug product
- GC genome copies
- ITFFB intrathecal final formulation buffer
- KanR kanamycin resistance (gene)
- MS mass spectrometry
- NGS next -generation sequencing
- qPCR quantitative polymerase chain reaction
- SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
- TCID50 50% tissue culture infective dose
- UPLC ultra-performance liquid chromatography
- USP United States Pharmacopeia.
- FIG. 8 shows ARSA enzyme activity in the left and right cerebral hemispheres of mice following intracerebroventricular administration of the AAVhu68.CB7.CI.hARSAco.rBG vector.
- N number of animals
- PBS phosphate -buffered saline. See, Example 2 for more details.
- FIGs. 9 A to 9B show ARSA enzyme activity in the liver and serum of mice following intracerebroventricular administration of the AAVhu68.CB7.CI.hARSAco.rBG vector.
- N number of animals
- PBS phosphate-buffered saline
- FIG. 10 shows delivery of ARSA to Neurons and Oligodendrocytes in the brain following intracerebroventricular administration of AAVhu68.CB7.CI.hARSAcoHA.rBG in mice.
- ARSA anti-HA primary antibody detected with a fluorescein isothiocyanate- conjugated secondary antibody
- oligodendrocytes red: anti-OLIG2 primary antibody detected with a tetramethylrhodamine-conjugated secondary antibody
- Representative images of the brain cortex are shown at 20x magnification with 500 ms exposure.
- Cropped and zoomed-in views show oligodendrocytes from the subcortical white matter expressing ARSA.
- ARSA arylsulfatase A (protein); GC, genome copies; HA, hemagglutinin; ICV,
- N number of animals
- OLIG2 oligodendrocyte transcription factor 2
- PBS phosphate-buffered saline
- FIG. 11 shows ARSA activity levels in cerebrospinal fluid of nonhuman primates following intra-cisterna magna administration of AAVhu68.CB7.CI.hARSAco.rBG.
- AAVhu68.CB7.CI.hARSAco.rBG Adult cynomolgus macaques received a single ICM administration of
- LD LD
- MD 1.00 x 10 13 GC
- HD 3.00 x 10 13 GC
- FIGs. 12A and 12B provide anti-ARSA antibody levels in cerebrospinal fluid and serum of nonhuman primates following intra-cistema magna administration of
- Serum was collected on Days 7, 14 ⁇ 1, 21 ⁇ 1, 28 ⁇ 1, 35 ⁇ 1, and 42 ⁇ 2.
- An indirect ELISA was performed on the CSF (dilution 1 :20, FIG. 12 A) and serum (dilution 1: 1000, FIG. 12B) using plates pre-coated with recombinant human ARSA to measure anti-hARSA antibody levels (absorbance at 450 nm).
- the dotted line represents the absorbance average in untreated controls.
- ARSA arylsulfatase A (protein); CSF, cerebrospinal fluid; ELISA, enzyme-linked immunosorbent assay; GC, genome copies; hARSA, human arylsulfatase A; HD, high dose; ICM, intra-cistema magna, LD, low dose; MD, mid dose; N, number of animals. Arrows from the legend are used to indicate each trial.
- FIG. 13A-13L show human ARSA expression in the brain of nonhuman primates following intra-cisterna magna administration of AAVhu68.CB7.CI.hARSAco.rBG.
- AAVhu68.CB7.CI.hARSAco.rBG at a dose of 3.00 x 10 13 GC (HD) (N 2).
- Untreated age- matched cynomolgus macaques served as a control (N 2).
- Representative images of sections through the brain’s cortex FIG. 13E, FIG. 13F, FIG. 13G,
- FIG. 131, and FIG. 13J hippocampus (FIG. 13H), thalamus (FIG. 13K), and cerebellum (FIG. 13L) for one AAVhu68.CB7.CI.hARSAco.rBG-treated animal is shown, along with sections from an untreated control for signal comparison (FIG. 13A, FIG. 13B, FIG. 13C, and FIG. 13D).
- ARSA arylsulfatase A (protein); GC, genome copies; HD, high dose; ICM, intra-cistema magna; N, number of animals.
- FIG. 14A, FIG. 14B, FIG. 14C, FIG. 14D, FIG. 14E, FIG. 14F, FIG. 14G, FIG. 14H, and FIG. 141 provide human ARSA expression in the spinal cord and dorsal root ganglia of nonhuman primates following intra-cistema magna administration of
- FIG. 14D Representative images of sections for one AAVhu68.CB7.CI.hARSAco.rBG-treated animal (FIG. 14D, FIG. 14E, FIG. 14F, FIG. 14G, FIG. 14H, and FIG. 141) is shown, along with sections from an untreated control for signal comparison (FIG. 14A, FIG. 14B, and FIG. 14C).
- ARSA arylsulfatase A (protein); GC, genome copies; HD, high dose; ICM, intra-cistema magna; N, number of animals.
- Arylsulfatase A (ARSA) gene and/or deficiencies in normal levels of functional Arylsulfatase A are provided herein.
- compositions and methods for treating disease(s) or symptom(s) caused by mutation(s) in the ARSA gene and/or deficiencies in normal levels of functional Arylsulfatase A are provided herein.
- An effective amount of a recombinant adeno-associated virus (rAAV) having an AAVhu68 capsid and packaged therein a vector genome encoding a functional human Arylsulfatase A (hARSA) protein is delivered to a subject in need.
- rAAV recombinant adeno-associated virus
- this rAAV is formulated with an aqueous buffer.
- the suspension is suitable for intrathecal injection.
- the rAAV vector is termed as AAVhu68.hARSAco, in which the hARSA coding sequence is an engineered hARSA coding sequence (termed as“hARSAco” or“hARSA” unless specified, for example, nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, SEQ ID NO: 3, or a sequence at least about 95% to about 99.9% identical thereto).
- the hARSAco is SEQ ID NO: 1.
- the hARSAco is SEQ ID NO: 3.
- the rAAV vector is termed AAVhu68.CB7.
- hARSAco in which the engineered hARSA coding sequence is under the control of regulatory sequences which include a chicken beta actin promoter with a cytomegalovirus enhancer (CB7; SEQ ID NO: 16).
- the compositions are delivered via an intra-cistema magna injection (ICM).
- Nucleic acid sequences encoding capsid of a clade F adeno-associated vims (AAV), which is termed herein AAVhu68, are utilized in the production of the AAVhu68 capsid and recombinant AAV (rAAV) carrying the vector genome. Additional details relating to AAVhu68 are provided in WO 2018/160582 and in this detailed description.
- the AAVhu68 vectors described herein are well suited for delivery of the vector genome comprising the engineered hARSA coding sequence to cells within the central nervous system (CNS), including brain, hippocampus, motor cortex, cerebellum, and motor neurons, and the peripheral nervous system (PNS), including nerves and ganglia outside the brain and the spinal cord. These vectors may be used for targeting other cells within the CNS and/or PNS and certain other tissues and cells, for example, kidney or liver or gallbladder.
- CNS central nervous system
- PNS peripheral nervous system
- Arylsulfatase A (hARSA)
- Two isoforms of human ARSA (hARSA) protein (UniProtKB - P15289, ARSA_HUMAN) have been identified: P51608- 1, SEQ ID NO: 2; and P51608-2, SEQ ID NO: 15.
- ARSA Arylsulfatase A
- a functional hARSA protein refers to an isoform, a natural variant, a variant, a polymorph, or a truncation of a hARSA protein which has at least about 10% of the enzymatic activity (i.e., enzyme activity) of the wildtype hARSA protein (for example, P51608-1, SEQ ID NO: 2; or P51608-2, SEQ ID NO: 15).
- the wildtype hARSA protein for example, P51608-1, SEQ ID NO: 2; or P51608-2, SEQ ID NO: 15.
- the functional hARSA protein has at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
- the functional hARSA protein has about 10% to about 15%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 50%, about 10% to about 75%, about 10% to about 90%, about 10% to about 100 %, about 10% to about 3-fold, about 15% to about 20%, about 15% to about 25%, about 15% to about 30%, about 15% to about 50%, about 15% to about 75%, about 15% to about 90%, about 15% to about 100 %, about 15% to about 3-fold, about 20% to about 25%, about 20% to about 30%, about 20% to about 50%, about 20% to about 75%, about 20% to about 90%, about 20% to about 100 %, about 20% to about 3-fold, about 25% to about 30%, about 25% to about 50%, about 25% to about 75%, about 25% to about 90%, about 25% to about 100 %, about 25% to about 3-fold, about 50% to about 75%, about 50% to about 90%, about 50% to about 100 %, about 50% to about 3-fold, about 75% to about 90%, about 75% to about 100 %, or about
- the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of SEQ ID NO: 15 (i.e., aa 85 to aa 507 of SEQ ID NO: 2) or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the functional hARSA protein comprises (i) a signal peptide, (ii) an amino acid sequence of amino acid (aa) 19 to aa 444 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto, and (iii) an amino acid sequence of aa 448 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the amino acid sequence of (ii) may be linked to the amino acid sequence of (iii) by disulfide bond(s).
- Other chemical bond(s) may be utilized, for example, covalent bond, and noncovalent bond (including hydrogen, ionic, hydrophobic, and Van Der Waals bonding).
- the link between the amino acid sequences of (ii) and (iii) is formed by a combination of the bonds described.
- the link between the amino acid sequences of (ii) and (iii) is a peptide linker (see, e.g., parts.igem.org/Protein_domains/Linker).
- the functional hARSA protein comprises (i) a signal peptide, (ii) an amino acid sequence of amino acid (aa) 85 to aa 444 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto, and (iii) an amino acid sequence of aa 448 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the amino acid sequence of (ii) may be linked to the amino acid sequence of (iii) by disulfide bond(s).
- Other chemical bond(s) may be utilized, for example, covalent bond, and noncovalent bond (including hydrogen, ionic, hydrophobic, and Van Der Waals bonding).
- the link between the amino acid sequences of (ii) and (iii) is formed by a combination of the bonds described.
- the link between the amino acid sequences of (ii) and (iii) is a peptide linker (see, e.g., parts.igem.org/Protein_domains/-Linker).
- the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 23 to aa 348 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 19 to aa 448 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the functional hARSA protein comprises (i) a signal peptide, and (ii) an amino acid sequence of amino acid (aa) 448 to aa 507 of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- the functional hARSA protein with the identity specified has its modifications outside of the aa 85 to aa 507 based on the numbering in SEQ ID NO: 2, and/or outside of any one or more of the aa 29, 69,
- the functional hARSA protein has an amino acid sequence of SEQ ID NO: 2 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%,
- the functional hARSA protein has an amino acid sequence of SEQ ID NO: 4 or an amino acid sequence at least about 90 % (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.
- a signal peptide (sometimes referred to as signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide) is a short peptide (usually 15-30 amino acids long) present at the N-terminus of the majority of newly synthesized proteins that are destined towards the secretory pathway (Blobel G, Dobberstein B (Dec 1975). "Transfer of proteins across membranes. I. Presence of proteolytically processed and unprocessed nascent immunoglobulin light chains on membrane- bound ribosomes of murine myeloma". J Cell Biol. 67 (3): 835-51).
- the signal peptide has an amino acid sequence of aa 1 to aa 18 of SEQ ID NO: 2 or an amino acid sequence of aa 1 to aa 20 of SEQ ID NO: 4.
- the signal peptide is from another protein which is secreted by a CNS cell (for example, a neuron), a PNS cell, or another cell (such as a kidney cell, or a liver cell).
- the signal peptide is preferably of human origin or a derivative of a human signal peptide, and is be about 15 to about 30 amino acids, preferably about 17 to 25 amino acids, or about 18 amino acids in length.
- the signal peptide is the native signal peptide (amino acids 1 to 18 of SEQ ID NO: 2).
- the functional hARSA protein comprises an exogenous leader sequence in the place of the native signal peptide.
- the signal peptide may be from a human IL2 or a mutated signal peptide.
- a human serpinFl secretion signal may be used as a signal peptide.
- Such chimeric hARSA proteins comprising an exogenous signal peptide and the mature portion of the hARSA (e.g., aa 19 to 507 of SEQ ID NO:2, aa 19 to aa 444 of SEQ ID NO: 2, aa 85 to aa 507 of SEQ ID NO: 2, aa 23 to aa 348 of SEQ ID NO: 2, or aa 448 to 507 of SEQ ID NO: 2) is included in the various embodiments described herein when reference is made to a functional hARSA protein.
- an exogenous signal peptide e.g., aa 19 to 507 of SEQ ID NO:2, aa 19 to aa 444 of SEQ ID NO: 2, aa 85 to aa 507 of SEQ ID NO: 2, aa 23 to aa 348 of SEQ ID NO: 2, or aa 448 to 507 of SEQ ID NO: 2
- hARSA coding sequence a nucleic acid sequence encoding a functional hARSA protein, termed as hARSA coding sequence or ARSA coding sequence or hARSA or ARSA.
- the hARSA coding sequence is a modified or engineered (hARSA or hARSAco).
- the hARSA coding sequence has a sequence of nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto.
- the hARSA coding sequence is nt 55 to nt 1521 of SEQ ID NO: 1 or a nucleic acid sequence at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical thereto.
- the hARSA coding sequence is SEQ ID NO: 1 or a sequence at least 95% to 99.9% identical thereto.
- the hARSA coding sequence is SEQ ID NO: 1 or a nucleic acid sequence at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical thereto.
- the hARSA coding sequence is SEQ ID NO: 3 or a sequence at least 95% to 99.9% identical thereto.
- the hARSA coding sequence is SEQ ID NO: 3 or a nucleic acid sequence at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical thereto.
- Transcript variants of hARSA (which is also hARSA coding sequence) can be found as NCBI Reference Sequences NM_000487.5, NM_001085425.2, NM_001085426.2,
- NCBI Reference Sequences is incorporated herein by reference in its entirety.
- the modified or engineered hARSA coding sequence shares less than about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity to one of the NCBI Reference Sequences. In certain embodiments, the modified or engineered hARSA coding sequence shares about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity to one of the NCBI Reference Sequences.
- nucleic acid or a“nucleotide”, as described herein, can be RNA, DNA, or a modification thereof, and can be single or double stranded, and can be selected, for example, from a group including: nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide-nucleic acid (PNA), pseudocomplementary PNA (pc-PNA), locked nucleic acid (LNA) etc.
- PNA peptide-nucleic acid
- pc-PNA pseudocomplementary PNA
- LNA locked nucleic acid
- nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc.
- sequence identity refers to the residues in the two sequences which are the same when aligned for correspondence.
- the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
- Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences.
- a suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids.
- “identity”,“homology”, or“similarity” between two different sequences “identity”,“homology” or“similarity” is determined in reference to“aligned” sequences.
- “Aligned” sequences or“alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.
- Sequence alignment programs are available for amino acid sequences, e.g., the“Clustal X”,“Clustal Omega”“MAP”,“PIMA”,“MSA”,
- nucleic acid sequences are also available for nucleic acid sequences. Examples of such programs include,“Clustal W”,“Clustal Omega”,“CAP Sequence Assembly”, “BLAST”,“MAP”, and“MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using FastaTM with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.
- FastaTM provides alignments and percent sequence identity of the regions
- MLD Metachromatic Leukodystrophy
- rAAV rAAV vector, methods and compositions useful in treating a disease or an abnormal condition caused by mutation(s) of Arylsulfatase A (ARSA) gene and/or deficiencies in normal levels of functional Arylsulfatase A, termed as“disease” herein, for example, Metachromatic leukodystrophy (MLD). See, e.g., omim.org/entry/250100.
- Arylsulfatase A Arylsulfatase A
- MLD Metachromatic leukodystrophy
- Metachromatic Leukodystrophy can be classified into the following types: early onset MLD which includes infantile MLD (typically begins equal to or earlier than 30 months of age) and early juvenile MLD (usually begins between 30 months of age to 6 years of age (including 6 years); juvenile MLD which includes early juvenile MLD and late juvenile MLD (usually begins between 7 years of age and 16 years of age, including 16 year old); and adult MLD (with an onset later than 16 years of age). Late infantile MLD patients have a devastating disease course with rapid and predictable decline that is homogeneous in the presentation of both motor and cognitive impairment (Kehrer et al., 2011a; Sessa et al., 2016).
- the rAAV, vector, composition and method described herein are useful in treating MLD, early onset MLD, infantile MLD, late infantile MLD, juvenile MLD, early juvenile MLD, late juvenile MLD, or adult MLD.
- the rAAV, vector, compositions and methods described herein may ameliorate disease symptom and/or delay disease progression in a subject.
- the rAAV, vector, compositions and methods described herein are useful in treating late infantile and early juvenile MLD.
- the subject or patient of the rAAV, vector, method or composition described herein has MLD, or is diagnosed with MLD. In certain embodiments, the subject or patient of rAAV, vector, the method or composition described herein is diagnosed with late infantile MLD or early juvenile MLD.
- the diagnosis of MLD may be made through both genetic and biochemical testing. Genetic testing can identify mutations in the ARSA, while biochemical testing includes sulfatase enzyme activity and urinary sulfatide excretion.
- An magnetic resonance imaging (MRI) can confirm a diagnosis of MLD.
- An MRI shows imaging of a person’s brain and can show the presence and absence of myelin. There is a classic pattern of myelin loss in the brains of individuals affected by MLD. As the disease progresses, imaging shows accumulating injury to the brain. In young children, the initial brain imaging can be normal.
- the subject of the rAAV, vector, method or composition described herein is a human less than 18 years old (e.g., less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 month(s) old, or less than about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 year(s) old).
- the subject is a newborn or a human more than 1 month old (e.g., more than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 month(s) old, or more than about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5,
- the patient is about 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 month(s) old, or about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 year(s) old.
- the patient is about 30 months to about 7 years of age. In certain embodiments, the patient is from about 30 months to 16 years of age, from 7 years to 16 years of age, or from 16 years to 40 years of age.
- “Patient” or“subject”, as used herein interchangeably, means a male or female mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research.
- the subject of these rAAV, vector, methods and compositions is a human patient.
- the subject of these rAAV, vector, methods and compositions is a male or female human.
- the subject of these rAAV, vector, methods and compositions is diagnosed with Metachromatic Leukodystrophy and/or with symptoms of Metachromatic Leukodystrophy.
- Disease symptoms may include, but are not limited to the following: decreased concentration and/or level and/or biological activity of ARSA (for example, in serum or in CSF), increased urine sulfatides, CNS myelination (demyelination load and pattern), white matter atrophy as measured by MRI, an abnormal (decreased or increased) neuronal metabolite N-acetylaspartate (NAA), myo-inositol (ml), choline (Cho) and/or lactate (Lac) levels (for example, as measured by proton magnetic resonance spectroscopy (MRS)), increased CSF sulfatide and lyso-sulfatide levels, abnormal Visual evoked potentials (VEPs), abnormal Brainstem auditory evoked responses (BAERs), gall bladder wall thickening (for example, via ultrasound evaluation); impaired motor function (for example, measured by the Gross Motor Function Classification for Metachromatic
- ARSA for example, in serum or in CSF
- CNS myelination
- GMFC-MLD Leukodystrophy
- GMFM Gross Motor Function Measure
- WHO World Health Organization
- impaired cognitive function for example, Total Intelligence Quotient [IQ] and sub domain IQ measured by the Bayley Scale of Infant Development [BSID -III], Wechsler
- disease symptoms may include abnormal properties (for example biomarker activity, electrophysiological activity, and/or imaging parameters) and clinical observations (for example, impaired gross and fine motor function, impaired cognitive and language development, abnormal neurological exam findings, impaired behavioral and milestone development, and
- the abnormal properties include but are not limited to functional impairment of myelin- producing oligodendrocytes and Schwann cells, peripheral nerve conduction abnormalities, peripheral neuropathy with slow nerve conduction velocities (NCVs), brain magnetic resonance imaging (MRI) showing a typical white matter (for example, the splenium of the corpus callosum and parieto-occipital white matter, projection fibers, cerebellar white matter, basal ganglia, and the thalamus) pattern (for example, a“tigroid pattern” of radiating stripes with bands of normal signal intensity within the abnormal white matter, see, e.g., Gieselmann and Krageloh-Mann, 2010; Martin et al, 2012; van Rappard et al., 2015); U-fiber involvement and cerebellar changes, white matter demyelination, bilateral areas of white matter hypodensity, especially in the frontal lobes, and cerebral atrophy reflecting loss of myelin), abnormal levels of the brain biomarkers N-
- the clinical observations include but are not limited to gross motor disturbances that manifest as clumsiness, toe walking, and frequent falls; fine motor skills; gait abnormalities; spastic paraparesis or ataxic movement; neuromuscular difficulties; neurologic symptoms (signs of weakness, loss of coordination progressing to spasticity and incontinence); hypotonia, and depressed deep tendon reflexes; seizures; dementia; epilepsy; difficulty urinating spasticity; feeding difficulties; pain in the extremities; impaired language function; impaired cognitive skills; impaired vision and hearing; losing previously acquired motor and cognitive milestones; decline in school or job performance, inattention, abnormal behaviors, psychiatric symptoms, intellectual impairment, uncontrolled laughter, cortical disturbances (e.g., apraxia, aphasia, agnosia), alcohol or drug use, poor money management, emotional lability, inappropriate affect, and
- neuropsychiatric symptoms including psychosis, schizophrenia, delusions, and hallucinations.
- Disease progression refers to subject’s age of onset, frequency of appearance, severity, or recurrence, of a disease symptom.
- a delay in disease progression normally means an elevated age of onset, a lower frequency of appearance, a decreased severity, or less recurrence, of a disease symptom.
- the terms“increase”“decrease”“reduce”“ameliorate”“elevate” “lower”“higher”“less”“more”“improve”“delay”“impair”“abnormal”“thick” or any grammatical variation thereof, or any similar terms indication a change means a variation of about 5 fold, about 2 fold, about 1 fold, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5 % compared to the corresponding reference (e.g., untreated control or a subject in normal condition without MLD), unless otherwise specified.
- compositions and methods herein provide a fast-acting, disease-modifying treatment to symptomatic early onset patients for whom no standard of care exists (HSCT and HSC-GT are not efficacious); and/or provide a therapy that can preserve or correct both CNS pathologies and peripheral nerve function, the latter of which is not corrected by HSCT and causes progressive fine and gross motor function loss and respiratory failure; and/or provide an alternative treatment option to HSC-GT, which requires harsh myeloablative conditioning, is only efficacious when performed prior to onset of symptoms, and may not substantially address peripheral neuropathy in all patients.
- the patient receives a co-therapy for which they would not have been eligible without the rAAV, vector, composition or method described herein.
- co therapies may include enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) via umbilical cord blood (UCB), allogeneic peripheral blood stem cells, or allogeneic bone marrow.
- an immunosuppressive co-therapy may be used in a subject in need.
- Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
- a glucocorticoid e.g., steroids, antimetabolites, T-cell inhibitors
- a macrolide e.g., a rapamycin or rapalog
- cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
- the immune suppressant may include a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN-b, IFN-g, an opioid, or TNF-a (tumor necrosis factor-alpha) binding agent.
- the immunosuppressive therapy may be started 0, 1, 2, 3, 4, 5, 6, 7, or more days prior to or after the gene therapy administration.
- Such immunosuppressive therapy may involve administration of one, two or more drugs (e.g., glucocorticoids, prednelisone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin)).
- drugs e.g., glucocorticoids, prednelisone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin
- Such immunosuppressive drugs may be administrated to a subject in need once, twice or for more times at the same dose or an adjusted dose.
- Such therapy may involve co-administration of two or more drugs, the (e.g., prednelisone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin)) on the same day.
