CN111334486A

CN111334486A - Phosphoketolase with improved activity and use thereof for producing metabolites

Info

Publication number: CN111334486A
Application number: CN202010186127.2A
Authority: CN
Inventors: 孙际宾; 李庆刚; 郑平; 周文娟; 张晓立; 德莱奥西班乔·泰沃; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2019-04-30
Filing date: 2019-04-30
Publication date: 2020-06-26
Anticipated expiration: 2039-04-30
Also published as: CN111411093A; CN110218710B; CN110218710A; CN111411093B; CN111334486B; WO2020220432A1

Abstract

The invention discloses phosphoketolase with improved activity and application thereof in producing metabolites. The protein provided by the invention is a mutant protein, and is obtained by mutating phosphoketolase as follows: the 6 th amino acid residue corresponding to the sequence 3 is mutated from I to T. The invention also protects the application of the mutant protein in preparing metabolites. Compared with the existing phosphoketolase, the phosphoketolase enzyme activity of the mutant protein provided by the invention is obviously increased, so that the yield of target metabolites is obviously improved.

Description

Phosphoketolase with improved activity and use thereof for producing metabolites

The application is a divisional application with the application number of ' 201910359888.0 ', the application date of ' 2019, 04 and 30 months, and the invention name of ' phosphoketolase with improved activity and application in metabolite production '.

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to phosphoketolase with improved activity and application of the phosphoketolase in producing metabolites, wherein the metabolites comprise but are not limited to amino acids (particularly amino acids derived from acetyl coenzyme A), succinic acid, citric acid and the like.

Background

Amino acids and organic acids are the most important components in human and animal nutrition, and have a very important position in the industries of medicine, health, food, chemical industry, animal feed, cosmetics and the like. Currently, amino acids and organic acids are mainly produced by microbial fermentation, and known amino acid-producing microorganisms include Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium), and the like. In recent years, with the development of genetic engineering technology, genetic engineering means are utilized to genetically modify strains, and a large number of efficient amino acid and organic acid production engineering strains are obtained.

Phosphoketolases (F/XPK), including fructose-6-phosphate transketolase (FPK) and xylulose-5-phosphate transketolase (XPK). The reaction catalyzed by fructose-6-phosphate transketolase is: fructose-6-phosphate (F6p) + Pi → acetyl phosphate (AcP) + erythrose-4-phosphate (E4P). The reaction catalyzed by xylulose 5-phosphate transketolase is: xylulose-5-phosphate (X5p) + pi → acetyl phosphate (AcP) + glyceraldehyde-3-phosphate (G3P). The phosphoketolase catalyzed reaction can reduce the oxidation of glucose, but many of the commonly used genetic engineering starting strains (including Escherichia coli, Corynebacterium glutamicum and the like) do not have F/XPK, and the introduction of F/XPK into these strains can increase the theoretical conversion rate of the metabolites derived from acetyl-CoA. The natural F/XPK enzyme activity is low, and a large amount of overexpression is needed to show the effect, so that the application potential is limited. Therefore, there is an urgent need in the art to develop phosphoketolase having high enzymatic activity.

Disclosure of Invention

The invention aims to provide phosphoketolase with improved activity and application thereof in producing metabolites.

The protein provided by the invention is a mutant protein, and is obtained by performing any one or more of the following mutations (a1) to (a12) on phosphoketolase:

(a1) the 2 nd amino acid residue corresponding to the sequence 3 is mutated from T to A;

(a2) the 6 th amino acid residue corresponding to the sequence 3 is mutated from I to T;

(a3) the 14 th amino acid residue corresponding to the sequence 3 is mutated from N to D;

(a4) the 20 th amino acid residue corresponding to the sequence 3 is mutated from E to D;

(a5) the 120 th amino acid residue corresponding to the sequence 3 is mutated from T to A;

(a6) the 231 th amino acid residue corresponding to the sequence 3 is mutated from E to K;

(a7) the 260 th amino acid residue corresponding to the sequence 3 is mutated from H to Y;

(a8) the 342 nd amino acid residue corresponding to the sequence 3 is mutated from E to K;

(a9) the amino acid residue 397 corresponding to the sequence 3 is mutated from K to R;

(a10) the amino acid residue 676 corresponding to the sequence 3 is mutated from D to G;

(a11) the 785 amino acid residue corresponding to the sequence 3 is mutated from F to L;

(a12) the 801 th amino acid residue corresponding to the sequence 3 is mutated from W to R.

