WO2020220432A1 - Phosphoketolase with enhanced activity and use thereof in metabolite production - Google Patents

Abstract

Disclosed are a phosphoketolase with enhanced activity and a use thereof in metabolite production. A protein is provided, being a mutant protein obtained by subjecting a phosphoketolase to any one or more of the following mutations: T at position 2 is mutated to A; I at position 6 is mutated to T; N at position 14 is mutated to D; E at position 20 is mutated to D; T at position 120 is mutated to A, E at position 231 is mutated to K; H at position 260 is mutated to Y; E at position 342 is mutated to K; K at position 397 is mutated to R, D at position 676 is mutated to G, F at position 785 is mutated to L; and W at position 801 is mutated to R. Also disclosed is a use of the mutant protein in metabolite production. Compared to existing phosphoketolases, the mutant protein phosphoketolase provided has markedly enhanced enzyme activity, which can significantly increase the yield of a target metabolite.

Description

Phosphotransketolase with increased activity and its application in production metabolites Technical field

The present invention belongs to the field of genetic engineering, and specifically relates to a phosphoketolase with increased activity and the application of the phosphoketolase in the production of metabolites. The metabolites involved include but are not limited to amino acids (especially those derived from acetyl-CoA) ), succinic acid, citric acid, etc.

Background technique

Amino acids and organic acids are the most important ingredients in human and animal nutrition. They play a very important role in the pharmaceutical, health, food, chemical, animal feed and cosmetic industries. At present, amino acids and organic acids are mainly produced by microbial fermentation. Known microorganisms that can produce amino acids include Escherichia, Corynebavterium, Brevibacterium, etc. In recent years, with the development of genetic engineering technology, genetic engineering methods have been used to genetically modify strains, and a large number of highly efficient amino acid and organic acid production engineering strains have been obtained.

Phosphoketolase (F/XPK), including 6-phosphate fructose transketolase (FPK) and 5-phosphoxylulose transketolase (XPK). The reaction catalyzed by 6-phosphate fructose transketolase is: fructose-6-phosphate (F6p)+Pi→acetyl phosphate (AcP)+erythrose-4-phosphate (E4P). The reaction catalyzed by 5-xylulose phosphate transketolase is: xylulose-5-phosphate (X5p) + pi→acetyl phosphate (AcP) + glyceraldehyde-3-phosphate (G3P). The reaction catalyzed by phosphoketolase can reduce the oxidation of glucose, but the commonly used genetic engineering strains (including Escherichia coli and Corynebacterium glutamicum, etc.) do not have F/XPK, and F/XPK is introduced into these strains. XPK can increase the theoretical conversion rate of metabolites derived from acetyl-CoA. The natural F/XPK enzyme activity is low and requires a large amount of overexpression to show the effect, which limits its application potential. Therefore, there is an urgent need in the art to develop phosphoketolase with high enzymatic activity.

Invention Disclosure

The purpose of the present invention is to provide a phosphoketolase with improved activity and its application in the production of metabolites.

The protein provided by the present invention is a mutant protein, and is a protein obtained by subjecting phosphoketolase to any one or more of the following (a1) to (a12) mutations:

(a1) The amino acid residue at position 2 corresponding to sequence 3 is mutated from T to A;

(a2) The amino acid residue at position 6 corresponding to sequence 3 is mutated from I to T;

(a3) The amino acid residue at position 14 corresponding to sequence 3 is mutated from N to D;

(a4) The 20th amino acid residue corresponding to sequence 3 is mutated from E to D;

(a5) The amino acid residue at position 120 corresponding to sequence 3 is mutated from T to A;

(a6) The amino acid residue at position 231 corresponding to sequence 3 was mutated from E to K;

(a7) The amino acid residue at position 260 corresponding to sequence 3 is mutated from H to Y;

(a8) The amino acid residue at position 342 corresponding to sequence 3 was mutated from E to K;

(a9) The amino acid residue at position 397 corresponding to sequence 3 is mutated from K to R;

(a10) The amino acid residue at position 676 corresponding to sequence 3 is mutated from D to G;

(a11) The amino acid residue at position 785 corresponding to sequence 3 was mutated from F to L;

(a12) The amino acid residue at position 801 corresponding to Sequence 3 was mutated from W to R.

The multiple mutations may specifically be any two of the above mutations, any three of the above mutations, any four of the above mutations, any five of the above mutations, any six of the above mutations, or more Any seven of the mutations, any eight of the above mutations, any nine of the above mutations, any ten of the above mutations, any eleven of the above mutations, or all of the above mutations.

The mutant protein provided by the present invention may specifically be a protein obtained by performing two mutations (a1) and (a2) of phosphoketolase.

The mutant protein provided by the present invention may specifically be a protein obtained by subjecting phosphoketolase to specific mutations and non-specific mutations. The specific mutations are (a1) and (a2) two mutations. The non-specific mutation is any one or any combination of the following mutations: (a3), (a4), (a5), (a6), (a7), (a8), (a9), (a10), ( a11), (a12).

The mutant protein provided by the present invention may specifically be a protein obtained by subjecting phosphoketolase to three mutations (a1), (a2) and (a7).

The mutant protein provided by the present invention may specifically be a protein obtained by subjecting phosphoketolase to specific mutations and non-specific mutations. The specific mutations are (a1), (a2) and (a7) three mutations. The non-specific mutation is any one or any combination of the following mutations: (a3), (a4), (a5), (a6), (a8), (a9), (a10), (a11), ( a12).

The (a1) may specifically be (b1). The (a2) may specifically be (b2). The (a3) may specifically be (b3). The (a4) may specifically be (b4). The (a5) may specifically be (b5). The (a6) may specifically be (b6). The (a7) may specifically be (b7). The (a8) may specifically be (b8). The (a9) may specifically be (b9). The (a10) may specifically be (b10). The (a11) may specifically be (b11). The (a12) may specifically be (b12).

(b1) The amino acid residue at position 2 is mutated from T to A.

(b2) The amino acid residue at position 6 is mutated from I to T.

(b3) The amino acid residue at position 14 is changed from N to D.

(b4) The 20th amino acid residue was changed from E to D.

(b5) The 120th amino acid residue was mutated from T to A.

(b6) The amino acid residue at position 231 was mutated from E to K.

(b7) The amino acid residue at position 260 was mutated from H to Y.

(b8) The amino acid residue at position 342 was mutated from E to K.

(b9) The amino acid residue at position 397 was mutated from K to R.

(b10) The amino acid residue at position 676 was mutated from D to G.

(b11) The amino acid residue at position 785 was changed from F to L.

(b12) The amino acid residue at position 801 was mutated from W to R.

The phosphoketolase may specifically be a protein shown in sequence 3 of the sequence listing.

The phosphoketolase may also be a protein or polypeptide with 90%, preferably 95%, more preferably 98%, and most preferably 99% homology with the protein shown in sequence 3 of the sequence listing.

Exemplarily, the mutant protein may be M21 protein, M41 protein, M71 protein, M81 protein, M82 protein, T2A protein, I6T protein, N14D protein, E20D protein, T120A protein, E231K protein, and H260Y protein in the examples. , E342K protein, K397R protein, D676G protein, F785L protein, W801R protein, T2A/I6T protein, T2A/H260Y protein, I6T/H260Y protein or T2A/I6T/H260Y protein.

Polynucleotides (such as genes, named as mutant genes) encoding any of the above mutant proteins also belong to the protection scope of the present invention.

Exemplarily, the mutant gene may specifically be a DNA molecule obtained by mutating the coding frame of the phosphoketolase gene in any one or more of the following (c1) to (c12):

(c1) The 4th nucleotide is changed from A to G;

(c2) The 17th nucleotide is changed from T to C;

(c3) The 40th nucleotide is changed from A to G;

(c4) The 60th nucleotide is changed from A to T;

(c5) The 358th nucleotide is changed from A to G;

(c6) Nucleotide at position 691 is changed from G to A;

(c7) The 778th nucleotide is changed from C to T;

(c8) The 1024th nucleotide is changed from G to A;

(c9) The 1190th nucleotide is changed from A to G;

(c10) The 2027th nucleotide is changed from A to G;

(c11) The 2353th nucleotide was changed from T to C;

(c12) The 2401th nucleotide was changed from T to C.

The mutant gene provided by the present invention may specifically be a DNA molecule obtained by performing two mutations (c1) and (c2) on the coding frame of the phosphoketolase gene.

The mutant gene provided by the present invention may specifically be a DNA molecule obtained by subjecting the coding frame of the phosphoketolase gene to specific mutations and non-specific mutations. The specific mutations are (c1) and (c2) two mutations. The non-specific mutation is any one or any combination of the following mutations: (c3), (c4), (c5), (c6), (c7), (c8), (c9), (c10), ( c11), (c12).

The mutant protein provided by the present invention may specifically be a DNA molecule obtained by performing three mutations (c1), (c2) and (c7) on the coding frame of the phosphoketolase gene.

The mutant protein provided by the present invention may specifically be a DNA molecule obtained by subjecting the coding frame of the phosphoketolase gene to specific mutations and non-specific mutations. The specific mutations are (c1), (c2) and (c7) three mutations. The non-specific mutation is any one or any combination of the following mutations: (c3), (c4), (c5), (c6), (c8), (c9), (c10), (c11), ( c12).

The coding frame of the phosphoketolase gene can be specifically as shown in sequence 4 of the sequence listing.