- One or more of these drugs may be continued after gene therapy administration, at the same dose or an adjusted dose.
- Such therapy may be for about 1 week
- an“expression cassette” refers to a nucleic acid molecule which comprises a coding sequence (e.g., a hARSA coding sequence), promoter, and may include other regulatory sequences therefor.
- the regulatory sequences necessary are operably linked to the hARSA coding sequence in a manner which permits its transcription, translation and/or expression in target cell.
- “operably linked” sequences include both expression control sequences that are contiguous with the hARSA coding sequence and expression control sequences that act in trans or at a distance to control the hARSA coding sequence.
- Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a Kozak sequence, a polyadenylation sequence, and a TATA signal.
- the promoter is a chicken beta actin promoter with a
- CB7 promoter e.g., nt 198 to nt 862 of SEQ ID NO: 5, also termed as hSyn or Syn herein.
- CB7 promoter e.g., nt 198 to nt 862 of SEQ ID NO: 5, also termed as hSyn or Syn herein.
- other promoters, or an additional promoter may be selected.
- a target cell is a nervous system cell, an oligodendrocyte, a microglia, a Central Nervous System (CNS) cell, a neuron in the CNS, a Peripheral Nervous System (PNS) cell, a Schwann cell, a macrophage in the PNS, or a cell in visceral organs (for example, a kidney cell, a liver cell and a gallbladder cell).
- the target cell may be a central nervous system cell.
- the target cell is one or more of an excitatory neuron, an inhibitory neuron, a glial cell, a cortex cell, a frontal cortex cell, a cerebral cortex cell, a spinal cord cell.
- the target cell is a peripheral nervous system (PNS) cell, for example a retina cell.
- PNS peripheral nervous system
- a target cell such as a monocyte, a B lymphocyte, a T lymphocyte, a NK cell, a lymph node cell, a tonsil cell, a bone marrow mesenchymal cell, a stem cell, a bone marrow stem cell, a heart cell, an epithelium cell, a esophagus cell, a stomach cell, a fetal cut cell, a colon cell, a rectum cell, a liver cell, a kindly cell, a lung cell, a salivary gland cell, a thyroid cell, an adrenal cell, a breast cell, a pancreas cell, an islet of Langerhans cell, a gallbladder cell, a prostate cell, a urinary bladder cell, a skin cell, a uterus cell, a cervix cell, a testis cell, or any other cell which expresses a functional hARSA protein in a subject without MLD.
- a monocyte such as a monocyte,
- the regulatory sequences comprise a ubiquitous promoter, for example a CB7 promoter.
- the regulatory elements comprise one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal.
- an additional or alternative promoter sequence may be included as part of the expression control sequences (regulatory sequences), e.g., located between the selected 5’ ITR sequence and the coding sequence.
- Constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], tissue specific promoters, or a promoter responsive to physiologic cues may be utilized in the vectors described herein.
- the promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV- 1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
- CMV human cytomegalovirus
- MBP myelin basic protein
- GFAP glial fibrillary acidic protein
- HSV- 1 herpes simplex virus
- LAP rouse
- an expression cassette may contain one or more other appropriate transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA for example WPRE; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
- RNA processing signals such as splicing and polyadenylation (poly A) signals
- sequences that stabilize cytoplasmic mRNA for example WPRE sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
- An example of a suitable enhancer is the CMV enhancer.
- Other suitable enhancers include those that are appropriate for desired target tissue indications.
- the regulatory sequences comprise one or more expression enhancers.
- the regulatory sequences contain two or more
- an enhancer may include a CMV immediate early enhancer (SEQ ID NO: 19). This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences.
- the expression cassette further contains an intron, e.g., the chicken beta-actin intron (SEQ ID NO: 17).
- the intron is a chimeric intron (CI)- a hybrid intron consisting of a human beta-globin splice donor and immunoglobulin G (IgG) splice acceptor elements.
- suitable introns include those known in the art, e.g., such as are described in WO 2011/126808.
- suitable polyA sequences include, e.g., Rabbit globin poly A, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyAs.
- one or more sequences may be selected to stabilize mRNA.
- An example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the polyA sequence and downstream of the coding sequence (see, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619). In certain embodiments, no WPRE sequence is present.
- another non-AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest.
- Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non- translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs.
- miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a“mature’" single stranded miRNA molecule.
- This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., m the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
- the expression cassette may further comprises a dorsal root ganglion (drg)-specific miRNA detargetting sequences to modulate expression levels in the CNS or peripheral dorsal root ganglia.
- the expression cassette or vector genome comprises one or more miRNA target sequences in the untranslated region (UTR) 3’ to a gene product coding sequence.
- UTR untranslated region
- at least two drg-specific miRNA target sequences are located in both 5’ and 3’ to the hARSA coding sequence.
- the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is selected from (i) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 20); (ii)
- the construct further comprises at least two tandem repeats comprise at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same or different.
- the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence.
- the start of the first of the at least two drg- specific miRNA tandem repeats is within 20 nucleotides from the 3’ end of the hARSA-coding sequence.
- the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3’ end of the hARSA-coding sequence.
- the miRNA tandem repeats comprise 200 to 1200 nucleotides in length.
- two or more consecutive miRNA target sequences are continuous and not separated by a spacer.
- two or more of the miRNA target sequences are separated by a spacer and each spacer is independently selected from one or more of (A) GGAT; (B) CACGTG; or (C) GCATGC.
- the spacer located between the miRNA target sequences may be located 3’ to the first miRNA target sequence and/or 5’ to the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same.
- no miR sequences are included in an expression cassette or vector genome.
- the AAVhu68 serotype which was selected as the capsid for
- AAVhu68.CB7.CI.hARSAco.RBG is 99% identical at the amino acid level to AAV9.
- AAVhu68 displays transduction characteristics in the nervous systems of NHPs and mice comparable to AAV9. This includes widespread transduction of cortical neurons (data not shown) and a small subset of myelin-producing oligodendrocytes.
- AAVhu68 transduces motor neurons with axons projecting into the PNS and DRG sensory neurons with axons projecting into the spinal cord and peripheral nerves (data not shown). Transduction was observed in lower motor neurons of the ventral horn and sensory neurons of the DRG. The transduced motor neurons have axons that contribute to the peripheral nerves.
- the AAVhu68 capsid targets cells in the CNS and PNS, which are both affected in MLD patients. Additionally, while newly synthesized ARSA can be transported directly from the trans-Golgi network to the lysosome, it can also be secreted and taken up by other cells via mannose-6-phosphate receptors where it is subsequently trafficked to the lysosomes. Thus, the underlying defect can be cross-corrected by rAAVhu68.hARSA expressing ARSA enzyme supplied to neighboring cells of the CNS that lack functional enzyme.
- AAVhu68 (previously termed AAV3G2) varies from another Clade F virus AAV9 by two encoded amino acids at positions 67 and 157 of vpl, based on the numbering of SEQ ID NO: 7.
- the other Clade F AAV (AAV9, hu31, hu31) have an Ala at position 67 and an Ala at position 157.
- the AAV capsid stereotype may be selected from AAVhu31 vpl (SEQ ID NOs: 11 and 12) or AAVhu32 vpl (SEQ ID NOs: 13 and 14).
- the term“clade” as it relates to groups of AAV refers to a group of AAV which are phylogenetic ally related to one another as determined using a Neighbor- Joining algorithm by a bootstrap value of at least 75% (of at least 1000 replicates) and a Poisson correction distance measurement of no more than 0.05, based on alignment of the AAV vpl amino acid sequence.
- the Neighbor- Joining algorithm has been described in the literature. See, e.g., M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000). Computer programs are available that can be used to implement this algorithm.
- the MEGA v2.1 program implements the modified Nei-Gojobori method.
- the sequence of an AAV vpl capsid protein one of skill in the art can readily determine whether a selected AAV is contained in one of the clades identified herein, in another clade, or is outside these clades. See, e.g., G Gao, et al, J Virol, 2004 Jun; 78(10): 6381-6388, which identifies Clades A, B, C, D, E and F, and provides nucleic acid sequences of novel AAV, GenBank Accession Numbers AY530553 to AY530629. See, also, WO 2005/033321.
- an AAVhu68 capsid is further characterized by one or more of the following.
- AAVhu68 capsid proteins comprise: AAVhu68 vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 7, vpl proteins produced from SEQ ID NO: 6, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 6 which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 7;
- the AAVhu68 vpl, vp2 and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence which encodes the full-length vpl amino acid sequence (amino acid 1 to 736).
- the vpl-encoding sequence is used alone to express the vpl, vp2 and vp3 proteins.
- this sequence may be co-expressed with one or more of a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence (about aa 203 to 736) without the vpl-unique region (about aa 1 to about aa 137) and/or vp2- unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA or tRNA (for example, the mRNA transcribed from about nucleotide (nt) 607 to about nt 2211 of SEQ ID NO: 6), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 6 which encodes aa 203 to 736 of SEQ ID NO: 7.
- a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence (about a
- the vpl-encoding and/or the vp2-encoding sequence may be co-expressed with the nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 7 (about aa 138 to 736) without the vpl- unique region (about aa 1 to about 137), or a strand complementary thereto, the corresponding mRNA or tRNA (for example, the mRNA transcribed from nt 412 to 2211 of SEQ ID NO: 6), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 6 which encodes about aa 138 to 736 of SEQ ID NO: 7.
- a rAAVhu68 has a rAAVhu68 capsid produced in a production system expressing capsids from an AAVhu68 nucleic acid sequence which encodes the vpl amino acid sequence of SEQ ID NO: 7, and optionally additional nucleic acid sequences, e.g., encoding a vp 3 protein free of the vpl and/or vp2 -unique regions.
- the rAAVhu68 resulting from production using a single nucleic acid sequence vpl produces the heterogenous populations of vpl proteins, vp2 proteins and vp3 proteins.
- the AAVhu68 capsid contains subpopulations within the vp 1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 7.
- These subpopulations include, at a minimum, deamidated asparagine (N or Asn) residues.
- asparagines in asparagine - glycine pairs are highly deamidated.
- the AAVhu68 vpl nucleic acid sequence has the sequence of SEQ ID NO: 6, or a strand complementary thereto, e.g., the corresponding mRNA or tRNA.
- the vp2 and/or vp3 proteins may be expressed additionally or alternatively from different nucleic acid sequences than the vpl, e.g., to alter the ratio of the vp proteins in a selected expression system.
- nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 7 (about aa 203 to 736) without the vpl-unique region (about aa 1 to about aa 137) and/or vp2 -unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 6).
- nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 7 (about aa 138 to 736) without the vpl-unique region (about aa 1 to about 137), or a strand complementary thereto, the corresponding mRNA or tRNA (nt 412 to 2211 of SEQ ID NO: 6).
- nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 7 may be selected for use in producing rAAVhu68 capsids.
- the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 6 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 6 which encodes SEQ ID NO: 7.
- the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 6 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 6 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 7.
- the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 6 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt 607 to about nt 2211 of SEQ ID NO: 6 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 7.
- nucleic acid sequences encoding this AAVhu68 capsid including DNA (genomic or cDNA), or RNA (e.g., mRNA).
- the nucleic acid sequence encoding the AAVhu68 vpl capsid protein is provided in SEQ ID NO: 6. See, WO 2018/160582 which is incorporated herein by reference in its entirety.
- the AAVhu68 capsid is produced using a nucleic acid sequence of SEQ ID NO: 6 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, which encodes the vpl amino acid sequence of SEQ ID NO: 7 with a modification (e.g., deamidated amino acid) as described herein.
- the vpl amino acid sequence is reproduced in SEQ ID NO: 7.
- the term“heterogenous” or any grammatical variation thereof refers to a population consisting of elements that are not the same, for example, having vpl, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.
- SEQ ID NO: 7 provides the encoded amino acid sequence of the AAVhu68 vpl protein.
- AAV capsid contains subpopulations within the vp 1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
- certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally liirther comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
- N highly deamidated asparagines
- a“subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified.
- a“subpopulation” of vpl proteins is at least one (1) vpl protein and less than all vpl proteins in an assembled AAV capsid, unless otherwise specified.
- A“subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified.
- vpl proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid.
- vpl, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.
- highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagines at amino acid 57 based on the numbering of SEQ ID NO: 7 (AAVhu68) may be deamidated based on the total vpl proteins may be deamidated based on the total vpl, vp2 and vp3 proteins).
- Such percentages may be determined using 2D-gel, mass spectrometry techniques, or other suitable techniques.
- the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues.
- Efficient capsid assembly of the majority of deamidation vpl proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vpl, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics.
- VP deamidation in the VP 1 -unique (VPl-u) region ( ⁇ aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly.
- the deamidation of N may occur through its C-terminus residue’s backbone nitrogen atom conducts a nucleophilic attack to the Asn's side chain amide group carbon atom.
- An intermediate ring-closed succinimide residue is believed to form.
- the succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate e.g., as illustrated below.
- each deamidated N in the VP1 , YP2 or VP3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and/or an interconverting blend of Asp and isoAsp, or combinations thereof.
- Any suitable ratio of a- and isoaspartic acid may be present.
- the ratio may be from 10: 1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic: isoaspartic, or about 1 :3 aspartic: isoaspartic, or another selected ratio.
- one or more glutamine (Q) may deamidates to glutamic acid (Glu), i.e., a-glutamic acid, g-glutamic acid (Glu), or a blend of a- and g-glutamic acid, which may interconvert through a common glutarinimide intermediate.
- Glu glutamic acid
- Any suitable ratio of a- and y- glutamic acid may be present.
- the ratio may be from 10: 1 to 1 : 10 a to g, about 50:50 a: g, or about 1 :3 a : g, or another selected ratio.
- an rAAV includes subpopulations within the rAAV capsid of vpl, vp2 and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine.
- other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions.
- modifications may include an amidation at an Asp position.
- an AAV capsid contains subpopulations of vpl, vp2 and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, of which at least 1% to 10% are deamidated as compared to the encoded amino acid sequence of the vp proteins.
- N residues The majority of these may be N residues. However, Q residues may also be deamidated.
- a rAAV has an AAV capsid having vpl, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four or more deamidated residues at the positions set forth in the table provided in Example 11 and incorporated herein by reference.
- Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry (MS), and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific).
- MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200-2000 m/z). Sequencing is performed via higher energy collisional dissociation
- fragmentation with a target value of le5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z.
- Survey scans were acquired at a resolution of 120,000 at m/z 200.
- Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30.
- the S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest.
- Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection.
- BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired.
- For peptide mapping searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as
- proteases may include, e.g., trypsin or chymotrypsin.
- Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between -OH and -NH2 groups). The percent deamidation of a particular peptide is determined by the mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides.
- isobaric species which are deamidated at different sites may co-migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation. It is understood by one of skill in the art that a number of variations on these illustrative methods can be used.
- suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
- QTOF quadrupole time of flight mass spectrometer
- suitable orbitrap instrument such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
- liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series).
- Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfmder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions).
- modifications may occur that do not result in conversion of one amino acid to a different amino acid residue.
- modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations.
- the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation.
- the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups).
- amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates.
- a mutant AAV capsid as described herein contains a mutation in an arginine - glycine pair, such that the glycine is changed to an alanine or a serine.
- a mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs.
- an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs.
- a mutant AAV capsid contains only a single mutation in an NG pair.
- a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP 1 -unique region. In certain embodiments, one of the mutations is in the VP 1 -unique region.
- a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.
- the AAVhu68 capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 7. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
- certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs in SEQ ID NO: 7 and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
- SEQ ID NO: 8 provide an amino acid sequence of a modified AAVhu68 capsid, illustrating positions which may have some percentage of deamidated or otherwise modified amino acids. The various combinations of these and other modifications are described herein.
- an“AAV9 capsid” is a self-assembled AAV capsid composed of multiple AAV9 vp proteins.
- the AAV9 vp proteins are typically expressed as alternative splice variants encoded by a nucleic acid sequence of SEQ ID NO: 9 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% thereto, which encodes the vpl amino acid sequence of GenBank accession: AAS99264.
- “AAV9 capsid” includes an AAV having an amino acid sequence which is 99% identical to AAS99264 or 99% identical to SEQ ID NO: 10. See, also US7906111 and WO 2005/033321.
- “AAV9 variants” include those described in, e.g., W02016/049230, US 8,927,514, US 2015/0344911, and US 8,734,809.
- nucleic acid indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences.
- the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein.
- sequence identity “percent sequence identity” or“percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence.
- the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
- “percent sequence identity” may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof.
- a fragment is at least about 8 amino acids in length and may be up to about 700 amino acids. Examples of suitable fragments are described herein.
- substantially homology indicates that, when optimally aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary strand), there is amino acid sequence identity in at least about 95 to 99% of the aligned sequences.
- the homology is over full-length sequence, or a protein thereof, e.g., a cap protein, a rep protein, or a fragment thereof which is at least 8 amino acids, or more desirably, at least 15 amino acids in length.
- “highly conserved” is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art.
- aligned sequences or“alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. In the examples, AAV alignments are performed using the published AAV9 sequences as a reference point.
- Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include,“Clustal Omega”,“Clustal W”,“CAP Sequence Assembly”,“MAP”, and“MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences.
- FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences.
- percent sequence identity between nucleic acid sequences can be determined using FastaTM with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.
- Multiple sequence alignment programs are also available for amino acid sequences, e.g., the“Clustal Omega”, “Clustal X”,“MAP”,“PIMA”,“MSA”,“BLOCKMAKER”,“MEME”, and“Match-Box” programs.
- any of these programs are used at default settings, although one of skill in the art can alter these settings as needed.
- one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res.,“A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999).
- rAAV replication-defective adeno-associated virus
- Arylsulfatase A gene SBA
- MLD Metachromatic Leukodystrophy
- the rAAV is desirably replication-defective and carries a vector genome comprising inverted terminal repeats (ITR) and a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell.
- ITR inverted terminal repeats
- hARSA functional human Arylsulfatase A
- the hARSA coding sequence comprises a sequence of nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto which encodes a functional hARSA.
- the vector genome comprises inverted terminal repeats (ITR) and an expression cassette as described in Part III.
- the rAAV comprises an AAV capsid.
- the AAV capsid may be selected based on the target cell.
- the AAV capsid is suitable for delivery of the vector genome in nervous system (for example, CNS or PNS).
- the AAV capsid is suitable for delivery of the vector genome in a neuron, a nervous system cell, an oligodendrocyte, a microglia, a Central Nervous System (CNS) cell, a neuron in the CNS, a Peripheral Nervous System (PNS) cell, a Schwann cell, a macrophage in the PNS, or a cell in visceral organs (for example, a kidney cell, a liver cell and a gallbladder cell).
- the AAV capsid is suitable for delivery of the vector genome in another target cell as described herein.
- the AAV capsid is selected from a cy02 capsid, a rh43 capsid, an AAV8 capsid, a rhOl capsid, an AAV9 capsid, an rh8 capsid, a rhlO capsid, a bbOl capsid, a hu37 capsid, a rh02 capsid, a rh20 capsid, a rh39 capsid, a rh64 capsid, an AAV6 capsid, an AAV1 capsid, a hu44 capsid, a hu48 capsid, a cy05 capsid a hul 1 capsid, a hu32 capsid, a pi2 capsid, or a variation thereof.
- the AAV capsid is a Clade F capsid, such as AAV9 capsid, AAVhu68 capsid, AAV-PHP.B capsid, hu31 capsid, hu32 capsid, or a variation thereof. See, e.g., WO 2005/033321 published April 14, 2015, WO 2018/160582, and US 2015/0079038, each of which is incorporated herein by reference in its entirety.
- the AAV capsid is a non-clade F capsid, for example a Clade A, B, C, D, or E capsid.
- the non-Clade F capsid is an AAV 1 or a variation thereof.
- the AAV capsid transduces a target cell other than the nervous system cells.
- the AAV capsid is a Clade A capsid (e.g., AAV1, AAV6), a Clade B capsid (e.g., AAV 2), a Clade C capsid (e.g., hu53), a Clade D capsid (e.g., AAV7), or a Clade E capsid (e.g., rhlO). Still, other AAV capsid may be chosen.
- the rAAV comprises an AAVhu68 capsid in which the vector genome is packaged.
- the AAVhu68 capsid is produced from a sequence encoding the predicted amino acid sequence of SEQ ID NO: 7. See, Part V for more details.
- the vector genome is entirely exogenous to the AAVhu68 capsid, as it contains no AAVhu68 genomic sequences.
- the functional hARSA has a signal peptide and a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2.
- the native hARSA signal peptide is used, e.g., aa 1 to aa 18 of SEQ ID NO: 2.
- the signal peptide has an amino acid sequence of aa 1 to aa 20 of SEQ ID NO: 4.
- the functional hARSA has an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4.
- the hARSA coding sequence is about 95% to 100% identical to nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1.
- the hARSA-coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3.
- the hARSA coding sequence encodes a sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2.
- the hARSA coding sequence encodes a sequence of SEQ ID NO: 2 or SEQ ID NO: 4. See, Part I for more details about hARSA coding sequence.
- the regulatory sequences direct hARSA expression in nervous system cells.
- the regulatory sequences comprise a ubiquitous promoter, for example, a CB7 promoter.
- the regulatory elements comprise one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal.
- the regulatory sequences comprise one or more of the following: a regulatory element derived from the chicken b-actin (BA) promoter and human
- CMV IE cytomegalovirus immediate-early enhancer
- rBG rabbit b- globin
- Poly A polyadenylation signal derived from the rBG gene
- the vector genome has a sequence of nucleotide (nt)
- the rAAV or a composition comprising the rAAV is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD), and/or to delay progression of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD). See, part II for more details.
- the rAAV as described herein is suitable for administration to a patient via an intra-cistema magna injection (ICM), including via a CT-guided sub-occipital injection into the cisterna magna.
- ICM intra-cistema magna injection
- the rAAV as described herein is suitable for administration to a subject who is 7 years of age or younger.
- the rAAV as described herein is suitable for administration to a subject in need thereof to ameliorate symptoms of Metachromatic Leukodystrophy or a disease associated with
- Arylsulfatase A (ARSA) gene mutation and/or to delay progression of Metachromatic
- the rAAV as described herein is administered in a single dose.
- the vector genome is a single-stranded AAV vector genome.
- a rAAV vector may be utilized in the invention which contains self complementary (sc) AAV vector genome.
- the regulatory control elements necessary are operably linked to the gene (e.g., hARSA coding sequence) in a manner which permits its transcription, translation and/or expression in a cell which takes up the rAAV.
- “operably linked” sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
- Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a polyA, a self-cleaving linker (e.g., form, furin-F2A, an IRES).
- a self-cleaving linker e.g., form, furin-F2A, an IRES.
- promoters may be selected.
- an additional or alternative promoter sequence may be included as part of the expression control sequences (regulatory sequences), e.g., located between the selected 5’ ITR sequence and the coding sequence.
- Constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], tissue specific promoters, or a promoter responsive to physiologic cues may be utilized in the vectors described herein.
- the promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron- specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
- CMV human cytomegalovirus
- MBP myelin basic protein
- GFAP glial fibrillary acidic protein
- HSV-1 herpes simplex virus
- LAP rouse
- a vector may contain one or more other appropriate transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA for example WPRE; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
- RNA processing signals such as splicing and polyadenylation (polyA) signals
- sequences that stabilize cytoplasmic mRNA for example WPRE sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
- An example of a suitable enhancer is the CMV enhancer.
- the regulatory sequences comprise one or more expression enhancers.
- the regulatory sequences contain two or more expression enhancers. These enhancers may be the same or may differ from one another.