The plurality of mutations may be specifically any two of the above mutations, any three of the above mutations, any four of the above mutations, any five of the above mutations, any six of the above mutations, any seven of the above mutations, any eight of the above mutations, any nine of the above mutations, any ten of the above mutations, any eleven of the above mutations, or all of the above mutations.

The mutant protein provided by the invention can be specifically a protein obtained by carrying out two mutations of (a1) and (a2) on phosphoketolase.

The mutant protein provided by the invention can be specifically a protein obtained by carrying out specific mutation and non-specific mutation on phosphoketolase. The specific mutation is (a1) or (a 2). The non-specific mutation is any one or any combination of the following mutations: (a3) (a4), (a5), (a6), (a7), (a8), (a9), (a10), (a11), and (a 12).

The mutant protein provided by the invention can be specifically protein obtained by carrying out three mutations of (a1), (a2) and (a7) on phosphoketolase.

The mutant protein provided by the invention can be specifically a protein obtained by carrying out specific mutation and non-specific mutation on phosphoketolase. The specific mutation is three mutations of (a1), (a2) and (a 7). The non-specific mutation is any one or any combination of the following mutations: (a3) (a4), (a5), (a6), (a8), (a9), (a10), (a11) and (a 12).

The (a1) may specifically be (b 1). The (a2) may specifically be (b 2). The (a3) may specifically be (b 3). The (a4) may specifically be (b 4). The (a5) may specifically be (b 5). The (a6) may specifically be (b 6). The (a7) may specifically be (b 7). The (a8) may specifically be (b 8). The (a9) may specifically be (b 9). The (a10) may specifically be (b 10). The (a11) may specifically be (b 11). The (a12) may specifically be (b 12).

(b1) The 2 nd amino acid residue is mutated from T to A.

(b2) The 6 th amino acid residue is mutated from I to T.

(b3) The 14 th amino acid residue is mutated from N to D.

(b4) The 20 th amino acid residue is mutated from E to D.

(b5) The 120 th amino acid residue is mutated from T to A.

(b6) The 231 th amino acid residue is mutated from E to K.

(b7) The 260 th amino acid residue is mutated from H to Y.

(b8) The 342 nd amino acid residue is mutated from E to K.

(b9) The amino acid residue 397 is mutated from K to R.

(b10) The 676 th amino acid residue is mutated from D to G.

(b11) The 785 amino acid residue was mutated from F to L.

(b12) The 801 th amino acid residue is mutated from W to R.

The phosphoketolase can be specifically a protein shown in a sequence 3 in a sequence table.

The phosphoketolase may also be a protein or polypeptide having 90%, preferably 95%, more preferably 98%, most preferably 99% homology to the protein shown in sequence 3 of the sequence listing.

Illustratively, the mutant protein may be M21 protein, M41 protein, M71 protein, M81 protein, M82 protein, T2A protein, I6T protein, N14D protein, E20D protein, T120A protein, E231K protein, H260Y protein, E342K protein, K397R protein, D676G protein, F785L protein, W801R protein, T2A/I6T protein, T2A/H260Y protein, I6T/H260Y protein or T2A/I6T/H260Y protein in the examples.

Polynucleotides (e.g., genes, designated mutant genes) encoding any of the above-described mutant proteins are also within the scope of the invention.

Illustratively, the mutant gene may specifically be a DNA molecule obtained by mutating a coding cassette of a phosphoketolase gene by any one or more of the following (c1) to (c 12):

(c1) the 4 th nucleotide is mutated from A to G;

(c2) the 17 th nucleotide is mutated from T to C;

(c3) the 40 th nucleotide is mutated from A to G;

(c4) the 60 th nucleotide is mutated from A to T;

(c5) the 358 th nucleotide is mutated from A to G;

(c6) the 691 bit nucleotide is mutated from G to A;

(c7) 778 th nucleotide is formed by C mutation T;

(c8) the 1024 th nucleotide is mutated from G to A;

(c9) the 1190 th nucleotide is mutated from A to G;

(c10) the 2027 th nucleotide is mutated from A to G;

(c11) the 2353 th nucleotide is mutated from T to C;

(c12) the 2401 th nucleotide is mutated from T to C.