Expression cassettes, recombinant vectors, recombinant isolated cells or recombinant microorganisms having any of the above-mentioned polynucleotides all belong to the protection scope of the present invention.

Fusion proteins with any of the above mutant proteins also belong to the protection scope of the present invention.

The fusion protein may be a protein obtained by fusing the mutant protein and a protein tag. The protein tag can be located at the N-terminus of the mutant protein or at the C-terminus of the mutant protein. There may also be spacer amino acid residues between the mutant protein and the protein tag, specifically, there may be less than 10 spacer amino acid residues.

Exemplary tags are shown in Table 1.

Table 1 Sequence of tags

label	Residues	sequence
Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
c-myc	10	EQKLISEEDL
HA	9	YPYDVPDYA

The fusion protein consists of the following elements in sequence from N-terminal to C-terminal: mutant protein, spacer sequence, and protein tag. The protein tag may specifically be a His ₆ tag. The spacer sequence may specifically consist of less than 10 amino acid residues. The interval sequence may specifically be "LE".

Exemplarily, the fusion protein may be FXPK-His ₆ protein, M21-His ₆ protein, M41-His ₆ protein, M71-His ₆ protein, M81-His ₆ protein, M82-His ₆ protein, T2A-His ₆ protein, I6T-His ₆ protein, N14D-His ₆ protein, E20D-His ₆ protein, T120A-His ₆ protein, E231K-His ₆ protein, H260Y-His ₆ protein, E342K-His ₆ protein, K397R- His ₆ protein, D676G-His ₆ protein, F785L-His ₆ protein, W801R-His ₆ protein, T2A/I6T-His ₆ protein, T2A/H260Y-His ₆ protein, I6T/H260Y-His ₆ protein or T2A/I6T/ H260Y-His ₆ protein.

The polynucleotide (for example, gene) encoding the fusion protein also belongs to the protection scope of the present invention.

Expression cassettes, recombinant vectors, recombinant isolated cells or recombinant microorganisms with polynucleotides encoding the fusion protein all belong to the protection scope of the present invention.

Exemplarily, any of the aforementioned recombinant vectors may specifically be the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR1-fxpk, the recombinant plasmid pTR-M21, the recombinant plasmid pTR-M41, the recombinant plasmid pTR-M71, the recombinant plasmid in the embodiment pTR-M81, recombinant plasmid pTR-M82, recombinant plasmid pTR-T2A, recombinant plasmid pTR-I6T, recombinant plasmid pTR-H260Y, recombinant plasmid pTR-T2A/I6T, recombinant plasmid pTR-T2A/I6T/H260Y, recombinant plasmid pET- fxpk, recombinant plasmid pET-M21, recombinant plasmid pET-M41, recombinant plasmid pET-M71, recombinant plasmid pET-M81, recombinant plasmid pET-M82, recombinant plasmid pET-T2A, recombinant plasmid pET-I6T, recombinant plasmid pET-N14D, Recombinant plasmid pET-E20D, recombinant plasmid pET-T120A, recombinant plasmid pET-E231K, recombinant plasmid pET-H260Y, recombinant plasmid pET-E342K, recombinant plasmid pET-K397R, recombinant plasmid pET-D676G, recombinant plasmid pET-F785L, recombinant plasmid pET-W801R, recombinant plasmid pET-T2A/I6T, recombinant plasmid pET-T2A/H260Y, recombinant plasmid pET-I6T/H260Y, recombinant plasmid pET-T2A/I6T/H260Y or plasmid pSil-fxpk.

The recombinant microorganism may be a recombinant microorganism obtained by introducing any of the above recombinant vectors into a host microorganism.

Exemplarily, any of the above-mentioned recombinant microorganisms may specifically be the strain Z188△pfk (pTR-fxpk) or the strain Z188△pfk (pTR1-fxpk) in the examples, and each of the strains obtained in Example 5 to Example 11. Recombinant bacteria.

The host microorganism can be an amino acid producing strain or an organic acid producing strain.

The host microorganisms include but are not limited to Corynebacterium glutamicum, Escherichia coli or Aspergillus niger, among others.

Exemplarily, the host microorganism may be Corynebacterium glutamicum Z188, strain Z188△pfk, Escherichia coli BL21 (DE3), Escherichia coli succinate production strain (for example, CGMCC No. 5107, CGMCC No. 5108 or CGMCC No. 5109 etc.), glutamine production strains (such as the glutamine production strain in Example 8), E. coli proline production strains (such as DH5α (pSW2)), E. coli trans-4-hydroxy-L-pro Acid-producing strains (such as DH5α (pSW3)), Aspergillus niger (such as Co827 (CICC 40347)).

The present invention also protects the application of specific substances in the preparation of metabolites; the specific substances are: any of the above mutant proteins, any of the above fusion proteins, any of the above mutant genes, and any of the above The gene encoding the fusion protein, any of the above expression cassettes, any of the above recombinant vectors, any of the above recombinant cells or any of the above recombinant microorganisms. The metabolite may specifically be an amino acid. Exemplarily, the amino acid may specifically be an amino acid derived from acetyl-CoA. Exemplarily, the amino acids include but are not limited to glutamic acid, glutamine, proline, trans-4-hydroxy-L-proline and the like. The metabolite may specifically be an organic acid. Exemplarily, the organic acid includes but is not limited to succinic acid, citric acid and the like.

The present invention also protects a method for increasing the enzymatic activity of phosphoketolase, which comprises the following steps: subjecting the phosphoketolase to any one or more of the following mutations (a1) to (a12): (a1) to (a12) Same as above.

The multiple mutations may specifically be any two of the above mutations, any three of the above mutations, any four of the above mutations, any five of the above mutations, any six of the above mutations, or more Any seven of the mutations, any eight of the above mutations, any nine of the above mutations, any ten of the above mutations, any eleven of the above mutations, or all of the above mutations.

In the method, specifically, two mutations (a1) and (a2) can be performed.

In the method, specific mutations and non-specific mutations can be specifically performed. The specific mutations are (a1) and (a2) two mutations. The non-specific mutation is any one or any combination of the following mutations: (a3), (a4), (a5), (a6), (a7), (a8), (a9), (a10), ( a11), (a12).

In the method, three mutations (a1), (a2) and (a7) can be specifically carried out.

In the method, specific mutations and non-specific mutations can be specifically performed. The specific mutations are (a1), (a2) and (a7) three mutations. The non-specific mutation is any one or any combination of the following mutations: (a3), (a4), (a5), (a6), (a8), (a9), (a10), (a11), ( a12).

The (a1) may specifically be (b1). The (a2) may specifically be (b2). The (a3) may specifically be (b3). The (a4) may specifically be (b4). The (a5) may specifically be (b5). The (a6) may specifically be (b6). The (a7) may specifically be (b7). The (a8) may specifically be (b8). The (a9) may specifically be (b9). The (a10) may specifically be (b10). The (a11) may specifically be (b11). The (a12) may specifically be (b12).

The phosphoketolase may specifically be a protein shown in sequence 3 of the sequence listing.

The phosphoketolase may also be a protein or polypeptide with 90%, preferably 95%, more preferably 98%, and most preferably 99% homology with the protein shown in sequence 3 of the sequence listing.

The present invention also protects a method for preparing metabolites, which includes the following steps: preparing metabolites by culturing any of the above-mentioned recombinant microorganisms. The method also includes the step of separating and purifying the metabolites from the culture system. The metabolite may specifically be an amino acid. Exemplarily, the amino acid may specifically be an amino acid derived from acetyl-CoA. Exemplarily, the amino acids include but are not limited to glutamic acid, glutamine, proline, trans-4-hydroxy-L-proline and the like. The metabolite may specifically be an organic acid. Exemplarily, the organic acid includes but is not limited to succinic acid, citric acid and the like.

The present invention also protects a method for obtaining a protein with increased phosphoketolase activity, which includes the following steps:

(1) Perform sequence alignment of an existing protein with a reference protein; the existing protein is an existing protein with phosphoketolase activity; the reference protein is the protein shown in sequence 3 of the sequence list;

(2) According to the comparison result, the specific mutation in the reference protein corresponds to the existing protein, and then the existing protein is mutated to obtain a new protein whose phosphoketolase activity is higher than that of the existing protein; The mutation is any one or more of the following (a1) to (a12): (a1) to (a12) are the same as above.

The (a1) may specifically be (b1). The (a2) may specifically be (b2). The (a3) may specifically be (b3). The (a4) may specifically be (b4). The (a5) may specifically be (b5). The (a6) may specifically be (b6). The (a7) may specifically be (b7). The (a8) may specifically be (b8). The (a9) may specifically be (b9). The (a10) may specifically be (b10). The (a11) may specifically be (b11). The (a12) may specifically be (b12).

The method for obtaining a protein with increased phosphoketolase activity also includes the step of detecting the phosphoketolase activity of new proteins and existing proteins, so as to select proteins with increased enzyme activity.

Any of the above-mentioned phosphoketolases includes but is not limited to 6-phosphofructose ketolase.

Any of the above-mentioned phosphoketolase enzyme activities includes but is not limited to 6-phosphofructose ketolase enzyme activity.