- an enhancer may include a CMV immediate early enhancer (SEQ ID NO: 19). This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences.
- the expression cassette further contains an intron, e.g., the chicken beta-actin intron (SEQ ID NO:
- the intron is a chimeric intron (Cl)- a hybrid intron consisting of a human beta-globin splice donor and immunoglobulin G (IgG) splice acceptor elements.
- suitable introns include those known in the art, e.g., such as are described in WO 2011/126808.
- suitable polyA sequences include, e.g., SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyAs.
- one or more sequences may be selected to stabilize mRNA.
- WPRE sequence is a modified WPRE sequence, which may be engineered upstream of the polyA sequence and downstream of the coding sequence (see, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619). In certain embodiments, no WPRE sequence is present.
- non-AAV coding sequence in addition to the hARSA coding sequence, another non-AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest.
- Useful gene products may include rniRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non-trans!ated RNA products. miRN As exhibit their activity through sequence-specific interactions with the 3' untranslated regions (IJTR) of target mRNAs.
- IJTR 3' untranslated regions
- miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule.
- This mature miRNA guides a multiprotein complex, miRTSC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
- the AAV sequences of the vector typically comprise the cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (See, e.g., B. J. Carter, in“Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155 168 (1990)).
- the ITR sequences are about 145 base pairs (bp) in length.
- substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of these sequences is permissible.
- the ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al, “Molecular Cloning.
- ⁇ ITR A shortened version of the 5’ ITR, termed ⁇ ITR. has been described in which the D-sequence and terminal resolution site (trs) are deleted.
- the full-length AAV 5’ and 3’ ITRs are used.
- ITRs from other AAV sources may be selected.
- the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.
- pseudotyped the pseudotyped.
- other configurations of these elements may be suitable.
- vector genomes are constructed which comprise a 5’ AAV ITR - promoter - optional enhancer - optional intron - hARSA coding sequence- polyA - 3’ ITR, termed as AAV.promoter.optional enhancer. optional intron.hARSA or hARSAco.polyA.
- the ITRs are from AAV2.
- more than one promoter is present.
- the enhancer is present in the vector genome.
- more than one enhancer is present.
- an intron is present in the vector genome.
- the enhancer and intron are present.
- the intron is a chimeric intron (Cl)- a hybrid intron consisting of a human beta- globin splice donor and immunoglobulin G (IgG) splice acceptor elements.
- the polyA is an SV40 poly A (i.e., a polyadenylation (PolyA) signal derived from Simian Virus 40 (SV40) late genes).
- the polyA is a rabbit beta-globin (RBG) poly A.
- the vector genome comprises a 5’ AAV ITR - CB7 promoter - hARSA coding sequence - poly A - 3’ ITR.
- a vector genome or a rAAV comprising the vector genome is illustrated herein as AAV.promoter (optional).
- Kozak (optional).intron (optional).hARSA coding sequence (e.g., hARSA, hARSAco). miRNA (optional).polyA(optionl).
- Staffer (optional).
- a rAAV is illustrated herein as AAVcapsid.promoter (optional). Kozak
- a production system useful for producing the rAAV is provided.
- cells were cultured which comprises a nucleic acid sequence encoding an AAVhu68 capsid protein, a vector genome as described herein and sufficient AAV rep functions and helper functions to permit packaging of the vector genome into the AAV capsid.
- the vector genome has a sequence of nt 1 to nt 3883 of SEQ ID NO: 5.
- the cell culture is a human embryonic kidney 293 cell culture.
- the AAV rep is from an AAV different from AAVhu68, for example, from AAV2.
- the AAV rep coding sequence and cap genes are on the same nucleic acid molecule, wherein there is optionally a spacer between the rep sequence and cap gene.
- the spacer is atgacttaaaccaggt (SEQ ID NO: 24).
- the vector genomes can be carried on any suitable vector, e.g., a plasmid, which is delivered to a packaging host cell.
- a suitable vector e.g., a plasmid
- the plasmids useful in this invention may be engineered such that they are suitable for replication and packaging in vitro in prokaryotic cells, insect cells, mammalian cells, among others. Suitable transfection techniques and packaging host cells are known and/or can be readily designed by one of skill in the art. An illustrative production process is provided in FIGs. 6-7.
- the plasmid has a sequence of SEQ ID NO: 5.
- AAVs suitable for use as vectors are known in the art. See generally, e.g., Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem.
- the ITRs are the only AAV components required in cis in the same construct as the nucleic acid molecule containing the gene.
- the cap and rep genes can be supplied in trans.
- the selected genetic element may be delivered to an AAV packaging cell by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
- Stable AAV packaging cells can also be made.
- the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
- AAV intermediate or“AAV vector intermediate” refers to an assembled rAAV capsid which lacks the desired genomic sequences packaged therein. These may also be termed an“empty” capsid. Such a capsid may contain no detectable genomic sequences of an expression cassette, or only partially packaged genomic sequences which are insufficient to achieve expression of the gene product. These empty capsids are non-fimctional to transfer the gene of interest to a host cell.
- the recombinant adeno-associated virus (AAV) described herein may be generated using techniques which are known. See, e.g., WO 2003/042397; WO 2005/033321, WO 2006/110689; US 7588772 B2.
- Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; an expression cassette composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein.
- ITRs AAV inverted terminal repeats
- a production cell culture useful for producing a recombinant AAVhu68 contains a nucleic acid which expresses the AAVhu68 capsid protein in the host cell; a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, e.g., a vector genome which contains AAV ITRs and a non-AAV nucleic acid sequence encoding a gene operably linked to regulatory sequences which direct expression of the gene in a host cell; and sufficient AAV rep functions and adenovirus helper functions to permit packaging of the vector genome into the recombinant AAVhu68 capsid.
- the cell culture is composed of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., Spodoptera frugiperda (Sf9) cells).
- mammalian cells e.g., human embryonic kidney 293 cells, among others
- insect cells e.g., Spodoptera frugiperda (Sf9) cells.
- baculovirus provides the helper functions necessary for packaging the vector genome into the recombinant AAVhu68 capsid.
- the rep functions are provided by an AAV other than AAVhu68.
- at least parts of the rep functions are from AAVhu68.
- the rep protein is a heterologous rep protein other than AAVhu68rep, for example but not limited to, AAV1 rep protein, AAV2 rep protein, AAV3 rep protein, AAV4 rep protein, AAV5 rep protein, AAV6 rep protein, AAV7 rep protein, AAV8 rep protein; or rep 78, rep 68, rep 52, rep 40, rep68/78 and rep40/52; or a fragment thereof; or another source. Any of these AAVhu68 or mutant AAV capsid sequences may be under the control of exogenous regulatory control sequences which direct expression thereof in a host cell.
- cells are manufactured in a suitable cell culture (e.g., HEK 293 or Sf9) or suspension.
- Methods for manufacturing the gene therapy vectors described herein include methods well known in the art such as generation of plasmid DNA used for production of the gene therapy vectors, generation of the vectors, and purification of the vectors.
- the gene therapy vector is an AAV vector and the plasmids generated are an AAV cis-plasmid encoding the AAV vector genome and the gene of interest, an AAV trans-plasmid containing AAV rep and cap genes, and an adenovirus helper plasmid.
- the vector generation process can include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with the plasmid DNA, post-transfection medium exchange to serum free medium, and the harvest of vector-containing cells and culture media.
- the harvested vector- containing cells and culture media are referred to herein as crude cell harvest.
- the gene therapy vectors are introduced into insect cells by infection with baculovirus- based vectors.
- the crude cell harvest may thereafter be subject method steps such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and/or formulation and filtration to prepare bulk vector.
- a two-step affinity chromatography purification at high salt concentration followed anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids. These methods are described in more detail in WO 2017/160360, International Patent Application No. PCT US2016/065970, filed December 9, 2016 and its priority documents, US Patent Application Nos. 62/322,071, filed April 13, 2016 and 62/226,357, filed December 11, 2015 and entitled“Scalable Purification Method for AAV9”, which is incorporated by reference herein.
- GC genome copies
- the number of particles (pt) per 20 mL loaded is then multiplied by 50 to give particles (pt) /mL.
- Pt/mL divided by GC/mL gives the ratio of particles to genome copies
- the methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon.
- Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti -AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al, J. Virol. (2000) 74:9281-9293).
- a secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase.
- a method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit.
- a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit.
- samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex).
- Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or coomassie stains.
- the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR).
- Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqManTM
- an optimized q-PCR method which utilizes a broad spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More
- the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size.
- the proteinase K buffer may be concentrated to 2 fold or higher.
- proteinase K treatment is about 0.2 mg/mL, but may be varied from 0.1 mg/mL to about 1 mg/mL.
- the treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes).
- heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000 fold) and subjected to TaqMan analysis as described in the standard assay.
- droplet digital PCR may be used.
- ddPCR droplet digital PCR
- methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb 14.
- the method for separating rAAVhu68 particles having packaged genomic sequences from genome-deficient AAVhu68 intermediates involves subjecting a suspension comprising recombinant AAVhu68 viral particles and AAVhu68 capsid intermediates to fast performance liquid chromatography, wherein the AAVhu68 viral particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at a pH of about 10.2, and subjected to a salt gradient while monitoring eluate for ultraviolet absorbance at about 260 nanometers (nm) and about 280 nm.
- the pH may be in the range of about 10.0 to 10.4.
- the AAVhu68 full capsids are collected from a fraction which is eluted when the ratio of A260/A280 reaches an inflection point.
- the diafiltered product may be applied to a Capture SelectTM Poros- AAV2/9 affinity resin (Life Technologies) that efficiently captures the AAV2/hu68 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles are efficiently captured.
- the rAAV.hARSA is suspended in a suitable physiologically compatible composition (e.g., a buffered saline).
- a suitable physiologically compatible composition e.g., a buffered saline
- This composition may be frozen for storage, later thawed and optionally diluted with a suitable diluent.
- the vector may be prepared as a composition which is suitable for delivery to a patient without proceeding through the freezing and thawing steps.
- NAb titer a measurement of how much neutralizing antibody (e.g., anti-AAV Nab) is produced which neutralizes the physiologic effect of its targeted epitope (e.g., an AAV).
- Anti-AAV NAb titers may be measured as described in, e.g., Calcedo, R., et al, Worldwide Epidemiology of Neutralizing Antibodies to Adeno- Associated Viruses. Journal of Infectious Diseases, 2009. 199(3): p. 381-390, which is incorporated by reference herein.
- sc refers to self-complementary.
- Self-complementary AAV refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double -stranded DNA template.
- dsDNA double stranded DNA
- A“replication-defective virus” or "viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
- the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the gene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production.
- rAAV particles are referred to as DNase resistant.
- DNase endonuclease
- other endo- and exo- nucleases may also be used in the purification steps described herein, to remove contaminating nucleic acids.
- Such nucleases may be selected to degrade single stranded DNA and/or double-stranded DNA, and RNA.
- Such steps may contain a single nuclease, or mixtures of nucleases directed to different targets, and may be endonucleases or exonucleases.
- nuclease-resistant indicates that the AAV capsid has fully assembled around the expression cassette which is designed to deliver a gene to a host cell and protects these packaged genomic sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process.
- a vector which is useful for treating a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD) in a subject in need thereof.
- the vector carries a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under the control of regulatory sequences which direct the hARSA expression in a target cell.
- hARSA coding sequence is about 95% to 100% identical to SEQ ID NO: 1.
- the function hARSA protein has an amino acid sequence of SEQ ID NO: 2.
- the hARSA-coding sequence is SEQ ID NO: 1.
- the vector or a composition comprising the vector is administrable to a subject in need thereof to ameliorate symptoms of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD), and/or to delay progression of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A (for example, MLD).
- a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A for example, MLD
- MLD functional Arylsulfatase A
- the vector comprises an expression cassette.
- the expression cassette comprises a nucleic acid sequence encoding a functional human Arylsulfatase A (hARSA) under control of regulatory sequences which direct the hARSA expression.
- the functional hARSA protein comprises a signal peptide and an amino acid sequence of amino acid (aa) 19 to aa 507 of SEQ ID NO: 2.
- the signal peptide has an amino acid sequence of aa 1 to aa 18 of SEQ ID NO: 2 or an amino acid sequence of aa 1 to aa 20 of SEQ ID NO: 4.
- the hARSA coding sequence has a sequence of nucleotide (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto which encodes a functional hARSA.
- the hARSA coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. See, Parts I, and III for more details.
- the vector is a viral vector selected from a recombinant parvovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adenovirus; or a non-viral vector selected from naked DNA, naked RNA, an inorganic particle, a lipid particle, a polymer-based vector, or a chitosan-based formulation.
- the selected vector may be delivered by any suitable method, including transfection, electroporation liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
- the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques.
- the vector is suitable for administration to a patient via an intra- cistema magna injection (ICM), including via a CT-guided sub-occipital injection into the cistema magna.
- ICM intra- cistema magna injection
- the vector is suitable for administration to a subject who is 7 years of age or younger.
- the vector is suitable for administration to a subject in need thereof to ameliorate symptoms of Metachromatic Leukodystrophy or a disease associated with Arylsulfatase A (ARSA) gene mutation, and/or to delay progression of
- the vector is administered in a single dose. See, Part II and Part VIII for more details.
- A“replication-defective virus” or "viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest (e.g., hARSA coding sequence) is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
- the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production.
- replication-defective viruses may be adeno-associated viruses (AAV), adenoviruses, lentiviruses (integrating or non-integrating), or another suitable virus source.
- AAV adeno-associated viruses
- adenoviruses adenoviruses
- lentiviruses integrating or non-integrating
- a composition comprising a rAAV or a vector as described herein and an aqueous suspension media.
- the aqueous composition is provided which comprises a formulation buffer and the rAAV or vector as described.
- the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant.
- the formulation buffer comprises about 0.0005 % to about 0.001% surfactant.
- the composition is at a pH of 7.2 to 7.8.
- AAV.CB7.CI.hARSAco.rBG drug product consists of a non-replicating recombinant adeno -associated viral (rAAV) vector as described herein and a formulation buffer.
- an aqueous pharmaceutical composition comprising a rAAV according to any one of claims 1 to 10 and a formulation buffer
- the formulation buffer comprises: an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant.
- the surfactant is present at 0.0005 % to about 0.001% of the pharmaceutical composition.
- the composition is at a pH in the range of 7.5 to 7.8.
- the formulation buffer is suitable for intravenous delivery, intrathecal administration, or intracerebroventricular administration.
- a pharmaceutical composition comprising a vector as described and a formulation buffer.
- the formulation buffer is suitable for intravenous delivery, intrathecal administration, or intracerebroventricular administration.
- the composition is suitable for administration to a patient via an intra-cistema magna injection (ICM), including via a CT-guided sub-occipital injection into the cistema magna.
- ICM intra-cistema magna injection
- the composition is suitable for administration to a subject who is 7 years of age or younger.
- the composition is suitable for administration to a subject in need thereof to ameliorate symptoms of Metachromatic
- the composition is administered in a single dose.
- the composition has an at least 2.50 x 10 13 GC rAAV per mL.
- compositions containing at least one rAAV stock e.g., an rAAVhu68 stock or a mutant rAAVhu68 stock
- an optional carrier, excipient and/or preservative e.g., an rAAV stock or a mutant rAAVhu68 stock
- An rAAV stock refers to a plurality of rAAV vectors which are the same, e.g., such as in the amounts described below in the discussion of concentrations and dosage units.
- “earner” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions.
- pharmaceutically-acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
- Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells
- the rAAV vector delivered vector genomes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
- a composition in one embodiment, includes a final formulation suitable for delivery to a subject, e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration.
- a final formulation suitable for delivery to a subject e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration.
- one or more surfactants are present in the formulation.
- the composition may be transported as a concentrate which is diluted for administration to a subject.
- the composition may be lyophilized and reconstituted at the time of administration.
- a suitable surfactant, or combination of surfactants may be selected from among non ionic surfactants that are nontoxic.
- a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Pluronic ® F68
- Poloxamer 188 which has a neutral pH, has an average molecular weight of 8400.
- Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (polyethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol.
- the formulation contains a poloxamer.
- Poloxamer 188 is selected.
- the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on weight ratio, w/w %) of the suspension. In another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on volume ratio, v/v %) of the suspension.
- the surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension, wherein n % indicates n gram per 100 mL of the suspension. In yet another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on weight over volume ratio, v/w %) of the suspension.
- “%” upon referring to a concentration is a weight ratio, for example, percentage of the substance (to be dissolved via a solvent into a solution ) weight over the solvent’s weight, or percentage of the substance (to be dissolved via a solvent into a solution ) weight over the solution’s weight.
- “%” upon referring to a concentration is a volume ratio, for example, percentage of the substance (to be dissolved via a solvent into a solution ) volume over the solvent’s volume, or percentage of the substance (to be dissolved via a solvent into a solution ) volume over the solution’s volume.
- “%” upon referring to a concentration indicates gram of the substance (to be dissolved via a solvent into a solution ) per 100 mL of the solvent or solution. In certain embodiments,“%” upon referring to a concentration, is a weight over volume ratio, for example, percentage of the substance (to be dissolved via a solvent into a solution ) weight over the solvent’s volume, or percentage of the substance (to be dissolved via a solvent into a solution ) weight over the solution’s volume.
- the vectors are administered in sufficient amounts to transfect the cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts.
- Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., brain, CSF, the liver (optionally via the hepatic artery), lung, heart, eye, kidney,), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, intraparenchymal, intracerebroventricular, intrathecal, ICM, lumbar puncture and other parenteral routes of administration. Routes of administration may be combined, if desired.
- a therapeutically effective human dosage of the viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about 1 x 10 9 to 1 x 10 16 vector genome copies.
- a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL suspension is delivered.
- a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL suspension is delivered.
- a dose of about 8.9 x 10 12 to 2.7 x 10 14 GC total is administered in this volume. In certain embodiments, a dose of about 1.1 x 10 10 GC/g brain mass to about 3.3 x 10 11 GC/g brain mass is administered in this volume.
- the dosage is adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
- the levels of expression of the transgene product can be monitored to determine the frequency of dosage resulting in viral vectors, preferably AAV vectors containing the minigene.
- dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the invention.
- the replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 16 GC (to treat an subject) including all integers or fractional amounts within the range, and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
- the compositions are formulated to contain at least lx10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 9 , 7x10 9 , 8x10 9 , or 9x10 9 GC per dose including all integers or fractional amounts within the range.
- the compositions are formulated to contain at least 1x10 10 , 2x10 10 ,
- compositions are formulated to contain at least lx10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per dose including all integers or fractional amounts within the range.
- the compositions are formulated to contain at least lx10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per dose including all integers or fractional amounts within the range.
- compositions are formulated to contain at least lx10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , or 9x10 12 GC per dose including all integers or fractional amounts within the range.
- compositions are formulated to contain at least lx10 13 ,
- compositions are formulated to contain at least lx10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per dose including all integers or fractional amounts within the range.
- the compositions are formulated to contain at least lx10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per dose including all integers or fractional amounts within the range.
- compositions are formulated to contain at least lx10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , or 9x10 15 GC per dose including all integers or fractional amounts within the range.
- the dose can range from lx10 10 to about lx10 12 GC per dose including all integers or fractional amounts within the range.
- the volume of carrier, excipient or buffer is at least about 25 mL. In one embodiment, the volume is about 50 mL. In another embodiment, the volume is about 75 mL. In another embodiment, the volume is about 100 mL. In another embodiment, the volume is about 125 mL. In another embodiment, the volume is about 150 mL. In another embodiment, the volume is about 175 mL.
- the volume is about 200 mL. In another embodiment, the volume is about 225 mL. In yet another embodiment, the volume is about 250 mL. In yet another embodiment, the volume is about 275 mL. In yet another embodiment, the volume is about 300 mL. In yet another embodiment, the volume is about 325 mL. In another embodiment, the volume is about 350 mL. In another embodiment, the volume is about 375 mL. In another embodiment, the volume is about 400 mL. In another embodiment, the volume is about 450 mL. In another embodiment, the volume is about 500 mL. In another embodiment, the volume is about 550 mL. In another embodiment, the volume is about 600 mL. In another embodiment, the volume is about 650 mL. In another embodiment, the volume is about 700 mL. In another embodiment, the volume is between about 700 and 1000 mL.
- the dose may be in the range of about 1 x 10 9 GC/g brain mass to about 1 x 10 12 GC/g brain mass. In certain embodiments, the dose may be in the range of about 1 x 10 10 GC/g brain mass to about 1 x 10 12 GC/g brain mass. In certain embodiments, the dose may be in the range of about 3 x 10 10 GC/g brain mass to about 5 x 10 11 GC/g brain mass.
- the viral constructs may be delivered in doses of from at least about least 1x 10 9 GC to about 1 x 10 15 , or about 1 x 10 11 to 5 x 10 13 GC.
- Suitable volumes for delivery of these doses and concentrations may be determined by one of skill in the art. For example, volumes of about 1 mL to 150 mL may be selected, with the higher volumes being selected for adults. Typically, for newborn infants a suitable volume is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, volumes of up to about 30 mL may be selected.
- volume up to about 50 mL may be selected.
- a patient may receive an intrathecal administration in a volume of about 5 mL to about 15 mL are selected, or about 7.5 mL to about 10 mL.
- Other suitable volumes and dosages may be determined.
- the dosage may be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
- the above-described recombinant vectors may be delivered to host cells according to published methods.
- the rAAV preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian patient.
- the rAAV for administration to a human patient, is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts.
- the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8.
- a physiologically acceptable pH e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8.
- a pH within this range may be desired; whereas for intravenous delivery, a pH of about 6.8 to about 7.2 may be desired.
- other pHs within the broadest ranges and these subranges may be selected for other route of delivery.
- the composition includes a carrier, diluent, excipient and/or adjuvant.
- Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the transfer virus is directed.
- one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline).
- Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water.
- the buffer/carrier should include a component that prevents the rAAV, from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.
- a suitable surfactant, or combination of surfactants may be selected from among non-ionic surfactants that are nontoxic.
- a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Poloxamer 188 (also known under the commercial names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, Kolliphor® P188) which has a neutral pH, has an average molecular weight of 8400.
- Poloxamer 188 also known under the commercial names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, Kolliphor® P188
- Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain
- the formulation contains a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content.
- Poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension.
- the formulation may contain, e.g., buffered saline solution comprising one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate -7H 2 0), potassium chloride, calcium chloride (e.g., calcium chloride -2H 2 0), dibasic sodium phosphate, and mixtures thereof, in water.
- the osmolarity is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com/-article/2093316-overview.
- a commercially available diluent may be used as a suspending agent, or in combination with another suspending agent and other optional excipients.
- Each 10 mL of Elliotts B Solution contains: Sodium Chloride, USP - 73 mg; Sodium Bicarbonate, USP - 19 mg; Dextrose, USP8 mg; Magnesium Sulfate ⁇ 7H20, USP 3 mg; Potassium Chloride, USP- 3 mg; Calcium Chloride ⁇ 2H20, USP - 2 mg; Sodium Phosphate, dibasic ⁇ 7H20, USP- 2 mg; Water for Injection, USP qs 10 mL.
- the pH of Elliotts B Solution is 6 to 7.5, and the osmolarity is 288 mOsmol per liter (calculated).
- the composition containing the rAAVhu68.hARSA is delivered at a pH in the range of 6.8 to 8, or 7.2 to 7.8, or 7.5 to 8.
- a pH above 7.5 may be desired, e.g., 7.5 to 8, or 7.8.
- the formulation may contain a buffered saline aqueous solution not comprising sodium bicarbonate.