The mutant gene provided by the invention can be a DNA molecule obtained by carrying out two mutations of (c1) and (c2) on the coding frame of the phosphoketolase gene.

The mutant gene provided by the invention can be a DNA molecule obtained by specifically mutating and non-specifically mutating a coding frame of a phosphoketolase gene. The specific mutation is (c1) and (c 2). The non-specific mutation is any one or any combination of the following mutations: (c3) (c4), (c5), (c6), (c7), (c8), (c9), (c10), (c11) and (c 12).

The mutant protein provided by the invention can be a DNA molecule obtained by carrying out three mutations of (c1), (c2) and (c7) on a coding frame of a phosphoketolase gene.

The mutant protein provided by the invention can be specifically a DNA molecule obtained by carrying out specific mutation and non-specific mutation on a coding frame of a phosphoketolase gene. The specific mutation is three mutations of (c1), (c2) and (c 7). The non-specific mutation is any one or any combination of the following mutations: (c3) (c4), (c5), (c6), (c8), (c9), (c10), (c11) and (c 12).

The coding frame of the phosphoketolase gene can be specifically shown as a sequence 4 in a sequence table.

Expression cassettes, recombinant vectors, recombinant isolated cells or recombinant microorganisms having any of the above polynucleotides are within the scope of the present invention.

Fusion proteins having any of the above described mutant proteins are also within the scope of the present invention.

The fusion protein may be a protein obtained by fusing the mutant protein with a protein tag. The protein tag can be located at the N-terminus of the mutant protein or at the C-terminus of the mutant protein. The mutant protein and the protein tag can also have spacer amino acid residues, and particularly can have less than 10 spacer amino acid residues.

Exemplary labels are specifically shown in table 1.

TABLE 1 sequences of tags

The fusion protein sequentially comprises the following components from N end to C end: mutant proteins, spacer sequences, protein tags. The protein tag can be His₆And (4) a label. The spacer sequence may in particular consist of less than 10 amino acid residues. The spacer sequence may specifically be "LE".

Illustratively, the fusion protein may be FXPK-His in the examples₆Protein, M21-His₆Protein, M41-His₆Protein, M71-His₆Protein, M81-His₆Protein, M82-His₆Protein, T2A-His₆Protein, I6T-His₆Protein, N14D-His₆Protein, E20D-His₆Protein, T120A-His₆Protein, E231K-His₆Protein, H260Y-His₆Protein, E342K-His₆Protein, K397R-His₆Protein, D676G-His₆Protein, F785L-His₆Protein, W801R-His₆Protein, T2A/I6T-His₆Protein, T2A/H260Y-His₆Protein, I6T/H260Y-His₆Protein or T2A/I6T/H260Y-His₆A protein.

Polynucleotides (e.g., genes) encoding the fusion proteins are also within the scope of the invention.

Expression cassettes, recombinant vectors, recombinant isolated cells or recombinant microorganisms having polynucleotides encoding the fusion proteins are within the scope of the invention.

Exemplary, any of the above recombinant vectors may be specifically the recombinant plasmids pTR-fxpk, pTR1-fxpk, pTR-M21, pTR-M41, pTR-M71, pTR-M81, pTR-M82, pTR-T2A, pTR-I6T, pTR-H260Y, pTR-T2A/I6T, pTR-T2A/I6T/H260Y, pET-fxpk, recombinant plasmid T-M21, recombinant pET-M41, recombinant pET-M71, recombinant plasmid pET-M81, recombinant plasmid pET-M82, recombinant pET-T2A, recombinant pET-M6, recombinant pET-M41, recombinant plasmid pET-M69514, recombinant plasmid N8653, recombinant plasmid pTR-M8427, recombinant plasmid pTR-M A, recombinant plasmid pTR-T2A, recombinant plasmid pTR-T-M T, recombinant plasmid pTR-I6, recombinant plasmid pTR-M82, recombinant plasmid pTT-M A, recombinant plasmid pTR-M21, recombinant plasmid pTT-M6, recombinant plasmid-M58, Recombinant plasmid pET-E231K, recombinant plasmid pET-H260Y, recombinant plasmid pET-E342K, recombinant plasmid pET-K397R, recombinant plasmid pET-D676G, recombinant plasmid pET-F785L, recombinant plasmid pET-W801R, recombinant plasmid pET-T2A/I6T, recombinant plasmid pET-T2A/H260Y, recombinant plasmid pET-I6T/H260Y, recombinant plasmid pET-T2A/I6T/H260Y or plasmid pSil-fxpk.