The recombinant isolated cell is obtained by introducing the gene into an isolated host cell. The host cell may specifically be a host cell that can produce amino acids and organic acids. The term "host cell" as used herein has the meaning commonly understood by those of ordinary skill in the art, that is, containing the phosphoketolase of the present invention and capable of producing amino acids, organic acids, particularly amino acids and organic acids derived from acetyl-CoA. cell. In other words, the present invention can use any host cell, as long as the cell contains the phosphoketolase of the present invention and can produce compounds such as amino acids and organic acids.

The recombinant microorganism is obtained by introducing the gene into a host microorganism. The host microorganism may specifically be a host microorganism that can produce amino acids and organic acids. The term "host microorganism" as used herein has the meaning commonly understood by those of ordinary skill in the art, that is, contains the phosphoketolase of the present invention and is capable of producing amino acids, organic acids, particularly amino acids and organic acids derived from acetyl-CoA. microorganism. In other words, the present invention can use any host microorganism, as long as the host microorganism contains the phosphoketolase of the present invention and can produce compounds such as amino acids and organic acids. The host microorganisms include, but are not limited to, Escherichia (Escherichia), Corynebacterium (Corynebacterium), Pantoea (Pantoea), Brevibacterium (Brevibacterium sp), Bacillus (Bacillus), Klebsiella Microorganisms of the genus Klebsiella, Serratia or Vibrio. The host microorganism is preferably Corynebacterium glutamicum, and most preferably Corynebacterium glutamicum. The host microorganism may specifically be Corynebacterium glutamicum Z188.

Description of the drawings

Figure 1 shows the results in Example 2.

Figure 2 shows the results in Example 3.

Figure 3 shows the results in Example 5.

Figure 4 shows the results in Example 6.

The best way to implement the invention

The "phosphoketolase" of the present invention includes 6-phosphate fructose transketolase (FPK) and/or 5-phosphoxylulose transketolase (XPK), which means that it can catalyze fructose-6-phosphate to generate acetyl phosphate and erythritol. An enzyme of musose-4-phosphate and/or an enzyme capable of catalyzing xylulose-5-phosphate to acetyl phosphate and glyceraldehyde-3-phosphate.

"Xylulose 5-phosphate transketolase" may be an enzyme derived from bacteria with 5-xylulose transketolase activity, including but not limited to Lactobacillus, methanol-assimilating bacteria, methane-assimilating bacteria, Streptococcus, etc., preferably Acetobacter, Bifidobacterium, Lactobacillus, Thiobacillus, Streptoccus, Methylcoccus (Methylococus), Buryrivibrio, Fibrobacter (Fibrobacter) bacteria, may also preferably belong to Candida (Candida), Rhodotorula (Rhodotorula), Rhodosporidium (Rhodosporidium), Pichia (Pichia), Hansenula (Hansenula), Kluyveromyces (Kluyveromyces), Saccharomyces (Saccharomyces), Trichosporon (Trichosporon), Wingea and other yeasts.

"Fructose 6-phosphate transketolase" can be an enzyme derived from bacteria with 6-phosphate fructose transketolase activity, including but not limited to Acetobacter, Bifidobacterium, Green Bacteria of the genus Chlorobium, Brucella, Methylococus, Gardnerella, including but not limited to Rhodotorula, Candida Yeasts such as Trichosporon and Saccharomyces.

Phosphoketolase may also be an enzyme, exhibiting two activities: 6-phosphate fructose transketolase (FPK) and 5-phosphoxylulose transketolase (XPK). Regarding the present invention, the phosphoketolase may be derived from Bifidobacterium adolescentis. In the present invention, a mutant protein with increased enzyme activity is obtained by mutating the protein shown in sequence 3 of the sequence list. Those skilled in the art can make any mutation as long as the enzyme activity is improved relative to its natural state. Within the scope of protection of the invention. Phosphoketolase can be derived from various species, including but not limited to Bifidobacterium adolescentis, B. lactis (B. lactis), Lactobacillus pentosus (L. pentosus), Lactobacillus plantarum (L. plantarum) and the like.

The term "natural state" as used herein refers to the activity of the polypeptide in the unmodified state in the microorganism, that is, the activity in the natural state.

The term "containing the phosphoketolase of the present invention" as used herein has the meaning conventionally understood by those skilled in the art, and can be implemented by methods known in the art, including but not limited to, for example, a polynucleotide encoding a protein The polynucleotide of the sequence is inserted into the chromosome, and/or the polynucleotide is cloned into a vector to introduce into the microorganism, and/or the copy of the polynucleotide is directly added on the chromosome, etc. It can also be achieved without limitation Any known method that can introduce protein activity.

The "amino acids, organic acids, especially amino acids and organic acids derived from acetyl-CoA" in the present invention refer to L-glutamic acid, L-glutamine, L-proline, L-hydroxyproline ( Trans-4-hydroxy-L-proline), L-arginine, L-leucine, L-isoleucine, L-cysteine, citric acid, succinic acid, etc. with acetyl-CoA Amino acids and organic acids as substrates.

The "amino acid and organic acid producing strain" in the present invention means that when bacteria are cultivated in culture, they can produce amino acids and organic acids and can accumulate amino acids and organic acids, or can secrete amino acids and organic acids into the culture medium. That is, the ability to obtain extracellular free amino acids and organic acids, especially the ability to accumulate more amino acids and organic acids compared with wild-type strains or parent strains. In order to give strains the ability to produce amino acids and organic acids, traditional breeding methods can be used, such as cultivating auxotrophic mutant strains, strains resistant to analogs, or mutant strains capable of producing amino acids and organic acid metabolism control, and cultivating amino acids, Organic acid biosynthesis-related enzyme activity is improved by recombinant strain method, or a combination of the above methods.

Those skilled in the art know that to mutate wild-type polypeptides in order to increase activity, it is more important to find sites that can achieve the desired purpose. Therefore, based on the teachings of the present invention, those skilled in the art will understand the position 2, 6, 14, 20, 120, 231, 260, 342 of the protein shown in sequence 3. The amino acid residues at position, 397, 676, 785, and 801 were mutated, and the relevant activity of the mutant was tested. In a specific embodiment, the phosphoketolase mutant protein of the present invention corresponds to the amino acid residue at position 2 of the protein shown in sequence 3 as A, and/or the amino acid residue at position 6 is T, and/or The 14th amino acid residue is D, and/or the 20th amino acid residue is D, and/or the 120th amino acid residue is A, and/or the 231st amino acid residue is K, and/or the 260th amino acid residue The amino acid residue at position 342 is Y, and/or the amino acid residue at position 342 is K, and/or the amino acid residue at position 397 is R, and/or the amino acid residue at position 676 is G, and/or the amino acid residue at position 785 is The residue is L, and/or the amino acid residue at position 801 is R.

In addition, it is not difficult for a person of ordinary skill in the art to know that changing a few amino acid residues in certain regions of the polypeptide, such as non-important regions, will not basically change the biological activity. For example, the sequence obtained by appropriately replacing certain amino acids will not affect the biological activity. Its activity (see Watson et al., Molecular Biology of The Gene, Fourth Edition, 1987, The Benjamin/Cummings Pub. Co. P224). Therefore, a person of ordinary skill in the art can implement this replacement and ensure that the resulting molecule still has the desired biological activity.

Therefore, it is obvious that the phosphoketolase mutant of the present invention is further mutated to obtain a further mutant that still has the function and activity of phosphoketolase. For example, it is well known to those skilled in the art to increase or decrease several amino acid residues at either end of a polypeptide, for example, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most Preferably, one amino acid residue does not affect the function of the obtained mutant. For example, to facilitate purification, technicians often put a 6×His tag on either end of the obtained protein, and this protein has the same function as a protein without a 6×His tag. Therefore, the present invention should include conservative mutants of the phosphoketolase of the present invention. These conservative mutants can be produced based on, for example, the amino acid substitution shown in Table 2.

Table 2

Initial residue

Representative substituted residues

Preferred substituted residues

Ala(A)	Val; Leu; Ile	Val
Arg(R)	Lys; Gln; Asn	Lys
Asn(N)	Gln; His; Lys; Arg	Gln
Asp(D)	Glu	Glu
Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
Glu(E)	Asp	Asp
Gly(G)	Pro; Ala	Ala
His(H)	Asn; Gln; Lys; Arg	Arg
Ile(I)	Leu; Val; Met; Ala; Phe	Leu
Leu(L)	Ile; Val; Met; Ala; Phe	Ile
Lys(K)	Arg; Gln; Asn	Arg
Met(M)	Leu; Phe; Ile	Leu
Phe(F)	Leu; Val; Ile; Ala; Tyr	Leu
Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
Thr(T)	Ser	Ser
Trp(W)	Tyr; Phe	Tyr
Tyr(Y)	Trp; Phe; Thr; Ser	Phe
Val(V)	Ile; Leu; Met; Phe; Ala	Leu

The invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or a polynucleotide that also includes additional coding and/or non-coding sequences.

Therefore, as used herein, "containing", "having" or "including" includes "including", "mainly consisting of", "essentially consisting of", and "consisting of"; "mainly consisting of" "...Constituted", "basically formed by..." and "constituted by..." belong to the subordinate concepts of "containing", "having" or "including".

The term "corresponding to" used herein has the meaning commonly understood by those of ordinary skill in the art. Specifically, "corresponding to" means that after two sequences are aligned for homology or sequence identity, one sequence corresponds to a specified position in the other sequence. Therefore, for example, in terms of "corresponding to the amino acid residue at position 40 of the protein shown in sequence 3," if a 6×His tag is added to one end of the protein shown in sequence 3, the resulting mutant corresponds to sequence 3. The 40th position of the amino acid sequence shown may be the 46th position.