- Such a formulation may contain a buffered saline aqueous solution comprising one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride and mixtures thereof, in water, such as a Harvard’s buffer.
- the aqueous solution may further contain Kolliphor® PI 88, a poloxamer which is commercially available from BASF which was formerly sold under the trade name Lutrol ® F68.
- the aqueous solution may have a pH of 7.2.
- the formulation may contain a buffered saline aqueous solution comprising 1 mM Sodium Phosphate (Na 3 PO 4 ), 150 mM sodium chloride (NaCl), 3mM potassium chloride (KC1), 1.4 mM calcium chloride (CaCl 2 ), 0.8 mM magnesium chloride (MgCl 2 ), and 0.001% poloxamer (e.g., Kolliphor®) 188, pH 7.2. See, e.g.,
- Harvard’s buffer is preferred due to better pH stability observed with Harvard’s buffer.
- the table below provides a comparison of Harvard’s buffer and Elliot’s B buffer.
- the formulation buffer is artificial CSF with Pluronic F68.
- the formulation may contain one or more permeation enhancers.
- suitable permeation enhancers may include, e.g., mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.
- compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers.
- suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulliir dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and
- Suitable chemical stabilizers include gelatin and albumin.
- compositions according to the present invention may comprise a pharmaceutically acceptable carrier, such as defined above.
- the compositions described herein comprise an effective amount of one or more AAV suspended in a pharmaceutically suitable carrier and/or admixed with suitable excipients designed for delivery to the subject via injection, osmotic pump, intrathecal catheter, or for delivery by another device or route.
- the composition is formulated for intrathecal delivery.
- Intrathecal delivery refers to a route of administration for drugs via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF).
- Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)),
- suboccipital/intracistemal, and/or Cl-2 puncture For example, material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture. In another example, injection may be into the cistema magna.
- the terms“intracisternal delivery” or“intracistemal administration” refer to a route of administration for drugs directly into the cerebrospinal fluid of the cistema magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cistema magna or via permanently positioned tube.
- the final formulation buffer comprises an artificial cerebrospinal fluid comprising buffered saline and one or more of sodium, calcium, magnesium, potassium, or mixtures thereof; and a surfactant.
- the surfactant is about 0.0005 % w/w to about 0.001% w/w of the suspension.
- the surfactant is Pluronic F68.
- the Pluronic F68 is present in an amount of about 0.0001% of the suspension.
- the composition is at a pH in the of 7.5 to 7.8 for intrathecal delivery.
- treatment of the composition described herein has minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and/or in human patients, well-tolerated with respect to sensory nerve toxicity and subclinical sensory neuron lesions.
- the composition described herein is useful in improving functional and clinical outcomes in the subject treated. Such outcomes may be measured at about 30 days, about 60 days, about 90 days, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, about 24 months, about 2.5 years, about 3 years, about 3.5 years, about 4 years, about 4.5 years and then yearly up to the about 5 years after administration of the composition.
- Measurement frequency may be about every 1 month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, or about every 12 months.
- composition described herein shows pharmacodynamics and clinical efficacy measured in treated subjects compared to untreated controls.
- the pharmacodynamics efficacy, clinical efficacy, functional outcomes, clinical outcomes, disease amelioration, or disease progression may be assessed via one or more of the following: concentration and/or level and/or biological activity of ARSA (for example, in serum or in CSF), urine sulfatides, CNS myelination (demyelination load and pattern), white matter atrophy as measured by MRI, neuronal metabolite N-acetylaspartate (NAA), myo-inositol (ml), choline (Cho) and/or lactate (Lac) levels (for example, as measured by proton magnetic resonance spectroscopy (MRS)), CSF sulfatide and lyso-sulfatide levels, Visual evoked potentials (VEPs), Brainstem auditory evoked responses (BAERs), gall-bladder wall thickening (for example, via ultrasound evaluation); motor function (for example, measured by the Gross Motor Function Classification for Metachromatic Leukodys
- ARSA
- BSID-III Wechsler Intelligence Scale for Children, Fifth Edition [WISC-V]), lifespan (compared to a patient), neurological clinical exam (NCE), nerve conduction velocity (NCV) of the ulnar, deep peroneal, median, sural nerves, age-at-onset and frequency of seizures captured by a seizure diary, behavior function (for example, measured by Vineland Adaptive Behavior Scales, Third Edition (Vineland -III)), Lansky Performance Index, Pediatric Quality of Life Inventory (for example, PedsQL and PedsQL-IS), and caregiver/parent quality of life.
- NCE nerve conduction velocity of the ulnar, deep peroneal, median, sural nerves, age-at-onset and frequency of seizures captured by a seizure diary
- behavior function for example, measured by Vineland Adaptive Behavior Scales, Third Edition (Vineland -III)
- Lansky Performance Index for example, PedsQL and PedsQL-IS
- the pharmacodynamics efficacy, clinical efficacy, functional outcomes, clinical outcomes, disease amelioration, or disease progression may be assessed abnormal properties (for example biomarker activity, electrophysiological activity, and/or imaging parameters) and clinical observations (for example, gross and fine motor function, cognitive and language development, neurological exam findings, behavioral and milestone development, and caregiver/parent-reported outcomes and decreased quality of life assessments).
- abnormal properties for example biomarker activity, electrophysiological activity, and/or imaging parameters
- clinical observations for example, gross and fine motor function, cognitive and language development, neurological exam findings, behavioral and milestone development, and caregiver/parent-reported outcomes and decreased quality of life assessments.
- Other disease amelioration or disease progression may be assessed, see, Parts II and VIII, relative section thereof is incorporated herein by reference in their entireties.
- the pharmacodynamics efficacy, clinical efficacy, functional outcomes, or clinical outcomes may include biomarkers, for example, pharmacodynamics and biological activity of rAAVhu68.hARSAco..
- a method of treating a subject having a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A for example, MLD
- ameliorating symptoms of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A for example, MLD
- delaying progression of a disease associated with an ARSA mutation or caused by deficiencies in normal levels of functional Arylsulfatase A for example, MLD
- the method comprises administrating an effective amount of a rAAV or a vector as described herein to a subject in need thereof.
- the vector or rAAV is administrable to a patient via an intra- cistema magna injection (ICM), for example, CT-guided sub-occipital injection into the cistema magna.
- ICM intra- cistema magna injection
- a vector or a composition is provided which is administrable to a patient having Metachromatic Leukodystrophy who is 7 years of age or younger.
- the method involves delivering the rAAV or the vector to a human patient in a single dose.
- the rAAV is administered at a dose between 3.00 x 10 10 genome copies (GC) per gram (GC/g) of brain mass and 1.00 x 10 12 GC/g of brain mass.
- disease symptom of the subject is ameliorated and/or the disease progression is delayed.
- nervous system-directed AAV gene therapy targets primarily neurons in vivo
- the cross-correction potential opens the possibility to correct ARSA-deficient myelinating cells, which cannot be transduced in vivo by most gene therapy vectors (Cearley et al., 2008; Lawlor et al, 2009).
- an“effective amount” herein is the amount which achieves amelioration of MLD symptoms and/or delayed MLD progression.
- the vectors are administered in sufficient amounts to transfect the cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts.
- Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., brain, CSF, the liver (optionally via the hepatic artery), lung, heart, eye, kidney,), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, intraparenchymal, intracerebroventricular, intrathecal, ICM, lumbar puncture and other parenteral routes of administration. Routes of administration may be combined, if desired.
- Dosages of the viral vector depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and can thus vary among patients.
- a therapeutically effective human dosage of the viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about 1 x 10 9 to 1 x 10 16 vector genome copies.
- a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL suspension is delivered.
- a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL suspension is delivered.
- a dose of about 8.9 x 10 12 to 2.7 x 10 14 GC total is administered in this volume.
- a dose of about 1.1 x 10 10 GC/g brain mass to about 3.3 x 10 11 GC/g brain mass is administered in this volume.
- the dosage is adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
- the levels of expression of the transgene product can be monitored to determine the frequency of dosage resulting in viral vectors, preferably AAV vectors containing the minigene.
- dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the invention.
- the replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 16 GC (to treat an subject) including all integers or fractional amounts within the range, and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
- the compositions are formulated to contain at least lx10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 9 , 7x10 9 , 8x10 9 , or 9x10 9 GC per dose including all integers or fractional amounts within the range.
- the compositions are formulated to contain at least 1x10 10 , 2x10 10 ,
- compositions are formulated to contain at least lx10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per dose including all integers or fractional amounts within the range.
- the compositions are formulated to contain at least lx10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per dose including all integers or fractional amounts within the range.
- compositions are formulated to contain at least lx10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , or 9x10 12 GC per dose including all integers or fractional amounts within the range.
- compositions are formulated to contain at least lx10 13 ,
- compositions are formulated to contain at least lx10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per dose including all integers or fractional amounts within the range.
- the compositions are formulated to contain at least lx10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per dose including all integers or fractional amounts within the range.
- compositions are formulated to contain at least lx10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , or 9x10 15 GC per dose including all integers or fractional amounts within the range.
- the dose can range from lx10 10 to about lx10 15 GC per kg body weight including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 9 , 7x10 9 , 8x10 9 , or 9x10 9 GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about lx10 10 , 2x10 10 , 3x10 10 , 4x10 10 , 5x10 10 , 6x10 10 , 7x10 10 , 8x10 10 , or 9x10 10 GC per kg body weight including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about lx10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , or 9x10 12 GC per kg body weight including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 , or 9x10 13 GC per kg body weight including all integers or fractional amounts within the range. In another embodiment, the effective amount of the vector is about lx10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per kg body weight including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , or 9x10 15 GC per kg body weight including all integers or fractional amounts within the range.
- the dose can range from lx10 10 to about lx10 15 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 9 , 2x10 9 , 3x10 9 , 4x10 9 ,
- the effective amount of the vector is about lx10 10 , 2x10 10 , 3x10 10 , 4x10 10 , 5x10 10 , 6x10 10 , 7x10 10 , 8x10 10 , or 9x10 10 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , or 9x10 12 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 , or 9x10 13 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the effective amount of the vector is about lx10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , or 9x10 15 GC per gram (g) brain mass including all integers or fractional amounts within the range.
- the volume of carrier, excipient or buffer is at least about 25 mL. In one embodiment, the volume is about 50 mL. In another embodiment, the volume is about 75 mL. In another embodiment, the volume is about 100 mL. In another embodiment, the volume is about 125 mL. In another embodiment, the volume is about 150 mL. In another embodiment, the volume is about 175 mL.
- the volume is about 200 mL. In another embodiment, the volume is about 225 mL. In yet another embodiment, the volume is about 250 mL. In yet another embodiment, the volume is about 275 mL. In yet another embodiment, the volume is about 300 mL. In yet another embodiment, the volume is about 325 mL. In another embodiment, the volume is about 350 mL. In another embodiment, the volume is about 375 mL. In another embodiment, the volume is about 400 mL. In another embodiment, the volume is about 450 mL. In another embodiment, the volume is about 500 mL. In another embodiment, the volume is about 550 mL. In another embodiment, the volume is about 600 mL. In another embodiment, the volume is about 650 mL. In another embodiment, the volume is about 700 mL. In another embodiment, the volume is between about 700 and 1000 mL.
- the dose may be in the range of about 1 x 10 9 GC/g brain mass to about 1 x 10 12 GC/g brain mass. In certain embodiments, the dose may be in the range of about 1 x 10 10 GC/g brain mass to about 3 x 10 11 GC/g brain mass. In certain embodiments, the dose may be in the range of about 1 x 10 10 GC/g brain mass to about 2.5 x 10 11 GC/g brain mass. In certain embodiments, the dose may be in the range of about 5 x 10 10 GC/g brain mass.
- the viral constructs may be delivered in doses of from at least about least lx 10 9 GC to about 1 x 10 15 , or about 1 x 10 11 to 5 x 10 13 GC.
- Suitable volumes for delivery of these doses and concentrations may be determined by one of skill in the art. For example, volumes of about 1 mL to 150 mL may be selected, with the higher volumes being selected for adults. Typically, for newborn infants a suitable volume is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, volumes of up to about 30 mL may be selected.
- volume up to about 50 mL may be selected.
- a patient may receive an intrathecal administration in a volume of about 5 mL to about 15 mL are selected, or about 7.5 mL to about 10 mL.
- Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
- the above-described recombinant vectors may be delivered to host cells according to published methods.
- the rAAV preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian patient.
- the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts.
- the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8.
- pH of the cerebrospinal fluid is about 7.28 to about 7.32
- a pH within this range may be desired; whereas for intravenous delivery, a pH of about 6.8 to about 7.2 may be desired.
- other pHs within the broadest ranges and these subranges may be selected for other route of delivery.
- treatment of the composition described herein has minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and/or in human patients, well-tolerated with respect to sensory nerve toxicity and subclinical sensory neuron lesions.
- the proposed population for the rAAV, vector, composition, and method consist of subjects with early onset late infantile and early juvenile MLD who have symptom onset ⁇ 7 years of age and whose predictable and rapid decline supports a robust study design and evaluation of functional outcomes within a reasonable follow-up period.
- Treatment via the rAAV, vector, composition or method is for disease symptom amelioration and delayed disease progression, including stabilizing the underlying pathology, thereby preventing disease onset and enabling normal or near-normal motor and cognitive development, or substantially preventing or delaying loss of skills (such as acquired
- Pre-symptomatic patients are eligible for this treatment.
- the AAVhu68 capsid of AAV.hARSAco and the ICM ROA effectively transduces cortical neurons, a small subset of myelin-producing oligodendrocytes, motor neurons with axons projecting into the PNS, and DRG sensory neurons with axons projecting into both the spinal cord and peripheral nerves.
- cortical neurons a small subset of myelin-producing oligodendrocytes
- motor neurons with axons projecting into the PNS and DRG sensory neurons with axons projecting into both the spinal cord and peripheral nerves.
- ARSA enzyme cross-correction may treat both the CNS manifestations and the peripheral neuropathy observed in many MLD patients, which is not addressed by HSC -GT or HSCT.
- the rAAV, vector, composition or method as described herein confers the greatest potential for benefit in patients with no or mild to moderate disease.
- ICM-delivered AAV gene therapies such as AAV. hARSAco, show rapid kinetic onset compared to that of HSC-based therapies, with peak ARSA expression in the CSF by 3 weeks after administration (See, Examples).
- AAVhARSAco may halt disease progression even in patients who already have some clinical signs of disease.
- patients with early onset MLD who have mild to moderate signs and symptoms would be eligible for the treatment by the rAAV, vector, composition or method as described herein (termed as treatment ) including those with mild gait abnormalities in patients who are ambulatory and are able to walk at least 10 steps independently, apparent delays in motor milestones acquisition (defined as >95th percentile for age in achieving a given milestone based on WHO criteria (Wijnhoven et al, 2004)), and mild signs on neurological exam.
- Indicators of disease progression that are not commonly found in patients with mild to moderate symptoms, include, such as feeding difficulties requiring gastrostomy, development of seizures, low cognitive function, severe abnormalities found on neurological exam (such as very brisk reflexes, severe hypotonus or spasticity of the limbs, severe dysphagia, dyspraxia, or ataxia), and vision or hearing loss would result in exclusion from the trial.
- a delay in this disease progression is shown as stabilization of disease at a low level of clinical function.
- pharmacodynamic and efficacy outcomes of the methods is measured at 1, 3, and 6 months, and then every 6 months during the 2 year short-term follow-up period, except for those that require sedation and/or LP.
- evaluation frequency decreases to once every 12 months.
- the early time points and 6 month intervals for the first 2 years were also selected in consideration of the rapid rate of disease progression in untreated early onset MLD patients.
- amelioration of a disease symptom or delay in disease progression is shown via assessing gross motor function.
- the GMFC-MLD is a validated, reliable, and simple tool for standardized assessment of gross motor function and decline over time in MLD patients (Kehrer et al, 2011b). It was modeled on a similar tool that assesses motor function in children with cerebral palsy and classifies children’s motor function into one of five levels based on differences in self-initiated movements (Palisano et al, 2006). Kehrer et al.
- GMFC-MLD GMFC-MLD
- the tool was validated for children from 18 months of age onwards, as this represents the upper age limit when children normally learn to walk (Largo et al., 1985; WHO, 2006). However, the tool would still apply for children who achieve the walking milestone before this age.
- the GMFM is included as a measurement for evaluating amelioration of a disease symptom or delay in disease progression. It is a standardized observational instrument designed and validated to measure change in gross motor function over time and after intervention in children with cerebral palsy (Russell et al., 1989; Lundkvist Josenby et al, 2009; Alotaibi et al, 2014).
- the GMFM is an 88-item tool that assesses motor function grouped across five functional domains: lying and rolling, sitting, crawling and kneeling, standing, and walking, running and jumping. Reference curves have also been developed for healthy children, who typically attain the most difficult skills on the scale (walking, running, jumping) by 5 years of age (Palisano et al., 2006).
- the tool is not validated for children with MLD, it has been proven useful for early onset MLD patients who received HSC-GT in demonstrating (near) normal gross motor development in subjects treated in the pre-symptomatic stage (Sessa et al, 2016; Fumagalli et al., 2017).
- One of the advantages of the 88 -item instrument is that it contains a large amount of information about various aspects of motor function and the sub-domains can be summarized and reported separately. Due to a plateau effect, the tool may not be as informative in older early juvenile patients who may already have reached the maximum GMFM score prior to study enrolment (i.e., cannot measure acquisition of new skills), although it would still be able to show maintenance or loss of gross motor function over time.
- Peripheral neuropathy is a common, painful, and progressively debilitating manifestation of MLD that can aggravate the fine and gross motor dysfunction in these patients (Gieselmann and Krageloh-Mann, 2010; van Rappard et al, 2015). HSC-based treatments do not appear to substantially ameliorate peripheral neuropathy (Boucher et al., 2015; van Rappard et al., 2016).
- AAV.hARSAco to transduce neurons, DRG, and peripheral nerve axons cells allow for expression of the ARSA enzyme within the brain and peripheral nerve dysfunction.
- Neurological examinations may be performed to assess clinical manifestations of peripheral neuropathy, and nerve conduction studies may be performed on representative motor and sensory nerves (deep peroneal nerve, median nerve, ulnar nerve, and sural nerve).
- MLD is primarily a demyelinating disease
- nerve conduction velocity is considered a relevant neurophysiologic parameter of the disease (Biffi et al, 2008) and may be measured.
- Motor milestone development depends on the age and stage of disease at the time of subject enrollment. Depending on the age of the subject at enrollment, subjects may have achieved certain motor skills or not yet shown signs of motor milestone development.
- Neurocognitive and behavioral manifestations may be assessed to show amelioration of a disease symptom or delay in disease progression. Assessing these manifestations is especially important in children with early juvenile MLD, in whom behavioral and cognitive symptoms are an important manifestation of the disease that may develop simultaneously with motor dysfunction.
- Clinical scales may be used to quantify the effects of AAV.hARSAco on development of and changes in cognition, language, and motor function, which may be assessed using the BSID-III and the WISC-V with transition to age-appropriate assessment tools done according to the patient’s estimated developmental age. Outcomes may be compared to the norms of typically developing children and untreated childr en. Each proposed measure has been previously used in the MLD population (Clarke et al., 1989; Boucher et al., 2015; Sessa et al., 2016).
- BSID-III This scale used primarily to assess the development of infants and toddlers, ages 1-42 months (Albers and Grieve, 2007). It consists of a standardized series of developmental play tasks. It derives a developmental quotient by converting raw scores of successfully completed items to scale scores and composite scores followed by a comparison of the scores with norms taken from typically developing children of the same age.
- the BSID-III has three main subtests.
- a Cognitive Scale includes such items as attention to familiar and unfamiliar objects, looking for a fallen object, and pretend play.
- a Language Scale assesses understanding and expression of language (e.g., the ability to follow directions and naming objects).
- a Motor Scale measures gross and fine motor skills (e.g., grasping, sitting, stacking blocks, and climbing stairs).
- the BSID -III can provide additional motor function information to complement the GMFC-MLD and GMFM.
- WISC-V This scale is an individually administered intelligence test or children between the ages of 6 and 16 years of age. It generates a Full Scale IQ that represents a child’s general intellectual ability and provides five primary index scores: Verbal Comprehension Index, Visual Spatial Index, Fluid Reasoning Index, Working Memory Index, and Processing Speed Index. These indices represent a child’s abilities in discrete cognitive domains.
- Survival is included as a measurement for amelioration of a disease symptom or delay in disease progression. Death is expected in the first 5 years of life for the majority of patients diagnosed with late infantile MLD, with 5 year survival of 25% (Mahmood et al., 2010), although survival can extend into the second decade of life with current levels of supportive care (Gomez- Ospina, 2017). Thus, the 5 year follow-up may be sufficient to demonstrate a survival benefit in the late infantile population, although it may not be sufficiently long to assess survival in the early juvenile cohort. Importantly, with improved levels of supportive care, children with early onset MLD can now remain alive beyond 10 years of age, albeit it at a very low level of function.
- seizures are not usually a presenting symptom for the early onset population, it is a feature of later stages of the disease (Gieselmann and Krageloh-Mann, 2010; Mahmood et al, 2010). Parents may be asked to maintain a diary to record seizure activity (onset, frequency, length, and type of seizure), which enables assessing whether AAV.hARSAco can either prevent or delay onset of seizures or decrease the frequency of seizure events.
- Measures of adaptive behavior along with parent and patient quality of life may be evaluated to show amelioration of a disease symptom or delay in disease progression using the tools that have been previously utilized in MLD patients (Martin et al., 2013; Boucher et al.,
- PedsQOL and PedsQL-IS As is the case with severe pediatric diseases, the burden of the disease on the family is significant.
- the Pediatric Quality of Life InventoryTM is a validated a tool that assesses quality of life in children and their parents (by parent proxy reports). It has been validated in healthy children and adolescents and has been used in various pediatric diseases (Iannaccone et al., 2009; Absoud et al., 2011; Consolaro and Ravelli, 2016). Therefore, the PedsQL is included to evaluate the impact of AAV.hARSAco on the quality of life of the patient and their family. It can be applied to parents of children 2 years old and above and may therefore be informative as the children age over the 5 year follow-up period.
- the Pediatric Quality of Life InventoryTM Infant Scale (Vami et al., 2011) is a validated modular instrument completed by parents designed to measure health-related quality of life specifically for healthy and ill infants aged 1-24 months. It also provides the possibility for self-reporting by children aged 5 years and up.
- Lansky Performance Index A scale that measures the functional status of an individual and provides a score that represents the person’s ability to carry out normal daily activities.
- Effect of rAAV e.g., AAV..hARSAco
- vector, composition or method as described herein on disease pathology may be measured to show amelioration of a disease symptom or delay in disease progression, including changes in myelination, functional outcomes related to myelination, and potential disease biomarkers.
- MLD central and peripheral demyelination
- Central demyelination may be tracked by MRI measurements of white matter regions, changes in which are indicators of disease state and progression (Gieselmann and Krageloh-Mann, 2010; Martin et al, 2012; van Rappard et al, 2015).
- Central demyelination detected by MRI positively correlates with the degree of gross motor dysfunction (Groeschel et al, 2011).
- Peripheral demyelination may be measured indirectly via NCV studies on the motor nerves (deep peroneal, tibial, and ulnar nerves) and sensory nerves (sural and median nerves), which also provides a readout of peripheral neuropathy.
- NCV studies monitor for fluctuations indicative of a change in biologically active myelin (i.e., F-wave and distal latencies, amplitude, or presence or absence of a response).