The recombinant microorganism may be a recombinant microorganism obtained by introducing any of the above recombinant vectors into a host microorganism.

Illustratively, any of the above recombinant microorganisms may be specifically the strain Z188 △ pfk (pTR-fxpk) or the strain Z188 △ pfk (pTR1-fxpk) in the examples, and each of the recombinant bacteria obtained in examples 5 to 11.

The host microorganism may be an amino acid-producing strain or an organic acid-producing strain.

Such host microorganisms include, but are not limited to, Corynebacterium glutamicum, Escherichia coli, or Aspergillus niger, among others.

Illustratively, the host microorganism may be Corynebacterium glutamicum Z188, strain Z188 △ pfk, Escherichia coli BL21(DE3), Escherichia coli succinic acid-producing strain (e.g., CGMCC No.5107, CGMCC No.5108, CGMCC No.5109, or the like), glutamine-producing strain (e.g., glutamine-producing strain in example 8), Escherichia coli proline-producing strain (e.g., DH5 α (pSW2)), Escherichia coli trans-4-hydroxy-L-proline-producing strain (e.g., DH5 α (pSW3)), Aspergillus niger (e.g., Co827(CICC 40347)).

The invention also protects the application of the specific substance in preparing the metabolite; the specific substances are: any of the above mutant proteins, any of the above fusion proteins, any of the above mutant genes, any of the above genes encoding the fusion proteins, any of the above expression cassettes, any of the above recombinant vectors, any of the above recombinant isolated cells, or any of the above recombinant microorganisms. The metabolite may specifically be an amino acid. Illustratively, the amino acid may specifically be an amino acid derived from acetyl-coa. Exemplary, such amino acids include, but are not limited to, glutamic acid, glutamine, proline, trans-4-hydroxy-L-proline, and the like. The metabolite may specifically be an organic acid. Illustratively, the organic acid includes, but is not limited to, succinic acid, citric acid, and the like.

The invention also provides a method for improving the enzymatic activity of phosphoketolase, which comprises the following steps: subjecting phosphoketolase to any one or more of the following mutations (a1) to (a 12): (a1) (a12) the same as above.

In the method, specifically, both of the mutations (a1) and (a2) can be carried out.

In the method, specific mutation and non-specific mutation may be specifically performed. The specific mutation is (a1) or (a 2). The non-specific mutation is any one or any combination of the following mutations: (a3) (a4), (a5), (a6), (a7), (a8), (a9), (a10), (a11), and (a 12).

In the method, specifically, three kinds of mutations (a1), (a2) and (a7) can be carried out.

In the method, specific mutation and non-specific mutation may be specifically performed. The specific mutation is three mutations of (a1), (a2) and (a 7). The non-specific mutation is any one or any combination of the following mutations: (a3) (a4), (a5), (a6), (a8), (a9), (a10), (a11) and (a 12).

The invention also provides a method for preparing the metabolite, which comprises the following steps: producing a metabolite by culturing a recombinant microorganism as described in any of the above. The method further comprises the step of separating and purifying the metabolite from the culture system. The metabolite may specifically be an amino acid. Illustratively, the amino acid may specifically be an amino acid derived from acetyl-coa. Exemplary, such amino acids include, but are not limited to, glutamic acid, glutamine, proline, trans-4-hydroxy-L-proline, and the like. The metabolite may specifically be an organic acid. Illustratively, the organic acid includes, but is not limited to, succinic acid, citric acid, and the like.

The invention also provides a method for obtaining the protein with the increased phosphoketolase enzyme activity, which comprises the following steps:

(1) performing sequence alignment on the existing protein and a reference protein; the existing protein is the existing protein with phosphoketolase enzyme activity; the reference protein is a protein shown in a sequence 3 of a sequence table;

(2) according to the comparison result, the specific mutation in the reference protein corresponds to the existing protein, and then the existing protein is mutated to obtain a new protein with phosphoketolase enzyme activity higher than that of the existing protein; the specific mutation is any one or more of the following mutations (a1) to (a 12): (a1) (a12) the same as above.