In a specific embodiment, as long as the homology or sequence identity is 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% or more, and has phosphotransketolase activity ( That is, the activity of 6-phosphofructose transketolase and/or 5-phosphoxylulose transketolase activity) are also within the protection scope of the present invention.

Methods of determining sequence homology or identity well known to those of ordinary skill in the art include but are not limited to: Computational Molecular Biology, Lesk, AM, Ed. Oxford University Press, New York, 1988; Biological Computing: Information Biocomputing:Informatics and Genome Projects, Smith, edited by DW, Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, edited by Griffin, AM and Griffin, HG , Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987 and Sequence Analysis Primer, Gribskov, M. and Devereux , J. Ed. M Stockton Press, New York, 1991 and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). The preferred method for determining identity is to obtain the largest match between the tested sequences. The method for determining identity is compiled in a publicly available computer program. Preferred computer program methods for determining the identity between two sequences include, but are not limited to: GCG package (Devereux, J. et al., 1984), BLASTP, BLASTN and FASTA (Altschul, S, F. et al., 1990). The public can obtain the BLASTX program from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples usually follow the conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions described in the manufacturer The suggested conditions. The test materials used in the following examples, unless otherwise specified, are all purchased from conventional biochemical reagent companies. The quantitative tests in the following examples are all set to three repeated experiments, and the results are averaged.

The document that contains the plasmid pK18mobsacB (plasmid pK18mobsacB) is recorded in the following documents: Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A (1994) Small mobilizable multipurpose cloning vectors-derived ids from p 18 K selection of defined deletions in the chromosome of Corynebacterium glutamicum.Gene 145(1):69-73.https://doi.org/10.1016/0378-1119(94)90324-7.

Plasmid pTRCmob (Plasmid pTRCmob) is described in the following literature: Liu, Q., et al. (2007). Journal of Biotechnology 132 (2007) 273-279.

The formula of the liquid CGXII inorganic salt medium is shown in Table 3 (adjusted to pH 7.0).

table 3

Medium composition	Content (per liter)
glucose	50g
(NH 4 ) 2 SO 4	20g
Urea	5g
KH 2 PO 4	1g
K 2 HPO 4	1g
MgSO 4	0.25g
3-morpholinopropanesulfonic acid	42g
CaCl 2	0.01g
FeSO 4 ·7H 2 0	0.01g
MnSO 4 ·H 2 0	0.01g
ZnS0 4 ·7H 2 0	0.001g
Protocatechuic acid	0.03g

CuSO 4	0.2mg
NiCl 2 ·6H 2 0	0.02mg
Biotin	0.2mg
Vitamin B1	0.1mg

Example 1. Construction of a strain with knockout pfk gene, namely strain Z188△pfk

Corynebacterium glutamicum Z188, namely Corynebacterium glutamicum (Corynebacterium glutamicum) Z188. The complete genome of Corynebacterium glutamicum Z188 can be found in GenBank accession number: NZ_AKXP00000000.1 (https://www.ncbi.nlm.nih.gov/nuccore/NZ_AKXP00000000). The pfk gene is the 6-phosphofructokinase gene. In the genomic DNA of Corynebacterium glutamicum Z188, the coding frame of the pfk gene and the nucleotide sequence of the 1000bp part of the upstream and downstream parts are shown in the sequence 2 of the sequence table (in the sequence 2 of the sequence table, nucleotides 1001-2041 To encode the frame, the protein shown in Sequence 1 of the Sequence Listing is encoded).

Δpfk-F1: CCTC GAATTC GGATGCTGCCAATGGAATGGTGCCCAGTG;

Δpfk-R1: CTTCAAGGTTAAATTCATTGCTGGCTGTGC;

Δpfk-F2: CAATGAATTT AACCTTGAAGGAAGTTCCATTC;

Δpfk-R2: TCTA CTGCAG GGAATGATGACACCGATGGTGTCTGTCCTCGAC.

1. Using the genomic DNA of Corynebacterium glutamicum Z188 as a template, a primer pair composed of Δpfk-F1 and Δpfk-R1 is used for PCR amplification to obtain a PCR amplification product.

2. Using the genomic DNA of Corynebacterium glutamicum Z188 as a template, a primer pair composed of Δpfk-F2/Δpfk-R2 is used for PCR amplification to obtain a PCR amplification product.

3. The PCR amplification product of step 1 and the PCR amplification product of step 2 are used as templates at the same time, and a primer pair composed of Δpfk-F1/Δpfk-R2 is used for PCR amplification to obtain a PCR amplification product.

4. Take the PCR amplified product obtained in step 3, use restriction enzymes EcoRI and PstI for double digestion, and recover the digested product.

5. Take the plasmid pK18mobsacB, use restriction enzymes EcoRI and PstI for double digestion, and recover the vector backbone.

6. Connect the digested product of step 4 and the vector backbone of step 5 to obtain a recombinant plasmid.

7. Using the recombinant plasmid obtained in step 6, according to the literature (Niebisch and Bott, (2001).Arch Microbiol 175(4):282-294.Schafer et al.,(1994).Gene 145(1):69-73 The two-step Rec recombination method described in) knocked out the pfk gene of Corynebacterium glutamicum Z188 to obtain a strain with the pfk gene knocked out, which was named strain Z188△pfk.

Strain Z188△pfk was sequenced. Compared with the genomic DNA of Corynebacterium glutamicum Z188, the only difference in the genome of the strain Z188Δpfk is that the segment shown at nucleotide 1100-1983 of the DNA molecule shown in sequence 2 of the sequence listing is deleted.

Example 2. Preparation and growth performance of recombinant bacteria

The phosphoketolase derived from Bifidobacterium adolescentis is shown in sequence 3 of the sequence table. Full codon optimization is performed on the protein coding gene shown in sequence 3 of the sequence table, and the optimized gene is shown in sequence 4 of the sequence table. The phosphoketolase shown in sequence 3 of the sequence listing is also called FXPK protein or F/XPK protein. The gene encoding FXPK protein is also called fxpk gene.

1. Preparation of recombinant plasmid

1. Synthesize the double-stranded DNA molecule shown in sequence 4 of the sequence table; use the synthesized double-stranded DNA molecule as a template to perform PCR amplification using a primer pair composed of F1 and R1, and recover the PCR amplified product.

F1: CTAC GAATTC GAAGGAGATATACATATG;

R1: TCAG GGATCC TCATTCGTTGTCACCCGCGGTC.

2. Take the PCR amplified product obtained in step 1, and use restriction enzymes EcoRI and BamHI for double digestion to recover the digested product.

3. Take the plasmid pTRCmob, use restriction enzymes EcoRI and BamHI for double digestion, and recover the vector backbone.

4. Connect the digested product of step 2 and the vector backbone of step 3 to obtain the recombinant plasmid pTR-fxpk. It was verified by sequencing that the recombinant plasmid pTR-fxpk contained a specific DNA molecule A. The specific DNA molecule A consists of the following five elements in sequence from upstream to downstream: the DNA molecule shown in sequence 5 of the sequence list (the nucleotides 1-246 in the sequence 5 constitute the promoter), and the EcoRI restriction recognition sequence "Gaattc", the ribosome binding site "GAAGGAGATATACAT", the DNA molecule shown in sequence 4 of the sequence listing, and the BamHI restriction recognition sequence "GGATCC".

5. Using the recombinant plasmid pTR-fxpk as a template, a primer pair consisting of Ptrc-1 and Ptrc-2 was used for single point mutation to obtain the recombinant plasmid pTR1-fxpk. The purpose of this step is to introduce a single point mutation in the promoter region to increase the promoter activity and promote gene expression.

Ptrc-1: GAGCGGATAACAATCTCACACAGGAAACAG;

Ptrc-2: CTGTTTCCTGTGTGAGATTGTTATCCGCTC.

The recombinant plasmid pTR1-fxpk was verified by sequencing. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR1-fxpk differs only in that the DNA molecule shown in sequence 6 of the sequence list is substituted for the DNA molecule shown in sequence 5 of the sequence list.

2. Preparation of recombinant bacteria

The recombinant plasmid pTR-fxpk was introduced into the strain Z188△pfk, and the recombinant strain was obtained and named as the strain Z188△pfk (pTR-fxpk).

The recombinant plasmid pTR1-fxpk was introduced into the strain Z188△pfk, and the recombinant strain was obtained, which was named as the strain Z188△pfk (pTR1-fxpk).

Three, compare the growth performance of strains

The tested strains were: Corynebacterium glutamicum Z188, strain Z188△pfk, strain Z188△pfk (pTR-fxpk), strain Z188△pfk (pTR1-fxpk).

The test strains were inoculated into liquid CGXII inorganic salt medium (OD _600nm value of the initial system = 0.1), cultured with shaking at 30°C and 850rpm, sampling at different times (200μL each), and the absorbance at _600nm (OD _600nm) value).

The results are shown in Figure 1. The strain Z188△pfk hardly grows in liquid CGXII inorganic salt medium. Both strain Z188△pfk (pTR-fxpk) and strain Z188△pfk (pTR1-fxpk) can grow normally. The higher the expression level of fxpk gene, the faster the growth rate of the strain. The results show that the increase in FXPK enzyme activity/content can promote the growth of strains, so that mutant proteins with increased enzyme activity can be screened from the mutant library by means of growth enrichment.

