WO2020221291A1 - 一种血红蛋白病治疗有效性预测方法 - Google Patents

一种血红蛋白病治疗有效性预测方法 Download PDF

Info

Publication number
WO2020221291A1
WO2020221291A1 PCT/CN2020/087766 CN2020087766W WO2020221291A1 WO 2020221291 A1 WO2020221291 A1 WO 2020221291A1 CN 2020087766 W CN2020087766 W CN 2020087766W WO 2020221291 A1 WO2020221291 A1 WO 2020221291A1
Authority
WO
WIPO (PCT)
Prior art keywords
modified
cells
individual
positive
bcl11a
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CN2020/087766
Other languages
English (en)
French (fr)
Chinese (zh)
Inventor
方日国
于玲玲
杨卉慧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Edigene Inc
Original Assignee
Edigene Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020217038930A priority Critical patent/KR20220002565A/ko
Priority to EA202192931A priority patent/EA202192931A1/ru
Priority to CA3138029A priority patent/CA3138029A1/en
Priority to JP2021564630A priority patent/JP2022531269A/ja
Priority to AU2020265060A priority patent/AU2020265060A1/en
Priority to CR20210591A priority patent/CR20210591A/es
Priority to PE2021001804A priority patent/PE20220003A1/es
Priority to CN202080028977.8A priority patent/CN113785059A/zh
Priority to MX2021013363A priority patent/MX2021013363A/es
Priority to BR112021021744A priority patent/BR112021021744A8/pt
Priority to PH1/2021/552732A priority patent/PH12021552732A1/en
Priority to SG11202112072QA priority patent/SG11202112072QA/en
Application filed by Edigene Inc filed Critical Edigene Inc
Priority to US17/607,796 priority patent/US20220193142A1/en
Priority to EP20798490.7A priority patent/EP3964579A4/en
Publication of WO2020221291A1 publication Critical patent/WO2020221291A1/zh
Priority to IL287672A priority patent/IL287672A/en
Anticipated expiration legal-status Critical
Priority to ZA2021/08584A priority patent/ZA202108584B/en
Priority to CONC2021/0016058A priority patent/CO2021016058A2/es
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/095Sulfur, selenium, or tellurium compounds, e.g. thiols
    • A61K31/10Sulfides; Sulfoxides; Sulfones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1774Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0641Erythrocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0647Haematopoietic stem cells; Uncommitted or multipotent progenitors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/05Inorganic components
    • C12N2500/10Metals; Metal chelators
    • C12N2500/20Transition metals
    • C12N2500/24Iron; Fe chelators; Transferrin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/14Erythropoietin [EPO]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2303Interleukin-3 (IL-3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/11Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • This application relates to an accompanying prediction method for predicting the effectiveness of gene editing technology in treating hemoglobinopathies.
  • This prediction method pre-isolates the patient’s CD34-positive hematopoietic stem cells before treating the disease, and uses gene editing technology to destroy the BCL11A erythroid enhancer site.
  • By evaluating the degree of up-regulation of gamma globin and fetal hemoglobin expression predict the gene-edited BCL11A erythroid in advance The effectiveness of enhancers in the treatment of hemoglobinopathies and assists in disease treatment.
  • Hemoglobinopathy is a group of inherited blood diseases caused by abnormal hemoglobin molecular structure or abnormal synthesis of globin peptide chain.
  • the two main disease types in hemoglobinopathies are ⁇ -thalassemia and sickle cell anemia.
  • the pathogenesis of ⁇ -thalassemia is due to genetic mutations in the ⁇ -globin peptide chain. Most patients have point mutations, and a few have large fragment gene deletions.
  • ⁇ 0 thalassaemia Gene deletion and certain point mutations can cause the synthesis of a part of ⁇ globin peptide chain to be completely inhibited, this type is called ⁇ 0 thalassaemia; and a small number of point mutations inhibit the synthesis of the ⁇ chain, but still retain a part of the peptide chain synthesis , This type is called ⁇ + thalassaemia, and different combinations may have different clinical symptoms. Due to the lack or decrease of ⁇ -globin expression, the excess ⁇ chains in the blood will be deposited in the red blood cells to form inclusion bodies, which attach to the surface of the red blood cell membrane, causing changes in the characteristics of the red blood cell membrane, and the cells become rigid, resulting in a decrease in deformability and a chronic condition.
  • Sickle-shaped red blood cell anemia similar to ⁇ -thalassemia, is an autosomal recessive genetic disease. The difference is that the anemia has a single mutation site. Due to the single base mutation of ⁇ globin, the normal ⁇ gene is Codon 6 is caused by the mutation of GAG (encoding glutamate) to GTG (valine). In the mutant homozygous state, normal ⁇ -globin and abnormal ⁇ -globin form a tetrameric complex called HbS. The tetramer carries half of the oxygen capacity of normal hemoglobin, and aggregates into polymers in the deoxygenated state.
  • the formed polymer is arranged parallel to the membrane and closely contacts the cell membrane.
  • the cell membrane changes from a normal concave shape to a sickle shape.
  • Sickle-shaped red blood cells have poor deformability and are easily broken and hemolyzed, causing blood vessel blockage, injury, necrosis, etc. (D. Rund, et al. New England Journal of Medicine. 2005, 718-739).
  • the current standard treatment methods for ⁇ -thalassemia and sickle cell anemia include long-term high-dose blood transfusion with iron removal therapy with iron removal agents and allogeneic hematopoietic stem cell transplantation treatment techniques.
  • long-term high-dose blood transfusions accompanied by iron removal treatment with iron removal agents lead to iron overload, and organ damage caused by large amounts of iron in the spleen, liver, heart, and kidneys of the patients is one of the main causes of death in children with thalassemia .
  • the treatment plan of gene editing therapy is to use gene editing tools, such as CRISPR/Cas9, Zinc Finer Nulease (ZFN) and TALEN, etc., to edit the patient’s self-sourced hematopoietic stem cells to increase the expression of Fetal Hemoglobin (HbF). Then the genetically modified self-sourced hematopoietic stem cells are returned to the patient to restore the patient's total hemoglobin to a normal level to achieve the purpose of treating the disease.
  • gene editing tools such as CRISPR/Cas9, Zinc Finer Nulease (ZFN) and TALEN, etc.
  • the main mechanism of gene editing therapy to treat ⁇ -thalassemia and sickle cell anemia is to use a biological phenomenon naturally present in the human body, namely, hemoglobin switch (Globin Switch).
  • Hemoglobin HbA
  • HbF hemoglobin switch
  • the tetramer complex composed of two alpha globins and two gamma globins is characterized by strong oxygen carrying capacity and weak oxygen releasing capacity, which is beneficial for the fetus to obtain nutrients from the mother.
  • the suitable target found is the position of the BCL11A erythroid enhancer (+58).
  • the region is modified by gene editing to down-regulate the expression of the BCL11A gene, thereby releasing the inhibition of the expression of ⁇ globin and HbF by the BCL11A gene, and increasing ⁇
  • the expression of globin and HbF does not affect the differentiation and development of other lineages, and some clinically asymptomatic patients also carry mutations at this site that cause HPFH (U. Manuela, et al. PNAS. 2008; P .Liu,et al.Nature Immunology.2003; DEBauer.Science.2013; VGSankaran,et al.Science.2008; Matthew C,et al.Nature.2015).
  • BCL11A gene inhibits the expression of HbF, then editing the BCL11A erythroid enhancer to increase HbF to treat patients may fail, and if the patient has undergone chemotherapy to clear the bone marrow and immune system, this will cause unpredictable potential harm.
  • the mechanism of regulating the expression of gamma globin and HbF fetal hemoglobin is very complicated, and it is difficult to predict the effectiveness of treatment methods by detecting the expression of a certain gene or several genes. Therefore, how to predict the extent and potential of the up-regulation of the expression of ⁇ globin and HbF by the BCL11A gene in advance is a key issue to be solved urgently for gene-edited autologous hematopoietic stem cell therapy.
  • This application uses the strategy of pre-assessing the degree of regulation of the BCL11A gene on HbF, and develops a companion diagnostic method for predicting the effectiveness of gene editing technology in the treatment of hemoglobinopathies, and predicts in advance that the gene editing BCL11A erythroid enhancer site is effective in improving gamma globin and HbF.
  • the expression level reduces the risk of failure or reduced effectiveness of the therapy due to the low expression or low function of BCL11A in the patient’s cells, which is conducive to the classification of patients in the clinical treatment process.
  • BCL11A and/or gamma globin and HbF are preferred Regulate and control patients who play a major role in treatment, and develop a new treatment plan with accompanying diagnosis plus gene-editing autologous hematopoietic stem cells, filling the gap in the existing technology, and helping gene editing technology autologous hematopoietic stem cells to treat hemoglobinopathy quickly Development to meet the needs of clinical applications.
  • this application proposes for the first time a new treatment plan and strategy for the treatment of hemoglobinopathies with companion diagnosis + gene-edited autologous hematopoietic stem cell BCL11A erythroid enhancer sites.
  • the present application provides a method for treating hemoglobinopathies in an individual, including:
  • An evaluation step which includes evaluating the first population of modified CD34-positive hematopoietic stem/progenitor cells ("CD34-positive HSPC") to produce the desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation Ability, wherein the modified CD34-positive HSPCs of the first population are derived from the individual and modified to reduce BCL11A function ("modified EV cells"); and
  • a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A function ("modified TR cells ").
  • this application provides a method for enhancing the expression of fetal hemoglobin in an individual, including:
  • An evaluation step which includes evaluating the first population of modified CD34-positive hematopoietic stem/progenitor cells ("CD34-positive HSPC") to produce the desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation Ability, wherein the modified CD34-positive HSPCs of the first population are derived from the individual and modified to reduce BCL11A function ("modified EV cells"); and
  • a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A function ("modified TR cells ").
  • this application provides a method for hemoglobin to function in an individual, including:
  • An evaluation step which includes evaluating the first population of modified CD34-positive hematopoietic stem/progenitor cells ("CD34-positive HSPC") to produce the desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation Ability, wherein the modified CD34-positive HSPCs of the first population are derived from the individual and modified to reduce BCL11A function ("modified EV cells"); and
  • a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A function ("modified TR cells ").
  • the present application provides a method of treating hemoglobinopathies in an individual, comprising a treatment step comprising administering to the individual a modified second population derived from the individual and modified to reduce BCL11A function CD34 positive HSPC ("modified TR cells"),
  • the individual is selected for treatment based on the functional evaluation through the evaluation step, and the evaluation step includes: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation
  • HbF fetal hemoglobin
  • the application provides a method for selecting individuals suffering from hemoglobinopathies for treatment with modified CD34-positive HSPCs of a second population, the modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A Function ("modified TR cells"), wherein the method includes an evaluation step including: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of gamma-globulin or fetal hemoglobin ( HbF), where the modified CD34-positive HSPCs of the first population are derived from the individual and have been modified to reduce BCL11A function ("modified EV cells"), where if the modified CD34-positive HSPCs of the first population produce If a level of gamma-globin or fetal hemoglobin (HbF) is required, the individual is selected for treatment.
  • modified TR cells modified TR cells
  • the application provides a method for determining whether an individual suffering from hemoglobinopathies is suitable for using a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce the function of BCL11A ("modified TR cells")
  • a method of treatment wherein the method includes an evaluation step, which includes: evaluating the ability of the modified CD34-positive HSPC of the first population to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation, wherein the first population
  • the modified CD34-positive HSPC derived from the individual and modified to reduce BCL11A function ("modified” EV cells), where if the modified CD34-positive HSPC of the first population produces the desired level of gamma-globulin or Fetal hemoglobin (HbF), the individual is suitable for treatment.
  • the present application provides a method for determining that an individual suffering from hemoglobinopathies is not suitable for use with a second population of modified CD34-positive HSPCs ("modified TR cells") derived from the individual and modified to reduce the function of BCL11A.
  • a method of treatment wherein the method includes an evaluation step, which includes: evaluating the ability of the modified CD34-positive HSPC of the first population to produce a desired level of gamma-globulin or fetal hemoglobin (HbF) after differentiation, wherein the first population
  • the modified CD34-positive HSPCs are derived from the individual and have been modified to reduce BCL11A function ("modified" EV cells), where if the modified CD34-positive HSPCs of the first population do not produce the desired level of ⁇ -spheres Protein or fetal hemoglobin (HbF) then the individual is not suitable for treatment with the modified TR cells.
  • assessing the ability of the first population of modified CD34-positive HSPCs to produce the required level of ⁇ -globulin or fetal hemoglobin (HbF) after differentiation refers to assessing the ability of the modified CD34-positive HSPCs to reduce the function of BCL11A after differentiation Whether the level of ⁇ -globin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPC without this modification is at least about 12%, 13%, 14% higher, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31% , 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% %, 90%, 95%, 100%, 120%.
  • the level of ⁇ -globin or fetal hemoglobin (HbF) produced by the first population after differentiation of modified CD34-positive HSPCs is higher than the level of ⁇ -globin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPCs without this modification
  • the level of ⁇ -globulin or fetal hemoglobin produced by the differentiation of the modified CD34-positive HSPC is the level of ⁇ -globulin or fetal hemoglobin produced by the differentiation of unmodified CD34-positive HSPC The level of 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, or higher.
  • the fetal hemoglobin produced by the modified CD34-positive HSPC after differentiation exceeds 6.5 g/dL, 7.0 g/dL, 7.5 g/dL, 8.0 g/dL, 8.5 g/dL, 9.0 g/dL, 9.5g/dL, 10g/dL, 10.5g/dL, 11.0g/dL peripheral blood, or higher levels.
  • the fetal hemoglobin produced by the modified CD34-positive HSPC after differentiation is approximately 9.0-18g/dL, such as 10-17g/dL, 11-15g/dL or 12-16g/dL peripheral blood .
  • the desired level of ⁇ -globulin is that the modified CD34-positive HSPC produces more than about 50%, 60%, 70%, 80% relative to the unmodified CD34-positive HSPC. , 90%, 100%, 120%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, or higher levels of ⁇ -globulin mRNA .
  • the evaluating step includes:
  • Modifying the isolated EV cells to obtain a first population of modified CD34-positive HSPC cells with reduced BCL11A function ("modified EV cells");
  • the step of treating includes:
  • Modifying the isolated TR cells to obtain a second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function;
  • the present application provides a method for treating hemoglobinopathies in an individual, including:
  • Evaluation step wherein the evaluation step includes:
  • Modifying the isolated TR cells to obtain a second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function;
  • the present application provides a method for treating hemoglobinopathies in an individual, including:
  • Evaluation step wherein the evaluation step includes:
  • administering e.g., intravenous injection, including a single intravenous injection
  • administering e.g., intravenous injection, including a single intravenous injection
  • the bone marrow or peripheral blood sample used to isolate CD34-positive HSPC to produce isolated EV cells is a small amount, for example, the bone marrow sampling volume is not more than 20 ml, such as 5-20 ml, 5-10 ml ;
  • the amount of peripheral blood sampling is not more than 30ml, such as 10-30ml, 15-20ml.
  • the bone marrow or peripheral blood sample used to isolate CD34-positive HSPC to produce isolated TR cells is a large amount, such as not less than 50 mL, for example, 50-300 ml, 100-200 ml.
  • the CD34-positive HSPC cells can be obtained from the bone marrow or peripheral blood of the individual.
  • the separation method includes magnetic bead separation.
  • the method includes genetically modifying the isolated EV cells.
  • the genetic modification includes the use of zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and regularly spaced short palindrome repeats (CRISPR), RNA editing , Any method in RNA interference (RNAi) technology or their combination to genetically modify isolated EV cells.
  • the BCL11A function is reduced by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2.
  • CD34-positive HSPC cells are genetically modified by CRISPR/Cas technology to reduce the function of BCL11A.
  • the CD34-positive HSPC cells are modified by the BCL11A function inhibitor to reduce the BCL11A function.
  • the BCL11A function inhibitor is a protein or nucleic acid molecule that inhibits the transcription and/or expression of the BCL11A gene, such as nucleases (such as ZFN and TALEN), peptide nucleic acids, antisense RNA, siRNA, miRNA, and shRNA.