The method for obtaining the protein with the increased phosphoketolase enzyme activity further comprises the step of detecting the phosphoketolase enzyme activity of the new protein and the existing protein so as to select the protein with the increased enzyme activity.

The phosphoketolase of any of the above includes, but is not limited to, fructose-6-phosphate ketolase.

Phosphoketolase enzyme activities described above include, but are not limited to, 6-phosphofructoketolase enzyme activities.

The recombinant isolated cell is obtained by introducing the gene into an isolated host cell. The host cell may be specifically a host cell capable of producing an amino acid or an organic acid. The term "host cell" as used herein is a cell having the meaning generally understood by a person skilled in the art, i.e. containing a phosphoketolase of the invention and being capable of producing amino acids, organic acids, in particular amino acids derived from acetyl-CoA, organic acids. In other words, the present invention can utilize any host cell as long as the cell contains the phosphoketolase of the present invention and is capable of producing amino acids, organic acids, and the like.

The recombinant microorganism is obtained by introducing the gene into a host microorganism. The host microorganism may specifically be a host microorganism capable of producing an amino acid or an organic acid. The term "host microorganism" as used herein is a microorganism having the meaning generally understood by those of ordinary skill in the art, i.e., a microorganism which contains the phosphoketolase of the present invention and is capable of producing amino acids, organic acids, particularly amino acids derived from acetyl-CoA, organic acids. In other words, the present invention can utilize any host microorganism as long as the host microorganism contains the phosphoketolase of the present invention and is capable of producing amino acids, organic acids, and the like. The host microorganism includes, but is not limited to, microorganisms of the genus Escherichia (Escherichia), Corynebacterium (Corynebacterium), Pantoea (Pantoea), Brevibacterium (Brevibacterium sp), Bacillus (Bacillus), Klebsiella (Klebsiella), Serratia (Serratia), or Vibrio (Vibrio). The host microorganism is preferably Corynebacterium glutamicum (Corynebacterium glutamicum), most preferably Corynebacterium glutamicum. The host microorganism may specifically be corynebacterium glutamicum Z188.

In the invention, 6-Phosphofructokinase (PFK) genes of amino acid production strains are knocked out, and the activity of exogenous phosphoketolase is coupled with the growth speed of the strains, so that mutant proteins with improved enzyme activity and a plurality of mutant sites capable of increasing the enzyme activity of the existing phosphoketolase are discovered by growth enrichment on the basis of wild FXPK proteins. Compared with the existing phosphoketolase, the phosphoketolase enzyme activity of the mutant protein provided by the invention is obviously increased. The mutation site provided by the invention is adopted to carry out single-point or multi-point mutation on the existing phosphoketolase, so that the enzymatic activity of the phosphoketolase can be obviously improved. The scheme provided by the invention can realize higher phosphoketolase activity, and further remarkably improve the yield of the target metabolite.

Drawings

FIG. 1 shows the results obtained in example 2.

FIG. 2 shows the results obtained in example 3.

FIG. 3 shows the results obtained in example 5.

FIG. 4 shows the results obtained in example 6.

Detailed Description

"phosphoketolase" of the invention includes fructose-6-phosphate transketolase (FPK) and/or xylulose-5-phosphate transketolase (XPK), and refers to an enzyme capable of catalyzing the production of acetyl phosphate and erythrose-4-phosphate from fructose-6-phosphate and/or an enzyme capable of catalyzing the production of acetyl phosphate and glyceraldehyde-3-phosphate from xylulose-5-phosphate.

The "xylulose 5-phosphate transketolase" may be an enzyme derived from a bacterium having xylulose 5-phosphate transketolase activity, including, but not limited to, lactic acid bacteria, methanol-assimilating bacteria, methane-assimilating bacteria, Streptococcus (Streptococcus), and the like, and may preferably be a bacterium of the genus Acetobacter (Acetobacter), Bifidobacterium (Bifidobacterium), Lactobacillus (Lactobacillus), Thiobacillus (Thiobacillus), Streptococcus (Streptococcus), methylcoccus (methylococcus), butyrobacter (Buryrivibrio), filamentous bacterium (fimbracter), and may also preferably be a bacterium belonging to the genus Candida (Candida), Rhodotorula (Rhodotorula), Rhodotorula (rhodosporium), Pichia (Pichia), Hansenula (Hansenula), Kluyveromyces (Kluyveromyces), Saccharomyces (Saccharomyces), Saccharomyces, winia, and the like.