Example 3. Obtaining a mutant protein with improved enzyme activity

1. Construction of fxpk gene mutant library

1. Use the recombinant plasmid pTR-fxpk as a template and use a primer pair consisting of F1 and R1 to perform error-prone PCR amplification. Error-prone PCR amplification, using

DNA polymerase (Beijing Quanshijin Biotech). Set up three reaction systems respectively, each containing 0.2mM, 0.5mM or 0.8mM manganese chloride. After completing the error-prone PCR amplification, the three reaction systems were combined.

2. Take the product of step 1 and use restriction enzymes EcoRI and BamHI for double digestion to recover the digested product.

3. Take the recombinant plasmid pTR-fxpk, use restriction enzymes EcoRI and BamHI for double digestion, and recover the vector backbone.

4. Connect the digested product of step 2 with the vector backbone of step 3 to obtain a recombinant plasmid.

5. Introduce the recombinant plasmid obtained in step 4 into the strain Z188△pfk to obtain the recombinant bacteria.

Since error-prone PCR amplification produced a variety of fxpk gene mutant genes, a variety of recombinant plasmids (about 10,000) were obtained in step 4 to form a fxpk gene mutant recombinant plasmid library, correspondingly, obtained in step 5 A variety of recombinant bacteria, forming fxpk gene mutation recombinant bacteria library.

The same method was used to construct 9 fxpk gene mutant recombinant strain banks, which were named M1 recombinant strain bank to M9 recombinant strain bank sequentially.

2. Obtain mutants with increased FXPK enzyme activity through growth enrichment

Use liquid CGXII inorganic salt medium to cultivate 9 fxpk gene mutant recombinant strains in a 24-deep well plate (1ml medium per well), shake culture at 30℃ and 850rpm, and transfer once every 48 hours (inoculation amount is 1%) ). After each incubation, take 200 μL into the microwell plate, and detect the absorbance (OD _600nm value) at 600nm with a microplate reader. The strain Z188△pfk (pTR-fxpk) was used as a control strain. The results are shown in Figure 2. With continuous subculture, M2 recombinant bacteria bank, M4 recombinant bacteria bank, M7 recombinant bacteria bank and M8 recombinant bacteria bank are all enriched to strains that can grow faster.

Sequencing analysis was performed on the M2 recombinant bacteria bank, M4 recombinant bacteria bank, M7 recombinant bacteria bank and M8 recombinant bacteria bank respectively, and a mutant gene of fxpk gene was screened from the M2 recombinant bacteria bank, M4 recombinant bacteria bank and M7 recombinant bacteria bank. , Two mutant genes of fxpk gene were screened from the M8 recombinant strain library. Thus, five mutant proteins of FXPK protein were obtained. Each mutant protein was named M21 protein, M41 protein, M71 protein, M81 protein and M82 protein. The mutant amino acids of each mutant protein compared with the FXPK protein, and the mutant nucleotides of each mutant gene compared with the fxpk gene (shown at nucleotides 26-2503 in the sequence 4 of the sequence list) are shown in Table 4.

Table 4

^(1-14) indicates that the nucleotide mutation causes the corresponding amino acid mutation, ^(-) indicates that the nucleotide mutation does not cause the amino acid mutation.

Example 4. Construction of each recombinant plasmid used to express each protein

The FXPK protein is shown in sequence 3 of the sequence listing. The fxpk gene is shown in sequence 4 of the sequence listing.

1. Prepare each recombinant plasmid separately and verify by sequencing.

Recombinant plasmid pTR-M21. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-M21 only differs in that the fxpk gene is replaced by the M21D gene. Compared with the fxpk gene, the M21D gene has the following 5 nucleotide mutations: the 17th nucleotide is changed from T to C, the 358th nucleotide is changed from A to G, and the 691th nucleotide is changed from G is mutated to A, nucleotide 1190 is mutated from A to G, and nucleotide 2027 is mutated from A to G. The M21D gene encodes the M21 protein. Compared with the FXPK protein, the M21 protein has the following 5 amino acid residue mutations: the 6th amino acid residue is changed from I to T, the 120th amino acid residue is changed from T to A, and the 231st amino acid residue is changed from E was mutated to K, the amino acid residue at position 397 was mutated from K to R, and the amino acid residue at position 676 was mutated from D to G.

Recombinant plasmid pTR-M41. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-M41 only differs in that the fxpk gene is replaced by the M41D gene. Compared with the fxpk gene, the M41D gene has the following 2 nucleotide mutations: the 4th nucleotide is changed from A to G, and the 2353th nucleotide is changed from T to C. The M41D gene encodes the M41 protein. Compared with the FXPK protein, the M41 protein has the following two amino acid residue mutations: the second amino acid residue is changed from T to A, and the 785th amino acid residue is changed from F to L.

Recombinant plasmid pTR-M71. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-M71 only differs in that the fxpk gene is replaced by the M71D gene. Compared with the fxpk gene, the M71D gene has the following 3 nucleotide mutations: the 40th nucleotide is changed from A to G, the 1481th nucleotide is changed from G to A, and the 2401th nucleotide is changed from T is mutated to C. The M71D gene encodes the M71 protein. Compared with the FXPK protein, the M71 protein has the following three amino acid residue mutations: the 14th amino acid residue N is changed to D, the 494th amino acid residue is changed from R to H, and the 801th amino acid residue is changed from W is mutated to R.

Recombinant plasmid pTR-M81. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-M81 only differs in that the fxpk gene is replaced by the M81D gene. Compared with the fxpk gene, the M81D gene has the following 4 nucleotide mutations: the 60th nucleotide is changed from A to T, the 778th nucleotide is changed from C to T, and the 1024th nucleotide is changed from G was mutated to A, and the 1401th nucleotide was mutated from G to A. The M81D gene encodes the M81 protein. Compared with the FXPK protein, the M81 protein has the following 4 amino acid residue mutations: the 20th amino acid residue is changed from E to D, the 260th amino acid residue is changed from H to Y, and the 342th amino acid residue is changed from H to Y. E was mutated to K, and the amino acid residue M at position 467 was mutated to I.

Recombinant plasmid pTR-M82. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-M82 only differs in that the fxpk gene is replaced by the M82D gene. Compared with the fxpk gene, the M82D gene has the following 3 nucleotide mutations: the 60th nucleotide is changed from A to T, the 778th nucleotide is changed from C to T, and the 1024th nucleotide is changed from G is mutated to A. The M82D gene encodes the M82 protein. Compared with the FXPK protein, the M82 protein has the following three amino acid residue mutations: the 20th amino acid residue is changed from E to D, the 260th amino acid residue is changed from H to Y, and the 342th amino acid residue is changed from H to Y. E is mutated to K.

Recombinant plasmid pTR-T2A. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-T2A only differs in that the fxpk gene is replaced by the T2A gene. Compared with the fxpk gene, the T2A gene has the following 1 nucleotide mutation: the 4th nucleotide is changed from A to G. The T2A gene encodes the T2A protein. Compared with the FXPK protein, the T2A protein has the following one amino acid residue mutation: the second amino acid residue is changed from T to A.

Recombinant plasmid pTR-I6T. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-I6T differs only in that the fxpk gene is replaced by the I6T gene. Compared with the fxpk gene, the I6T gene has the following 1 nucleotide mutation: the 17th nucleotide is changed from T to C. The I6T gene encodes the I6T protein. Compared with the FXPK protein, the I6T protein has the following one amino acid residue mutation: the 6th amino acid residue is changed from I to T.

Recombinant plasmid pTR-H260Y. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-H260Y differs only in that the fxpk gene is replaced by the H260Y gene. Compared with the fxpk gene, the H260Y gene has the following 1 nucleotide mutation: the 778th nucleotide is changed from C to T. The H260Y gene encodes the H260Y protein. Compared with the FXPK protein, the H260Y protein has the following one amino acid residue mutation: the 260th amino acid residue is changed from H to Y.

Recombinant plasmid pTR-T2A/I6T. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-T2A/I6T differs only in that the fxpk gene is replaced by the T2A/I6T gene. Compared with the fxpk gene, the T2A/I6T gene has the following 2 nucleotide mutations: the 4th nucleotide is changed from A to G, and the 17th nucleotide is changed from T to C. The T2A/I6T gene encodes the T2A/I6T protein. Compared with the FXPK protein, the T2A/I6T protein has the following two amino acid residue mutations: the second amino acid residue is mutated from T to A, and the sixth amino acid residue is mutated from I to T.

Recombinant plasmid pTR-T2A/I6T/H260Y. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-T2A/I6T/H260Y differs only in that the fxpk gene is replaced by the T2A/I6T/H260Y gene. Compared with the fxpk gene, the T2A/I6T/H260Y gene has the following 3 nucleotide mutations: the 4th nucleotide is changed from A to G, the 17th nucleotide is changed from T to C, and the 778th nucleotide The nucleotide is changed from C to T. The T2A/I6T/H260Y gene encodes the T2A/I6T/H260Y protein. Compared with the FXPK protein, the T2A/I6T/H260Y protein has the following three amino acid residue mutations: the second amino acid residue is changed from T to A, the sixth amino acid residue is changed from I to T, and the 260th amino acid residue The amino acid residue is mutated from H to Y.