- neuronal metabolites may be evaluated as biomarkers showing amelioration of a disease symptom or delay in disease progression.
- CSF (lyso)-sulfatide levels may therefore reflect disease severity in the PNS and could provide a marker to assess the impact of a therapy on the peripheral nervous system.
- CSF sulfatide and lyso-sulfatide levels may be included to show amelioration of a disease symptom or delay in disease progression.
- VEPs may be used to objectively measure responses to visual stimuli as an indicator of central visual impairment or loss. Hearing loss is also common during disease progression, and early indications of auditory abnormalities may be measured via BAER testing.
- Gallbladder abnormalities are a common finding in MLD and predispose the patient to gallbladder carcinoma (van Rappard et al., 2016) and occur in all subtypes of MLD.
- the assays listed below may be performed to show amelioration of a disease symptom and/or a delay in disease progression:
- AAVhu68 adeno-associated virus serotype hu68
- AE adverse event
- ARSA adeno-associated virus serotype hu68
- the rAAV, vector, composition and methods provides supra-physiologic levels of the ARSA enzyme within days of administration to both the CNS and PNS, both of which are affected in MLD patients.
- the AAVhu68 capsid and ICM route were selected based upon the observation of superior transduction of neurons, DRG, and peripheral nerve axons cells.
- vector transduction of myelinating cells is limited, the cross-correction potential would allow for enzyme uptake by oligodendrocytes.
- AAV vector and ARSA enzyme can be transported along axons, expanding the expression of the therapeutic enzyme within the brain and to the periphery.
- the AAV.CB7.CI.hARSAco.rBG is administered as a single dose via a computed tomography- (CT-) guided sub -occipital injection into the cisterna magna (intra- cistema magna [ICM]).
- CT- computed tomography-
- ICM intra- cistema magna
- some clade F isolates such as AAV9 have demonstrated extremely efficient brain transduction (Gray et al., 2013; Haurigot et al, 2013; Hinderer et al, 2014; Bell et al, 2015).
- gene therapy has shown greatly enhanced potential to treat a variety of neurological disorders, and several programs utilizing second-generation vectors have progressed into the clinic (Haurigot et al., 2013; Hinderer et al, 2014; Bell et al, 2015; Gurda et al., 2016; Hinderer et al., 2016).
- AAV vectors including AAV9
- AAV9 can transduce cells within the CNS after IV delivery
- IV vector delivery has two critical limitations.
- the low efficiency of vector penetration into the CNS necessitates extremely large vector doses to achieve therapeutic levels of transgene expression, increasing the risk of systemic toxicity and potentially requiring quantities of vector that may not be feasible to manufacture for many patient populations (Gray et al, 2011; Hinderer et al., 2014; Gurda et al, 2016).
- gene transfer to the CNS after IV vector delivery is profoundly limited by pre-existing NAbs to the vector capsid (Gray et al, 2011).
- IT vector delivery has been developed as an alternative approach.
- the IT ROA has the potential to achieve transgene delivery throughout the CNS and PNS with a single minimally invasive injection.
- Animal studies have demonstrated that by obviating the need to cross the blood-brain barrier, IT delivery results in substantially more efficient CNS gene transfer with much lower vector doses than those required for the IV approach (Gray et al, 2011; Hinderer et al, 2014).
- IT vector delivery is not affected by pre-existing NAbs to the AAV capsid, making this approach applicable to a broader patient population (Haurigot et al., 2013).
- IT AAV delivery can be performed using a variety of routes for CSF access.
- Lumbar puncture (LP) is the most common method for accessing CSF, and was therefore evaluated as a route for AAV administration in NHPs. Delivery of an AAV9 vector into the CSF via an LP was found to be at least 10-fold less efficient at transducing cells of the brain and spinal cord compared to injection of the vector more superiorly at the level of the cistema magna (Hinderer et al, 2014).
- ICM injection also known as suboccipital puncture
- LPs blood vessels
- the procedure can be performed under real time CT guidance, allowing for visualization of critical structures, such as the medulla, vertebral arteries, and posterior inferior cerebellar arteries during needle insertion (Pomerantz et al, 2005; Hinderer et al., 2014).
- the vectors provided herein may be administered intrathecally via the method and/or the device provided in this section and described in WO 2018/160582, which is incorporated by reference herein. Alternatively, other devices and methods may be selected.
- the method comprises the steps of CT-guided sub-occipital injection via spinal needle into the cistema magna of a patient.
- the term CT-guided sub-occipital injection via spinal needle into the cistema magna of a patient.
- Computed Tomography refers to radiography in which a three-dimensional image of a body structure is constructed by computer from a series of plane cross-sectional images made along an axis.
- rAAVhu68.hARSAco On the day of treatment, the appropriate concentration of rAAVhu68.hARSAco is be prepared. A syringe containing 5.6 mL of rAAVhu68.hARSAco at the appropriate concentration is delivered to the procedure room. The following personnel are present for study drug administration: interventionalist performing the procedure; anesthesiologist and respiratory technician(s); nurses and physician assistants; CT (or operating room) technicians; site research coordinator. Prior to drug administration, a lumbar puncture is performed to remove a predetermined volume of CSF and then to inject iodinated contrast intrathecally (IT) to aid in visualization of relevant anatomy of the cistema magna.
- IT iodinated contrast intrathecally
- Intravenous (IV) contrast may be administered prior to or during needle insertion as an alternative to the intrathecal contrast.
- the decision to used IV or IT contrast is at the discretion of the interventionalist.
- the subject is anesthetized, intubated, and positioned on the procedure table.
- the injection site is prepped and draped using sterile technique.
- a spinal needle 22-25 G are advanced into the cistema magna under fluoroscopic guidance.
- a larger introducer needle may be used to assist with needle placement.
- the extension set are attached to the spinal needle and allowed to fill with CSF.
- a syringe containing contrast material may be connected to the extension set and a small amount injected to confirm needle placement in the cistema magna. After the needle placement is confirmed by CT guidance +/- contrast injection, a syringe containing 5.6 mL of rAAVhu68.hARSAco is connected to the extension set. The syringe contents are slowly injected over 1-2 minutes, delivering a volume of 5.0 mL. The needle are slowly removed from the subject.
- doses may be scaled by brain mass, which provides an approximation of the size of the CSF compartment.
- dose conversions are based on a brain mass of 0.4 g for an adult mouse, 90 g for a juvenile rhesus macaque, and 800 g for children 4-18 months of age.
- the following table provides illustrative doses for a murine MED study, NHP toxicology study, and equivalent human doses.
- a rAAVhu68.hARSAco vector is administered to a subject in a single dose.
- multiple doses for example 2 doses
- multiple doses delivered days, weeks, or months, apart may be desired.
- a single dose of rAAVhu68.hARSAco vector is about 1 x 10 9 GC to about 3 x 10 11 GC.
- the dose of rAAVhu68.HARSA is 1 x 10 10 GC/brain mass to 3.33 x 10 11 GC/brain mass. In other embodiments, different doses may be selected.
- compositions can be formulated in dosage units to contain an amount of AAV that is in the range of about 1 x 10 9 genome copies (GC) to about 5 x 10 13 GC (to treat an average subject of 70 kg in body weight).
- a spinal tap is performed in which from about 15 mL (or less) to about 40 mL CSF is removed and in which vector is admixed with the CSF and/or suspended in a compatible carrier and delivered to the subject.
- the vector concentration is about 3 x 10 13 GC, but other amounts such as about 1 x 10 9 GC, about 5X 10 9 GC, about 1 X 10 10 GC, about 5 X 10 10 GC, about 1 X 10 11 GC, about 5 X 10 11 GC, about 1 X 10 12 GC, about 5 X 10 12 GC, or about 1.0 x 10 13 GC.
- a co-therapy may be delivered with the rAAVhu68.hARSAco compositions provided herein.
- Co therapies such as described earlier in this application are incorporated herein by reference.
- RNA RNA
- expression RNA
- transcription relates in particular to the production of peptides or proteins. Expression may be transient or may be stable.
- an“expression cassette” refers to a nucleic acid molecule which comprises a coding sequence, promoter, and may include other regulatory sequences therefor.
- a vector genome may contain two or more expression cassettes.
- the term“transgene” may be used interchangeably with“expression cassette”.
- such an expression cassette for generating a viral vector contains the coding sequence for the gene product described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein.
- heterologous when used with reference to a protein or a nucleic acid indicates that the protein or the nucleic acid comprises two or more sequences or subsequences which are not found in the same relationship to each other in nature.
- the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid.
- the nucleic acid has a promoter from one gene arranged to direct the expression of a coding sequence from a different gene.
- the promoter is heterologous.
- an“effective amount” refers to the amount of the rAAV composition which delivers and expresses in the target cells an amount of the gene product from the vector genome.
- An effective amount may be determined based on an animal model, rather than a human patient. Examples of a suitable murine or NHP model are described herein.
- translation in the context of the present invention relates to a process at the ribosome, wherein an mRNA strand controls the assembly of an amino acid sequence to generate a protein or a peptide.
- the terms“a” (or“an”), “one or more,” and“at least one” is used interchangeably herein.
- AAV.CB7.CI.hARSAco.rBG or AAVhu68.hARSAco or AAV.hARSAco was delivered into the CSF to achieve therapeutic ARSA expression levels and rescue several biomarkers of MLD.
- Example 3 demonstrated that the observed -expression of ARSA results in part from the transduction and/or cross-correction of both cortical neurons and oligodendrocytes, which are the two main cell types affected by ARSA deficiency in MLD patients. Potentially therapeutic levels of ARSA have also been obtained in a size-relevant animal, the cynomolgus macaque (Example 4), and efficacy studies are conducted in an in vivo and/or in vitro MLD disease model.
- Example 7 provides a pharmacology and toxicology study of
- Example 10 shows a trial of
- AAV.CB7.CI.hARSAco.rBG in a pediatric MLD population AAV.CB7.CI.hARSAco.rBG in a pediatric MLD population.
- Components of an AAV.hARSAco are illustrated in the following table.
- Vectors are constructed from cis-plasmids containing a coding sequence for human ARSA (SEQ ID NO: 1 and SEQ ID NO: 3) expressed from the chicken beta actin promoter with a cytomegalovirus enhancer (CB7; SEQ ID NO: 16) flanked by AAV2 inverted terminal repeats.
- the vectors are packaged in an AAV serotype hu68 capsid (WO 2018/160582) by triple transfection of adherent HEK 293 cells and purified by iodixanol gradient centrifugation as previously described in Lock, M., et al. Rapid, Simple, and Versatile Manufacturing of
- AAV.CB7.CI.hARSAco.rBG is produced by triple plasmid transfection of HEK293 working cell bank (WCB) cells with the AAV cis plasmid
- the size of the AAV.CB7.CI.hARSAco.rBG packaged vector genome is 3883 bases (nt 1 to nt 3883 of SEQ ID NO: 5).
- the cis plasmid (FIG. 2) contains the following vector genome sequence elements:
- ITR Inverted Terminal Repeat
- AAV2 130 base pairs [bp], GenBank: NC_001401
- the ITRs function as both the origin of vector DNA replication and the packaging signal for the vector genome when AAV and adenovirus helper functions are provided in trans. As such, the ITR sequences represent the only cis sequences required for vector genome replication and packaging.
- CMV IE Human Cytomegalovirus Immediate-Early Enhancer
- Chicken b-Actin (BA) Promoter SEQ ID NO: 18: This ubiquitous promoter (281 bp, GenBank: X00182.1) was selected to drive transgene expression in any cell type.
- Chimeric Intron (Cl) The hybrid intron consists of a chicken BA splice donor (973 bp, GenBank: X00182.1) and rabbit b-globin splice acceptor element. The intron is transcribed, but removed from the mature messenger ribonucleic acid (mRNA) by splicing, bringing together the sequences on either side of it. The presence of an intron in an expression cassette has been shown to facilitate the transport of mRNA from the nucleus to the cytoplasm, thus enhancing the accumulation of the steady level of mRNA for translation. This is a common feature in gene vectors intended for increased levels of gene expression.
- mRNA messenger ribonucleic acid
- the engineered complementary deoxyribonucleic acid (cDNA) of the human ARSA gene (SEQ ID NO: 1 or SEQ ID NO: 3) encodes arylsulfatase A, which is a lysosomal enzyme responsible for the desulfation of the sulfated galactosphingolipids, galactosylceramide-3-O-sulfate and galactosylsphingosine-3-O-sulfate (1527 bp; 509 amino acids [aa], GenBank: NP_000478.3).
- rBG Poly A Rabbit b-Globin Polyadenylation Signal (rBG Poly A): The rBG PolyA signal (127 bp, GenBank: V00882.1) facilitates efficient polyadenylation of the transgene mRNA in cis. This element functions as a signal for transcriptional termination, a specific cleavage event at the 3' end of the nascent transcript and the addition of a long polyadenyl tail.
- the AAV2/hu68 trans plasmid (FIG. 3) is pAAV2/hu68.KanR. It is 8030 bp in length and encodes four wild type AAV2 replicase (Rep) proteins required for the replication and packaging of the AAV vector genome.
- the pAAV2/hu68.KanR plasmid also encodes three wild type AAVhu68 virion protein capsid (Cap) proteins, which assemble into a virion shell of the AAV serotype hu68 to house the AAV vector genome.
- Cap wild type AAVhu68 virion protein capsid
- the AAV9 cap gene from plasmid pAAV2/9n (which encodes the wild type AAV2 rep and AAV9 cap genes on a plasmid backbone derived from the pBluescript KS vector) was removed and replaced with the AAVhu68 cap gene.
- the ampicillin resistance (AmpR) gene was also replaced with the kanamycin resistance (KanR) gene, yielding pAAV2/hu68.KanR.
- This cloning strategy relocated the AAV p5 promoter sequence (which normally drives rep expression) from the 5' end of rep to the 3' end of cap, leaving behind a truncated p5 promoter upstream of rep. This truncated promoter serves to down- regulate expression of rep and, consequently, maximize vector production. All component parts of the plasmid have been verified by direct sequencing.
- Plasmid pAdDeltaF6(KanR) (FIG. 4) was constructed and is 15,770 bp in size.
- the plasmid contains the regions of adenovirus genome that are important for AAV replication; namely, E2A, E4, and VA RNA (the adenovirus El functions are provided by the HEK293 cells).
- the plasmid does not contain other adenovirus replication or structural genes.
- the plasmid does not contain the cis elements critical for replication, such as the adenoviral ITRs; therefore, no infectious adenovirus is expected to be generated.
- the plasmid was derived from an El, E3-deleted molecular clone of Ad5 (pBHGlO, a pBR322 -based plasmid). Deletions were introduced into Ad5 to eliminate expression of unnecessary adenovirus genes and reduce the amount of adenovirus DNA from 32 kb to 12 kb (FIG. 5A). Finally, the ampicillin resistance gene was replaced by the kanamycin resistance gene to create pAdeltaF6(KanR) (FIG. 5B). The E2, E4, and VA adenoviral genes that remain in this plasmid, along with El, which is present in HEK293 cells, are necessary for AAV vector production.
- AAV.CB7.CI.hARSAco.rBG is manufactured by transient transfection of HEK293 cells followed by downstream purification.
- a manufacturing process flow diagram is shown FIGs 6 and 7. The major reagents entering into the preparation of the product are indicated on the left side of the diagram and in-process quality assessments are depicted on the right side of the diagram. A description of each production and purification step is also provided.
- Product manufacturing follows a linear flow of unit operations and utilizes disposable, closed bioprocessing systems unless otherwise specified. All steps of the production process involving cell culture, from cell seeding to harvest collection, are performed aseptically using sterile, single-use disposable tubing and bag assemblies.
- Cells are expanded using Coming flatware (T- Flasks, CellSTACKs [CS-10] and/or HYPERStacks [HS-36]). Cells are transfected in a bioreactor(s), and all open manipulations are performed in class II biological safety cabinets (BSCs) in an ISO Class 5 environment. The purification process are performed in a closed system where possible.
- Coming flatware T- Flasks, CellSTACKs [CS-10] and/or HYPERStacks [HS-36]
- BSCs class II biological safety cabinets
- the purification process are performed in a closed system where possible.
- AAV.CB7.CI.hARSAco.rBG The manufacturing process for AAV.CB7.CI.hARSAco.rBG was developed and involves transient transfection of human embryonic kidney 293 (HEK293) cells with plasmid DNA.
- HEK293 working cell bank (WCB) used in the production was tested and qualified as detailed in FDA and International Council for Harmonisation (ICH) guidelines.
- ICH International Council for Harmonisation
- BDS bulk drug substance
- PEI- polyethylenimine-
- Harvested AAV material is purified sequentially by clarification, tangential flow filtration (TFF), affinity chromatography, and anion exchange chromatography in disposable, closed
- the product is formulated in intrathecal final formulation buffer (ITFFB; artificial CSF with 0.001% Pluronic F-68).
- IFFB intrathecal final formulation buffer
- the BDS batch or batches are frozen, subsequently thawed, pooled if necessary, adjusted to the target concentration, and sterile -filtered through a 0.22 pm filter, and vials are filled.
- the small-scale bioreactor is a linearly scaled bioreactor with equal bed height for cell growth with respect to the large-scale bioreactor.
- the use of the small-scale bioreactor and the large-scale bioreactor allows for scalable manufacturing with minimal process and material impact.
- the large-scale bioreactor and/or the small-scale bioreactor is utilized for the production of the toxicology lot(s).
- the large-scale bioreactor is used for the production of the good manufacturing practice (GMP) drug substance (DS) lot(s) to be utilized in clinical trials and for licensure.
- GMP good manufacturing practice
- DS drug substance
- comparability testing that is conducted to compare a new lot manufactured with an updated procedure or with new material to a previous lot consists of a subset of tests included in the certificate of analysis (COA).
- COA certificate of analysis
- a Particle content analysis by AUC is determined upon completion of toxicology lot manufacturing and product establishment manufacturing runs.
- AUC analytical ultracentrifugation
- GC genome copies
- ITR inverted terminal repeat
- IU infectious units
- MS mass spectrometry
- NGS next-generation sequencing
- qPCR quantitative polymerase chain reaction
- rcAAV replication-competent adeno-associated virus
- SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
- TBD to be determined
- TCID50 50% tissue culture infective dose
- USP United States Pharmacopeia.
- the cell culture and harvest manufacturing process comprise four main manufacturing steps: (a) cell seeding and expansion, (b) transient transfection, (c) vector harvest, and (d) vector clarification. These process setups are depicted in the overview process diagram (FIG. 6).
- a fully characterized HEK293 cell line is used for the production process.
- a WCB has been produced.
- Cell culture used for vector production is initiated from one or two thawed WCB vials and expanded as per a Master Batch Record (MBR) document.
- Cells are expanded using tissue culture plastic to allow sufficient cell mass to be generated for seeding in a large-scale bioreactor vessel surface area for vector production per DS batch.
- Cells are cultivated in medium composed of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% gamma irradiated New Zealand-sourced fetal bovine serum (FBS).
- the cells are anchorage-dependent, and cell disassociation is accomplished using TrymLETM Select, an animal product-free cell dissociation reagent.
- Cell seeding is accomplished using sterile, single-use disposable bioprocess bags and tubing sets.
- the reactor is temperature-, pH-, and dissolved oxygen- (DO-) controlled.
- DO- dissolved oxygen-
- DMEM media + 10% FBS fetal bovine serum
- cell culture media is replaced with fresh, serum-free DMEM media and the cells are transfected with the three production plasmids using a PEI-based transfection method. All plasmids used in the production process are produced in the context of a CMO quality system as described above with infrastructure -utilizing controls to ensure traceability, document control, and materials segregation. Sufficient plasmid DNA transfection complexes are prepared in the BSC to transfect up to 500 m 2 (per BDS batch).
- a DNA/PEI mixture is prepared containing cis (vector genome) plasmid, trans (rep and cap genes) plasmid, and helper plasmid in an optimal ratio with GMP-grade PEI (PEIPro HQ, PolyPlus Transfection SA).
- This plasmid ratio was determined to be optimal for AAV production in small-scale optimization studies.
- the solution is allowed to sit at room temperature for up to 25 minutes, then added to serum-free media to quench the reaction, and finally added to the bioreactor.
- the reactor is temperature- and DO-controlled, and cells are incubated for 5 days.
- Transfected cells and media are harvested from the bioreactor using disposable bioprocess bags by aseptically pumping the medium out of the bioreactor. Following the harvest, detergent, endonuclease, and MgCE (a co-factor for the endonuclease) are added to release vector and digest unpackaged DNA.
- the product in a disposable bioprocess bag
- the product is incubated at 37°C for 2 hours in a temperature-controlled single-use mixer to provide sufficient time for enzymatic digestion of residual cellular and plasmid DNA present in the harvest as a result of the transfection procedure. This step is performed to minimize the amount of residual DNA in the final vector DP.
- NaCl is added to a final concentration of 500 mM to aid in the recovery of the product during filtration and downstream TFF.
- Cells and cellular debris are removed from the product using a pre-filter and depth filter capsule (1.2/0.22 pm) connected in series as a sterile, closed tubing and bag set that is driven by a peristaltic pump. Clarification assures that downstream filters and chromatography columns are protected from fouling, and bioburden reduction filtration ensures that at the end of the filter train, any bioburden potentially introduced during the upstream production process is removed before downstream purification.
- the purification process comprises four main manufacturing steps: (a) concentration and buffer exchange by TFF, (b) affinity chromatography, (c) anion exchange chromatography, and (d) concentration and buffer exchange by TFF. These process steps are depicted in the overview process diagram (FIG. 6). General descriptions of each of these processes are provided below.
- volume reduction (20-fold) of the clarified product is achieved by TFF using a custom sterile, closed bioprocessing tubing, bag, and membrane set.
- the principle of TFF is to flow a solution under pressure parallel to a membrane of suitable porosity (100 kDa).
- the pressure differential drives molecules of smaller size through the membrane and effectively into the waste stream while retaining molecules larger than the membrane pores.
- the parallel flow sweeps the membrane surface, preventing membrane pore fouling and product loss through binding to the membrane.
- a liquid sample may be rapidly reduced in volume while retaining and concentrating the desired molecule.
- Diafiltration in TFF applications involves addition of a fresh buffer to the recirculating sample at the same rate that liquid is passing through the membrane and to the waste stream. With increasing volumes of diafiltration, increasing amounts of the small molecules are removed from the recirculating sample. This diafiltration results in a modest purification of the clarified product, but also achieves buffer exchange compatible with the subsequent affinity column chromatography step. Accordingly, a 100 kDa, PES (polyethersulfone) membrane for concentration is utilized, which is then diafiltered with a minimum of four diavolumes of a buffer composed of 20 mM Tris pH 7.5 and 400 mM NaCl. The diafiltered product is then further clarified with a 1.2/0.22 pm depth filter capsule to remove any precipitated material.
- PES polyethersulfone
- the Poros-AAV elution pool is diluted 50-fold (20 mM Bis-Tris propane, 0.001% Pluronic F-68, pH 10.2) to reduce ionic strength and enable binding to a CIMultusTM QA monolith matrix (BIA Separations).
- vector product is eluted using a 60 column volume NaCl linear salt gradient (10-180 mM NaCl). This shallow salt gradient effectively separates capsid particles without a vector genome (empty particles) from particles containing vector genome (full particles) and results in a preparation enriched for full particles.
- the full particle peak eluate is collected and neutralized. The peak area is assessed and compared to previous data for determination of the approximate vector yield.
- the pooled anion exchange intermediate is concentrated and buffer-exchanged using TFF.
- TFF a 100 kDa membrane hollow fiber TFF membrane is used.