The "fructose-6-phosphate ketolase" may be an enzyme derived from a bacterium having fructose-6-phosphate ketolase activity, including but not limited to bacteria of the genus Acetobacter (Acetobacter), Bifidobacterium (Bifidobacterium), Chlorella (Chlorobium), Brucella (Brucella), Methylococcus (Methylococcus), Gardnerella (Gardnerella), including but not limited to yeasts belonging to the genus Rhodotorula (Rhodotorula), Candida (Trichosporon), Saccharomyces (Saccharomyces), and the like.

Phosphoketolase may also be an enzyme exhibiting both fructose-6-phosphate transketolase (FPK) and xylulose-5-phosphate transketolase (XPK) activities. In connection with the present invention, the phosphoketolase may be derived from bifidobacterium adolescentis. In the invention, mutant protein with improved enzyme activity is obtained by mutating the protein shown in the sequence 3 of the sequence table, and persons skilled in the art can perform mutation at will, so long as the enzyme activity is improved relative to the natural state, the mutant protein is also within the protection scope of the invention. Phosphoketolase may be derived from various species including, but not limited to, bifidobacterium adolescentis, bifidobacterium lactis (b.lactis), lactobacillus pentosus (l.pentosus), lactobacillus plantarum (l.plantarum), and the like.

The term "native state" as used herein refers to the activity of a polypeptide in a microorganism in an unmodified state, i.e., the activity in the native state.

The term "comprising a phosphoketolase of the invention" as used herein has the meaning conventionally understood by a person skilled in the art and may be carried out by methods known in the art, including, but not limited to, such as: the insertion of a polynucleotide comprising a polynucleotide sequence encoding a protein into a chromosome, and/or the introduction of a polynucleotide into a microorganism by cloning the polynucleotide into a vector, and/or the direct addition of copies of the polynucleotide on a chromosome, may also be accomplished by any known method that can introduce protein activity, without limitation.

The "amino acid or organic acid, particularly an amino acid or organic acid derived from acetyl-CoA" in the present invention refers to an amino acid or organic acid having acetyl-CoA as a substrate, such as L-glutamic acid, L-glutamine, L-proline, L-hydroxyproline (trans-4-hydroxy-L-proline), L-arginine, L-leucine, L-isoleucine, L-cysteine, citric acid, or succinic acid.

The "amino acid/organic acid-producing strain" of the present invention means a strain which can produce an amino acid or an organic acid and accumulate the amino acid or the organic acid when the bacterium is cultured in a culture medium, or can secrete the amino acid or the organic acid into the culture medium, that is, can obtain extracellular free amino acid or organic acid, and particularly means an ability to accumulate more amino acid or organic acid than a wild-type strain or a parent strain. In order to impart the ability of producing amino acids, organic acids to strains, conventional breeding methods such as breeding auxotrophic mutants, anti-analog strains, or metabolic control mutants capable of producing amino acids, organic acids, and breeding recombinant strains having improved activity of enzymes involved in biosynthesis of amino acids, organic acids, or a combination thereof can be used.

It is known to those skilled in the art that it is more important to mutate the wild-type polypeptide in order to increase its activity to find a site that achieves the desired purpose. Therefore, based on the teaching of the present invention, the skilled person will mutate the amino acid residues at

positions

2, 6, 14, 20, 120, 231, 260, 342, 397, 676, 785 and 801 of the protein shown in sequence 3 and test the related activity of the mutant. In a specific embodiment, the phosphoketolase mutant protein of the invention has a protein corresponding to the protein shown in sequence 3, wherein the amino acid residue at position 2 is a, and/or the amino acid residue at position 6 is T, and/or the amino acid residue at position 14 is D, and/or the amino acid residue at position 20 is D, and/or the amino acid residue at position 120 is a, and/or the amino acid residue at position 231 is K, and/or the amino acid residue at position 260 is Y, and/or the amino acid residue at position 342 is K, and/or the amino acid residue at position 397 is R, and/or the amino acid residue at position 676 is G, and/or the amino acid residue at position 785 is L, and/or the amino acid residue at position 801 is R.