2. Prepare the recombinant plasmid pET-fxpk.

Insert the DNA molecule shown in the 4th to 2475th nucleotides in sequence 4 of the sequence table between the NdeI and XhoI digestion recognition sequences of plasmid pET-30a(+) to obtain the recombinant plasmid pET-fxpk. It was verified by sequencing that the recombinant plasmid pET-fxpk contained a specific DNA molecule B. The specific DNA molecule B consists of the following five elements in sequence from upstream to downstream: NdeI digestion recognition sequence "CATATG" (where ATG is used as the start codon of the fusion gene), and positions 4-2475 in sequence 4 of the sequence table The DNA molecule shown by the nucleotide (that is, the fxpk gene with the start codon and the stop codon removed), the XhoI digestion recognition sequence "CTCGAG", the His ₆ tag coding sequence "CACCACCACCACCACCAC", and the stop codon "TGA". The fusion gene in the recombinant plasmid expresses the FXPK-His ₆ protein. The FXPK-His ₆ protein is composed of the following elements in sequence from the N-terminal to the C-terminal: FXPK protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

3. Prepare each recombinant plasmid separately and verify by sequencing.

Recombinant plasmid pET-M21. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-M21 differs only in that the M21D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses the M21-His ₆ protein. The M21-His ₆ protein is composed of the following elements in sequence from the N-terminal to the C-terminal: M21 protein, LE (XhoI restriction recognition sequence encoding), His ₆ tag.

Recombinant plasmid pET-M41. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-M41 only differs in that the M41D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses the M41-His ₆ protein. The M41-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: M41 protein, LE (XhoI digestion recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-M71. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-M71 is only that the M71D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses the M71-His ₆ protein. The M71-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: M71 protein, LE (XhoI digestion recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-M81. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-M81 differs only in that the M81D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses the M81-His ₆ protein. The M81-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: M81 protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-M82. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-M82 only differs in that the M82D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses the M82-His ₆ protein. The M82-His ₆ protein is composed of the following elements in sequence from N-terminal to C-terminal: M82 protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-T2A. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-T2A differs only in that the T2A gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses the T2A-His ₆ protein. The T2A-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: T2A protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-I6T. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-I6T is only that the I6T gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses I6T-His ₆ protein. The I6T-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: I6T protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-N14D. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-N14D differs only in that the N14D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the N14D gene has the following 1 nucleotide mutation: the 40th nucleotide is changed from A to G. The N14D gene encodes the N14D protein. Compared with the FXPK protein, the N14D protein has the following 1 amino acid residue mutation: the 14th amino acid residue N is changed to D. The fusion gene in the recombinant plasmid expresses the N14D-His ₆ protein. The N14D-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: N14D protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-E20D. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-E20D is only that the E20D gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the E20D gene has the following 1 nucleotide mutation: the 60th nucleotide is changed from A to T. The E20D gene encodes the E20D protein. Compared with the FXPK protein, the E20D protein has the following one amino acid residue mutation: the 20th amino acid residue is changed from E to D. The fusion gene in the recombinant plasmid expresses E20D-His ₆ protein. The E20D-His ₆ protein is composed of the following elements in sequence from the N-terminal to the C-terminal: E20D protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-T120A. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-T120A differs only in that the T120A gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the T120A gene has the following 1 nucleotide mutation: the 358th nucleotide is changed from A to G. The T120A gene encodes the T120A protein. Compared with the FXPK protein, the T120A protein has the following one amino acid residue mutation: the 120th amino acid residue changes from a mutation T to A. The fusion gene in the recombinant plasmid expresses the T120A-His ₆ protein. The T120A-His ₆ protein is composed of the following elements in sequence from N-terminal to C-terminal: T120A protein, LE (XhoI restriction recognition sequence encoding), His ₆ tag.

Recombinant plasmid pET-E231K. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-E231K differs only in that it replaces the fxpk gene with the stop codon removed by the E231K gene with the stop codon removed. Compared with the fxpk gene, the E231K gene has the following 1 nucleotide mutation: the 691th nucleotide is changed from G to A. The E231K gene encodes the E231K protein. Compared with the FXPK protein, the E231K protein has the following one amino acid residue mutation: the 231st amino acid residue is changed from E to K. The fusion gene in the recombinant plasmid expresses E231K-His ₆ protein. The E231K-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: E231K protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-H260Y. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-H260Y only differs in that the H260Y gene with the stop codon removed replaces the fxpk gene with the stop codon removed. The fusion gene in the recombinant plasmid expresses H260Y-His ₆ protein. The H260Y-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: H260Y protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-E342K. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-E342K only differs in that the E342K gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the E342K gene has the following 1 nucleotide mutation: the 1024th nucleotide is changed from G to A. The E342K gene encodes the E342K protein. Compared with the FXPK protein, the E342K protein has the following one amino acid residue mutation: the 342th amino acid residue is changed from E to K. The fusion gene in the recombinant plasmid expresses E342K-His ₆ protein. The E342K-His ₆ protein is composed of the following elements in sequence from N-terminal to C-terminal: E342K protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-K397R. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-K397R is only that the K397R gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the K397R gene has the following 1 nucleotide mutation: the 1190th nucleotide is changed from A to G. The K397R gene encodes the K397R protein. Compared with the FXPK protein, the K397R protein has the following one amino acid residue mutation: the 397th amino acid residue is changed from K to R. The fusion gene in the recombinant plasmid expresses K397R-His ₆ protein. The K397R-His ₆ protein is composed of the following elements in sequence from N-terminal to C-terminal: K397R protein, LE (XhoI digestion recognition sequence encoding), His ₆ tag.

Recombinant plasmid pET-D676G. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-D676G is only that the D676G gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the D676G gene has the following 1 nucleotide mutation: the 2027th nucleotide is changed from A to G. The D676G gene encodes the D676G protein. Compared with the FXPK protein, the D676G protein has the following one amino acid residue mutation: the 676th amino acid residue is changed from D to G. The fusion gene in the recombinant plasmid expresses D676G-His ₆ protein. The D676G-His ₆ protein is composed of the following elements in sequence from N-terminal to C-terminal: D676G protein, LE (XhoI restriction recognition sequence encoding), His ₆ tag.

Recombinant plasmid pET-F785L. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-F785L is only that the F785L gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the F785L gene has the following 1 nucleotide mutation: the 2353th nucleotide is changed from T to C. The F785L gene encodes the F785L protein. Compared with the FXPK protein, the F785L protein has the following one amino acid residue mutation: the 785th amino acid residue is changed from F to L. The fusion gene in the recombinant plasmid expresses F785L-His ₆ protein. The F785L-His ₆ protein is composed of the following elements in sequence from the N-terminal to the C-terminal: F785L protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-W801R. Compared with the recombinant plasmid pET-fxpk, the difference of the recombinant plasmid pET-W801R is only that the W801R gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the W801R gene has the following 1 nucleotide mutation: the 2401th nucleotide is changed from T to C. The W801R gene encodes the W801R protein. Compared with the FXPK protein, the W801R protein has the following one amino acid residue mutation: the 801th amino acid residue is changed from W to R. The fusion gene in the recombinant plasmid expresses W801R-His ₆ protein. The W801R-His ₆ protein is composed of the following elements from the N-terminus to the C-terminus: W801R protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-T2A/I6T. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-T2A/I6T differs only in that the fxpk gene is replaced by the T2A/I6T gene. The fusion gene in the recombinant plasmid expresses T2A/I6T-His ₆ protein. The T2A/I6T-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: T2A/I6T protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-T2A/H260Y. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-T2A/H260Y differs only in that the T2A/H260Y gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the T2A/H260Y gene has the following 2 nucleotide mutations: the 4th nucleotide is changed from A to G, and the 778th nucleotide is changed from C to T. The T2A/H260Y gene encodes the T2A/H260Y protein. Compared with the FXPK protein, the T2A/H260Y protein has the following two amino acid residue mutations: the second amino acid residue is changed from T to A, and the 260th amino acid residue is changed from H to Y. The fusion gene in the recombinant plasmid expresses T2A/H260Y-His ₆ protein. The T2A/H260Y-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: T2A/H260Y protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-I6T/H260Y. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-I6T/H260Y differs only in that the I6T/H260Y gene with the stop codon removed replaces the fxpk gene with the stop codon removed. Compared with the fxpk gene, the I6T/H260Y gene has the following 2 nucleotide mutations: the 17th nucleotide is changed from T to C, and the 778th nucleotide is changed from C to T. The I6T/H260Y gene encodes the I6T/H260Y protein. Compared with the FXPK protein, the I6T/H260Y protein has the following two amino acid residue mutations: the 6th amino acid residue is changed from I to T, and the 260th amino acid residue is changed from H to Y. The fusion gene in the recombinant plasmid expresses I6T/H260Y-His ₆ protein. The I6T/H260Y-His ₆ protein is composed of the following elements in sequence from the N-terminus to the C-terminus: I6T/H260Y protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Recombinant plasmid pET-T2A/I6T/H260Y. Compared with the recombinant plasmid pET-fxpk, the recombinant plasmid pET-T2A/I6T/H260Y differs only in that the fxpk gene is replaced by the T2A/I6T/H260Y gene. The fusion gene in the recombinant plasmid expresses T2A/I6T/H260Y-His ₆ protein. The T2A/I6T/H260Y-His ₆ protein is composed of the following elements from the N-terminus to the C-terminus: T2A/I6T/H260Y protein, LE (XhoI restriction recognition sequence encoding), and His ₆ tag.