- the product is brought to a target concentration and then buffer-exchanged into the ITFFB (artificial CSF with 0.001% Pluronic F-68).
- the bulk drug substance (BDS) is sterile - filtered (0.22 pm), stored in sterile containers, and frozen at ⁇ -60°C in a quarantine location until release for final fill.
- the frozen bulk drug substance are thawed, pooled, and adjusted to the target concentration (dilution or concentrating step via TFF) using the final formulation buffer (FFB).
- the product is terminally filtered through a 0.22 pm filter and filled into sterile West
- Bacterial master cell bank (BMCB) glycerol stocks of the cis, trans and helper plasmids were made by mixing 1 mL from a 1 L overnight culture of transformed Stbl2TM E. coli cells with an equal volume of sterile 50% glycerol. Two 0.5 mL aliquots of the BMCB glycerol stocks per construct are prepared from the mixture and stored in Nalgene cryogenic vials at -80°C. To verify BMCB glycerol stocks, amplified plasmid DNA is subjected to in-house structure analysis involving restriction enzyme digestion followed by gel electrophoresis, and full-plasmid sequence analysis by Sanger sequencing at Qiagen.
- BWCB bacterial working cell bank
- Production cultures are inoculated by scraping the frozen BWCB glycerol stock.
- Plasmids used as source material for Good Manufacturing Practice (GMP) vector manufacturing are produced at a facility that is not qualified as a GMP facility; however, plasmids are produced in a manner that is designed to meet the requirements for Current Good Manufacturing Practice (cGMP) intermediates. Plasmid production is conducted on dedicated components and in a dedicated suite. The production procedures and oversight are conducted to ensure a consistent qualify product with highly pure DNA, which meets stringent release criteria as captured in the following table.
- Components used in the production of plasmids are“animal- free” (based on the COAs from each vendor for component products), and all components used in the process (fermentation flasks, containers, membranes, resin, columns, tubing and any component that comes into contact with the plasmid) are dedicated to a single plasmid and are certified TSE -/BSE-free.
- the PolyFlo® resin, columns and components utilized are procured for the exclusive use in the manufacturing of a single plasmid.
- the fermentation, lysis and purification of the plasmid occurs in dedicated rooms marked with the designated plasmid name. No other plasmids are processed in those rooms at the same time. The rooms and equipment are cleaned between each plasmid production campaign.
- NGS next-generation sequencing
- Puresyn All plasmid DNA used in the production of vectors for pharmacology /toxicology are made through Puresyn’s Premium-Research Ready Program. Puresyn’s Premium-Research Ready Program are produced using cleaning and segregation procedures and single-use components however they are not produced in a dedicated room.
- HEK293 cells were originally generated by transforming HEK cells with sheared adenovirus type 5 (Ad5) DNA (Graham et al, 1977). The cells express the E1A and E1B gene products required for rAAV production. HEK293 cells are highly transfectable, yielding high levels of rAAV upon plasmid DNA transfection.
- Ad5 sheared adenovirus type 5
- AAV vector (2.00 x 10 11 GC) is treated with Baseline Zero endonuclease and Plasmid Safe DNAse to eliminate non-encapsulated DNA in the environment and then incubated for 10 min at 95°C in lx phosphate-buffered saline (PBS) and 0.5% sodium dodecyl sulfate (SDS) to denature the vector genome.
- Denatured vector genome is subsequently annealed by slowly cooling the reaction mix to 24°C at a rate of 0.6°C/minute in a thermocycler, cleaned up using the QIA quick PCR Purification Kit (QIAGEN), and sheared to an average size of 500 bp on a Covaris Ultrasonicator. DNA shearing is evaluated on a 2100 Bioanalyzer with High Sensitivity DNA reagent kit (Agilent). Sheared DNA is prepared into NGS libraries using the
- NEBNextUltrall library kit according to the manufacturer’s protocol, size-selected, and cleaned up by Agencourt AMPure XP beads (Beckman Coulter). Individual NGS libraries are then analyzed on a Bioanalyzer again for fragment size distribution and quantified by a Qubit® 3.0 Fluorometer prior to pooling at equal molarity. The concentration of final pooled library is measured by a Qubit® 3.0 Fluorometer, denatured, and diluted to 8 pM according to Illumina’s Miseq System Denature and Dilute Libraries Guide. PhiX control is spiked in the final library at 10%. Sequencing is performed using an Illumina MiSeq Nano Reagent Kit V2 (250 bp paired- end) on a MiSeq sequencer. Data analysis is performed as described above using the NGS alignment approach.
- Sequencing reads are automatically de-multiplexed and adapter-trimmed by the MiSeq computer.
- the trimmed reads for each plasmid are aligned to the corresponding reference sequence, and sequence variants are called using BBTools bioinformatics software suite (sourceforge.net/projects/bbmap).
- BBMap jgi.doe.gov/data-and-tools/bbtools/
- VCF files are further parsed by a custom UNIX script to generate simplified tab-delimited tables (retaining only CHROM, REF, ALT, QUAL, TYPE, DEPTH, AF, RAF, SB, DP4 fields).
- BAM files are visually inspected in IGV Integrated Genomic Viewer software (software.broadinstitute.org/software/igv/) to ensure proper NGS alignments.
- de novo assembly is conducted to build a long, circularized sequence using NOV OPlasty (github.com/ndierckx/NOVOPlasty).
- NOV OPlasty github.com/ndierckx/NOVOPlasty
- Confirmation of the AAVhu68 serotype of the DP is achieved using a new assay developed at the University of Pennsylvania and Bioproximity, LLC based upon the analysis of peptides of a AAV capsid protein.
- the method involves trypsin digestion of the VP followed by tandem mass spectrometry (MS) characterization on a Q-Exactive Orbitrap mass spectrometer to sequence the capsid protein peptides.
- MS tandem mass spectrometry
- a spectral library from the tandem mass spectra sequenced and a targeted MS method is used to assay for signature peptides that can uniquely identify specific AAV viral particles serotypes.
- a bank of signature peptides specific for eight serotypes (AAVhu68, AAV1, AAV2, AAV6, AAV8, AAV9, AAVrhlO, and AAVhu37) are screened against the tandem mass spectra produced by digestion of the test article. For a positive identification, signature peptide(s) from a single serotype only are detected.
- a ddPCR-based technique for determining the GC titer for AAV vectors has been developed (Lock et al, 2014).
- the reference standard is generated during the pilot runs and is used to qualify the assay. The method is practical, reports equivalent or better titers than qPCR, and does not require a plasmid standard curve.
- the assay utilized involves digestion with DNase I, followed by ddPCR analysis to measure encapsulated vector GC. DNA detection is accomplished using sequence-specific primers targeting the polyA region in combination with a fluorescently tagged probe hybridizing to this same region.
- a number of standards, validation samples, and controls have been introduced into the assay.
- This assay is qualified using pilot reference standard.
- the assay is qualified by establishing and defining assay parameters, including sensitivity, limit of detection (LOD), range of qualification, and intra- and inter-assay precision.
- An internal AAVhu68 reference lot is established and used to perform the qualification studies.
- the infectious unit (IU) assay is used to determine the productive uptake and replication of rAAV vector in RC32 cells (rep2 expressing HeLa cells).
- RC32 cells rep2 expressing HeLa cells.
- a 96-well endpoint format has been employed similar to that previously published. Briefly, RC32 cells are co-infected by serial dilutions of rAAV BDS and a uniform dilution of Ad5 with 12 replicates at each dilution of rAAV. Seventy -two hours after infection, the cells are lysed, and qPCR is performed to detect rAAV vector amplification over input.
- TCID50 tissue culture infectious dose
- Sedimentation velocity as measured in an analytical ultracentrifuge (AUC) can detect aggregates, other minor components, as well as provide good quantitation of relative amounts of different particle species based upon their different sedimentation coefficients.
- AUC analytical ultracentrifuge
- Vector samples are loaded into cells with two-channel charcoal-epon centerpieces with 12 mM optical path length.
- the supplied dilution buffer is loaded into the reference channel of each cell.
- the loaded cells are then placed into an AN-6OT1 analytical rotor and loaded into a Beckman-Coulter ProteomeLab XL-I analytical ultracentrifuge equipped with both absorbance and RI detectors.
- the raw data is analyzed using the c(s) method and implemented in the analysis program SEDFIT.
- the resultant size distributions are graphed and the peaks integrated.
- the percentage values associated with each peak represent the peak area fraction of the total area under all peaks and are based upon the raw data generated at 280 nm.
- Many labs use these values to calculate fulkempty ratios. However, because empty and full particles have different extinction coefficients at this wavelength, the raw data can be adjusted accordingly.
- the ratio of the empty particle and full monomer peak values both before and after extinction coefficient adjustment is used to determine the fulkempty ratio, and both ratios are recorded.
- a qPCR assay is used to detect residual HEK293 DNA. After spiking with a“non- relevant DNA,” total DNA (non-relevant, vector, and residual genomic DNA) is extracted from approximately 1 mL of product. The HCDNA is quantified using qPCR targeting 18S rDNA. The quantities of DNA detected are normalized based on the recovery of the spiked non-relevant DNA. Three different amplicon sizes are tested to establish the size spectrum of residual HCDNA.
- An ELISA is performed to measure levels of contaminating host HEK293 cell proteins.
- the Cygnus Technologies HEK293 Host Cell Proteins 2nd Generation ELISA kit is used according to the instructions provided by the vendor.
- a sample is analyzed for the presence of replication-competent AAV2/hu68 (rcAAV) that could potentially arise during the production process.
- rcAAV replication-competent AAV2/hu68
- a three-passage assay has been developed consisting of cell -based amplification and passage followed by detection of rcAAV DNA by real time qPCR (caphu68 target).
- the cell-based component consists of inoculating monolayers of HEK293 cells (PI) with dilutions of the test sample and wild type human Ad5.
- the maximal amount of the product tested is 1.00 x 10 10 GC of the vector product. Due to the presence of adenovirus, rcAAV amplifies in the cell culture. After 2 days, a cell lysate is generated, and Ad5 is heat-inactivated.
- the clarified lysate is then passed onto a second round of cells (P2) to enhance sensitivity (again in the presence of Ad5). After 2 days, a cell lysate is generated, and Ad5 is heat-inactivated. The clarified lysate is then passed onto a third round of cells (P3) to maximize sensitivity (again in the presence of Ad5). After 2 days, cells are lysed to release DNA, which is then subjected to qPCR to detect AAVhu68 cap sequences. Amplification of AAVhu68 cap sequences in an Ad5 -dependent manner indicates the presence of rcAAV.
- AAV2/hu68 surrogate positive control containing AAV2 rep and AAVhu68 cap genes enables the LOD of the assay to be determined (0.1 IU, 1 IU, 10 IU, and 100 IU).
- LOD of the assay 0.1 IU, 1 IU, 10 IU, and 100 IU.
- the test method is performed.
- an in vitro relative potency bioassay is performed. Briefly, cells are plated in a 96-well plate and incubated at 37°C/5% CO2 overnight. The next day, cells are infected with serially diluted AAV vector and are incubated at
- Vector samples are first quantified for total protein against a bovine serum albumin (BSA) protein standard curve using a bicinchoninic acid (BCA) assay. The determination is made by mixing equal parts of sample with a Micro-BCA reagent provided in the kit. The same procedure is applied to dilutions of a BSA standard. The mixtures are incubated at 60°C and absorbance measured at 562 nm. A standard curve is generated from the standard absorbance of the known concentrations using a 4-parameter fit. Unknown samples are quantified according to the 4 -parameter regression.
- BSA bovine serum albumin
- BCA bicinchoninic acid
- the samples are normalized for genome titer, and 5.00 x 10 9 GC is separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions.
- SDS-PAGE gel is then stained with SYPRO Ruby dye. Any impurity bands are quantified by densitometry. Stained bands that appear in addition to the three AAV-specific proteins (VP1, VP2, and VP3) are considered protein impurities. The impurity mass percent as well as approximate molecular weight of contaminant bands are reported.
- the SDS-PAGE gel is also used to quantify the VP 1, VP2, and VP3 proteins and determine their ratio.
- GC/IU ratio is a measure of product consistency.
- the ddPCR titer (GC/mL) is divided by the“infectious unit” (IU/mL) to give the calculated GC/IU ratio.
- IU/mL “infectious unit”
- mice Healthy 6 - 8 - week-old C57BL6/J mice were selected for this Proof- of-Concept (POC) experiments.
- the ICV route was selected because the small size of mice makes it difficult to reliably inject AAV vector via ICM.
- the age was selected based on historical data and our previous experience performing ICV injections in this age of mice (Hinderer et al, 2016).
- a 21 day necropsy time point was chosen to capture stable transgene expression based upon previous experience with other ICV-administered AAV vectors in mice (Hinderer et al, 2016).
- C57BL6/J wild type mice were administered the AAVhu68.CB7.CI.hARSAco.rBG vector into the CSF via a single ICV injection into the right cerebral ventricle at either a low dose of 1.00 x 10 10 GC or a high dose of 1.00 x 10 11 GC.
- the doses were selected based upon previous dose ranging studies of an ICV-administered AAV vector in a different LSD mouse model (Hinderer et al, 2016).
- As a control age-matched C57BL6/J mice were injected with a single ICV injection into the right cerebral ventricle with vehicle (PBS) to obtain baseline ARSA activity levels.
- PBS vehicle
- mice Twenty -one days after the administration, mice were necropsied, and ARSA activity levels quantified in dialyzed protein extracts from samples of brain, liver, and serum using a colorimetric assay based on the cleavage of an artificial substrate, 4-Nitrocatechol Sulfate.
- ARSA activity levels were measured in the left versus right cerebral hemispheres 21 days after the
- AAVhu68.CB7.CI.hARSAco.rBG vector administration was 12% and 31% higher in the brains of mice administered the low dose (1.00 x 10 10 GC) or high dose
- ARSA activity levels in the serum were 30% and 151% higher in mice administered the low dose (1.00 x 10 10 GC) or high dose (1.00 x 10 11 GC) of the AAVhu68.CB7.CI.hARSAco.rBG vector, respectively (FIG. 9 A).
- ARSA activity levels were 11-fold and 28-fold higher in mice administered the low dose (1.00 x 10 10 GC) or high dose (1.00 x 10 11 GC) of the
- AAVhu68.CB7.CI.hARSAco.rBG vector respectively (FIG. 9B). These results suggest that, in addition to the brain, CSF-delivered AAVhu68.CB7.CI.hARSAco.rBG vector may have transduced and/or cross-corrected cells of peripheral organ systems, particularly in the liver. Overexpression of enzymatically active ARSA is also detected in liver and serum at both doses of AAV.CB7.CI.hARSAco.rBG.
- this experiment confirmed that a single unilateral ICV injection of the AAVhu68.CB7.CI.hARSAco.rBG vector in mice resulted in dose -dependent expression of an enzymatically active ARSA enzyme in both hemispheres of the brain within 21 days. Functional ARSA enzyme was also present in the serum and liver, suggesting that the
- AAVhu68.CB7.CI.hARSAco.rBG vector was transduced in peripheral organ systems. However, because we were measuring ARSA activity as overexpression above wild type baseline levels, this overexpression precluded the translation of these results to a potentially effective therapeutic dose. An MED study is therefore performed in Arsa -/- mice to confirm the dose range (Example
- AAVhu68.CB7.CI.hARSAcoFlA.rBG was utilized which is an AAVhu68 vector similar to AAVhu68.CB7.CI.hARSAco.rBG that encodes human engineered ARSA enzyme tagged with a C-terminal HA peptide. Because anti-ARSA antibodies can, in theory, cross-react with endogenous murine ARSA in wild type animals, an anti-hemagglutinin (HA) antibody was used to assess ARSA expression following ICV administration. The observed ARSA expression profile following the administration of this similar AAVhu68 vector is expected to be representative of ARSA expression following AAVhu68.CB7.CI.hARSAco.rBG administration.
- HA hemagglutinin
- mice were necropsied, and brain samples containing cortex and subcortical white matter were obtained to assess expression of ARSA in oligodendrocytes (which are identified by expression of oligodendrocyte transcription factor 2 (OLIG2)).
- the vector dose, mouse strain, age, and necropsy time point were selected to mirror Example 2, and the cortex and subcortical white matter were examined because these regions are consistently transduced after ICV administration and are key tissues to target for treating MLD.
- AAVhu68.CB7.CI.hARSAco.rBG can provide a long-lasting source of secreted ARSA enzyme to both the neurons and myelinating cells of the CNS and PNS that are affected in MLD patients.
- this experiment demonstrated that by 21 days after ICV administration of a vector similar to AAVhu68.CB7.CI.hARSAco.rBG in wild type mice, ARSA enzyme was successfully delivered to both neurons and oligodendrocytes in the brain, which are key target cell types for the treatment of MLD.
- Transduced cells expressing HA-tagged ARSA were observed in both sides of the brain after a unilateral ICV administration.
- HSC-GT is similar to the therapeutic approach described in these Examples in that it relies on cross-correction from CNS-resident cells secreting ARSA, it was reasoned that CSF levels of ARSA in NHPs would be predictive of the potential efficacy of the
- the AAVhu68.CB7.CI.hARSAco.rBG vector was administered ICM at a dose of 3.00 x 10 12 GC (low dose), 1.00 x 10 13 GC (mid-dose), or 3.00 x 10 13 GC (high dose) to adult cynomolgus macaques.
- CSF and serum were collected weekly during the 42 days following AAVhu68.CB7.CI.hARSAco.rBG administration (with the exception of Day 30 for CSF collection) to assess the dynamics of ARSA activity levels and the presence of inhibitory anti- ARSA antibodies.
- AAVhu68.CB7.CI.hARSAco.rBG The doses of AAVhu68.CB7.CI.hARSAco.rBG were selected based upon previous experience with ICM-administered vectors expressing secretable proteins in NHPs (Hordeaux et al., 2018). Sample collection time points during the 42 days following
- AAVhu68.CB7.CI.hARSAco.rBG treatment were expected to capture a stable plateau for ARSA activity levels based upon our previous experience that transgene expression is detectable by 14 days after IT AAV administration (Hinderer et al, 2014; Hinderer et al, 2018).
- AAVhu68.CB7.CI.hARSAco.rBG administered either the mid-dose (1.00 x 10 13 GC) or high dose (3.00 x 10 13 GC) of AAVhu68.CB7.CI.hARSAco.rBG increased CSF ARSA activity above baseline levels. ARSA activity peaked 7-14 days post treatment and subsequently returned to baseline levels by 35- 42 days post treatment. At its peak, ARSA activity was at least double that of baseline for each NHP receiving the mid-dose or high dose, suggesting that AAVhu68.CB7.CI.hARSAco.rBG might be capable of restoring normal ARSA levels when administered to an ARSA-deficient MLD patient. In contrast, the low dose (3.00 x 10 12 GC) of AAVhu68.CB7.CI.hARSAco.rBG was not effective at increasing ARSA activity levels (FIG. 11).
- AAVhu68.CB7.CI.hARSAco.rBG administration may have resulted from the production of inhibitory anti-hARSA antibodies.
- FOG. 12A In the serum, an increase in circulating anti-hARSA antibodies was apparent in some animals by 21-28 days after
- AAVhu68.CB7.CI.hARSAco.rBG administration By 42 days, most animals displayed elevated anti-hARSA antibodies, but unlike CSF, serum levels did not appear to correlate with the dose of AAVhu68.CB7.CI.hARSAco.rBG (FIG. 12B). These results suggest that the observed drop in ARSA activity 14 days after AAVhu68.CB7.CI.hARSAco.rBG administration was due to the induction of CSF- and serum-circulating anti-hARSA antibodies.
- transduced cells expressing human ARSA enzyme were detected throughout the brain, including the cortex (FIG. 13E, FIG. 13F, FIG. 13G, FIG. 131, and FIG. 13J), hippocampus (FIG. 13H), thalamus (FIG. 13K), and cerebellum (FIG. 13L).
- Cells of the cervical (FIG. 14D), thoracic (FIG. 14E), and lumbar (FIG. 14F) spinal cord along with cervical (FIG. 14G), thoracic (FIG. 14H), and lumbar (FIG. 141) DRG also expressed human ARSA enzyme .
- AAVhu68.CB7.CI.hARSAco.rBG (3.00 x 10 12 GC) or mid-dose (1.00 x 10 13 GC) of AAVhu68.CB7.CI.hARSAco.rBG were generated, and analysis is performed.
- AAVhu68.CB7.CI.hARSAco.rBG total ARSA activity levels in the CSF of NHPs more than doubled.
- CSF ARSA activity levels returned to approximately baseline levels over the subsequent 28 days due to the production of antibodies against the human ARSA transgene.
- transduced cells throughout the brain and spinal cord still persisted for the duration of the 42 day study, including cells that have projections into the PNS (e.g., DRGs and motor neurons).
- Axonopathy at the high dose (3.00 x 10 13 GC) without clinical signs were observed and were consistent with previous findings following ICM AAV administration.
- These data support use of AAVhu68.CB7.CI.hARSAco.rBG for delivering ARSA to deficient neurons and myelin- producing cells in the CNS and PNS of MLD patients.
- Arsa arylsulfatase A (gene, mouse); CNS, central nervous system; CRISPR/Cas9, clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9; Gal3stl, galactose-3-O-sulfotransferase- l (gene, mouse); GAL3ST1, galactose-3-O-sulfotransferase-l (protein); PNS, peripheral nervous system; tg, transgene.
- the classic MLD mouse model (referred to in the literature as“non-demyelinating MLD mice”) was developed through homologous recombination via insertion of a 1.3 kb neomycin cassette into exon 4 of the Arsa gene. This insertion resulted in a complete knock out of the gene with homozygous Arsa -/- mice lacking detectable Arsa mRNA and functional protein. These mice develop progressive sulfatide storage in the CNS, PNS, kidneys, and liver similar to what has been described in MLD patients. However, the storage and associated phenotypes are slower to progress when compared to human patients, manifesting around middle age in the mouse (6-12 months).
- Increased sulfatide levels can be detected by 6 months using a biochemical analysis (Ramakrishnan et al, 2007), but significant histological sulfatide staining is only observable by 10-12 months of age (Gieselmann et al, 1998).
- the most consistent neurological symptoms measurable in Arsa -/- mice are abnormalities in gait pattern (based upon footprint analysis) and reduced motor coordination (measured by rotarod performance) (Gieselmann et al, 1998; Matzner et al, 2009; Stroobants et al., 2011), which usually appear after 6-10 months of age.
- no demyelination is found in the CNS or PNS of Arsa -/- mice, which explains the surprisingly mild phenotype and normal lifespan observed for these animals.
- GAL3ST1 is involved in the biosynthesis of sulfatides, and the double mutant mice (tg/Arsa -/- ) accumulate about two times more sulfatides in their tissues when compared to Arsa -/- mice.
- the tg/Arsa -/- mice exhibit increased storage of sulfolipids in the CNS and PNS detected by alcianophilic histological staining, impaired nerve conduction, and decreased myelination in the PNS and, to a lesser extent, the CNS (Ramakrishnan et al., 2007), all of which are key features of MLD in human patients.
- AAVhu68.CB7.CI.hARSAco.rBG The pharmacological activity of AAVhu68.CB7.CI.hARSAco.rBG is assessed in both in vivo and in vitro models of MLD.
- a novel Arsa -/- (+/- AAV-PH.B- GAL3ST1) mouse model was generated and is characterized as the availability of published in vivo models (Arsa -/- [single mutation] and tg / Arsa -/- [ double mutation]) is limited.