  • the inhibitor of BCL11A function is a protein or nucleic acid molecule that inhibits the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the BCL11A function inhibits
  • the agent is a protein or nucleic acid molecule that interferes with, inhibits or destroys the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the inhibitor of BCL11A function is a nuclease (such as ZFN and TALEN), peptide nucleic acid, antisense RNA, siRNA, nuclease that interferes with, inhibits or destroys the region from 60495197th to 60495346th human chromosome 2 miRNA.
  • the step includes: 1) Allowing differentiation to Culturing the modified EV cells under the condition of obtaining the red blood cell population; and 2) determining the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the red blood cells.
  • evaluating the ability of the modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step includes determining the mRNA level of ⁇ -globin. In some embodiments of the above method, evaluating the ability of the modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step includes determining the protein level of fetal hemoglobin (HbF). In some embodiments of the above methods, wherein the individual has not undergone CD34-positive HSPC cell mobilization or pretreatment prior to the assessment step. For example, the individual has not injected bone marrow and lymph clearing drugs, such as Busulfan and Fludarabine, before the assessment step. In some embodiments of the above method, the evaluating step is repeated at least once before the treating step.
  • the method of modifying the isolated TR cells may be the same or different from the method of modifying the isolated EV cells. In some embodiments, the method of modifying the isolated TR cell may be the same as the method of modifying the isolated EV cell. In some embodiments of the aforementioned methods, the isolated TR cells are genetically modified. In some embodiments of the above method, the genetic modification includes the use of zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and regularly spaced short palindrome repeats (CRISPR), RNA editing , Any method of RNA interference (RNAi) technology, or a combination thereof to genetically modify isolated TR cells.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector nuclease
  • CRISPR regularly spaced short palindrome repeats
  • RNA editing Any method of RNA interference (RNAi) technology, or a combination thereof to genetically modify isolated TR cells.
  • the function of BCL11A is reduced by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2.
  • CD34-positive HSPC cells are genetically modified by CRISPR/Cas technology to reduce the function of BCL11A.
  • the CD34-positive HSPC cells are modified by the BCL11A function inhibitor to reduce the BCL11A function.
  • the BCL11A function inhibitor is a protein or nucleic acid molecule that inhibits the transcription and/or expression of the BCL11A gene, such as nucleases (such as ZFN and TALEN), peptide nucleic acids, antisense RNA, siRNA, miRNA, and shRNA.
  • the inhibitor of BCL11A function is a protein or nucleic acid molecule that inhibits the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the BCL11A function inhibits
  • the agent is a protein or nucleic acid molecule that interferes with, inhibits or destroys the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the inhibitor of BCL11A function is a nuclease (such as ZFN and TALEN), peptide nucleic acid, antisense RNA, siRNA, nuclease that interferes with, inhibits or destroys the region from 60495197th to 60495346th human chromosome 2 miRNA.
  • the treatment step includes mobilizing the bone marrow of the individual so that a large amount of hematopoietic stem cells are produced by the bone marrow and released into the peripheral blood circulation system.
  • Mobilizing CD34-positive HSPCs includes administering granulocyte colony stimulating factor (GCSF) and/or plerixafor (plerixafor) before collecting CD34-positive HSPC cells (e.g., 4-10 days, 5-8 days, 6-7 days). ).
  • GCSF granulocyte colony stimulating factor
  • plerixafor plerixafor
  • the step of treating further comprises: pre-treating the individual before administering the modified TR cells.
  • the pre-treatment may include myeloablization and/or lymphalysis.
  • the pretreatment includes chemotherapy, monoclonal antibody therapy, or systemic radiation.
  • the chemotherapy comprises administering to the individual one or more chemotherapeutic agents selected from the group consisting of busulfan, Cyclophosphamide and fludarabine.
  • the treatment comprises the step of administering to the individual (such as intravenous injection, comprising a single intravenous injection) ⁇ 2x10 6, ⁇ 5x10 6, ⁇ 1x10 7, ⁇ 2x10 7 cells / kg body weight Modified TR cells.
  • the isolated TR cells are cultured for one or more days before modification, and then the isolated TR cells are modified.
  • the modified TR cells are cultured for one or more days (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days) before being administered to the individual.
  • the modified TR cells are stored under freezing conditions for at least 24 hours before the modified TR cells are administered to the individual.
  • the modified TR cells are cultured for one or more days (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days) before being stored under freezing conditions.
  • the hemoglobinopathy is selected from the group consisting of sickle cell disease, sickle cell trait, hemoglobin C disease, hemoglobin C trait, hemoglobin S/C disease, hemoglobin D disease, hemoglobin E disease, thalassemia, hemoglobin-related disorders with increased oxygen affinity, hemoglobin-related disorders with decreased oxygen affinity, unstable hemoglobinopathy, and methemoglobinemia.
  • the hemoglobinopathies are selected from the group consisting of ⁇ -thalassemia and sickle cell anemia.
  • the hemoglobinopathy is ⁇ 0 or ⁇ + thalassemia.
  • the individual is a human. In some embodiments, the individual is a human under 35 years of age. In some embodiments, the individual is male. In some embodiments, the individual is female. In some embodiments, the individual is a human without cardiac, liver, lung, or spleen complications. In some embodiments, the individual's hemoglobin level before treatment is no more than 5.0 g/dL, 6.0 g/dL, 7.0 g/dL, 8.0 g/dL, 9.0 g/dL peripheral blood. In some embodiments of the above method, wherein the step of treating is performed immediately following the step of evaluating.
  • FIG. 1 Electrotransformation of Cas9 mRNA encoding gene (SEQ ID NO: 1) and 2 sgRNAs of the erythroid enhancer that destroy BCL11A, sgRNA-1 and sgRNA-2 respectively, enter 5 different thalassemia patients and 2 healthy donors Mobilization of hematopoietic stem cells derived from peripheral blood, 4 days later, "Synthego ICE Analysis" online software analysis produced statistical analysis of Indels efficiency.
  • FIG. 2 Electrotransformation of Cas9 mRNA and two sgRNAs that destroy the erythroid enhancer of BCL11A, sgRNA-1 and sgRNA-2 respectively, enter 5 different thalassemia patients and 2 healthy donors to mobilize CD34-positive hematopoiesis derived from peripheral blood Stem cells, undergo red blood cell differentiation, and test 18 days later to detect the expression ratio of human CD71 and human CD235a membrane proteins, which represents the efficiency of erythroid differentiation.
  • Control group represents cells that have not undergone gene editing
  • sgRNA-1 and sgRNA-2 represent cells that have undergone two sgRNA gene editing, respectively.
  • FIG. 3 Electrotransformation of Cas9 mRNA and two sgRNAs that destroy the erythroid enhancer of BCL11A, sgRNA-1 and sgRNA-2 respectively, enter 5 different thalassemia patients and 2 healthy donors to mobilize CD34-positive hematopoiesis derived from peripheral blood Stem cells, red blood cell differentiation, 18 days later, detection of HBG ( ⁇ -globin) gene mRNA expression by fluorescence quantitative PCR.
  • Control group represents cells that have not undergone gene editing.
  • Experimental group represent cells that have undergone two sgRNA gene editing.
  • N 3 experimental replicates. HBG gene and GAPDH gene were normalized.
  • Figure 4 A electrotransformation of Cas9 mRNA and BCL11A erythroid enhancer sgRNA-2 into 2 different healthy donors to mobilize 3 batches of CD34-positive hematopoietic stem cells from peripheral blood, 4 days later, "Synthego ICE Analysis” is online Software analysis produces statistical analysis of Indels efficiency.
  • Figure 4B Electrotransformation of Cas9 mRNA and erythroid enhancer sgRNA-2 that destroys BCL11A into 10 thalassemia patients mobilizes CD34-positive hematopoietic stem cells from peripheral blood. Multi-batch experiment (three batches of patient donor 1 and patient donor 6, Patient donor 9 and patient donor 10 each have two independent batches). After 2 days, the "Synthego ICE Analysis” online software analysis produces a statistical analysis of Indels efficiency.
  • FIG. 5 Electrotransformation of Cas9 mRNA and erythroid enhancer sgRNA-2 that destroys BCL11A into 2 different healthy donors. 3 batches of CD34-positive hematopoietic stem cells derived from peripheral blood were mobilized. Red blood cell differentiation was carried out. After 18 days, the test was performed to detect humans. The expression of two membrane proteins, CD71 and human CD235a, indicates the efficiency of erythroid differentiation. Control group: represents cells that have not undergone gene editing, and experimental group: represents cells that have undergone sgRNA-2 gene editing.
  • FIG. 6 Electrotransform Cas9 mRNA and destroy BCL11A erythroid enhancer sgRNA-2 into 10 thalassemia patients. Mobilize CD34-positive hematopoietic stem cells derived from peripheral blood in multiple batch experiments for red blood cell differentiation. After 18 days, it will be tested to detect human CD71 and human CD235a. The expression of two membrane proteins indicates the efficiency of erythroid differentiation. Control group: represents cells that have not undergone gene editing, and experimental group: represents cells that have undergone sgRNA-2 gene editing.
  • FIG. 7 Electrotransformation of Cas9 mRNA and BCL11A erythroid enhancer sgRNA-2 into the first healthy donor.
  • Three batches of CD34-positive hematopoietic stem cells derived from peripheral blood were mobilized. Red blood cell differentiation experiments. After 18 days of differentiation, fluorescence quantitative PCR was performed Detection of mRNA expression of genes such as BCL11A and HBG (( ⁇ -globin)).
  • Control group represents cells that have not undergone gene editing.
  • Experimental group represents cells that have undergone sgRNA-2 gene editing.
  • N 3 experimental replicates.
  • HBG gene and BCL11A gene were normalized with GAPDH gene respectively.
  • FIG. 8 Electrotransformation of Cas9 mRNA and BCL11A erythroid enhancer sgRNA-2 into a second healthy donor.
  • Three batches of CD34-positive hematopoietic stem cells derived from peripheral blood were mobilized. Red blood cell differentiation experiment. After 18 days of differentiation, fluorescence quantitative PCR was performed Detection of mRNA expression of genes such as BCL11A and HBG (( ⁇ -globin)).
  • Control group represents cells that have not undergone gene editing.
  • Experimental group represents cells that have undergone sgRNA-2 gene editing.
  • N 3 experimental replicates.
  • HBG gene and BCL11A gene were normalized with GAPDH gene respectively.
  • FIG. 9A Electrotransform Cas9 mRNA and destroy BCL11A erythroid enhancer sgRNA-2 into 10 thalassemia patients. Mobilize CD34-positive hematopoietic stem cells derived from peripheral blood. Multi-batch experiment for red blood cell differentiation, 18 days later, and flow cytometry to detect differentiation The ratio of HbF expression in red blood cells. Control group: represents cells that have not undergone gene editing, and experimental group: represents cells that have undergone sgRNA-2 gene editing.
  • Figure 9B Statistical analysis of multiples of HbF+% in the experimental group and HbF+% in the control group from different thalassemia patients.
  • Figure 11 Schematic diagram of a new treatment plan for gene editing BCL11A erythroid enhancer site to treat hemoglobinopathy.
  • This application relates to reducing the function of BCL11A, such as destroying the BCL11A erythroid enhancer site in hematopoietic stem cells through genome editing technology, and performing red blood cell differentiation on hematopoietic stem cells after gene editing.
  • BCL11A destroying the BCL11A erythroid enhancer site in hematopoietic stem cells through genome editing technology
  • red blood cell differentiation on hematopoietic stem cells after gene editing.
  • this application provides a method for treating hemoglobinopathies in an individual, including:
  • a) Evaluation step which includes evaluating the ability of the first population of modified CD34-positive hematopoietic stem cells/progenitor cells ("CD34-positive HSPC") to produce the desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation , wherein the modified CD34-positive HSPCs of the first population are derived from the individual and have been modified to reduce BCL11A function ("modified EV cells"); and
  • a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A function ("modified TR cells ").
  • the first population and/or the second population are modified by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2 (such as genetic modification by CRISPR/Cas technology, It includes introducing sgRNA containing any sequence of SEQ ID NO: 3 to SEQ ID NO: 25 into the CD34-positive hematopoietic stem cells/progenitor cells to edit the BCL11A gene) to reduce the function of BCL11A.
  • the present application provides a method of treating hemoglobinopathies in an individual, comprising a treatment step comprising administering to the individual a modified second population derived from the individual and modified to reduce BCL11A function CD34 positive HSPC ("modified TR cells"),
  • the individual is selected for treatment based on the functional evaluation through the evaluation step, and the evaluation step includes: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation
  • HbF fetal hemoglobin
  • the first population and/or the second population are modified by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2 (such as genetic modification by CRISPR/Cas technology, It includes introducing sgRNA containing any sequence of SEQ ID NO: 3 to SEQ ID NO: 25 into the CD34-positive hematopoietic stem cells/progenitor cells to edit the BCL11A gene) to reduce the function of BCL11A.
  • the application provides a method for selecting individuals suffering from hemoglobinopathies for treatment with modified CD34-positive HSPCs of a second population, the modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A Function ("modified TR cells"), wherein the method includes an evaluation step including: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of gamma-globulin or fetal hemoglobin ( HbF), where the modified CD34-positive HSPCs of the first population are derived from the individual and have been modified to reduce BCL11A function ("modified EV cells"), where if the modified CD34-positive HSPCs of the first population produce If a level of gamma-globin or fetal hemoglobin (HbF) is required, the individual is selected for treatment.
  • modified TR cells modified TR cells
  • the first population and/or the second population are modified by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2 (such as genetic modification by CRISPR/Cas technology, It includes introducing sgRNA containing any sequence of SEQ ID NO: 3 to SEQ ID NO: 25 into the CD34-positive hematopoietic stem cells/progenitor cells to edit the BCL11A gene) to reduce the function of BCL11A.
  • the present application provides a method for treating hemoglobinopathies in an individual, including:
  • Evaluation step wherein the evaluation step includes:
  • the first population and/or the second population are modified by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2 (such as genetic modification by CRISPR/Cas technology, It includes introducing sgRNA containing any sequence of SEQ ID NO: 3 to SEQ ID NO: 25 into the CD34-positive hematopoietic stem cells/progenitor cells to edit the BCL11A gene) to reduce the function of BCL11A.
  • the bone marrow or peripheral blood sample used to isolate CD34-positive HSPC to produce isolated EV cells is a small amount, for example, the bone marrow sampling volume is not more than 20 ml, such as 5-20 ml, 5-10 ml ;
  • the amount of peripheral blood sampling is not more than 30ml, such as 10-30ml, 15-20ml.
  • the bone marrow or peripheral blood sample used to isolate CD34-positive HSPC to produce isolated TR cells is a large amount, such as not less than 50 mL, for example, 50-300 ml, 100-200 ml.
  • the CD34-positive HSPC cells can be obtained from the bone marrow or peripheral blood of the individual.
  • the separation method includes magnetic bead separation.
  • the cells in bone marrow or peripheral blood are specifically labeled with super paramagnetic MACS MicroBeads (MACS micro magnetic beads). After magnetic labeling, these cells are passed through a sorting column placed in a strong and stable magnetic field. The matrix in the column creates a high gradient magnetic field). The magnetically labeled cells stay in the column while the unlabeled cells flow out.
  • the magnetically labeled cells retained in the column can be eluted, so that two cell populations, labeled and unlabeled, can be obtained.
  • the Ficoll liquid density gradient centrifugation method can be used to separate different cell layers in the blood through low-speed density gradient centrifugation using the difference in the specific gravity of different components. The density of red blood cells and granulocytes is greater than that of the stratified liquid, and the red blood cells will quickly agglomerate into a bunch of money and accumulate at the bottom of the tube after encountering Ficoll liquid.
  • CD34-positive HSPC cells can be obtained by subsequent magnetic bead sorting .
  • the application provides a method for determining whether an individual suffering from hemoglobinopathies is suitable for using a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce the function of BCL11A ("modified TR cells")
  • a method of treatment wherein the method includes an evaluation step, which includes: evaluating the ability of the modified CD34-positive HSPC of the first population to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation, wherein the first population