Example 5. Preparation of various proteins and determination of their enzyme activity as phosphoketolase

The recombinant plasmid was introduced into E. coli BL21 (DE3) to obtain a recombinant bacteria. Use liquid LB medium to cultivate the recombinant bacteria, shake culture at 37℃, 200rpm to OD _600nm = 0.6-0.8, then add IPTG and make the concentration in the system 0.4mM, then culture with shaking at 20℃, 200rpm for 18 hours, then 4 Centrifuge at 7000g for 5min to collect the bacteria. Wash the cells, then ultrasonically break them, and then collect the supernatant, use His SpinTrap columns (purchased from GE, product number 28-4013-53) to purify the protein with His ₆ tag, and then replace the protein buffer system to pH7 .2 PBS buffer.

The recombinant plasmid pET-fxpk was prepared by the above steps to obtain FXPK-His ₆ protein. The recombinant plasmid pET-M21 was prepared by the above steps to obtain M21-His ₆ protein. The recombinant plasmid pET-M41 was prepared by the above steps to obtain M41-His ₆ protein. The recombinant plasmid pET-M71 was prepared by the above steps to obtain M71-His ₆ protein. The recombinant plasmid pET-M81 was prepared by the above steps to obtain M81-His ₆ protein. The recombinant plasmid pET-M82 was prepared by the above steps to obtain M82-His ₆ protein. The recombinant plasmid pET-T2A was prepared by the above steps to obtain T2A-His ₆ protein. The recombinant plasmid pET-I6T was prepared by the above steps to obtain I6T-His ₆ protein. The recombinant plasmid pET-N14D was prepared by the above steps to obtain N14D-His ₆ protein. The recombinant plasmid pET-E20D was prepared by the above steps to obtain E20D-His ₆ protein. The recombinant plasmid pET-T120A was prepared by the above steps to obtain the T120A-His ₆ protein. The recombinant plasmid pET-E231K was prepared by the above steps to obtain E231K-His ₆ protein. The recombinant plasmid pET-H260Y was prepared by the above steps to obtain H260Y-His ₆ protein. The recombinant plasmid pET-E342K was prepared by the above steps to obtain E342K-His ₆ protein. The recombinant plasmid pET-K397R was prepared by the above steps to obtain K397R-His ₆ protein. The recombinant plasmid pET-D676G was prepared by the above steps to obtain D676G-His ₆ protein. The recombinant plasmid pET-F785L was prepared by the above steps to obtain F785L-His ₆ protein. The recombinant plasmid pET-W801R was prepared by the above steps to obtain W801R-His ₆ protein. The recombinant plasmid pET-T2A/I6T/I6T was prepared by the above steps to obtain T2A/I6T-His ₆ protein. The recombinant plasmid pET-T2A/H260Y was prepared by the above steps to obtain T2A/H260Y-His ₆ protein. The recombinant plasmid pET-I6T/H260Y is prepared by the above steps to obtain I6T/H260Y-His ₆ protein. The recombinant plasmid pET-T2A/I6T/H260Y/I6T/H260Y was prepared by the above steps to obtain the T2A/I6T/H260Y-His ₆ protein.

Use ThermoFisher's BCA protein quantification kit for protein quantification.

The reactivity of each of the His _6- tagged proteins prepared above to fructose 6-phosphate was measured respectively. Reaction principle: The substrate 6-phosphate fructose is catalyzed by the test protein to generate acetyl phosphate, acetyl phosphate and hydroxylamine generate hydroxamic acid, and hydroxamic acid reacts with ferric chloride to generate a red compound, which can be detected at 505 nm. Reaction system: 49μl phosphate buffer (pH6.5, 100mM), 1μl 10mM thiamine pyrophosphate aqueous solution, 0.1μl 100mM MgCl ₂ aqueous solution, 0.1μl 0.7M cysteine hydrochloride aqueous solution, 30μl 100mM fructose-6 -Phosphoric acid aqueous solution, 20μl test protein solution. Put the reaction system in a 30℃ water bath for 10 minutes; then add 80μl of 2mol/L hydroxylamine aqueous solution, mix well and let stand at room temperature for 10 minutes; then add 55μl of 15g/100ml trichloroacetic acid aqueous solution, 55μl of 4mol/L hydrochloric acid aqueous solution, 55 μl of 5g/100ml FeCl ₃ ·6H ₂ O aqueous solution, then stand at room temperature to react for 1 minute; then sample 200 μl to detect the absorbance at _{505 nm} (OD _{505 nm} value). An enzyme activity unit (U) is defined as the enzyme required for every 1 μmol of acetyl phosphate produced within 1 minute of reaction time.

The enzyme activity (U) is divided by the amount of protein (mg) to obtain the specific enzyme activity (U/mg).

The specific enzyme activity of each of the His _6- tagged proteins prepared above as phosphoketolase is shown in Figure 3. In Figure 3, FXPK represents FXPK-His ₆ protein, M21 represents M21-His ₆ protein, M41 represents M41-His ₆ protein, and so on. The enzyme activity of each mutant protein as a phosphoketolase is higher than that of wild-type FXPK protein, and the enzyme activity of T2A/I6T protein and T2A/I6T/H260Y protein is the highest.

Example 6. Comparison of glutamate-producing ability of recombinant bacteria expressing various proteins

The recombinant plasmids were respectively introduced into Corynebacterium glutamicum Z188 to obtain each recombinant bacteria. The recombinant plasmids are as follows: recombinant plasmid pTR-fxpk, recombinant plasmid pTR-M21, recombinant plasmid pTR-M41, recombinant plasmid pTR-M71, recombinant plasmid pTR-M81, recombinant plasmid pTR-M82, recombinant plasmid pTR-T2A, recombinant plasmid pTR-I6T, recombinant plasmid pTR-H260Y, recombinant plasmid pTR-T2A/I6T, recombinant plasmid pTR-T2A/I6T/H260Y.

The ability of the tested strains to produce glutamic acid by fermentation was tested. The tested strains were as follows: Corynebacterium glutamicum Z188 and each recombinant strain prepared above.

Seed culture medium: glucose 50g/L, phosphoric acid 0.7g/L, magnesium sulfate heptahydrate 0.8g/L, ammonium sulfate 10g/L, 3-(N-Malindi) propanesulfonic acid 84g/L, corn flour 3g/ L, urea 10g/L, peptone 1g/L, yeast powder 0.5g/L, the balance is water, and the pH is adjusted to 7.0 with sodium hydroxide. The difference between fermentation medium and seed medium is that peptone and yeast powder are not added.

Take a single clone of the tested strain, inoculate it into 5ml of seed culture medium, and cultivate with shaking at 30°C and 850rpm for 12 hours to obtain seed liquid. Take a 96-well plate, add 150μl of fermentation medium to each well, and then inoculate the seed solution with 10% of the inoculum, then cultivate with shaking at 30°C and 850rpm for 33 hours, and then use the SBA-40D biosensor analyzer to detect glutamate production ( Calculate the conversion rate from glucose to glutamate per liter of glutamate content in the system) and glucose consumption.

The results are shown in Figure 4. It can be seen that compared with the wild-type FXPK protein, the tested FXPK mutant proteins can increase the production and conversion rate of glutamate.

Example 7. The influence of each protein on the production of succinic acid by E. coli fermentation

Using the recombinant plasmids constructed in step 1 of Example 4 and the recombinant plasmid pTR-fxpk, the Escherichia coli succinic acid producing strain (CGMCC No. 5107, CGMCC No. 5108 or CGMCC No. 5109, Chinese Patent ZL201110264353.9) was transformed, To obtain succinate producing strains carrying wild-type fxpk genes and different fxpk mutant genes. The ability of the strain to produce succinic acid was tested using the fermentation conditions for succinic acid production described in Chinese patent ZL201110264353.9. Compared with wild-type FXPK, the protease activity of each FXPK mutant was significantly improved. Compared with the parallel strains carrying wild-type fxpk genes, the strains carrying various fxpk mutant genes have significantly improved succinic acid production capacity and sugar-acid conversion rate.

Example 8. The influence of each protein on the fermentation production of glutamine by Corynebacterium glutamicum

Based on the glutamate-producing strain Z188, according to the literature report, the Y405F mutation of its glutamine synthetase can produce glutamine (Liu, Q., et al. 2008. Appl Microbiol Biotechnol77(6):1297 -1304.). The recombinant plasmids constructed in step 1 of Example 4 and the recombinant plasmid pTR-fxpk were used to transform into the constructed glutamine-producing strain, using the literature (Liu, Q., et al. 2008. Appl Microbiol Biotechnol 77(6) ): 1297-1304.) The glutamine fermentation conditions described above test the ability of the strain to produce glutamine. Compared with wild-type FXPK, the protease activity of each FXPK mutant was significantly improved. Compared with the parallel strains carrying wild-type fxpk genes, the strains carrying various fxpk mutant genes have significantly improved glutamine production capacity and sugar acid conversion rate.

Example 9. The influence of each protein on the production of proline by E. coli fermentation

Escherichia coli proline production strain DH5α (pSW2) is an Escherichia coli DH5α carrying plasmid pSW2, in which plasmid pSW2 is mutated from the glutamate kinase proB74 [proB (NCBI-GI: 16128228) Asp 107 to Asn] gene And the gene of glutamate semialdehyde dehydrogenase proA (NCBI-GI: 16128229) was ligated to plasmid puc19 and constructed (Example 5 in Chinese Patent 2014107400221).