- the new mouse model displays a natural history comparable to that of the classic Arsa -/- mouse, including phenotypes similar to those observed in MLD patients, specifically sulfatide storage in cells of the central nervous system (CNS), peripheral nervous system (PNS), kidneys, and liver along with gait abnormalities and reduced motor coordination.
- CNS central nervous system
- PNS peripheral nervous system
- the new Arsa -/- mouse line was generated using CRISPR/Cas9 embryonic microinjection.
- Four founders were produced that have deletions of exons 2-4 that ranged from 1105 bp to 1133 bp in length. All four founders were bred once with C57BL/6J wild type mice and successfully transmitted the deleted allele to the FI generation.
- FI generation carriers were crossbred once more into a C57BL6/J background to further dilute any unwanted off-target editing. All four lines produced F2 generation carriers that are being bred to generate and characterize the four Arsa -/- mouse lines. The first Arsa -/- mice were bom.
- the utilized genetic engineering strategy targets the mouse Arsa gene located on chromosome 15 using several guide RNAs to facilitate the targeted deletion of exon 2 through exon 4. While the classic Arsa -/- model employed homologous recombination of a neomycin cassette to produce a null allele, CRISPR/Cas9 gene editing is anticipated to produce a complete knock out with a comparable phenotype in less time than previous gene targeting methods.
- mice that overexpress GAL3ST1 similar to tg/Arsa -/- mice is also generated to determine whether demyelination can be observed under aggravated conditions.
- an AAV-PHP.B vector is employed to overexpress GAL3ST (AAV -PHP.B.CB7.GAL3STlco.rBG [AAV- PH.B.GAL3ST1]).
- the AAV.PHP.B capsid was selected because it displays robust CNS tropism after systemic (IV) injection in C57BL6/J mice (Deverman et al, 2016; Hordeaux et al, 2019).
- Either the Arsa -/- mouse or the AAV-PH.B.GAL3STl-mediated aggravated Arsa -/- mouse or both are selected for pharmacology and MED studies. The decision is based on which mouse line displays the best breeding performance and percentage of Arsa -/- mice from crosses of Arsa +/- carriers, in addition to meeting the greatest number of phenotypic criteria above.
- mice with approximately 8 weeks of age are enrolled in the natural history study after
- a delayed or absent demyelination phenotype may be observed.
- a subset of mice in each line is treated with an IV bolus of an AAV-PHP.B vector encoding the sulfatide-synthesizing enzyme GAL3ST1 (AAV-PHP.B.CB7.GAL3STlco.rBG) to increase sulfatide synthesis rates.
- GAL3ST1 sulfatide-synthesizing enzyme
- overexpression of GAL3ST1 may create a more rapid storage overload and an aggravated disease model that demonstrates demyelination along a time course more similar to the disease progression observed in humans.
- mice All mice are subjected to weekly clinical observations to monitor general health and ataxia in parallel with Arsa -/- mice in the natural history study.
- EXAMPLE 6 Identification of the Minimum Effective Dose (MED) of AAVhu68.CB7.CI.hARSAco.rBG in Area 7 - Mice.
- MED Minimum Effective Dose
- the Arsa -/- mouse line identified Example 5 is selected to conduct the MED study of ICV- administered AAV.CB7.CI.hARSAco.rBG.
- the age at injection, in-life parameters, and age at necropsy are based on the most relevant disease biomarkers defined in other examples.
- the MED study is performed using the toxicological vector lot that is manufactured for the GLP NHP toxicology study.
- the study evaluates four dose levels to determine the MED, pharmacology, and histopathology (efficacy and safety).
- the dose levels were selected based on the pilot dose range in wild type mice Examples 2 and 3 and the maximal feasible dose when scaled to humans.
- the age of ICV injection is determined based on the natural history study results. Animals are sacrificed at an appropriate time point post-injection to obtain
- necropsy time points are determined based upon Example 5, and may be performed when mice are approximately 5-12 months of age based upon the natural history of the published Arsa -/- models. However, the necropsy time point may be extended based on the results of the natural history study and the endpoints that are measured.
- Efficacy endpoints are defined based on results from Example 5 and may include assays such as ataxia scoring, body weight, motor coordination on a rotarod, and sensory function on a hotplate. In the absence of a satisfying neurobehavioral endpoint, ARSA activity levels, sulfatide storage, and histopathology may be the criteria used to define the MED.
- Example 5 identifies a reliable aggravated model using AAV-PHP.B-mediated GAL3ST1 overexpression (sulfatide overload), one study arm for aggravated mice is performed at each dose level. Those mice concurrently receive an IV-administered dose of AAV.PHP.B.GAL3ST1 and an ICV-administered dose of AAV.CB7.CI.hARSAco.rBG on Study Day 0 to avoid the production of cross-reactive NAbs, which might occur with staggered dosing.
- bInitial histopathology analysis focuses on the brain, cervical spinal cord, cervical DRG, peripheral nerves, liver, spleen, kidney, lungs, heart, diaphragm, and muscle. Additional tissues are also collected for optional histopathology, including gastrointestinal tract, reproductive organs, adrenal glands, and lymph nodes. Organs are weighed as appropriate.
- Arsa arylsulfatase A (gene, mouse); ARSA, arylsulfatase A (protein); CNS, central nervous system; CSF, cerebrospinal fluid; GAL3ST1, galactose-3 -O-sulfotransferase- 1 (protein); GC, genome copies;
- AAV.CB7.CI.hARSAco.rBG efficacy of AAV- mediated ARSA gene delivery is assessed using an in vitro disease model.
- an MLD patient-derived iPSC-based model recapitulating defective glial and neuronal differentiation as well as several features of MLD, such as lysosomal compartment expansion, sulfatide storage, oxidative stress, and apoptosis was characterized (Frati et al, 2018).
- One patient-derived cell line (RIKEN cell bank reference HPS0240), as well as two CRISPR-Cas9 ARSA knockout iPSC clones, is characterized. An appropriate cell line is identified.
- AAVhu68 capsid is known to poorly transduce cells in culture, a different AAV serotype may be used to deliver an ARSA- encoding vector genome which is or similar to AAV.CB7.CI.hARSAco.rBG for these studies.
- the neural progenitor cell stage did not show any conclusive phenotype in terms of oxidative stress or morphological changes described by Frati et al. (2016), Differentiated cells (neurons and oligodendrocytes) are under investigation because they demonstrated a more prominent sulfatide storage phenotype in the published work. With reliable sulfatide storage, phenotype rescue is tested using AAV-mediated ARSA transduction. Because the AAVhu68 capsid is known to poorly transduce cells in culture, a capsid of a different serotype may be used to deliver an ARSA-encoding vector genome which is or similar to AAV.CB7.CI.hARSAco.rBG.
- Both adult cynomolgus macaques and juvenile Rhesus macaques have similar anatomical and physiological features and replicate the CNS anatomy of the intended infantile clinical population and can be treated using the clinical ROA (ICM).
- the similarity in anatomy and ROA may result in representative vector distribution and transduction profiles, which allow for more accurate assessment of toxicity than is possible in mice.
- more rigorous neurological assessments are performed in NHPs than in a rodent model, allowing for more sensitive detection of CNS toxicity.
- a pharmacology study demonstrated the potential for AAV- mediated delivery of ARSA enzyme via transduction and/or cross-correction of both neurons and myelin-producing oligodendrocytes in the brain of healthy mice following ICV administration of AAV.CB7.CI.hARSAco.rBG.
- a pharmacology study in cynomolgus macaques administered AAV.CB7.CI.hARSAco.rBG via the clinical route (ICM) showed increased ARSA activity in the CSF by at least double endogenous levels during the first 14 days after treatment.
- AAV.CB7.CI.hARSAco.rBG has the potential to deliver therapeutic levels of ARSA to the CSF of MLD patients. Furthermore, it is demonstrated that for at least 42 days after
- AAV.CB7.CI.hARSAco.rBG administration transduced and/or cross-corrected cells expressing ARSA persist broadly throughout the brain and spinal cord, including cells with projections into the PNS (spinal motor neurons and dorsal root ganglia [DRG]).
- AAV.CB7.CI.hARSAco.rBG therefore has the potential to provide a long-lasting source of secreted ARSA enzyme to both the neurons and myelinating cells of the CNS and PNS that are affected in MLD patients.
- a 180 day GLP-compliant toxicology study of AAV.CB7.CI.hARSAco.rBG is performed in juvenile Rhesus macaques using the intended clinical route of administration (ROA).
- Intrathecal (IT) delivery of other AAV vectors into the CSF of Rhesus macaques has resulted in peak transgene expression 2-3 weeks after injection followed by a stable plateau in transgene expression by 90 days.
- a peak in ARSA expression is observed 14 days after ICM administration in cynomolgus macaques. Therefore, a 180 day time point is sufficient to evaluate any toxicity occurring during the period of maximum exposure to the transgene product. Evaluations through 180 days are also adequate to detect immediate toxicity due to the injection procedure or an innate inflammatory response to the test article, as well as adaptive immune responses to the vector capsid or transgene product.
- a 180 day GLP-compliant safety study are conducted in juvenile Rhesus macaques (approximately 1-2 years of age) to investigate the toxicology of AAV.CB7.CI.hARSAco.rBG following ICM administration.
- the 180 day evaluation period was selected because this allows sufficient time for a secreted transgene product to reach stable plateau levels following ICM
- AAV administration The age of administration was selected to be representative of our intended infantile population in terms of CNS anatomy.
- the study design is outlined in the table below.
- ICM intra-cistema magna
- ITFFB intrathecal final formulation buffer
- M male
- NA not applicable
- ROA route of administration
- AAV.CB7.CI.hARSAco.rBG dose levels are selected to be equivalent to those that is evaluated in the MED study when scaled by brain mass (assuming 0.4 g for the mouse and 90 g for the Rhesus macaque).
- NHPs are dosed using the same vector delivery device as described.
- Baseline neurologic examinations are performed. After AAV.CB7.CI.hARSAco.rBG or vehicle administration, the animals are monitored daily for signs of distress and abnormal behavior. Blood and CSF clinical pathology assessments and neurologic examinations are performed on a weekly basis for 30 days following AAV.CB7.CI.hARSAco.rBG or vehicle administration, and every 30 days thereafter.
- anti-AAVhu68 NAbs and cytotoxic T lymphocyte responses to AAVhu68 and the AAV.CB7.CI.hARSAco.rBG transgene product are assessed by an interferon gamma (IFN-g) enzyme-linked immunospot (ELISpot) assay.
- IFN-g interferon gamma enzyme-linked immunospot
- mice Ninety days after AAV.CB7.CI.hARSAco.rBG or vehicle administration, 50% of the animals (Groups 1-4) are euthanized, and a histopathological analysis is performed on a comprehensive list of tissues, including, but not limited to, brain, spinal cord, DRG, peripheral nerves, heart, liver, spleen, kidney, lungs, reproductive organs, adrenal glands, and lymph nodes. Organs are weighed as appropriate. Lymphocytes are harvested from the circulating compartment (peripheral blood mononuclear cells) and CNS-draining lymph nodes are evaluated for the presence of T cells reactive to both the capsid and transgene product in these organs at the time of necropsy.
- Groups 1-4 Ninety days after Groups 1-4 are euthanized (One hundred and eighty days after AAV.CB7.CI.hARSAco.rBG or vehicle administration) the remaining animals (Groups 5-8) are euthanized, and a histopathological analysis is performed as above.
- Tissues, CSF, and serum for vector biodistribution are harvested and archived, in addition to urine and feces to assess vector excretion.
- qPCR in tissue samples was assessed using the same capsid and ROA in juvenile macaques.
- ICM vector administration results in immediate vector distribution within the CSF compartment, and both efficacy and toxicity are related to CNS vector exposure. Doses are therefore scaled by brain mass, which provides an approximation of the size of the CSF compartment. Dose conversions are based on a brain mass 0.4 g for an adult mouse (Gu et al, 2012), 90 g for juvenile rhesus macaques (Herndon et al, 1998), and 800 g for 4- 12 -month-old human infants (Dekaban, 1978). Equivalent human doses are shown in the table below.
- vector genomes are constructed which include drg-detargetting miRNA sequences.
- a rAAV vector genome is constructed as, from 5’ to 3’, CB7 promoter, engineered hARSA coding sequence, four consecutive miRNA 183 (with sequence of AGTGAATTCTACCAGTGCCATA, SEQ ID NO:
- AAV.CB7.CI.hARSAco.miRNA183.rBG This vector genome is termed as AAV.CB7.CI.hARSAco.miRNA183.rBG while a rAAV comprising this vector genome and an AAVhu68 capsid is termed as AAVhu68.CB7.CI.hARSAco.miRNA183.rBG.
- Production of the rAAV vector comprising this vector genome is performed similar to the method described in Example 1. Efficacy and toxicity of the AAVhu68.CB7.CI.hARSAco.miRNA183.rBG are tested using methods and models described in Examples 2-8 and 10.
- Safety and tolerability, pharmacodynamics, and clinical efficacy are assessed over 2 years, and all subjects are followed through 5 years post-administration of AAV.CB7.CI.hARSAco.rBG for the long-term evaluation of safety and tolerability, pharmacodynamics, disease progression, and clinical outcomes.
- the study consists of a screening phase to determine eligibility of each potential subject from approximately Day -35 to Day -1.
- baseline assessments include brain MRI, LP for CSF collection, blood draw, urine collection, vitals, ECG, a physical exam, a neurological exam, and clinical assessments.
- Baseline assessments occur on Days -1 and Day 0, and eligibility is reconfirmed at baseline prior to administration of AAV.CB7.CI.hARSAco.rBG.
- subjects are admitted to the hospital on the morning of Day 0.
- Subjects receive a single ICM dose of AAV.CB7.CI.hARSAco.rBG on Day 0 and remain in the hospital for at least 24 hours after dosing for observation.
- Subsequent study visits occur at Day 7, Day 14, Day 30, 3 months, and 6 months after dosing, followed by every 6 months for the first 2 years after dosing.
- Long-term follow-up (LTFU) visits occur for an additional 3 years at a frequency of every 12 months through 5 years post-dosing.
- a single dose of AAV.CB7.CI.hARSAco.rBG is administered at one of dose levels as indicated below.
- Cohort 1 (Low Dose): Three eligible subjects (Subjects #1-3) are sequentially enrolled and administered the low dose of AAV.CB7.CI.hARSAco.rBG with a 4 week safety observation period between the first and second subject. If no SRTs are observed, all available safety data is evaluated by a safety board 4 weeks after the third subject in Cohort 1 is administered AAV.CB7.CI.hARSAco.rBG.
- Cohort 2 High Dose: Three eligible subjects (Subjects #4-6) are sequentially enrolled and administered the high dose of AAV.CB7.CI.hARSAco.rBG with a 4 week safety observation period between the fourth and fifth subject. If no SRTs are observed, the safety board evaluates all available safety data 4 weeks after Subject #6 is administered AAV.CB7.CI.hARSAco.rBG, including safety data from subjects in Cohort 1.
- Cohort 3 (MTD, Maximum Tolerated Dose): With a positive recommendation by the safety board, 6 additional subjects (Subjects #7-12) are enrolled and administered a single ICM dose AAV.CB7.CI.hARSAco.rBG at the MTD. Dosing for subjects in this cohort are not staggered with a 4 week safety observation period between each subject.
- a total enrollment of 9 subjects are enrolled in either the high dose or low dose cohort, and 12 subjects in total (across all doses).
- a safety margin is applied so that the high dose selected for human subjects is 30-50% of the equivalent MTD in NHPs.
- the low dose is typically 2-3-fold less than the selected high dose provided it is a dose that exceeds the equivalent scaled MED in the animal studies. With the understanding that if tolerated, the higher dose would be expected to be advantageous.
- the dosing window between the second and third patient in the cohort would be at least 24 hours to observe the patient for acute toxicity, allergic reactions, and procedure-related events. Given the rarity of the disease, the probability that two subjects would present simultaneously for treatment is considered low.
- the rationale for the proposed approach is that the risk of missing the treatment window because the patient experienced rapid disease progression would outweigh the potential benefit of prolonged safety follow-up before dosing the next patient in the cohort.
- the pediatric patients (>4 months of age) with early onset (late infantile or early juvenile) MLD caused by ARSA enzyme deficiency represent the population with the highest unmet need.
- Those MLD patients enrolled in our proposed FIH trial may have a 0/0 (two null ARSA alleles with no detectable functional enzyme produced) or 0/R (Heterozygosity for one null ARSA allele and one“residual” ARSA allele (R) encoding enzyme with residual functional activity that can still degrade small amounts of sulfatide) genotype. They display a devastating disease course with rapid and predictable decline in both motor and cognitive impairment leading to death within a few years of disease onset. Disease -modifying treatments are unavailable for most early onset patients.
- Hematopoietic stem cell transplant does not provide benefit in this population, while hematopoietic stem cell with gene therapy (HSC-GT) is an investigational treatment that is only effective in pre-symptomatic patients, who constitute a small minority of the early onset population.
- HSC-GT hematopoietic stem cell with gene therapy
- Primary endpoints assess the safety and tolerability of AAV.CB7.CI.hARSAco.rBG.
- Secondary or exploratory endpoints include pharmacokinetic and pharmacodynamic properties (transgene expression, biomarker activity, and imaging parameters) and clinical efficacy outcomes (gross and fine motor function, cognitive and language development, neurological exam findings, behavioral and milestone development, and parent-reported outcomes and quality of life assessments).
- Efficacy endpoints and timing of follow-up were selected to measure prevention or stabilization of disease progression.
- Gallbladder pathologies are therefore monitored in our proposed FIH trial as both a safety signal and an exploratory endpoint.
- AAV.CB7.CI.hARSAco.rBG To assess the safety and tolerability of AAV.CB7.CI.hARSAco.rBG through 24 months following administration of a single ICM dose through evaluation of: AEs and SAEs, Vital signs and physical examinations, Neurological examinations, Electrocardiograms (ECGs), Sensory nerve conduction studies (for evaluation of DRG toxicity), Laboratory assessments (serum chemistry, hematology, coagulation studies, liver function tests [LFTs], urinalysis, and CSF chemistry and cytology), and/or immunogenicity of the vector and transgene product.
- ECGs Electrocardiograms
- Sensory nerve conduction studies for evaluation of DRG toxicity
- Laboratory assessments serum chemistry, hematology, coagulation studies, liver function tests [LFTs], urinalysis, and CSF chemistry and cytology
- immunogenicity of the vector and transgene product To assess the safety and tolerability of AAV.CB7.CI
- GMFC-MLD Metachromatic Leukodystrophy
- Additional measurements for efficacy of AAV.CB7.CI.hARSAco.rBG includes the following: To assess the pharmacodynamics and biological activity of
- AAV.CB7.CI.hARSACO.RBG over 2 years following administration of a single ICM dose based on the following endpoints: Levels of ARSA in CSF and serum;
- Inclusion Criteria comprises the following:
- An older sibling affected by MLD index case whose age of symptom onset was ⁇ 7 years of age.
- Subjects are classified as late infantile, early juvenile, or intermediate late infantile/early juvenile based on age of symptom onset in the index case and their ARSA genotype as follows: Late infantile: symptom onset in index case ⁇ 30 months of age and genotype typically 0/0; Early juvenile: symptom onset in index case >30 months and ⁇ 7 years of age with genotype typically 0/R; Intermediate late infantile/early juvenile: symptom onset in index case ⁇ 7 years of age, but unable to unambiguously characterize index case as late infantile or early juvenile
- MLD is diagnosed in a pre-symptomatic child without an older affected sibling (e.g., incidentally or via newborn screening when available), the totality of available data strongly suggest that the subject has an early onset variant of MLD likely to benefit from gene therapy, and the subject is ⁇ 7 years of age, then the subject may be considered eligible after discussion and approval by the Sponsor Medical Monitor;
- a delay in expected achievement of motor milestones such as a delay in achieving independent standing or walking (>95 th percentile on WHO milestone ranges)
- Mild abnormalities on NCE including, but not limited to, increased tone, spasticity, or hyperreflexia. If the subject has achieved independent walking, then signs of mild ataxia are acceptable provided the subject can walk at least 10 steps independently;
- Symptomatic Early Juvenile Subjects are eligible if they have mild/moderate abnormalities on NCE including, but not limited to, increased tone, spasticity, hyperreflexia, or mild gait abnormalities not requiring aids for walking;
- Exclusion Criteria comprises the following:
- HIV human immunodeficiency virus
- Hepatitis C Hepatitis C
- AAV.CB7.CI.hARSAco.rBG is administered as a single dose to hospitalized subjects on Day 0 via real-time CT-guided sub-occipital injection into the cistema magna.
- a syringe containing 5.6 mL of AAV.CB7.CI.hARSAco.rBG at the appropriate titer is prepared by the Investigational Pharmacy associated with the study and delivered to the procedure room.
- the subject Prior to study drug administration, the subject is anesthetized, intubated, and the injection site is prepped and draped using sterile technique.
- An LP is performed to remove a predetermined volume of CSF, after which iodinated contrast is IT injected to aid in visualization of relevant anatomy of the cistema magna.
- IV contrast may be administered prior to or during needle insertion as an alternative to the IT contrast. The decision to use IV or IT contrast is at the discretion of the interventionalist performing the procedure.
- a spinal needle (22-25 G) is advanced into the cistema magna under CT-fluoroscopic guidance. A larger introducer needle may be used to assist with needle placement. After confirmation of needle placement, the extension set is attached to the spinal needle and allowed to fill with CSF.
- a syringe containing contrast material may be connected to the extension set and a small amount injected to confirm needle placement in the cistema magna. After the needle placement is confirmed, the syringe containing AAV.CB7.CI.hARSAco.rBG is connected to the extension set. The syringe contents are slowly injected over 1-2 minutes, delivering a volume of 5.0 mL.
- Safety assessments including collection of Adverse Events (AEs) and Serious Adverse Events (SAEs), physical and neurologic examinations, vital signs, clinical laboratory tests (serum chemistry, hematology, coagulation, LFTs, urinalysis), ECGs, nerve conduction studies, and CSF cytology and chemistry (cell counts, protein, glucose) are performed. Safety evaluations after the first three subjects in Cohort 1 and after the first three subjects in Cohort 2 are conducted. Statistical comparisons are performed for secondary and exploratory endpoints.
- AEs Adverse Events
- SAEs Serious Adverse Events
- Measurements at each time point are compared to baseline values for each subject, as well as data from age-matched healthy controls and natural history data from MLD patients with comparable cohort characteristics where available for each endpoint.
- AAVhu68 was analyzed for modifications. Briefly, AAVhu68 vectors were produced using vector genomes which are not relevant to this study, each produced using conventional triple transfection methods in 293 cells. For a general description of these techniques, see, e.g., Bell CL, et al, The AAV9 receptor and its modification to improve in vivo lung gene transfer in mice. J Clin Invest. 2011;121:2427-2435.
- a plasmid encoding the sequence to be packaged (a transgene expressed from a chicken b-actin promoter, an intron and a poly A derived from Simian Virus 40 (SV40) late gene) flanked by AAV2 inverted terminal repeats, was packaged by triple transfection of HEK293 cells with plasmids encoding the AAV2 rep gene and the AAVhu68 cap gene and an adenovirus helper plasmid (pAdAF6).
- the resulting AAV viral particles can be purified using CsCl gradient centrifugation, concentrated, and frozen for later use.
- Denaturation and alkylation To 100 mg of the thawed viral preparation (protein solution), add 2 m ⁇ of 1M Dithiothreitol (DTT) and 2m1 of 8M guanidine hydrochloride (GndHCl) and incubate at 90°C for 10 minutes. Allow the solution to cool to room temperature then add 5m1 of freshly prepared 1M iodoacetamide (IAM) and incubate for 30 minutes at room temperature in the dark. After 30 minutes, quench alkylation reaction by adding 1 m ⁇ of 1M DTT.