Furthermore, it will be appreciated by those of ordinary skill in The art that The alteration of a small number of amino acid residues in certain regions, e.g., non-critical regions, of a polypeptide does not substantially alter The biological activity, e.g., The sequence resulting from The appropriate substitution of certain amino acids does not affect its activity (see Watson et al, Molecular Biology of The Gene, fourth edition, 1987, The Benjamin/Cummings pub. Co. P224). Thus, one of ordinary skill in the art would be able to effect such a substitution and ensure that the resulting molecule still possesses the desired biological activity.

For example, it is well known to those skilled in the art that the addition or subtraction of several amino acid residues, e.g., preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, at either end of a polypeptide does not affect the function of the resulting mutant.

TABLE 2

Initial residue	Representative substituted residue	Preferred substituent residues
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The present invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

Thus, as used herein, "comprising," "having," or "including" includes "comprising," "consisting essentially of … …," "consisting essentially of … …," and "consisting of … …"; "consisting essentially of … …", "consisting essentially of … …", and "consisting of … …" are subordinate concepts of "comprising", "having", or "including".

Thus, for example, with respect to "amino acid residue corresponding to position 40 of a protein as set forth in sequence 3," position 40 of the resulting mutant corresponding to the amino acid sequence set forth in sequence 3 may be position 46 if a6 × His tag is added to one end of the protein as set forth in sequence 3.

In a specific embodiment, it is within the scope of the present invention as long as the homology or sequence identity is 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% or more, and has phosphoketolase activity (i.e., fructose-6-phosphate transketolase activity and/or xylulokinase-5-phosphate activity).

Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: computer Molecular Biology (computerized Molecular Biology), Lesk, a.m. ed, oxford university press, new york, 1988; biological calculation: informatics and genomic projects (Biocomputing: information and genoprojects), Smith, d.w. eds, academic press, new york, 1993; computer analysis of Sequence Data (computer analysis of Sequence Data), first part, Griffin, a.m. and Griffin, h.g. eds, humana press, new jersey, 1994; sequence Analysis in molecular biology (Sequence Analysis in molecular biology), von Heinje, g., academic Press, 1987 and Sequence Analysis primers (Sequence Analysis primer), Gribskov, m. and Devereux, J. eds M Stockton Press, New York, 1991 and Carllo, h. and Lipman, D.S., SIAM J.applied Math., 48:1073 (1988). The preferred method of determining identity is to obtain the greatest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. et al, 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al, 1990). BLASTX programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al, NCBI NLM NIH Bethesda, Md.20894; Altschul, S. et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the laboratory Manual (New York: Cold Spring Harbor laboratory Press,1989), or according to the manufacturer's recommendations. The test materials used in the following examples were purchased from conventional biochemicals, unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

A document describing plasmid pK18mobsacB (plasmid pK18mobsacB) is described in the following documents: schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A (1994) Smallmobil multipurpose closing vectors derived from the Escherichia coli pK18 and pK19-selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145(1) 69-73.https:// doi. org/10.1016/0378-1119(94) 90324-7.

Plasmid pTRCmob (plasmid pTRCmob), described in the following documents: liu, Q., et al, (2007). Journal of Biotechnology 132(2007) 273-279.

The formulation of the liquid CGXII mineral salts medium is shown in Table 3 (pH adjusted to 7.0).

TABLE 3

Example 1 construction of a pfk Gene-knocked-out Strain, strain Z188 △ pfk

Corynebacterium glutamicum Z188, Corynebacterium glutamicum (Corynebacterium glutamicum) Z188. The whole genome of Corynebacterium glutamicum Z188 is described in GenBank access number: NZ _ AKXP00000000.1(https:// www.ncbi.nlm.nih.gov/nuccore/NZ _ AKXP 00000000). The pfk gene is the 6-phosphofructokinase gene. In the genomic DNA of Corynebacterium glutamicum Z188, the coding frame of pfk gene and the nucleotide sequence of 1000bp parts of the upstream and downstream thereof are shown in sequence 2 of the sequence table (in sequence 2 of the sequence table, the 1001-2041 th nucleotide is the coding frame and the protein shown in sequence 1 of the sequence table is coded).