  • the modified CD34-positive HSPCs are derived from the individual and have been modified to reduce BCL11A function ("modified" EV cells), where if the modified CD34-positive HSPCs of the first population produce the desired level of ⁇ -globulin or Fetal hemoglobin (HbF), the individual is suitable for treatment.
  • the present application provides a method for determining that an individual suffering from hemoglobinopathies is not suitable for use with a second population of modified CD34-positive HSPCs ("modified TR cells") derived from the individual and modified to reduce the function of BCL11A.
  • a method of treatment wherein the method includes an evaluation step, which includes: evaluating the ability of the modified CD34-positive HSPC of the first population to produce a desired level of gamma-globulin or fetal hemoglobin (HbF) after differentiation, wherein the first population
  • the modified CD34-positive HSPCs are derived from the individual and have been modified to reduce BCL11A function ("modified" EV cells), where if the modified CD34-positive HSPCs of the first population do not produce the desired level of ⁇ -spheres Protein or fetal hemoglobin (HbF), the individual is not suitable for treatment with modified CD34-positive HSPCs ("modified TR cells") of the second population.
  • Hematopoietic stem cells refer to cell populations with vigorous proliferation potential, multi-directional differentiation ability and self-renewal ability. Hematopoietic stem cells can not only differentiate and supplement various blood cells, but also maintain the characteristics and quantity of stem cells through self-renewal. The degree of differentiation and proliferation ability of hematopoietic stem cells are different and heterogeneous. Pluripotent hematopoietic stem cells are the most primitive.
  • directed pluripotent hematopoietic stem cells such as myeloid hematopoietic stem cells that can produce granulocytes, erythroid, mononuclear and megakaryocyte-platelet lines, and lymphocytes that can produce B lymphocytes and T lymphocytes stem cell.
  • myeloid hematopoietic stem cells that can produce granulocytes, erythroid, mononuclear and megakaryocyte-platelet lines, and lymphocytes that can produce B lymphocytes and T lymphocytes stem cell.
  • lymphocytes that can produce B lymphocytes and T lymphocytes stem cell.
  • this cell is also a primitive blood cell, it has lost many of the basic characteristics of hematopoietic stem cells. If it has lost the ability of multi-directional differentiation, it can only differentiate towards one line or a closely related secondary line; Lost the ability of repeated self-renewal, and rely on the proliferation and differentiation of hematopoietic stem cells to supplement the number; the proliferation potential is limited and can only divide several times. According to the number of blood cell lines that hematopoietic progenitor cells can differentiate, they are divided into unipotent hematopoietic progenitor cells (differentiated into only one blood cell line) and oligopotent hematopoietic progenitor cells (differentiated into 2 to 3 blood cell lines).
  • hematopoietic stem cell/progenitor cell and “hematopoietic stem cell” can be used interchangeably, covering pluripotent hematopoietic stem cells, directed pluripotent hematopoietic stem cells and hematopoietic progenitor cells, and are the general term for hematopoietic stem cells with different heterogeneities.
  • CD34-positive hematopoietic stem/progenitor cell refers to a population of stem cells and progenitor cells that express CD34 markers on the surface and have hematopoietic function.
  • CD34-positive HSPC hematopoietic stem/progenitor cell, HSPC
  • flow cytometry and fluorescently labeled anti-CD34 antibodies can be used to detect and count CD34-positive hematopoietic stem/progenitor cells.
  • CD34-positive hematopoietic stem cells/progenitor cells are isolated or obtained from an organism (individual) containing cells of hematopoietic origin. "Separation” refers to removal from its original environment. For example, a cell is isolated if it is separated from some or all of the components that normally accompany it in its natural state.
  • Hematopoietic stem/progenitor cells can be obtained or isolated from unfractionated or fractionated bone marrow of adults, including femurs, hip bones, ribs, sternum and other bones. Hematopoietic stem cells and progenitor cells can be directly obtained or separated from the hip bone with a needle and syringe, or obtained from the blood, usually obtained from the blood after pretreatment with a hematopoietic stem cell mobilizer such as G-CSF (granulocyte colony stimulating factor) . Other sources of hematopoietic stem and progenitor cells include cord blood, placental blood, and peripheral blood of mobilized individuals.
  • G-CSF granulocyte colony stimulating factor
  • kits for purifying hematopoietic stem and progenitor cells from a variety of cell sources are commercially available, and in specific embodiments, these kits can be used with the methods of the present invention.
  • CD34 positive hematopoietic stem cells/progenitor cells can represent at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% of the cell population rich in CD34 positive cells Or 100% CD34-positive hematopoietic stem/progenitor cell population.
  • a “modified” cell refers to a cell that has undergone changes at the molecular or cellular level through biological or chemical methods.
  • the isolated CD34-positive hematopoietic stem cells/progenitor cells (“CD34-positive HSPC") are reduced by gene editing methods, such as those selected from ZFN, TALEN, CHRISPR, RNA editing, or RNAi, to disrupt the BCL11A gene or its coding RNA to produce BCL11A.
  • the modified EV cells or modified TR cells are reduced by gene editing methods, such as those selected from ZFN, TALEN, CHRISPR, RNA editing, or RNAi.
  • BCL11A function inhibitors such as nucleases (such as ZFN and TALEN), peptide nucleic acids, antisense RNA, siRNA, miRNA, shRNA and other BCL11A function inhibitors can also be used to inhibit the function of the BCL11A gene to achieve the isolation of CD34-positive hematopoietic stem cells/progenitor cells (" CD34-positive HSPC") to produce modified EV cells or modified TR cells.
  • CD34 positive hematopoietic stem cells/progenitor cells (“CD34-positive HSPC")
  • EV cell herein represents a cell used for evaluation (EV); and "TR cell” herein represents a cell used for treatment (TR).
  • the "mobilization" of hematopoietic stem cells refers to the process by which hematopoietic stem cells in the hematopoietic microenvironment move from a specific bone marrow microenvironment to the peripheral circulation after being affected by a mobilizing agent.
  • Hemoglobinopathy is a group of inherited blood diseases caused by abnormal hemoglobin molecular structure or abnormal synthesis of globin peptide chain. Clinical manifestations of hemolytic anemia, methemoglobinemia or cyanosis due to tissue hypoxia or compensatory erythrocytosis due to increased or decreased hemoglobin oxygen affinity.
  • Hemoglobin is a binding protein composed of globin and heme.
  • the globin molecule has two pairs of peptide chains, one pair is ⁇ chain, the other pair is non- ⁇ chain, there are 5 kinds of ⁇ , ⁇ , ⁇ , ⁇ (structure similar to ⁇ chain) and ⁇ .
  • Human hemoglobin is composed of two pairs (4) of hemoglobin monomers (each peptide chain is connected to a heme to form a hemoglobin monomer) combined into a tetramer according to a certain spatial relationship, such as HbA (or HbA1, ⁇ 2 ⁇ 2), HbA2 ( ⁇ 2 ⁇ 2) and HbF ( ⁇ 2 ⁇ 2).
  • HbF ( ⁇ 2 ⁇ 2) is a tetramer of fetal hemoglobin.
  • BCL11A is a transcription factor. It was first discovered in mice as a binding site for retroviruses and was named Evi9. Later, this gene was also found in the human genome and located on chromosome 2. Short arm 2p13 site.
  • Reduced function of modified BCL11A refers to modification, such as genetic modification (for example, gene editing at the DNA level and/or RNA level) or the addition of BCL11A function inhibitors (for example, nucleases targeting the BCL11A gene (such as ZFN and TALEN), peptides Nucleic acid, antisense RNA, siRNA, miRNA, shRNA) cause the BCL11A gene to be destroyed, its expression and/or transcription is inhibited, weakened, blocked, interfered.
  • BCL11A function inhibitors for example, nucleases targeting the BCL11A gene (such as ZFN and TALEN), peptides Nucleic acid, antisense RNA, siRNA, miRNA, shRNA
  • CRISPR/Cas is a gene editing technology, including but not limited to various naturally occurring or artificially designed CRISPR/Cas systems, such as the CRISPR/Cas9 system.
  • the naturally occurring CRISPR/Cas system (Naturally occurring CRISPR/Cas system) is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight invading viruses and foreign DNA.
  • CRISPR/Cas9 the working principle of CRISPR/Cas9 is that crRNA (CRISPR-derived RNA) combines with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, which guides the nuclease Cas9 protein in the sequence of pairing with crRNA.
  • the target site shears double-stranded DNA.
  • sgRNA single guide RNA
  • Cas9 effector nuclease can co-localize RNA, DNA and protein, which has great potential for transformation.
  • the CRISPR/Cas system can use type 1, type 2 or type 3 Cas proteins. In some embodiments of the present invention, the method uses Cas9.
  • Other applicable CRISPR/Cas systems include but are not limited to the systems and methods described in WO2013176772, WO2014065596, WO2014018423, US8,697,359, PCT/CN2018/112068, and PCT/CN2018/112027.
  • the method includes genetically modifying the isolated EV cells. In some embodiments of the above methods, the genetic modification includes
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector nuclease
  • CRISPR regularly spaced short palindrome repeat
  • RNA editing RNA interference (RNAi) technology
  • the BCL11a enhancer (influencing, for example, a nucleic acid sequence that enhances the expression or function of BCL11a) is destroyed by genetic modification (e.g. selected from (ZFN, TALEN, CRISPR, RNA editing or RNAi).
  • genetic modification e.g. selected from (ZFN, TALEN, CRISPR, RNA editing or RNAi).
  • BCL11a enhancer is one of exon 2 and exon 3 of the BCL11a gene
  • the nucleic acid sequence between e.g., located at or corresponding to the position as recorded in hg38 +55:Chr2:60497676-60498941; +58:Chr2:60494251-60495546; +62:Chr2:60490409-60491734).
  • An example of the BCL11a enhancer is the +62 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL11a gene.
  • BCL11a enhancer is exon 2 and exon of the BCL11a gene
  • the +58 region of the nucleic acid sequence between 3 (the 150bp sequence of the 58K site of the BCL11A gene: ctgccagtcctcttctaccccacccacgccccaccctaatcagaggccaaacccttcctggagcctgtgataaaagcaactgttagcttgcactagactagcttcaaagttgtattgaccctggtaga11) is the exon of the BCL gene exon BCL11A exon (SEQ ID: CLaactgttagcttgcactagactagcttcaaagttgtgtag11).
  • the function of BCL11A is reduced by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2.
  • CD34-positive HSPC cells are modified by CRISPR/Cas technology to reduce the function of BCL11A.
  • the inhibitor of BCL11A function is a protein or nucleic acid molecule that inhibits the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the BCL11A function inhibits
  • the agent is a protein or nucleic acid molecule that interferes with, inhibits or destroys the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the inhibitor of BCL11A function is a nuclease (such as ZFN and TALEN), peptide nucleic acid, antisense RNA, siRNA, nuclease that interferes with, inhibits or destroys the region from 60495197th to 60495346th human chromosome 2 miRNA.
  • the BCL11A genomic region from 60495219th to 60495336th chromosome 2 in the hematopoietic stem cell is destroyed by gene editing technology to reduce the BCL11A function.
  • the gene editing technology is zinc finger nuclease-based gene editing technology, TALEN gene editing technology, or CRISPR/Cas gene editing technology, RNA editing technology, RNAi technology.
  • the gene editing technology is CRISPR/Cas9 gene editing technology.
  • the BCL11A genome target nucleotide sequence is complementary to a sequence selected from any one of SEQ ID No. 3 to SEQ ID No. 25.
  • sgRNA comprising any sequence selected from SEQ ID NO: 3 to SEQ ID NO: 25 is introduced into the CD34-positive hematopoietic stem/progenitor cell to edit the BCL11A gene and reduce the function of BCL11A.
  • the sgRNA is 2'-O-methyl analog and/or internucleotide 3'thiomodification.
  • the chemical modification is the 2'-O-methyl of one, two and/or three bases before the 5'end and/or the last base of the 3'end of the sgRNA. Base analog modification.
  • the sgRNA and Cas9-encoding nucleotides are co-introduced into the CD34-positive hematopoietic stem/progenitor cells. In some embodiments of the above methods, sgRNA and Cas9-encoding nucleotides are co-introduced into hematopoietic stem cells by electroporation. In some embodiments of the above method, the electrotransmission conditions are 200-600V, 0.5ms-2ms.
  • Cell “differentiation” refers to the process in which cells from the same source gradually produce cell groups with different morphological structures and functional characteristics.
  • the "differentiation" from hematopoietic stem cells to erythrocytes includes hematopoietic stem cell stage, erythroid progenitor cell stage, erythroid precursor cell (primary red blood cell to late red blood cell) proliferation and differentiation stage, reticulocyte proliferation and maturation process, and reticulum Red blood cells release from peripheral blood to mature into red blood cells.
  • Hematopoietic stem cell stage It is currently known that hematopoietic stem cells mainly exist in bone marrow, spleen, liver and other hematopoietic tissues. There is also a small amount of circulation in the peripheral blood.
  • Erythroid progenitor cell stage In the progenitor cell stage, a cell is a cell group between hematopoietic stem cells and erythroid precursor cells. Hematopoietic stem cells differentiate into erythroid progenitor cells under the influence of bone marrow hematopoietic microenvironment. The hematopoietic microenvironment includes microvascular system, nervous system and hematopoietic interstitium. Humoral factors and cytokines have a special effect and influence on the differentiation of hematopoietic stem cells. Erythroid precursor cell stage: including primitive red blood cells, early young red blood cells, middle young red blood cells, late young red blood cells and reticulocytes to reach mature red blood cells.
  • the process of cell maturation is a process in which hemoglobin increases and nuclear activity decreases.
  • the hemoglobin content in nucleated red blood cells continues to increase, and the RNA content continues to decrease.
  • the increase in hemoglobin in red blood cells causes the nucleus to lose activity and no longer synthesize DNA or RNA.
  • this is due to the fact that hemoglobin enters the nucleus through the pores of the nuclear membrane and acts on nuclear histones (nucleohistones), resulting in inactivation of chromosomes and promoting nuclear condensation. Late immature red blood cells have lost the ability to continue dividing.
  • the nucleus is concentrated and escaped, and is swallowed by mononuclear macrophages, or fragmented and dissolved in the spleen to become reticulocytes without nuclei.
  • Hemoglobin is no longer synthesized in the mature red blood cell stage. According to the theory that the increase of intracellular hemoglobin concentration will cause the cell nucleus to lose activity, the number of red blood cell maturation process divisions and the final cell size have a certain relationship with the speed of hemoglobin synthesis. As the cells mature, the diameter of erythroid cells gradually decreases, and the cell volume gradually decreases.
  • organelles such as mitochondria, Golgi apparatus, polyribosomes
  • Gene activity is governed by the expression of globin during the maturation of red blood cells.
  • Globin only accounts for 0.1% of protein in primitive red blood cells, reaching 95% in reticulocytes. It is known that the synthesis of human globin is mainly HbA ( ⁇ 2 ⁇ 2), a small amount of HbA2 ( ⁇ 2 ⁇ 2) and HbF ( ⁇ 2 ⁇ 2).
  • the proliferation time of erythroid cells can be estimated by using directional radionuclide labeling cell proliferation cycle DNA synthesis ability as an indicator.
  • the proliferation time of primitive red blood cells is about 20 hours, that of early red blood cells is about 16 hours, and that of middle and young red blood cells is 25-30 hours. Late young red blood cells do not have the ability to synthesize DNA and are non-proliferative cells. Therefore, normal erythroid precursor cells are generated from bone marrow, and it takes about 3 to 5 days after proliferation and differentiation until new reticulocytes escape from the bone marrow. The reticulocytes then stay in the spleen for 1 to 2 days, continue to mature and change the lipid composition of the membrane before entering the blood circulation.
  • the ability of the desired level of ⁇ -globulin or fetal hemoglobin (HbF) means that EV cells are modified and differentiated to produce ⁇ -globin or fetal hemoglobin compared to the level of ⁇ -globin or fetal hemoglobin produced after differentiation of EV cells without modification -The level of globulin or fetal hemoglobin is increased, for example, at least 0.2 times, 0.3 times, 0.4 times, 0.5 times, 1.0 times, 1.5 times, 2.0 times, 2.5 times, 3.0 times, 3.5 times, 4.0 times, 4.5 times, 5 times Times, 5.5 times, 6.0 times or more.
  • the desired level of gamma-globulin or fetal hemoglobin is relative to unmodified CD34-positive HSPC, which produces 120%, 130%, 140%, 150% %, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, or higher levels of ⁇ -globin or fetal hemoglobin.
  • assessing the ability of the first population of modified CD34-positive HSPCs to produce the required level of ⁇ -globulin or fetal hemoglobin (HbF) after differentiation refers to assessing the ability of the modified CD34-positive HSPCs to reduce the function of BCL11A after differentiation Whether the level of ⁇ -globin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPC without this modification is at least about 12%, 13%, 14% higher, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31% , 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% %, 90%, 95%, 100%, 120%.
  • the desired level of fetal hemoglobin exceeds 6.5 g/dL, 7.0 g/dL, 7.5 g/dL, 8.0 g/dL, 8.5 g/dL, 9.0 g/dL, 9.5 g /dL, 10g/dL, 10.5g/dL, 11.0g/dL peripheral blood, or higher levels.
  • the desired level of ⁇ -globulin is that the modified CD34-positive HSPC produces more than 50%, 60%, 70%, 80%, relative to the unmodified CD34-positive HSPC. 90%, 100%, 120%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, or higher levels of ⁇ -globulin mRNA.