- DTT Dithiothreitol
- GndHCl 8M guanidine hydrochloride
- Digestion To the denatured protein solution add 20mM Ammonium Bicarbonate, pH 7.5- 8 at a volume that dilutes the final GndHCl concentration to 800mM. Add trypsin solution for a 1 :20 trypsin to protein ratio and incubate at 37 °C overnight. After digestion, add TFA to a final of 0.5% to quench digestion reaction.
- Mass Spectrometry Approximately 1 microgram of the combined digestion mixture is analyzed by UHPLC-MS/MS. LC is performed on an UltiMate 3000 RSLCnano System (Thermo Scientific). Mobile phase A is MilliQ water with 0.1% formic acid. Mobile phase B is acetonitrile with 0.1% formic acid. The LC gradient is run from 4% B to 6% B over 15 min, then to 10% B for 25 min (40 minutes total), then to 30% B for 46 min (86 minutes total). Samples are loaded directly to the column. The column size is 75 cm x 15 um I.D. and is packed with 2 micron C18 media (Acclaim PepMap).
- the LC is interfaced to a quadrupole-Orbitrap mass spectrometer (Q- Exactive HF, Thermo Scientific) via nanoflex electrospray ionization using a source.
- the column is heated to 35oC and an electrospray voltage of 2.2 kV is applied.
- the mass spectrometer is programmed to acquire tandem mass spectra from top 20 ions. Full MS resolution to 120,000 and MS/MS resolution to 30,000. Normalized collision energy is set to 30, automatic gain control to le5, max fill MS to 100 ms, max fill MS/MS to 50 ms.
- Mass spectrometer RAW data files were analyzed by BioPharma Finder 1.0 (Thermo Scientific). Briefly, all searches required 10 ppm precursor mass tolerance, 5ppm fragment mass tolerance, tryptic cleavage, up to 1 missed cleavages, fixed modification of cysteine alkylation, variable modification of methionine/tryptophan oxidation,
- T refers to the trypsin and C refers to chymotrypsin.
- AAVhu68.CB7.CI.eGFP.WPRE.rBG (3.00 x 10 13 GC)
- AAVhu68 capsid provides the possibility of cross-correction in the CNS.
- HSC-GT lentiviral hematopoietic stem cell gene therapy
- Gieselmann V. Matzner U., Hess B., Lullmann-Rauch R., Coenen R., Hartmann D., D'Hooge R., DeDeyn P., & Nagels G. (1998). "Metachromatic leukodystrophy: Molecular genetics and an animal model.” J Inherit Metab Dis. 21(5):564-74. Gieselmann V., Polten A., Kreysing J., & von Figura K. (1989). "Arylsulfatase A pseudodeficiency: loss of a polyadenylylation signal and N-glycosylation site.” Proc Natl Acad Sci U S A. 86(23):9436-40.
- Kapaun P. Dittmann R.W., Granitzny B., Eickhoff W., Wulbrand H., Neumaier-Probst E., Zander A., & Kohlschuetter A. (1999). "Slow progression of juvenile metachromatic leukodystrophy 6 years after bone marrow transplantation.” J Child Neurol. 14(4):222-8.
- REGENXBIO (2019). REGENXBIO reports fourth quarter and full -year 2018 financial results and recent operational highlights.
- Sessa M. Lorioli L., Fumagalli F., Acquati S., Redaelli D., Baldoli C., Canale S., Lopez I.D., Morena F., Calabria A., Fiori R., Silvani P., Rancoita P.M., Gabaldo M., Benedicenti F., Antonioli G., Assanelli A., Cicalese M.P., Del Carro U., Sora M.G., Martino S., Quattrini A., Montini E., Di Serio C., Ciceri F., Roncarolo M.G., Aiuti A., Naldini L., & Biffi A.
- Hematopoietic stem cell transplantation does not retard disease progression in the psycho-cognitive variant of late-onset metachromatic leukodystrophy. J Inherit Metab Dis. 33 Suppl 3:S471-5. Solders M., Martin D.A., Andersson C., Remberger M., Andersson T., Ringden O., & Solders G. (2014). "Hematopoietic SCT: a useful treatment for late metachromatic
- Zafeiriou D.I. Kontopoulos E.E., Michelakakis H.M., Anastasiou A.L., & Gombakis N.P. (1999). "Neurophysiology and MRI in late-infantile metachromatic leukodystrophy.” Pediatr Neurol. 21(5):843-6.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Hospice & Palliative Care (AREA)
- Virology (AREA)
- Inorganic Chemistry (AREA)
- Psychiatry (AREA)
- Environmental Sciences (AREA)
- Cell Biology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Psychology (AREA)
- Mycology (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202080048744.4A CN114072129A (zh) | 2019-05-03 | 2020-05-02 | 可用于治疗异染性脑白质营养不良的组合物 |
| AU2020270421A AU2020270421A1 (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
| US17/608,493 US12338451B2 (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
| EP20803017.1A EP3962454A4 (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
| CA3135539A CA3135539A1 (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
| JP2021564955A JP7715640B2 (ja) | 2019-05-03 | 2020-05-02 | 異染性白質ジストロフィーの治療に有用な組成物 |
| BR112021021908A BR112021021908A2 (pt) | 2019-05-03 | 2020-05-02 | Composições úteis no tratamento da leucodistrofia metacromática |
| PE2021001824A PE20220930A1 (es) | 2019-05-03 | 2020-05-02 | Composiciones utiles en el tratamiento de leucodistrofia metacromatica |
| KR1020217039381A KR20220020261A (ko) | 2019-05-03 | 2020-05-02 | 이염성 백질이영양증의 치료에 유용한 조성물 |
| SG11202111867XA SG11202111867XA (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
| MX2021013420A MX2021013420A (es) | 2019-05-03 | 2020-05-02 | Composiciones utiles en el tratamiento de leucodistrofia metacromatica. |
| IL287715A IL287715A (en) | 2019-05-03 | 2021-10-31 | Useful preparations in the treatment of metachromatic leukodystrophy |
| CONC2021/0016323A CO2021016323A2 (es) | 2019-05-03 | 2021-11-30 | Composiciones útiles en el tratamiento de leucodistrofia metacromática |
| US19/201,601 US20250313859A1 (en) | 2019-05-03 | 2025-05-07 | Compositions useful in treatment of metachromatic leukodystrophy |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962843091P | 2019-05-03 | 2019-05-03 | |
| US62/843,091 | 2019-05-03 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/608,493 A-371-Of-International US12338451B2 (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
| US19/201,601 Continuation US20250313859A1 (en) | 2019-05-03 | 2025-05-07 | Compositions useful in treatment of metachromatic leukodystrophy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020227166A1 true WO2020227166A1 (en) | 2020-11-12 |
Family
ID=73050896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/031207 Ceased WO2020227166A1 (en) | 2019-05-03 | 2020-05-02 | Compositions useful in treatment of metachromatic leukodystrophy |
Country Status (17)
| Country | Link |
|---|---|
| US (2) | US12338451B2 (https=) |
| EP (1) | EP3962454A4 (https=) |
| JP (1) | JP7715640B2 (https=) |
| KR (1) | KR20220020261A (https=) |
| CN (1) | CN114072129A (https=) |
| AR (1) | AR118850A1 (https=) |
| AU (1) | AU2020270421A1 (https=) |
| BR (1) | BR112021021908A2 (https=) |
| CA (1) | CA3135539A1 (https=) |
| CL (1) | CL2021002881A1 (https=) |
| CO (1) | CO2021016323A2 (https=) |
| IL (1) | IL287715A (https=) |
| MX (1) | MX2021013420A (https=) |
| PE (1) | PE20220930A1 (https=) |
| SG (1) | SG11202111867XA (https=) |
| TW (1) | TW202108760A (https=) |
| WO (1) | WO2020227166A1 (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021231579A1 (en) * | 2020-05-12 | 2021-11-18 | The Trustees Of The University Of Pennsylvania | Compositions for drg-specific reduction of transgene expression |
| RU2769577C1 (ru) * | 2021-06-01 | 2022-04-04 | федеральное государственное автономное образовательное учреждение высшего образования "Казанский (Приволжский) федеральный университет" (ФГАОУ ВО КФУ) | Препарат для лечения метахроматической лейкодистрофии и способ ее лечения |
| AU2020292256B2 (en) * | 2019-06-10 | 2023-01-19 | Homology Medicines, Inc. | Adeno-associated virus compositions for ARSA gene transfer and methods of use thereof |
| WO2023133584A1 (en) * | 2022-01-10 | 2023-07-13 | The Trustees Of The University Of Pennsylvania | Compositions useful in treatment of metachromatic leukodystrophy |
| WO2023196863A1 (en) * | 2022-04-05 | 2023-10-12 | Astellas Gene Therapies, Inc. | Adeno-associated virus potency assay and uses thereof |
| WO2023225481A1 (en) * | 2022-05-16 | 2023-11-23 | Genzyme Corporation | Methods of treating metachromatic leukodystrophy |
| JP2024515612A (ja) * | 2021-04-12 | 2024-04-10 | ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | 球脊髄性筋萎縮症(sbma)の治療に有用な組成物 |
| WO2024079361A1 (en) * | 2022-10-14 | 2024-04-18 | Neuway Pharma Gmbh | A PROTEIN- OR PEPTIDE-BASED CAPSULE (PPC), PREFERABLY A VLP, LOADED WITH A MESSENGER RNA (mRNA) AND A METHOD OF PRODUCTION AND PURIFICATION THEREOF |
| EP4351661A4 (en) * | 2021-06-08 | 2025-12-10 | Univ Pennsylvania | Recombinant adeno-associated viruses for Lesch-Nyhan's disorder and their uses |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024036250A2 (en) * | 2022-08-10 | 2024-02-15 | Homology Medicines, Inc. | Adeno-associated virus compositions for arsa gene transfer and methods of use thereof |
| CN118389675B (zh) * | 2024-05-27 | 2025-06-27 | 南方医科大学珠江医院 | 芳香族氨基酸脱羧酶作为标志物在肝性脑病的检测产品中的应用 |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000026393A1 (en) * | 1998-10-31 | 2000-05-11 | University Of Medicine And Dentistry Of New Jersey | A myeloid precursor cell useful for gene therapy and for modulation of immune responses |
| WO2002098455A2 (en) * | 2001-06-07 | 2002-12-12 | Hemebiotech A/S | Production of recombinant human arylsulfatase a |
| US20080003211A1 (en) * | 2004-01-30 | 2008-01-03 | Zymenex A/S | Production and Purification of Recombinant Arylsulftase |
| WO2013096899A2 (en) * | 2011-12-23 | 2013-06-27 | Shire Human Genetic Therapies, Inc. | Stable formulations for cns delivery of arylsulfatase a |
| US20180071373A1 (en) * | 2015-05-15 | 2018-03-15 | Regents Of The University Of Minnesota | Adeno-associated virus for therapeutic delivery to central nervous system |
| WO2018160582A1 (en) * | 2017-02-28 | 2018-09-07 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clade f vector and uses therefor |
Family Cites Families (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5139941A (en) | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
| US5436146A (en) | 1989-09-07 | 1995-07-25 | The Trustees Of Princeton University | Helper-free stocks of recombinant adeno-associated virus vectors |
| US6268213B1 (en) | 1992-06-03 | 2001-07-31 | Richard Jude Samulski | Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy |
| US5869305A (en) | 1992-12-04 | 1999-02-09 | The University Of Pittsburgh | Recombinant viral vector system |
| US6204059B1 (en) | 1994-06-30 | 2001-03-20 | University Of Pittsburgh | AAV capsid vehicles for molecular transfer |
| US6093570A (en) | 1995-06-07 | 2000-07-25 | The University Of North Carolina At Chapel Hill | Helper virus-free AAV production |
| US5741683A (en) | 1995-06-07 | 1998-04-21 | The Research Foundation Of State University Of New York | In vitro packaging of adeno-associated virus DNA |
| US6548286B1 (en) | 1997-04-14 | 2003-04-15 | Cell Genesys, Inc. | Methods for increasing the efficiency of recombinant AAV product |
| US6146874A (en) | 1998-05-27 | 2000-11-14 | University Of Florida | Method of preparing recombinant adeno-associated virus compositions |
| AU780231B2 (en) | 1998-11-10 | 2005-03-10 | University Of North Carolina At Chapel Hill, The | Virus vectors and methods of making and administering the same |
| CA2379166C (en) | 1999-08-09 | 2013-03-26 | Targeted Genetics Corporation | Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms instrastrand base pairs |
| US7201898B2 (en) | 2000-06-01 | 2007-04-10 | The University Of North Carolina At Chapel Hill | Methods and compounds for controlled release of recombinant parvovirus vectors |
| MX359371B (es) | 2001-11-13 | 2018-09-25 | Univ Pennsylvania | Un metodo para detectar y/o identificar secuencias del virus adeno-asociado y aislamiento de secuencias novedosas identificadas de ese modo. |
| AU2003274397A1 (en) | 2002-06-05 | 2003-12-22 | University Of Florida | Production of pseudotyped recombinant aav virions |
| EP2345731B1 (en) | 2003-09-30 | 2015-10-21 | The Trustees of the University of Pennsylvania | Adeno-associated virus (AAV) clades, sequences, vectors containing same, and uses thereof |
| ES2525067T3 (es) | 2005-04-07 | 2014-12-17 | The Trustees Of The University Of Pennsylvania | Método de incremento de la función de un vector de AAV |
| JP4495210B2 (ja) | 2005-06-09 | 2010-06-30 | パナソニック株式会社 | 振幅誤差補償装置及び直交度誤差補償装置 |
| US7588772B2 (en) | 2006-03-30 | 2009-09-15 | Board Of Trustees Of The Leland Stamford Junior University | AAV capsid library and AAV capsid proteins |
| US8734809B2 (en) | 2009-05-28 | 2014-05-27 | University Of Massachusetts | AAV's and uses thereof |
| WO2011126808A2 (en) | 2010-03-29 | 2011-10-13 | The Trustees Of The University Of Pennsylvania | Pharmacologically induced transgene ablation system |
| US8927514B2 (en) | 2010-04-30 | 2015-01-06 | City Of Hope | Recombinant adeno-associated vectors for targeted treatment |
| HRP20191923T1 (hr) | 2010-06-25 | 2020-01-10 | Shire Human Genetic Therapies, Inc. | Postupci i sastavi za isporuku arilsulfataze a u cns |
| AU2012346448B2 (en) * | 2011-12-02 | 2017-09-14 | Armagen, Inc. | Methods and compositions for increasing arylsulfatase A activity in the CNS |
| WO2013151665A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| CN115120746A (zh) * | 2013-05-15 | 2022-09-30 | 明尼苏达大学董事会 | 腺相关病毒介导的基因向中枢神经系统转移 |
| AU2015320694B2 (en) | 2014-09-24 | 2021-11-11 | City Of Hope | Adeno-associated virus vector variants for high efficiency genome editing and methods thereof |
| EP3387138B1 (en) | 2015-12-11 | 2022-01-26 | The Trustees Of The University Of Pennsylvania | Scalable purification method for aav9 |
| JP2019509270A (ja) * | 2016-02-17 | 2019-04-04 | シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド | アリールスルファターゼaのcns送達のための方法および組成物 |
| AU2018329741B2 (en) * | 2017-09-08 | 2025-02-20 | Poseida Therapeutics, Inc. | Compositions and methods for chimeric ligand receptor (CLR)-mediated conditional gene expression |
| WO2020132455A1 (en) | 2018-12-21 | 2020-06-25 | The Trustees Of The University Of Pennsylvania | Compositions for drg-specific reduction of transgene expression |
-
2020
- 2020-05-02 KR KR1020217039381A patent/KR20220020261A/ko active Pending
- 2020-05-02 JP JP2021564955A patent/JP7715640B2/ja active Active
- 2020-05-02 CN CN202080048744.4A patent/CN114072129A/zh active Pending
- 2020-05-02 BR BR112021021908A patent/BR112021021908A2/pt unknown
- 2020-05-02 WO PCT/US2020/031207 patent/WO2020227166A1/en not_active Ceased
- 2020-05-02 MX MX2021013420A patent/MX2021013420A/es unknown
- 2020-05-02 AU AU2020270421A patent/AU2020270421A1/en active Pending
- 2020-05-02 SG SG11202111867XA patent/SG11202111867XA/en unknown
- 2020-05-02 CA CA3135539A patent/CA3135539A1/en active Pending
- 2020-05-02 EP EP20803017.1A patent/EP3962454A4/en active Pending
- 2020-05-02 US US17/608,493 patent/US12338451B2/en active Active
- 2020-05-02 PE PE2021001824A patent/PE20220930A1/es unknown
- 2020-05-04 TW TW109114778A patent/TW202108760A/zh unknown
- 2020-05-04 AR ARP200101259A patent/AR118850A1/es unknown
-
2021
- 2021-10-31 IL IL287715A patent/IL287715A/en unknown
- 2021-11-03 CL CL2021002881A patent/CL2021002881A1/es unknown
- 2021-11-30 CO CONC2021/0016323A patent/CO2021016323A2/es unknown
-
2025
- 2025-05-07 US US19/201,601 patent/US20250313859A1/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000026393A1 (en) * | 1998-10-31 | 2000-05-11 | University Of Medicine And Dentistry Of New Jersey | A myeloid precursor cell useful for gene therapy and for modulation of immune responses |
| WO2002098455A2 (en) * | 2001-06-07 | 2002-12-12 | Hemebiotech A/S | Production of recombinant human arylsulfatase a |
| US20080003211A1 (en) * | 2004-01-30 | 2008-01-03 | Zymenex A/S | Production and Purification of Recombinant Arylsulftase |
| WO2013096899A2 (en) * | 2011-12-23 | 2013-06-27 | Shire Human Genetic Therapies, Inc. | Stable formulations for cns delivery of arylsulfatase a |
| US20180071373A1 (en) * | 2015-05-15 | 2018-03-15 | Regents Of The University Of Minnesota | Adeno-associated virus for therapeutic delivery to central nervous system |
| WO2018160582A1 (en) * | 2017-02-28 | 2018-09-07 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clade f vector and uses therefor |
Non-Patent Citations (2)
| Title |
|---|
| KOHEI HIRONAKA; YOSHIYUKI YAMAZAKI; YUKIHIKO HIRAI; MOTOKO YAMAMOTO; NORIKO MIYAKE; KOICHI MIYAKE; TAKASHI OKADA; AKIO MORITA; TAK: "Enzyme replacement in the CSF to treat metachromatic leukodystrophy in mouse model using single intracerebroventricular injection of self-complementary AAV1 vector", SCIENTIFIC REPORTS, vol. 5, no. 13104, 18 August 2015 (2015-08-18), pages 1 - 12, XP055599294 * |
| See also references of EP3962454A4 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2020292256B2 (en) * | 2019-06-10 | 2023-01-19 | Homology Medicines, Inc. | Adeno-associated virus compositions for ARSA gene transfer and methods of use thereof |
| WO2021231579A1 (en) * | 2020-05-12 | 2021-11-18 | The Trustees Of The University Of Pennsylvania | Compositions for drg-specific reduction of transgene expression |
| JP2024515612A (ja) * | 2021-04-12 | 2024-04-10 | ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | 球脊髄性筋萎縮症(sbma)の治療に有用な組成物 |
| RU2769577C1 (ru) * | 2021-06-01 | 2022-04-04 | федеральное государственное автономное образовательное учреждение высшего образования "Казанский (Приволжский) федеральный университет" (ФГАОУ ВО КФУ) | Препарат для лечения метахроматической лейкодистрофии и способ ее лечения |
| WO2022255906A1 (en) * | 2021-06-01 | 2022-12-08 | Federal State Autonomus Educational Institution Of Higher Learning "Kazan (Volga Region) Federal University" | Drug for genetic and gene-cell-based therapy |
| EP4351661A4 (en) * | 2021-06-08 | 2025-12-10 | Univ Pennsylvania | Recombinant adeno-associated viruses for Lesch-Nyhan's disorder and their uses |
| WO2023133584A1 (en) * | 2022-01-10 | 2023-07-13 | The Trustees Of The University Of Pennsylvania | Compositions useful in treatment of metachromatic leukodystrophy |
| WO2023196863A1 (en) * | 2022-04-05 | 2023-10-12 | Astellas Gene Therapies, Inc. | Adeno-associated virus potency assay and uses thereof |
| WO2023225481A1 (en) * | 2022-05-16 | 2023-11-23 | Genzyme Corporation | Methods of treating metachromatic leukodystrophy |
| WO2024079361A1 (en) * | 2022-10-14 | 2024-04-18 | Neuway Pharma Gmbh | A PROTEIN- OR PEPTIDE-BASED CAPSULE (PPC), PREFERABLY A VLP, LOADED WITH A MESSENGER RNA (mRNA) AND A METHOD OF PRODUCTION AND PURIFICATION THEREOF |
Also Published As
| Publication number | Publication date |
|---|---|
| US12338451B2 (en) | 2025-06-24 |
| CA3135539A1 (en) | 2020-11-12 |
| US20250313859A1 (en) | 2025-10-09 |
| CO2021016323A2 (es) | 2021-12-10 |
| SG11202111867XA (en) | 2021-11-29 |
| CN114072129A (zh) | 2022-02-18 |
| EP3962454A4 (en) | 2023-05-31 |
| US20220228170A1 (en) | 2022-07-21 |
| EP3962454A1 (en) | 2022-03-09 |
| AR118850A1 (es) | 2021-11-03 |
| JP2022531861A (ja) | 2022-07-12 |
| KR20220020261A (ko) | 2022-02-18 |
| BR112021021908A2 (pt) | 2022-02-01 |
| AU2020270421A1 (en) | 2021-11-18 |
| PE20220930A1 (es) | 2022-05-31 |
| IL287715A (en) | 2021-12-01 |
| MX2021013420A (es) | 2022-02-03 |
| TW202108760A (zh) | 2021-03-01 |
| CL2021002881A1 (es) | 2022-07-29 |
| JP7715640B2 (ja) | 2025-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250313859A1 (en) | Compositions useful in treatment of metachromatic leukodystrophy | |
| US12612647B2 (en) | Compositions useful in treatment of spinal muscular atrophy | |
| US12428653B2 (en) | Gene therapy for ceroid lipofuscinoses | |
| JP2025032175A (ja) | クラッベ病の治療に有用な組成物 | |
| US20240425882A1 (en) | Compositions useful in treatment of cdkl5 deficiency disorder (cdd) | |
| US20230190966A1 (en) | Compositions useful for treating gm1 gangliosidosis | |
| JP2023524437A (ja) | Cdkl5欠損症(cdd)の治療において有用な組成物 | |
| US20250177495A1 (en) | Compositions useful in treatment of metachromatic leukodystrophy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20803017 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3135539 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021564955 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021021908 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2020270421 Country of ref document: AU Date of ref document: 20200502 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2021/0016323 Country of ref document: CO |
|
| WWP | Wipo information: published in national office |
Ref document number: NC2021/0016323 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 2020803017 Country of ref document: EP Effective date: 20211203 |
|
| ENP | Entry into the national phase |
Ref document number: 112021021908 Country of ref document: BR Kind code of ref document: A2 Effective date: 20211029 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 521430755 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 521430755 Country of ref document: SA |
|
| WWR | Wipo information: refused in national office |
Ref document number: 521430755 Country of ref document: SA |
|
| WWR | Wipo information: refused in national office |
Ref document number: NC2021/0016323 Country of ref document: CO |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17608493 Country of ref document: US |