The recombinant plasmids constructed in step 1 of Example 4 and the recombinant plasmid pTR-fxpk were used to transform E. coli proline producing strain DH5α (pSW2). The fermentation conditions described in Example 5 of Chinese Patent No. 2014107400221 were used to test the ability of the strain to produce proline. Compared with wild-type FXPK, the protease activity of each FXPK mutant was significantly improved. Compared with the parallel strain carrying the wild-type fxpk gene, the strain carrying each fxpk mutant gene has a significantly improved proline production ability and a significantly higher sugar-acid conversion rate.

Example 10: The influence of each protein on the fermentation production of trans-4-hydroxy-L-proline by E. coli

Escherichia coli trans-4-hydroxy-L-proline production strain DH5α (pSW3) is an Escherichia coli DH5α carrying plasmid pSW3, in which plasmid pSW3 is further connected to L-proline on the basis of plasmid pSW2 in the patent- It is constructed by 4-hydroxylase (Chinese Patent 2014107400221).

The recombinant plasmids constructed in step one of Example 4 and the recombinant plasmid pTR-fxpk were used to transform E. coli trans-4-hydroxy-L-proline producing strain DH5α (pSW3). The fermentation conditions described in Example 5 of Chinese Patent No. 2014107400221 were used to test the ability of the strain to produce trans-4-hydroxy-L-proline. Compared with wild-type FXPK, the protease activity of each FXPK mutant was significantly improved. Compared with the parallel strain carrying the wild-type fxpk gene, the strain carrying each fxpk mutant gene has a significantly improved ability to produce trans-4-hydroxy-L-proline and a sugar-acid conversion rate.

Example 11. The influence of various proteins on the fermentation of Aspergillus niger to produce citric acid

Using the recombinant plasmid pTR-fxpk as a template, a primer pair consisting of Fxpk-Fm (Fxpk-Fm:att ctcgag ATGACCTCTCCGGTTATCG) and Fxpk-Rm (Fxpk-Rm: aat gcatgc TCATTCGTTGTCACCCG) was used to amplify wild-type fxpk genes, respectively. Add XhoI and SphI restriction sites at the 5'end and 3'end. Then the gene was inserted into the Aspergillus niger expression plasmid pSilent-1 (Genbank ID: AB303070) by XhoI and SphI double enzyme digestion, and the Aspergillus niger expression plasmid pSil-fxpk with the fxpk gene with PtrpC as the promoter and TtrpC as the terminator was obtained.

For each recombinant plasmid constructed in Step 1 of Example 4, referring to the above method, an Aspergillus niger expression plasmid of the mutant gene was prepared.

The plasmids were transformed into the protoplasts of Aspergillus niger Co827 (CICC 40347). The fermentation conditions described in the examples of Chinese patent 201710022533.3 were used to test the ability of recombinant Aspergillus niger to produce citric acid. Compared with wild-type FXPK, the protease activity of each FXPK mutant was significantly improved. Compared with the parallel strain carrying the wild-type fxpk gene, the strain carrying each fxpk mutant gene has a significantly improved ability to produce citric acid, and the sugar-acid conversion rate has been significantly improved.

Industrial application

The present invention has the following effects: In the present invention, the inventor knocks out the 6-phosphofructokinase (PFK) gene of the amino acid producing strain, and couples the activity of exogenous phosphoketolase with the growth rate of the strain, thereby improving Based on wild-type FXPK protein, mutant proteins with increased enzyme activity and multiple mutation sites that can increase the enzyme activity of existing phosphoketolase were discovered through growth enrichment. Compared with the existing phosphoketolase, the phosphoketolase activity of the mutant protein provided by the present invention is significantly increased. Using the mutation sites provided by the present invention to perform single-point or multiple-point mutations on the existing phosphoketolase can significantly improve its phosphoketolase activity. The present invention provides a solution, which can achieve higher phosphoketolase activity, thereby significantly increasing the yield of target metabolites.

Claims (10)

1. Mutant protein is a protein obtained by subjecting phosphoketolase to any one or more of the following mutations (a1) to (a12):

   (a1) The amino acid residue at position 2 corresponding to sequence 3 is mutated from T to A;

   (a2) The amino acid residue at position 6 corresponding to sequence 3 is mutated from I to T;

   (a3) The amino acid residue at position 14 corresponding to sequence 3 is mutated from N to D;

   (a4) The 20th amino acid residue corresponding to sequence 3 is mutated from E to D;

   (a5) The amino acid residue at position 120 corresponding to sequence 3 is mutated from T to A;

   (a6) The amino acid residue at position 231 corresponding to sequence 3 was mutated from E to K;

   (a7) The amino acid residue at position 260 corresponding to sequence 3 is mutated from H to Y;

   (a8) The amino acid residue at position 342 corresponding to sequence 3 was mutated from E to K;

   (a9) The amino acid residue at position 397 corresponding to sequence 3 is mutated from K to R;

   (a10) The amino acid residue at position 676 corresponding to sequence 3 is mutated from D to G;

   (a11) The amino acid residue at position 785 corresponding to sequence 3 was mutated from F to L;

   (a12) The amino acid residue at position 801 corresponding to Sequence 3 was mutated from W to R.
2. A fusion protein having the mutant protein of claim 1.
3. The polynucleotide encoding the mutant protein of claim 1 or the polynucleotide encoding the fusion protein of claim 2.
4. An expression cassette, a recombinant vector, a recombinant microorganism or an isolated recombinant cell having the polynucleotide of claim 3.
5. The application of specific substances in the preparation of metabolites;

   The specific substance is: the mutant protein of claim 1, or, the fusion protein of claim 2, or, the polynucleotide of claim 3, or, the expression cassette of claim 4, Or, the recombinant vector of claim 4, or, the recombinant microorganism of claim 4, or, the isolated recombinant cell of claim 4.
6. A method for improving the enzymatic activity of phosphoketolase includes the following steps:

   The phosphoketolase is subjected to any one or more of the following mutations (a1) to (a12):

   (a1) The amino acid residue at position 2 corresponding to sequence 3 is mutated from T to A;

   (a2) The amino acid residue at position 6 corresponding to sequence 3 is mutated from I to T;

   (a3) The amino acid residue at position 14 corresponding to sequence 3 is mutated from N to D;

   (a4) The 20th amino acid residue corresponding to sequence 3 is mutated from E to D;

   (a5) The amino acid residue at position 120 corresponding to sequence 3 is mutated from T to A;

   (a6) The amino acid residue at position 231 corresponding to sequence 3 was mutated from E to K;

   (a7) The amino acid residue at position 260 corresponding to sequence 3 is mutated from H to Y;

   (a8) The amino acid residue at position 342 corresponding to sequence 3 was mutated from E to K;

   (a9) The amino acid residue at position 397 corresponding to sequence 3 is mutated from K to R;

   (a10) The amino acid residue at position 676 corresponding to sequence 3 is mutated from D to G;

   (a11) The amino acid residue at position 785 corresponding to sequence 3 was mutated from F to L;

   (a12) The amino acid residue at position 801 corresponding to Sequence 3 was mutated from W to R.
7. A method for preparing metabolites, comprising the following steps: preparing metabolites by culturing the recombinant microorganism according to claim 4.
8. The method according to claim 7, characterized in that: the method further comprises the step of separating and purifying the metabolites from the culture system.
9. A method for obtaining a protein with increased phosphoketolase activity includes the following steps:

   (1) Perform sequence alignment of an existing protein with a reference protein; the existing protein is an existing protein with phosphoketolase activity; the reference protein is the protein shown in sequence 3 of the sequence list;

   (2) According to the comparison result, the specific mutation in the reference protein corresponds to the existing protein, and then the existing protein is mutated to obtain a new protein with a higher phosphoketolase activity than the existing protein;

   The specific mutation is any one or more of the following (a1) to (a12):

   (a1) The amino acid residue at position 2 corresponding to sequence 3 is mutated from T to A;

   (a2) The amino acid residue at position 6 corresponding to sequence 3 is mutated from I to T;

   (a3) The amino acid residue at position 14 corresponding to sequence 3 is mutated from N to D;

   (a4) The 20th amino acid residue corresponding to sequence 3 is mutated from E to D;

   (a5) The amino acid residue at position 120 corresponding to sequence 3 is mutated from T to A;

   (a6) The amino acid residue at position 231 corresponding to sequence 3 was mutated from E to K;

   (a7) The amino acid residue at position 260 corresponding to sequence 3 is mutated from H to Y;

   (a8) The amino acid residue at position 342 corresponding to sequence 3 was mutated from E to K;

   (a9) The amino acid residue at position 397 corresponding to sequence 3 is mutated from K to R;

   (a10) The amino acid residue at position 676 corresponding to sequence 3 is mutated from D to G;

   (a11) The amino acid residue at position 785 corresponding to sequence 3 was mutated from F to L;

   (a12) The amino acid residue at position 801 corresponding to Sequence 3 was mutated from W to R.
10. 9. The method according to claim 9, characterized in that: the method further comprises the step of detecting the phosphoketolase activity of the new protein and the existing protein, thereby selecting the protein with increased enzyme activity.

Images