  • the above-mentioned ⁇ -globin or fetal hemoglobin (HbF) level can be differentiated from CD34-positive HSPC to more than 10% of the total differentiated cell population (e.g. 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%), for example, by detecting ⁇ -globulin mRNA or hemoglobin (HbF) detection, to compare the differentiation of CD34-positive HSPCs that have been modified to reduce the function of BCL11A to produce ⁇ -globulin Or whether the level of fetal hemoglobin (HbF) is at least about 12%, 13%, 14%, 15%, 16% higher than the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPC without this modification , 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33
  • the CD34-positive HSPC that has been modified to reduce the function of BCL11A is performed by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2 (such as genetic modification by CRISPR/Cas technology, This includes introducing sgRNA containing any sequence of SEQ ID NO: 3 to SEQ ID NO: 25 into the CD34-positive hematopoietic stem cells/progenitor cells to edit the BCL11A gene to reduce the function of BCL11A.
  • the ability of the modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation is evaluated in the evaluation step, the step comprising: i) allowing differentiation to Culturing the modified EV cells under the condition of obtaining the red blood cell population; and 2) determining the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the red blood cells.
  • evaluating the ability of the modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step includes determining the mRNA level of ⁇ -globin. In some embodiments of the above method, evaluating the ability of the modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step includes determining the protein level of fetal hemoglobin (HbF). In some embodiments of the above methods, wherein the individual has not undergone CD34-positive HSPC cell mobilization or pretreatment prior to the assessment step.
  • the CD34-positive HSPC cell mobilization includes administering G-CSF and/or MozobilTM (Genzyme Corporation) or other hematopoietic stem cell mobilization agents to the subject.
  • the evaluation step is repeated at least once before the treatment step, such as 2, 3, 4, 5 or more times.
  • the isolated TR cells can be modified by using the same or different methods as the modified isolated EV cells.
  • the isolated TR cells are genetically modified.
  • the method includes genetically modifying the isolated TR cells.
  • the genetic modification includes any of zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and regularly spaced short palindrome repeats (CRISPR). A method or a combination thereof genetically modifies the isolated TR cells.
  • the BCL11a enhancer in isolated EV cells or TR cells is destroyed by genetic modification (e.g. selected from (ZFN, TALEN, CRISPR, RNA editing, RNAi) methods (influences, e.g., enhances the expression of BCL11a or Functional nucleic acid sequence).
  • genetic modification e.g. selected from (ZFN, TALEN, CRISPR, RNA editing, RNAi) methods
  • influences e.g., enhances the expression of BCL11a or Functional nucleic acid sequence.
  • BCL11a enhancer see, for example, Bauer et al., Science [Science], Vol. 342, 2013, pp. 253-257.
  • BCL11a enhancer is the BCL11a gene The nucleic acid sequence between Exon 2 and Exon 3 (e.g., located at or corresponding to the position recorded in hg38 +55: Chr2: 60497676-60498941; +58: Chr2: 60494251-60495546; +62: Chr2: 60490409-60491734).
  • An example of the BCL11a enhancer is the +62 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL11a gene.
  • An example of the BCL11a enhancer is the BCL11a gene The +58 region of the nucleic acid sequence between exon 2 and exon 3.
  • the BCL11a enhancer is +55 of the nucleic acid sequence between exon 2 and exon 3 of the BCL11a gene area.
  • the function of BCL11A is reduced by modifying the BCL11A gene in the region from 60495197th to 60495346th human chromosome 2.
  • CD34-positive HSPC cells are modified by CRISPR/Cas technology to reduce the function of BCL11A.
  • the inhibitor of BCL11A function is a protein or nucleic acid molecule that inhibits the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the BCL11A function inhibits
  • the agent is a protein or nucleic acid molecule that interferes with, inhibits or destroys the transcription and/or expression of genes from the 60495197th to 60495346th region of human chromosome 2.
  • the inhibitor of BCL11A function is a nuclease (such as ZFN and TALEN), peptide nucleic acid, antisense RNA, siRNA, nuclease that interferes with, inhibits or destroys the region from 60495197th to 60495346th human chromosome 2 miRNA.
  • the BCL11A genomic region from 60495219th to 60495336th chromosome 2 in the hematopoietic stem cell is destroyed by gene editing technology to reduce the BCL11A function.
  • the gene editing technology is zinc finger nuclease-based gene editing technology, TALEN gene editing technology, or CRISPR/Cas gene editing technology, RNA editing technology, RNAi technology.
  • the gene editing technology is CRISPR/Cas9 gene editing technology.
  • the BCL11A genome target nucleotide sequence is complementary to a sequence selected from any one of SEQ ID No. 3 to SEQ ID No. 25.
  • the following table lists the genomic sequence positions on human chromosome 2 targeted by the sgRNA shown in SEQ ID No. 3 to SEQ ID No. 25, and the cleavage site of Cas9 cleavage caused by each sgRNA.
  • SEQ ID NO: 3 The sgRNA (sometimes abbreviated as enhancer-1) sgRNA coding sequence of enhancer-1 named BCL11A:
  • SEQ ID NO: 4 The sgRNA coding sequence of the enhancer-2 named BCL11A (sometimes also referred to as enhancer-2):
  • SEQ ID NO: 5 The sgRNA (sometimes abbreviated as enhancer-3) sgRNA coding sequence of enhancer-3 named BCL11A:
  • SEQ ID NO: 6 The sgRNA (sometimes abbreviated as enhancer-4) sgRNA coding sequence of enhancer-4 named BCL11A:
  • SEQ ID NO: 7 The sgRNA (sometimes abbreviated as enhancer-5) sgRNA coding sequence of enhancer-5 named BCL11A:
  • SEQ ID NO: 8 The sgRNA (sometimes abbreviated as enhancer-6) sgRNA coding sequence of enhancer-6 named BCL11A:
  • SEQ ID NO: 9 sgRNA (sometimes abbreviated as enhancer-7) sgRNA coding sequence of enhancer-7 named BCL11A:
  • SEQ ID NO: 10 The sgRNA (sometimes abbreviated as enhancer-8) sgRNA coding sequence of enhancer-8 named BCL11A:
  • SEQ ID NO: 11 The sgRNA (sometimes abbreviated as enhancer-9) sgRNA coding sequence of enhancer-9 named BCL11A:
  • SEQ ID NO: 12 The sgRNA (sometimes abbreviated as enhancer-10) sgRNA coding sequence of enhancer-10 named BCL11A:
  • SEQ ID NO: 13 sgRNA (sometimes abbreviated as enhancer-11) sgRNA coding sequence of enhancer-11 named BCL11A:
  • SEQ ID NO: 14 sgRNA (sometimes abbreviated as enhancer-12) sgRNA coding sequence of enhancer-12 named BCL11A:
  • SEQ ID NO: 15 The sgRNA (sometimes abbreviated as enhancer-13) sgRNA coding sequence of enhancer-13 named BCL11A:
  • SEQ ID NO: 16 The sgRNA (sometimes abbreviated as enhancer-14) sgRNA coding sequence of enhancer-14 named BCL11A:
  • SEQ ID NO: 17 The sgRNA (sometimes abbreviated as enhancer-15) sgRNA coding sequence of enhancer-15 named BCL11A:
  • SEQ ID NO: 18 sgRNA (sometimes abbreviated as enhancer-16) sgRNA coding sequence of enhancer-16 named BCL11A:
  • SEQ ID NO: 19 The sgRNA coding sequence of enhancer-17 named BCL11A (sometimes also referred to as enhancer-17):
  • SEQ ID NO: 20 sgRNA (sometimes also referred to as enhancer-18) sgRNA coding sequence of enhancer-18 named BCL11A:
  • SEQ ID NO: 21 The sgRNA (sometimes abbreviated as enhancer-19) sgRNA coding sequence of enhancer-19 named BCL11A:
  • SEQ ID NO: 22 sgRNA (sometimes also referred to as enhancer-20) sgRNA coding sequence of enhancer-20 named BCL11A:
  • SEQ ID NO: 23 The sgRNA (sometimes abbreviated as enhancer-21) sgRNA coding sequence of enhancer-21 named BCL11A:
  • SEQ ID NO: 24 The sgRNA coding sequence of enhancer-22 named BCL11A (sometimes also referred to as enhancer-22):
  • SEQ ID NO: 25 The sgRNA (sometimes abbreviated as enhancer-23) sgRNA coding sequence of enhancer-23 named BCL11A:
  • the guide sequence in sgRNA is any polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and direct the sequence-specific binding of the CRISPR complex to the target sequence.
  • the degree of complementarity between the guide sequence and its corresponding target sequence is about or greater than about 80%, 85%, 90%, 95%, 97.5%, 99% or more.
  • the optimal alignment can be determined using any appropriate algorithm for aligning sequences, non-limiting examples of which include Smith-Waterman algorithm, Needleman-Wimsch algorithm, Burrows-Wheeler Transform-based algorithms (such as Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocraft Technologies, ELAND ((Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn) and Maq (available at maq.sourceforge.net).
  • any appropriate algorithm for aligning sequences non-limiting examples of which include Smith-Waterman algorithm, Needleman-Wimsch algorithm, Burrows-Wheeler Transform-based algorithms (such as Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocraft Technologies, ELAND ((Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn) and Maq (available at maq.source
  • the guide sequence length can be about or greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or more nucleotides. In some embodiments, the guide sequence length is less than about 75, 70, 65, 60, 55 , 50, 45, 40, 35, 30, 25, 20, 15, 12 or fewer nucleotides.
  • the ability of the guide sequence to direct the sequence-specific binding of the CR1SPR complex to the target sequence can be assessed by any appropriate assay method
  • a host cell with the corresponding target sequence can be provided with the components of the CRISPR system (including the guide sequence to be tested) sufficient to form a CRISPR complex, for example, it can be transfected with a vector encoding the CRISPR sequence component, and then evaluated within the target sequence
  • the preferential cleavage (such as by the Surveyor assay as described herein) is carried out.
  • the cleavage of the target polynucleotide sequence can be performed in the test tube by providing the target sequence, the CRISPR complex (including the guide sequence to be tested and the The evaluation is performed by comparing the binding or cleavage rate of the test and the control guide sequence in the target sequence.
  • Other determination methods known to those skilled in the art can also be used for the above determination and evaluation.
  • the sgRNA used in the gene editing process is chemically modified.
  • “Chemically modified sgRNA” refers to the special chemical modification of sgRNA, such as 2'-O-methyl analog modification at the 3 bases of its 5'and 3'ends and/or 3'between nucleotides Thio modification.
  • the chemically modified sgRNA has at least the following two advantages.
  • chemical modification methods commonly used in the art can be used, as long as they can improve the stability of sgRNA (extend the half-life) and enhance the ability to enter the cell membrane.
  • other modification methods are also included, for example, Deleavey GF1, Damha MJ. Designing chemically modified oligonucleotides for targeted gene silence. Chem Biol. 2012 Aug 24; 19(8): 937-54, and Hendel et al. Chemically modified guide RNAs enhancement CRISPR-Cas genome editing in human primary cells. Nat Biotechnol. 2015 Sep; 33(9): 985-989 The chemical modification method reported in the literature.
  • the sgRNA and/or Cas9 encoding nucleotides are introduced into hematopoietic stem cells by electrotransduction, for example, 250-360V, 0.5-1ms; 250-300V, 0.5-1ms; 250V 1ms; 250V 2ms; 300V 0.5ms; 300V 1ms; 360V0.5ms; or 360V1ms electroporation conditions to introduce hematopoietic stem cells.
  • the sgRNA and Cas9-encoding nucleotides are introduced into hematopoietic stem cells by electrotransduction.
  • the sgRNA is introduced into hematopoietic stem cells expressing Cas9 by electrotransduction.
  • the Cas9-encoding nucleotides are mRNAs, such as mRNAs containing ARCA caps.
  • the Cas9 encoding nucleotide is in a viral vector, such as a lentiviral vector.
  • the Cas9 encoding nucleotide comprises the sequence set forth in SEQ ID NO:26.
  • the sgRNA and Cas9 encoding nucleotides are in the same vector.
  • sgRNA comprising any sequence selected from SEQ ID NO: 3 to SEQ ID NO: 25 is introduced into the CD34-positive hematopoietic stem/progenitor cell to edit the BCL11A gene and reduce the function of BCL11A.
  • the sgRNA is 2'-O-methyl analog and/or internucleotide 3'thiomodification.
  • the chemical modification is the 2'-O-methyl of one, two and/or three bases before the 5'end and/or the last base of the 3'end of the sgRNA. Base analog modification.
  • the sgRNA and Cas9-encoding nucleotides are co-introduced into the CD34-positive hematopoietic stem/progenitor cells. In some embodiments of the above methods, sgRNA and Cas9-encoding nucleotides are co-introduced into hematopoietic stem cells by electroporation. In some embodiments of the above method, the electrotransmission conditions are 200-600V, 0.5ms-2ms.
  • mobilizing CD34-positive HSPCs in the treatment step comprises: treating the individual with granulocyte colony stimulating factor (GCSF) and/or plerixafor.
  • GCSF granulocyte colony stimulating factor
  • the step of treating further comprises: pre-treating the individual before administering the modified TR cells.
  • the pretreatment includes chemotherapy, monoclonal antibody therapy, or systemic radiation.
  • the chemotherapy includes administering to the individual one or more chemotherapeutic agents selected from the group consisting of busulfan, cyclophosphamide, and fludarabine.
  • the modified EV cell population is cultured in vitro to further differentiate into red blood cell precursor cells or mature red blood cells expressing ⁇ -globin or fetal hemoglobin.
  • the red blood cell precursor cell is a precursor cell that can express ⁇ -globin or fetal hemoglobin before mature red blood cells.
  • the hematopoietic stem cell erythroid expansion and differentiation medium is used to perform hematopoietic stem cell erythroid expansion and differentiation on the modified EV cell population, wherein the hematopoietic stem cell erythroid expansion and differentiation culture
  • the base includes a basal medium, and a composition of growth factors, wherein the composition of growth factors includes stem cell growth factor (SCF); interleukin 3 (IL-3) and erythropoietin (EPO).
  • SCF stem cell growth factor
  • IL-3 interleukin 3
  • EPO erythropoietin
  • it further comprises using erythroid differentiation and denucleation medium for erythroid differentiation and denucleation of hematopoietic stem cells, the erythroid differentiation and denucleation medium comprising a basal medium, growth factors, and progesterone receptors and glucocorticoids Antagonists and/or inhibitors of hormone receptors.
  • the growth factor in the erythroid differentiation and denucleation medium includes erythropoietin (EPO), and the antagonist and/or inhibitor of the progesterone receptor and glucocorticoid receptor is selected From any one or two or more of the following compounds (I) to (IV):
  • the hematopoietic stem cell erythroid expansion and differentiation medium comprises a basal medium and growth factor additives, wherein the basal medium can be selected from any serum-free basal medium, such as STEMSPAN TM SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), optionally supplemented with ITS (Thermofisher), L-gulutamin (Thermofisher), vitamin C and/or bovine serum albumin; wherein the growth factor additive is selected from IL-3 A combination of one or more of, SCF and EPO.
  • serum-free basal medium such as STEMSPAN TM SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), optionally supplemented with ITS (Thermofisher), L-gulutamin (Thermofisher), vitamin C and/or bovine serum albumin; wherein
  • the modified EV cell population is expanded and differentiated for 5-10 days, such as 6-10 days, 7-10 days, to obtain erythrocyte precursor cells, such as erythroblasts. , Nucleated red blood cells, young red blood cells and reticulocytes. The red blood cell precursor cells are then processed for about 4-14 days, such as about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days of differentiation (or differentiation and denucleation) to obtain mature red blood cells .
  • the step of differentiating the population of modified EV cells into mature red blood cells that produce a desired level of gamma-globin or fetal hemoglobin (HbF) may include:
  • CD34-positive hematopoietic stem cells/progenitor cells isolated CD34-positive HSPC from human peripheral blood (with or without bone marrow hematopoietic stem cell mobilization) or bone marrow,
  • a serum-free medium (Serum-free medium (SFME)
  • SFME serum-free medium
  • 5-10 days such as 5 days, 6 days, 7 days, 8 days, 9 days, and 10 days
  • differentiation to differentiate HSPC into red blood cell precursor cells
  • the hematopoietic stem cell erythroid differentiation and denucleation medium comprises a basic medium, growth factors and chemical small molecule additives, wherein the basic medium is a serum-free basic medium, for example, STEMSPAN TM SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), optionally added with ITS (Thermofisher), L-gulutamin (Thermofisher), vitamin C and/or bovine serum albumin, growth factors and chemical small molecule additives Including EPO, human transferrin and/or chemical small molecule mifepristone.
  • the basic medium is a serum-free basic medium, for example, STEMSPAN TM SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), optionally added with ITS (Thermofisher), L-gulutamin (Thermofisher),
  • the modified CD34-positive HSPC (EV cell population) differentiated to produce ⁇ -globin mRNA or hemoglobin (HbF), and the produced ⁇ -globin mRNA or hemoglobin (HbF) can be detected by conventional methods in the art.
  • the modified CD34-positive HSPC (EV cell population) is differentiated to an enucleated red blood cell accounting for more than about 10% of the total differentiated cell population (e.g.
  • the level of ⁇ -globulin mRNA or hemoglobin (HbF) produced can be detected by conventional methods in the art, and compared with those produced after differentiation of CD34-positive HSPCs that have been modified to reduce the function of BCL11A Whether ⁇ -globin or fetal hemoglobin (HbF) is higher than the ⁇ -globin or fetal hemoglobin (HbF) produced after differentiation of CD34-positive HSPC without this modification.
  • the increase is at least about 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 55%, 60% , 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 120%, indicating that the method of the present invention can be used for treatment.
  • any commonly used basic medium can be used in the above-mentioned hematopoietic stem cell erythroid expansion and differentiation medium and hematopoietic stem cell erythroid differentiation denucleation medium, such as STEMSPAN TM SFEM II (purchased from STEM CELL TECHONOLOGIES); for example, purchased from Thermo Fisher IMDM, DF12, Knockout DMEM, RPMI 1640, Alpha MEM, DMEM, etc.
  • other components can be further added to these basic media as needed, for example, ITS (that is, mainly including insulin, human transferrin, and selenium), L-glutamine, vitamin C, and bovine serum albumin can be added.
  • ITS 2mM L-glutamine, 10-50 ⁇ g/ml vitamin C and 0.5-5 mass% BSA (bovine serum albumin)
  • BSA bovine serum albumin
  • DF12 can be added with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin.
  • Knockout DMEM can be supplemented with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin
  • RPMI 1640 can be supplemented with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin
  • Alpha MEM can be supplemented with the same concentration ITS, L-glutamine, vitamin C and bovine serum albumin
  • DMEM can also be added with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin.
  • the concentration of additional ITS in various basal media may be: insulin concentration is 0.1 mg/ml, human transferrin is 0.0055 mg/ml, selenium element is 6.7 ⁇ 10 -6 mg/ml.
  • the concentration of each component of ITS added can also be adjusted according to actual needs. ITS can be purchased from Thermofisher and adjusted to the appropriate final use concentration as required.
  • the modified TR cell population is not proliferated ex vivo or in vitro before being administered to the individual.
  • the modified TR cells can be washed to remove treatment reagents and administered to patients without proliferating them ex vivo.
  • the modified TR cells are administered to the patient before any significant ex vivo cell division occurs, or before any significant time required for ex vivo cell division.
  • the modified TR cells are cultured for one or more days before being administered to an individual after being modified.
  • the modified TR cells are administered to the patient within 2, 4, 6, 12, 24, 48 hours after being modified.
  • the modified TR cells are stored under freezing conditions for at least 24 hours before the modified TR cells are administered to the individual.
  • the modified TR cells are cultured for one or more days before storage under freezing conditions.
  • the modified TR cells can be cultured in a serum-free basal medium supplemented with cytokines that maintain cell viability for one or more days (for example, 1 day to 3 days), such as SCF (Stem Cell Factor) ), TPO (Thrombopoietin), FLT-3L (FMS-like Tyrosine Kinase 3 Ligand), IL-6 (Interleukin-6).
  • cytokines that maintain cell viability for one or more days (for example, 1 day to 3 days), such as SCF (Stem Cell Factor) ), TPO (Thrombopoietin), FLT-3L (FMS-like Tyrosine Kinase 3 Ligand), IL-6 (Interleukin-6).
  • cytokines that maintain cell viability for one or more days (for example, 1 day to 3
  • the isolated TR cells are cultured for one or more days before modification, and then the isolated TR cells are modified.
  • the hemoglobinopathy is selected from the group consisting of sickle cell disease, sickle cell trait, hemoglobin C disease, hemoglobin C trait, hemoglobin S/C disease, hemoglobin D disease, hemoglobin E disease, thalassemia, hemoglobin-related disorders with increased oxygen affinity, hemoglobin-related disorders with decreased oxygen affinity, unstable hemoglobinopathy, and methemoglobinemia.
  • the hemoglobinopathies are selected from the group consisting of ⁇ -thalassemia and sickle cell anemia.
  • the hemoglobinopathy is ⁇ 0 or ⁇ + thalassemia.
  • the individual is a human.
  • the step of treating is performed immediately following the step of evaluating.
  • treatment refers to obtaining the desired pharmacological and/or physiological effects, including but not limited to, achieving improvement or elimination of disease symptoms.
  • the effect may be prophylactic, manifested as the complete or partial prevention of the disease or its symptoms; and/or the effect may be therapeutic, manifested by achieving improvement or elimination of symptoms, or providing protection against the disease and/or attributable to the disease Partial or complete cure of the adverse effects.
  • treatment includes any treatment of a disease in mammals, especially humans, including: (a) preventing the onset of an individual; (b) inhibiting the disease, that is, preventing its development; (c) alleviating the disease, for example, causing the disease Remission, for example, complete or partial elimination of disease symptoms; and (d) return the individual to a pre-disease state, for example, rebuild the blood system.
  • treatment does not necessarily mean the complete eradication or cure of a disease or disease state or its related symptoms, and it encompasses any minimal improvement or alleviation of any one or more measurable manifestations of the disease or disease state.
  • treatment includes improvement of hematopoietic reconstitution or survival of the individual.
  • a method of treating hemoglobinopathies in an individual comprising:
  • a) Evaluation step which includes evaluating the ability of the first population of modified CD34-positive hematopoietic stem cells/progenitor cells ("CD34-positive HSPC") to produce the desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation , wherein the modified CD34-positive HSPCs of the first population are derived from the individual and have been modified to reduce BCL11A function ("modified EV cells"); and
  • a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A function ("modified TR cells ").
  • a method of treating hemoglobinopathies in an individual comprising a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce the function of BCL11A ( "Modified TR cells"),
  • the individual is selected for treatment based on the functional evaluation through the evaluation step, and the evaluation step includes: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation
  • HbF fetal hemoglobin
  • a method for selecting individuals with hemoglobinopathies for treatment with a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce the BCL11A function (“ Modified TR cells"), wherein the method includes an evaluation step including: evaluating the ability of the modified CD34-positive HSPCs of the first population to produce a desired level of gamma-globin or fetal hemoglobin (HbF) after differentiation , Wherein the modified CD34-positive HSPCs of the first population are derived from the individual and are modified to reduce BCL11A function ("modified EV cells"), wherein if the modified CD34-positive HSPCs of the first population produce the desired level of ⁇ -Globulin or fetal hemoglobin (HbF), the individual is selected for treatment.
  • Modified TR cells modified TR cells
  • a method for determining whether an individual suffering from hemoglobinopathy is suitable for treatment with a second population of modified CD34-positive HSPCs ("modified TR cells") derived from the individual and modified to reduce the function of BCL11A includes an evaluation step, which includes: evaluating the ability of the modified CD34-positive HSPCs of the first population to produce a desired level of ⁇ -globulin or fetal hemoglobin (HbF) after differentiation, wherein the modified CD34-positive HSPCs of the first population CD34-positive HSPCs are derived from the individual and have been modified to reduce BCL11A function ("modified" EV cells), where if the modified CD34-positive HSPCs of the first population produce the required levels of ⁇ -globulin or fetal hemoglobin (HbF ), the individual is suitable for treatment.
  • modified TR cells modified TR cells
  • a method for determining that an individual suffering from hemoglobinopathy is not suitable for treatment with a second population of modified CD34-positive HSPCs ("modified TR cells”) derived from the individual and modified to reduce the function of BCL11A includes an evaluation step including: evaluating the ability of the modified CD34-positive HSPCs of the first population to produce a desired level of ⁇ -globulin or fetal hemoglobin (HbF) after differentiation, wherein the modified CD34-positive HSPCs of the first population CD34-positive HSPCs are derived from the individual and have been modified to reduce BCL11A function ("modified EV cells"), where if the modified CD34-positive HSPCs of the first population do not produce the desired level of gamma-globulin or fetal hemoglobin (HbF) then the individual is not suitable for the modified TR cells for treatment.
  • modified TR cells modified TR cells
  • Modifying the isolated EV cells to obtain a first population of modified CD34-positive HSPC cells with reduced BCL11A function ("modified EV cells");
  • Modifying the isolated TR cells to obtain a second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function;
  • a method of treating hemoglobinopathy in an individual comprising:
  • Evaluation step wherein the evaluation step includes:
  • Modifying the isolated TR cells to obtain a second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function;
  • modifying the isolated EV cell comprises genetically modifying the isolated EV cell.
  • RNA editing and RNA interference group genetically modify isolated EV cells.
  • the modified EV cells include: i) culturing modified EV cells under conditions that allow differentiation to obtain a red blood cell population; and 2) determining the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the red blood cells.
  • evaluating the ability of modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step comprises: Determine the mRNA level of ⁇ -globulin.
  • evaluating the ability of the modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluating step comprises: determining The protein level of fetal hemoglobin (HbF).
  • the modified TR cells are modified through genetic modification.
  • modifying the isolated TR cell comprises genetically modifying the isolated TR cell.
  • RNA editing and RNA interference group of technologies genetically modify isolated TR cells.
  • mobilizing CD34-positive HSPC in the treatment step comprises: treating the said with granulocyte colony stimulating factor (GCSF) and/or plerixafor individual.
  • GCSF granulocyte colony stimulating factor
  • step of treating further comprises: pre-treating the individual before administering the modified TR cells.
  • the chemotherapy comprises administering to the individual one or more chemotherapeutic agents selected from the group consisting of busulfan, cyclophosphamide, and fludarabine .
  • hemoglobinopathy is selected from diseases consisting of sickle cell disease, sickle cell trait, hemoglobin C disease, hemoglobin C trait, hemoglobin S /C disease, hemoglobin D disease, hemoglobin E disease, thalassemia, hemoglobin-related disorders with increased oxygen affinity, hemoglobin-related disorders with reduced oxygen affinity, unstable hemoglobinopathy, and methemoglobinemia disease.
  • hemoglobinopathies are selected from the group consisting of ⁇ -thalassemia and sickle cell anemia.
  • assessing the ability of the modified CD34-positive HSPCs of the first population to produce the required level of gamma-globulin or fetal hemoglobin (HbF) after differentiation refers to assessing that the modification reduces the function of BCL11A Whether the level of ⁇ -globin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPCs is at least about 12% higher than the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPCs without this modification, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29% , 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 55%, 60%, 65%, 70%, 75 %, 80%
  • modified TR cells in the preparation of a medicament used in a method for treating hemoglobinopathies in an individual, the method comprising:
  • a) Evaluation step which includes evaluating the ability of the first population of modified CD34-positive hematopoietic stem cells/progenitor cells ("CD34-positive HSPC") to produce the desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation , wherein the modified CD34-positive HSPCs of the first population are derived from the individual and have been modified to reduce BCL11A function ("modified EV cells"); and
  • a treatment step comprising administering to the individual a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce BCL11A function ("modified TR cells ").
  • modified TR cells in the preparation of a medicament for use in a method for treating hemoglobinopathy in an individual, the method comprising a treatment step, the treatment step comprising administering to the individual a modified TR cell derived from the individual
  • modified TR cells The second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function
  • the individual is selected for treatment based on the functional evaluation through the evaluation step, and the evaluation step includes: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation
  • HbF fetal hemoglobin
  • the modified EV cells are prepared to determine whether an individual suffering from hemoglobinopathies is suitable or unsuitable for using a second population of modified CD34-positive HSPCs derived from the individual and modified to reduce the function of BCL11A ("modified TR cells") for use in a product used in a method of treatment, wherein the method includes an evaluation step, which includes: evaluating the first population of modified CD34-positive HSPCs to produce a desired level of gamma-globulin or fetus after differentiation Hemoglobin (HbF) capacity, where the modified CD34-positive HSPCs of the first population are derived from the individual and modified to reduce BCL11A function (modified EV cells), where if the modified CD34-positive HSPCs of the first population produce The desired level of ⁇ -globin or fetal hemoglobin (HbF), the individual is suitable for treatment; wherein if the modified CD34-positive HSPC of the first population does not produce the desired level of ⁇ -globin or feta
  • Modifying the isolated EV cells to obtain a first population of modified CD34-positive HSPC cells with reduced BCL11A function ("modified EV cells");
  • Modifying the isolated TR cells to obtain a second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function;
  • the evaluation steps include:
  • the treatment steps include:
  • Modifying the isolated TR cells to obtain a second population of modified CD34-positive HSPCs ("modified TR cells") with reduced BCL11A function;
  • modifying the isolated EV cell includes genetically modifying the isolated EV cell.
  • the modified EV cells are evaluated in the evaluation step, the The steps include: i) culturing modified EV cells under conditions that allow differentiation to obtain a red blood cell population; and 2) determining the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the red blood cells.
  • evaluating the ability of modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step comprises: Determine the mRNA level of ⁇ -globulin.
  • evaluating the ability of modified EV cells to produce a desired level of ⁇ -globin or fetal hemoglobin (HbF) after differentiation in the evaluation step comprises: determining The protein level of fetal hemoglobin (HbF).
  • the modified TR cells are modified through genetic modification.
  • modifying the isolated TR cell comprises genetically modifying the isolated TR cell.
  • RNA editing and RNA interference group of technologies genetically modify isolated TR cells.
  • mobilizing CD34-positive HSPC in the treatment step comprises: treating the said with granulocyte colony stimulating factor (GCSF) and/or plexafor (plerixafor) individual.
  • GCSF granulocyte colony stimulating factor
  • step of treating further comprises: pre-treating the individual before administering the modified TR cells.
  • hemoglobinopathy is selected from diseases consisting of sickle cell disease, sickle cell trait, hemoglobin C disease, hemoglobin C trait, hemoglobin S /C disease, hemoglobin D disease, hemoglobin E disease, thalassemia, hemoglobin-related disorders with increased oxygen affinity, hemoglobin-related disorders with reduced oxygen affinity, unstable hemoglobinopathy, and methemoglobinemia disease.
  • hemoglobinopathies are selected from the group consisting of ⁇ -thalassemia and sickle cell anemia.
  • assessing the ability of the modified CD34-positive HSPCs of the first population to produce the required level of gamma-globulin or fetal hemoglobin (HbF) after differentiation refers to assessing that the modification reduces the function of BCL11A Whether the level of ⁇ -globin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPCs is at least about 12% higher than the level of ⁇ -globulin or fetal hemoglobin (HbF) produced by the differentiation of CD34-positive HSPCs without this modification, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29% , 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 55%, 60%, 65%, 70%, 75 %, 80%
  • Example 1 Gene editing of the BCL11A enhancer of hematopoietic stem cells
  • This embodiment relates to the use of the CRISPR/Cas9 system to gene edit thalassemia (hereinafter referred to as thalassaemia) patients and healthy donors to mobilize CD34-positive hematopoietic stem cell BCL11A erythroid enhancer sites derived from peripheral blood.
  • thalassaemia gene edit thalassemia
  • CRISPR RGEN TOOLS Use "CRISPR RGEN TOOLS” software to design sgRNA targeting BCL11A(+58) site and synthesize two chemically modified sgRNAs.
  • the sequence information is as follows: sgRNA-1: ctaacagttgcttttatcac (SEQ ID NO: 5), sgRNA-2: atcagaggccaaacccttcc SEQ ID NO: 4.
  • Cas9 mRNA coding sequence information is as follows: gacaagaagtacagcatcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatctggaagaggataagaagcac
  • sgRNA The chemical synthesis of sgRNA means that the first three bases at the 5'end and the last three bases at the 3'end of sgRNA are modified with 2'-O-methyl analogs and 3'thiomodification between nucleotides. As shown in the following chemical formula, the left side is the chemically modified sgRNA, and the right side is the unmodified sgRNA. Both Cas9 mRNA and sgRNA were purchased from Trilink Biotechnologies, USA.
  • CD34-positive hematopoietic stem cells from the mobilized peripheral blood of 5 patients with anemia and 2 healthy donors ((mobilized peripheral blood samples are provided by the Southern Chunfu (Children) Institute of Hematology).
  • the BTX ECM830 electroporation instrument selects the "300V 1ms" electroporation condition, and electrotransforms the synthesized Cas9 mRNA and chemically modified sgRNA-1 and sgRNA-2 into 5 patients and 2 healthy CD34-positive hematopoietic stem cells, respectively.
  • the genome of the CD34-positive hematopoietic stem cells was extracted, and fragments of 453 bp on the left side and 450 bp on the right side of the sgRNA cleavage site were selected for amplification and Sanger sequencing was performed.
  • Reverse primer gggaagctccaaactctcaa (SEQ ID NO: 27)
  • the results show that the two sgRNAs synthesized in this example can successfully gene-edit different thalassaemia patients and healthy donors to mobilize CD34-positive hematopoietic stem cells derived from peripheral blood.
  • the gene editing efficiency of sgRNA-1 is between 30% and 70%, and the efficiency of Indels varies significantly between different donors.
  • sgRNA-2 can edit cells more efficiently and stably to produce Indels, destroy the BCL11A erythroid enhancer, and target 5 patient donors and 2 healthy donors with a gene editing efficiency of 60-80%.
  • This experiment verifies the expression of gamma globin (HBG gene) mRNA after differentiation of gene-edited hematopoietic stem cells derived from the peripheral blood of thalassaemia patients and healthy donors after mobilization.
  • HBG gene gamma globin
  • the first step of the "two-step method" differentiation is to use hematopoietic stem cell erythroid expansion and differentiation medium to induce the differentiation of CD34+ hematopoietic stem progenitor cells into erythroid progenitor cells for differentiation, and then use hematopoietic stem cell erythroid differentiation to denucleate culture
  • the basis induces differentiation of erythroid progenitor cells into mature red blood cells.
  • the basic medium in hematopoietic stem cell erythroid expansion and differentiation medium is StemSpan TM SFEM II, growth factor is 50-200 ng/ml SCF, 10-100 ng/ml IL-3, 1-10U EPO/ml, culture Conditions: CD34+ hematopoietic stem progenitor cells, at a cell density of 1.0 ⁇ 10 ⁇ 5 cells/ml, cultured with hematopoietic stem cell erythroid expansion and differentiation medium, after 7 days of differentiation, CD34+ hematopoietic stem progenitor cells differentiate into erythroid progenitor cells .
  • the basic medium in the hematopoietic stem cell erythroid differentiation and denucleation medium is STEMSPAN TM SFEM II, the growth factor is 1-10 U EPO, 100-1000 ⁇ g/ml human transferrin, and the chemical small molecule is 0.5-10 ⁇ m mifepristone.
  • the erythroid progenitor cells cultured in one step are differentiated in the hematopoietic stem cell erythroid differentiation denucleation medium at a cell density of 1.0 ⁇ 10 ⁇ 6 cells/ml, and the erythroid progenitor cells differentiate and mature into mature red blood cells.
  • the experimental group includes: sgRNA-1 and sgRNA-2 and the control group can efficiently differentiate into red blood cells, the expression ratio of CD71 and CD235a are both above about 80%, and the differentiation efficiency is high, indicating that the editing effects of sgRNA-1 and sgRNA-2 are both Relatively good.
  • the mRNA of the cells was extracted from mature red blood cells differentiated from hematopoietic stem cells in Example 2.1, reverse transcribed into cDNA, and the mRNA expression of HBG gene was detected by fluorescent quantitative PCR. As shown in Figure 3.
  • sgRNA-1 is increased by about 4.2 times, and sgRNA-2 is increased by about 3.8 times.
  • sgRNA-1 is increased by about 1.8 times
  • sgRNA-2 is increased by about 2 times.
  • sgRNA-1 is increased by about 2.1 times
  • sgRNA-2 is increased by about 3.1 times.
  • sgRNA-1 is increased by about 4 times, and sgRNA-2 is increased by about 5.8 times.
  • sgRNA-1 is increased by about 1.6 times
  • sgRNA-2 is increased by about 2.2 times.
  • sgRNA-1 is increased by about 3.0 times, and sgRNA-2 is increased by about 6.1 times.
  • sgRNA-1 increased by about 1.7 times
  • sgRNA-2 increased by about 1.7 times.
  • sgRNA-1 and sgRNA-2 have a difference in the degree of improvement of gamma globin (HBG), compared with donors with low degree of gamma globin (HBG) improvement, the degree of gamma globin (HBG) improvement is higher Among the donors, sgRNA-1 and sgRNA-2 tend to be the same, with a high degree of consistency and stability. For example, for patient donor 1, sgRNA-1 and sgRNA-2 are both increased by about 4 times, but in patient donors 2.
  • Both sgRNA-1 and sgRNA-2 are only increased by about 2 times; for healthy donor 1, sgRNA-1 and sgRNA-2 are both increased by 3.0 to 6.0 times, but in healthy donor 2, sgRNA-1 and sgRNA -2 are all improved by less than 2 times.
  • This experiment involves a multi-batch verification experiment of using the CRISPR/Cas9 system to efficiently gene edit two healthy donors to mobilize peripheral blood-derived CD34-positive hematopoietic stem cells BCL11A erythroid enhancer sites.
  • Example 2 From the results of Example 1 and Example 2, it can be seen that using Cas9 mRNA and sgRNA-2 can not only efficiently and stably edit the BCL11A erythroid enhancer site, the gene editing efficiency is 60-80%, which is higher than sgRNA-1. Moreover, after removing the inhibition of BCL11A on gamma globin (HBG) and fetal hemoglobin HbF, sgRNA-2 increased the mRNA level of gamma globin (HBG) higher than sgRNA-1. Therefore, in this example, sgRNA-2 was selected as the preferred target for subsequent experiments.
  • HBG gamma globin
  • HbF fetal hemoglobin HbF
  • the electroporation condition of "300V 1ms" was selected, and the synthesized Cas9 mRNA and the chemically modified sgRNA-2 were electroporated into the CD34-positive hematopoietic stem cells of two healthy donors. After 4 days, they were extracted.
  • fragments about 450 bp around the sgRNA cutting site and a total length of 903 bp were selected for amplification, and Sanger sequencing was performed. See Example 1 for sequencing primers and gene editing efficiency analysis methods. The experimental results are shown in Figure 4A
  • the synthesized sgRNA-2 in this example can successfully and efficiently gene-edit CD34-positive hematopoietic stem cells derived from peripheral blood from different donors, and both can efficiently produce Indels, targeting 2 healthy donors
  • the gene editing efficiency reached 70-80%.
  • "three batches of experiments” means that for each healthy donor, we obtained a sample of peripheral blood mobilization, isolated CD34-positive hematopoietic stem cells, but performed 3 independent gene editing for this cell experiment.
  • the synthesized sgRNA-2 in this example can successfully and efficiently gene edit CD34-positive hematopoietic stem cells derived from peripheral blood from different thalassaemia patients, and all of them can efficiently produce Indels for 10 thalassaemias.
  • the gene editing efficiency reached about 60-80% or more.
  • patient donor 1 performed 3 independent genes In the editing experiment, the three patient donors 6, 9, and 10 performed two independent gene editing experiments, while the remaining patient donors performed a single gene editing experiment.
  • Example 4 Expression of gamma globin mRNA and fetal hemoglobin HbF after differentiation of hematopoietic stem cells
  • This embodiment relates to detecting the expression of BCL11A gene and gamma globin mRNA after erythroid differentiation of gene-edited hematopoietic stem cells, wherein the hematopoietic stem cells are derived from peripheral blood mobilized by healthy donors.
  • the two-step differentiation method consists of using hematopoietic stem cell erythroid expansion and differentiation medium for differentiation, and then using hematopoietic stem cell erythroid differentiation and denucleation medium for differentiation.
  • the hematopoietic stem cell erythroid expansion and differentiation medium is StemSpan TM SFEM II as the basic medium, growth factor is 50-200 ng/ml SCF, 10-100 ng/ml IL-3, 1-10U EPO/ml, culture conditions : Use hematopoietic stem cell erythroid expansion and differentiation medium to cultivate hematopoietic stem cells at 1.0 ⁇ 10 ⁇ 5 cells/ml for 7 days.
  • Hematopoietic stem cell erythroid differentiation and denucleation medium is STEMSPAN TM SFEM II, growth factor is 1-10U EPO, 100-1000 ⁇ g/ml human transferrin, chemical small molecule is 0.5-10 ⁇ m mifepristone, which will use the previous The cultured 1.0 ⁇ 10 ⁇ 6cells/ml cells were differentiated in the hematopoietic stem cell erythroid differentiation denucleation medium for 11 days.
  • the electrotransformation conditions of 300v 1ms were selected to electrotransform Cas9 mRNA and sgRNA-2 into 10 thalassaemia patients to mobilize hematopoietic stem cells derived from peripheral blood.
  • the control group cells had no electroporation step.
  • CD71 and CD235a After 18 days of differentiation, we detected the expression of CD71 and CD235a, as shown in Figure 6. Both the experimental group and the control group can differentiate into red blood cells with high efficiency. There are individual differences in the erythroid differentiation efficiency of different thalassaemia patients. The double positive expression ratio of CD71 and CD235a is about 60-95%. It shows that its differentiation efficiency is high and the effect is good.
  • CD34-positive hematopoietic stem cells 1 sample of peripheral blood mobilization for each of these 10 thalassaemia patients, and isolated CD34-positive hematopoietic stem cells.
  • the CD34-positive hematopoietic stem cells of patient donor 1 were used for 3 independent gene editing experiments and 3 independent red blood cell differentiation experiments.
  • the CD34-positive hematopoietic stem cells of patient donors 6, 9 and 10 were respectively performed 2 There were two independent gene editing experiments and two red blood cell differentiation experiments. The remaining 6 patient donors carried out a single gene editing experiment and a single red blood cell differentiation experiment.
  • the mRNA of the cells was extracted from mature red blood cells differentiated from hematopoietic stem cells in Example 4.1.1, reverse transcribed into cDNA, and the mRNA expression of genes such as BCL11A and HBG was detected by fluorescent quantitative PCR. As shown in Figures 7 and 8.
  • the mature red blood cells differentiated from hematopoietic stem cells in Example 4.1.2 were used to detect the positive expression ratio of fetal hemoglobin HbF in the cells by flow cytometry. As shown in Figures 9A, 9B and 10.
  • HbF expression of the three batches of patient donor 1 and patient donor 7 is about 1.3 times that of the control group, while the HbF expression of patient donor 2 is About 2.3 times that of the control group.
  • the different batch experiments of the same thalassaemia patient showed that the HbF expression level was very similar.
  • the two batch experiments of patient donor 1 showed that the HbF expression was about 1.3 times that of the control group, and the HbF expression of patient donor 9 was about 1.4 of that of the control group.
  • the HbF expression of patient donor 10 is about 1.5-1.6 times that of the control group.
  • Example 2.2 From the results of Example 2.2, Example 4.2 and Example 4.3, it is not difficult to find that for different donors, after electrotransformation of Cas9 mRNA and the same sgRNA for the erythroid enhancer of BCL11A, the effects of gamma globin and fetal hemoglobin HbF There is a significant difference in expression improvement.
  • the regulatory mechanism for gamma globin and fetal hemoglobin HbF is complex, for the same individual, from the fetal period to the birth year, the regulatory mechanism of gamma globin and fetal hemoglobin HbF is relatively constant, which means that BCL11A
  • the degree of inhibition and effect of genes on gamma globin and fetal hemoglobin HbF are basically unchanged (Paikari A, et al. Br J Haematol. 2018; Lettre G, et al. Lancet. 2016; G. Lettre, et al. PNAS .2008,11869-11874; Marina et al, Molecular Therapy. 2017; Megan D, et al. Blood.
  • the current treatment strategy of gene-edited BCL11A erythroid enhancers for hemoglobinopathy has obvious potential defects, that is, the prior art does not predict the effects of BCL11A on gamma globin and fetal hemoglobin HbF in advance.
  • the degree and effect of regulation patients will be treated with large doses of bone marrow-removing drugs and autologous hematopoietic stem cell transplantation. It is very likely that the treatment plan will be ineffective or the effect will not be significant, which will bring potential huge harm to patients.
  • This application provides an effective prediction method, that is, the degree and effect of ⁇ globin and fetal hemoglobin HbF in different individuals are different, and the results are consistent and stable; the same individual’s hematopoietic stem cells have undergone different batches of experiments.
  • gene editing down-regulates the expression of BCL11A, the enhancement and effect of gamma globin and fetal hemoglobin HbF are consistent and stable; if the fetal hemoglobin HbF can be increased by at least about 12% after gene editing, the treatment is considered to be effective for patients with thalassaemia .
  • this application proposes a new treatment method for hemoglobinopathies using gene-edited BCL11A erythroid enhancers, that is, companion diagnosis + gene-edited autologous hematopoietic stem cell therapy. As shown in Figure 11.
  • Companion diagnosis Before using the gene-edited BCL11A erythroid enhancer to treat patients with hemoglobinopathy, we can predict the effectiveness of the treatment in advance, that is, extract a small amount of bone marrow or peripheral blood from the patient in advance, and isolate the CD34-positive hematopoietic stem cells After gene editing the BCL11A erythroid enhancer site, the edited cells are differentiated into mature red blood cells, and the expression level of gamma globin (HBG gene) and fetal hemoglobin HbF is evaluated through a series of indicators. Select gamma globin and fetus Patients with higher levels of increased expression of hemoglobin HbF are treated as priority subjects, and the probability of the effectiveness of the treatment plan is higher.
  • HBG gene gamma globin
  • HbF fetal hemoglobin
  • the expression of fetal hemoglobin HbF in the experimental group is increased by at least about 12%, then the patients receiving treatment may benefit clinically. Because on the one hand, it is clinically believed that patients with hemoglobin content of 90g/L can get rid of blood transfusion dependence. If patients with higher expression of gamma globin and fetal hemoglobin HbF are selected for treatment, it is more likely to get rid of blood transfusion dependence.
  • the prediction method developed in this application only needs to extract a small amount of bone marrow or peripheral blood, and the process is simple. Patients do not need to go through complicated procedures to make the bone marrow produce a large amount of hematopoietic stem cells, and the patient did not inject large doses of bone marrow and lymph clearing drugs, such as busulfan and fludarabine, during the screening period. Health is guaranteed.
  • Gene-edited autologous hematopoietic stem cell therapy The companion diagnostic method developed in this application is used to determine the subjects of the hemoglobinopathies that will eventually be treated. Then enter the gene-edited autologous hematopoietic stem cell treatment process: 1. The subject will be given granulocyte colony stimulating factor (G-CSF) or/and plerixafor (an antagonist of the dechemokine receptor CXCR4) for bone marrow mobilization, so that Bone marrow produces a large number of hematopoietic stem cells released into the peripheral blood circulation system. 2. After mobilization, enter the production process of gene-edited cell therapy products.
  • G-CSF granulocyte colony stimulating factor
  • plerixafor an antagonist of the dechemokine receptor CXCR4
  • CD34-positive hematopoietic stem cells are obtained and cultured through CD34 magnetic bead labeling and sorting.
  • electrotransform Cas9 and sgRNA to edit the BCL11A erythroid enhancer site.
  • the cells are cryopreserved, enter the quality control and safety evaluation stage, and after reaching the release standards, they can be ready to start returning to the patient. 3.
  • the clinician will notify the subject to be hospitalized and receive pretreatment chemotherapy (the myeloablative drug Busulfan or/and, the lymph clearing drug cyclophosphamide and fluda Labine (fludarabine)), it should be noted that different clinical institutions may adopt different pretreatment programs.
  • marrow clearing drugs such as busulfan
  • Lymphatic drugs such as cyclophosphamide and fludarabine.
  • the method of the present application has the following advantages: First, the present application finds for the first time that in different individuals, after gene-edited hematopoietic stem cells down-regulate the expression of BCL11A, the degree of elevation and effect on gamma globin and fetal hemoglobin HbF are different, and In the same individual, after gene-edited hematopoietic stem cells down-regulate the expression of BCL11A, it is a consistent and stable phenomenon for the enhancement and effect of gamma globin and fetal hemoglobin HbF, which fills the gap in the prior art.
  • this application sets for the first time the effectiveness threshold for the enhancement of fetal hemoglobin HbF after the gene-edited BCL11A erythroid enhancer, that is, the HbF is increased by at least about 12% after editing, then after the patient receives treatment, the disease may be significant Improvement, it is possible to reduce the frequency of blood transfusion or get rid of blood transfusion.
  • the companion diagnostic method developed by this application is simple to operate, and only needs to extract a small amount of bone marrow or peripheral blood from patients who are in the screening period (patient screening period usually lasts 2-3 months) to isolate CD34 positive Hematopoietic stem cells, gene editing BCL11A erythroid enhancer, red blood cell differentiation, detection of the degree of improvement of gamma globin and fetal hemoglobin HbF, the entire evaluation process only needs 3 to 4 weeks to complete, avoiding the patient's BCL11A gene for gamma Individual differences in the regulation of globin and fetal hemoglobin HbF lead to the risk of ineffective treatment or insignificant effects.
  • this application proposes a brand-new treatment plan that combines companion diagnosis and gene-edited autologous hematopoietic stem cell therapy to improve the safety and effectiveness of gene-editing treatment of hemoglobinopathy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Diabetes (AREA)
  • Developmental Biology & Embryology (AREA)
  • Analytical Chemistry (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/CN2020/087766 2019-04-30 2020-04-29 一种血红蛋白病治疗有效性预测方法 Ceased WO2020221291A1 (zh)

Priority Applications (17)

Application Number Priority Date Filing Date Title
PH1/2021/552732A PH12021552732A1 (en) 2019-04-30 2020-04-29 Method for predicting effectiveness of treatment of hemoglobinopathy
CA3138029A CA3138029A1 (en) 2019-04-30 2020-04-29 Method for predicting effectiveness of treatment of hemoglobinopathy
JP2021564630A JP2022531269A (ja) 2019-04-30 2020-04-29 異常ヘモグロビン症の治療の有効性を予測するための方法
AU2020265060A AU2020265060A1 (en) 2019-04-30 2020-04-29 Method for predicting effectiveness of treatment of hemoglobinopathy
CR20210591A CR20210591A (es) 2019-04-30 2020-04-29 Método para la predicción de eficacia del tratamiento de hemoglobinopatía
PE2021001804A PE20220003A1 (es) 2019-04-30 2020-04-29 Metodo para la prediccion de eficacia del tratamiento de hemoglobinopatia
CN202080028977.8A CN113785059A (zh) 2019-04-30 2020-04-29 一种血红蛋白病治疗有效性预测方法
MX2021013363A MX2021013363A (es) 2019-04-30 2020-04-29 Metodo para la prediccion de eficacia del tratamiento de hemoglobinopatia.
BR112021021744A BR112021021744A8 (pt) 2019-04-30 2020-04-29 Métodos para tratar hemoglobinopatia e para determinar se um indivíduo sofrendo de hemoglobinopatia é adequado ou inadequado para tratar com uma segunda população das hspcs positivas em cd34 modificadas
KR1020217038930A KR20220002565A (ko) 2019-04-30 2020-04-29 이상헤모글로빈증 치료의 효과를 예측하는 방법
EA202192931A EA202192931A1 (ru) 2019-04-30 2020-04-29 Способ прогнозирования эффективности лечения гемоглобинопатии
SG11202112072QA SG11202112072QA (en) 2019-04-30 2020-04-29 Method for predicting effectiveness of treatment of hemoglobinopathy
US17/607,796 US20220193142A1 (en) 2019-04-30 2020-04-29 Method for predicting effectiveness of treatment of hemoglobinopathy
EP20798490.7A EP3964579A4 (en) 2019-04-30 2020-04-29 Method for predicting effectiveness of treatment of hemoglobinopathy
IL287672A IL287672A (en) 2019-04-30 2021-10-28 A method for predicting the effectiveness of hemoglobinopathy treatment
ZA2021/08584A ZA202108584B (en) 2019-04-30 2021-11-03 Method for predicting effectiveness of treatment of hemoglobinopathy
CONC2021/0016058A CO2021016058A2 (es) 2019-04-30 2021-11-26 Método para la predicción de eficacia del tratamiento de hemoglobinopatía

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2019085116 2019-04-30
CNPCT/CN2019/085116 2019-04-30

Publications (1)

Publication Number Publication Date
WO2020221291A1 true WO2020221291A1 (zh) 2020-11-05

Family

ID=73028604

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2020/087766 Ceased WO2020221291A1 (zh) 2019-04-30 2020-04-29 一种血红蛋白病治疗有效性预测方法

Country Status (19)

Country Link
US (1) US20220193142A1 (https=)
EP (1) EP3964579A4 (https=)
JP (1) JP2022531269A (https=)
KR (1) KR20220002565A (https=)
CN (1) CN113785059A (https=)
AU (1) AU2020265060A1 (https=)
BR (1) BR112021021744A8 (https=)
CA (1) CA3138029A1 (https=)
CL (1) CL2021002854A1 (https=)
CO (1) CO2021016058A2 (https=)
CR (1) CR20210591A (https=)
EA (1) EA202192931A1 (https=)
IL (1) IL287672A (https=)
MA (1) MA55817A (https=)
MX (1) MX2021013363A (https=)
PE (1) PE20220003A1 (https=)
PH (1) PH12021552732A1 (https=)
SG (1) SG11202112072QA (https=)
WO (1) WO2020221291A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022206986A1 (en) * 2021-04-02 2022-10-06 Shanghaitech University Gene therapy for treating beta-hemoglobinopathies

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3956449B1 (en) 2019-04-15 2026-02-25 EdiGene Therapeutics (Beijing) Inc. Methods and compositions for editing rnas
EP3997229A4 (en) 2019-07-12 2024-07-03 Peking University TARGETED RNA EDITING BY HARNESSING ENDOGENOUS ADAR USING MODIFIED RNA

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013126794A1 (en) * 2012-02-24 2013-08-29 Fred Hutchinson Cancer Research Center Compositions and methods for the treatment of hemoglobinopathies
WO2013176772A1 (en) 2012-05-25 2013-11-28 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
WO2014018423A2 (en) 2012-07-25 2014-01-30 The Broad Institute, Inc. Inducible dna binding proteins and genome perturbation tools and applications thereof
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
WO2014065596A1 (en) 2012-10-23 2014-05-01 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
CN104955943A (zh) * 2012-11-27 2015-09-30 儿童医疗中心有限公司 用于胎儿血红蛋白再诱导的靶向bcl11a远端调控元件
WO2016135558A2 (en) * 2015-02-23 2016-09-01 Crispr Therapeutics Ag Materials and methods for treatment of hemoglobinopathies
WO2018142364A1 (en) * 2017-02-06 2018-08-09 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
CN108779462A (zh) * 2015-12-28 2018-11-09 诺华股份有限公司 用于治疗血红蛋白病的组合物和方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11788087B2 (en) * 2017-05-25 2023-10-17 The Children's Medical Center Corporation BCL11A guide delivery

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013126794A1 (en) * 2012-02-24 2013-08-29 Fred Hutchinson Cancer Research Center Compositions and methods for the treatment of hemoglobinopathies
WO2013176772A1 (en) 2012-05-25 2013-11-28 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
WO2014018423A2 (en) 2012-07-25 2014-01-30 The Broad Institute, Inc. Inducible dna binding proteins and genome perturbation tools and applications thereof
WO2014065596A1 (en) 2012-10-23 2014-05-01 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
CN104955943A (zh) * 2012-11-27 2015-09-30 儿童医疗中心有限公司 用于胎儿血红蛋白再诱导的靶向bcl11a远端调控元件
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
WO2016135558A2 (en) * 2015-02-23 2016-09-01 Crispr Therapeutics Ag Materials and methods for treatment of hemoglobinopathies
CN108779462A (zh) * 2015-12-28 2018-11-09 诺华股份有限公司 用于治疗血红蛋白病的组合物和方法
WO2018142364A1 (en) * 2017-02-06 2018-08-09 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
BAUER ET AL., SCIENCE, vol. 342, 2013, pages 253 - 257
CHANG K.H. ET AL.: "Long-Term Engraftment and Fetal Globin Induction upon BCL11A Gene Editing inBone-Marrow-Derived CD 34+ Hematopoietic Stem and Progenitor Cells.", MOLECULAR THERAPY: METHODS & CLINICAL DEVELOPMENT., vol. 4, 31 March 2017 (2017-03-31), pages 137 - 148, XP055552856, DOI: 10.1016/j.omtm.2016.12.009 *
D. RUND ET AL., NEW ENGLAND JOURNAL OF MEDICINE, 2005, pages 718 - 739
DELEAVEY GF1DAMHA MJ: "Designing chemically modified oligonucleotides for targeted gene silencing", CHEM BIOL, vol. 19, no. 8, 24 August 2012 (2012-08-24), pages 937 - 54, XP055107150, DOI: 10.1016/j.chembiol.2012.07.011
HENDEL ET AL.: "Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells", NAT BIOTECHNOL., vol. 33, no. 9, September 2015 (2015-09-01), pages 985 - 989, XP055548372, DOI: 10.1038/nbt.3290
LETTRE G ET AL., LANCET, 2016
MARINA ET AL., MOLECULAR THERAPY, 2017
MATTHEW C. ET AL., NATURE, 2015
MEGAN D ET AL., BLOOD, 2015
P. LIU ET AL., NATURE IMMUNOLOGY, 2003
PAIKARI A ET AL., BR J HAEMATOL., 2018
See also references of EP3964579A4
U. MANUELA ET AL., PNAS, 2008, pages 11869 - 11874
V.G. SANKARAN ET AL., SCIENCE, 2008
VINJAMUR DS ET AL., BR. J. HAEMATOL., 2018

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022206986A1 (en) * 2021-04-02 2022-10-06 Shanghaitech University Gene therapy for treating beta-hemoglobinopathies

Also Published As

Publication number Publication date
US20220193142A1 (en) 2022-06-23
CO2021016058A2 (es) 2021-12-10
EA202192931A1 (ru) 2022-02-22
CL2021002854A1 (es) 2022-08-12
SG11202112072QA (en) 2021-12-30
AU2020265060A1 (en) 2021-12-16
BR112021021744A2 (https=) 2021-12-28
CN113785059A (zh) 2021-12-10
JP2022531269A (ja) 2022-07-06
BR112021021744A8 (pt) 2023-03-21
CA3138029A1 (en) 2020-11-05
PH12021552732A1 (en) 2023-01-16
KR20220002565A (ko) 2022-01-06
EP3964579A1 (en) 2022-03-09
MA55817A (fr) 2022-03-09
PE20220003A1 (es) 2022-01-05
IL287672A (en) 2021-12-01
EP3964579A4 (en) 2023-07-26
MX2021013363A (es) 2021-11-18
CR20210591A (es) 2022-03-11

Similar Documents

Publication Publication Date Title
CN109735497B (zh) 一种提高胎儿血红蛋白表达水平的方法
JP2022519409A (ja) 機能的ミトコンドリアで富化された幹細胞を用いたミトコンドリア増強療法
WO2020221291A1 (zh) 一种血红蛋白病治疗有效性预测方法
WO2021043278A1 (zh) 基于脱靶评估评价基因编辑治疗的方法
TW202100752A (zh) 一種異常血紅素症治療有效性預測方法
CN112442516A (zh) 一种高效修复环状铁粒幼细胞性贫血基因突变的方法
HK40040694A (en) Method for predicting effectiveness of treatment of hemoglobinopathy
CN112447264A (zh) 基于脱靶评估评价基因编辑治疗的方法
Tian et al. A novel methodology of the myeloid-derived suppressor cells (MDSCs) generation with splenic stroma feeder cells
HK40006190B (zh) 一种提高胎儿血红蛋白表达水平的方法
HK40006191A (en) Method for increasing fetal hemoglobin expression
HK40006190A (en) Method for increasing fetal hemoglobin expression level
WO2021037234A1 (zh) 一种高效修复环状铁粒幼细胞性贫血基因突变的方法
Apolostolopoulou et al. Osteoprotegerin-Enabled Immune Evasion by Pathological Adipose Stromal Cells Drives Metabolic Dysfunction in Obesity
HK40044491A (en) Method for efficiently repairing gene mutation of ring sideroblastic anemia
HK40042478A (en) Method for evaluating gene editing therapy based on off-target assessment
i Líndez Arginase 2 as a Metabolic Immune Checkpoint in Anti-tumor Immunity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20798490

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3138029

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021564630

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021021744

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2021/0016058

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 20217038930

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020798490

Country of ref document: EP

Effective date: 20211130

WWP Wipo information: published in national office

Ref document number: NC2021/0016058

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2020265060

Country of ref document: AU

Date of ref document: 20200429

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112021021744

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211028

WWE Wipo information: entry into national phase

Ref document number: 521430705

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 521430705

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: 521430705

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: NC2021/0016058

Country of ref document: CO