Δpfk-F1：CCTCGAATTCGGATGCTGCCAATGGAATGGTGCCCAGTG；

Δpfk-R1：CTTCAAGGTT AAATTCATTGCTGGCTGTGC；

Δpfk-F2：CAATGAATTT AACCTTGAAGGAAGTTCCATTC；

Δpfk-R2：TCTACTGCAGGGAATGATGACACCGATGGTGTCTGTCCTCGAC。

1. And (3) carrying out PCR amplification by using the genomic DNA of Corynebacterium glutamicum Z188 as a template and adopting a primer pair consisting of delta pfk-F1 and delta pfk-R1 to obtain a PCR amplification product.

2. And (3) carrying out PCR amplification by using the genomic DNA of Corynebacterium glutamicum Z188 as a template and adopting a primer pair consisting of delta pfk-F2/delta pfk-R2 to obtain a PCR amplification product.

3. And (3) simultaneously taking the PCR amplification product in the step (1) and the PCR amplification product in the step (2) as templates, and carrying out PCR amplification by adopting a primer pair consisting of delta pfk-F1/delta pfk-R2 to obtain the PCR amplification product.

4. And (3) taking the PCR amplification product obtained in the step (3), carrying out double enzyme digestion by using restriction enzymes EcoRI and PstI, and recovering the enzyme digestion product.

5. Taking the plasmid pK18mobsacB, carrying out double enzyme digestion by using restriction enzymes EcoRI and PstI, and recovering a vector framework.

6. And (5) connecting the enzyme digestion product in the step (4) with the vector skeleton in the step (5) to obtain the recombinant plasmid.

7. Using the recombinant plasmid obtained in step 6, the pfk Gene of Corynebacterium glutamicum Z188 was knocked out according to the two-step Rec recombination method described in the literature (Niebisch and Bott, (2001); ArchMicrobiol175(4):282-294.Schafer et al., (1994). Gene 145(1):69-73), to give a pfk Gene-knocked-out strain, which was designated as strain Z188 △ pfk.

The genome of strain Z188 △ pfk differs from the genome DNA of C.glutamicum Z188 only in that the region indicated by nucleotides 1100-1983 of the DNA molecule indicated in sequence 2 of the sequence listing is deleted.

Example 2 preparation and growth Properties of recombinant bacteria

The phosphoketolase derived from bifidobacterium adolescentis is shown as a sequence 3 in a sequence table. And (3) carrying out all-codon optimization on the encoding gene of the protein shown in the sequence 3 of the sequence table, wherein the optimized gene is shown in the sequence 4 of the sequence table. The phosphoketolase shown in the sequence 3 of the sequence table is also called FXPK protein or F/XPK protein. The gene encoding the FXPK protein is also called FXPK gene.

Firstly, preparing recombinant plasmid

1. Synthesizing a double-stranded DNA molecule shown in a sequence 4 of the sequence table; the synthesized double-stranded DNA molecule is used as a template, PCR amplification is carried out by adopting a primer pair consisting of F1 and R1, and a PCR amplification product is recovered.

F1：CTACGAATTCGAAGGAGATATACATATG；

R1：TCAGGGATCCTCATTCGTTGTCACCCGCGGTC。

2. And (3) taking the PCR amplification product obtained in the step (1), carrying out double enzyme digestion by using restriction enzymes EcoRI and BamHI, and recovering the enzyme digestion product.

3. Taking the plasmid pTRCmob, carrying out double enzyme digestion by using restriction enzymes EcoRI and BamHI, and recovering the vector framework.

4. And (3) connecting the enzyme digestion product in the step (2) with the vector framework in the step (3) to obtain the recombinant plasmid pTR-fxpk. The recombinant plasmid pTR-fxpk has a specific DNA molecule A through sequencing verification. The specific DNA molecule A sequentially consists of the following five elements from upstream to downstream: DNA molecule shown in sequence 5 of the sequence table (the 1 st to 246 th nucleotides in the sequence 5 form a promoter), EcoRI enzyme cutting recognition sequence "gattc", ribosome binding site "GAAGGAGATATACAT", DNA molecule shown in sequence 4 of the sequence table, and BamHI enzyme cutting recognition sequence "GGATCC".

5. The recombinant plasmid pTR-fxpk is taken as a template, and a primer pair consisting of Ptrc-1 and Ptrc-2 is adopted for single-point mutation to obtain the recombinant plasmid pTR 1-fxpk. The purpose of this step is to introduce single point mutation into the promoter region, thereby increasing the promoter activity of the promoter and promoting the expression of the gene.

Ptrc-1：GAGCGGATAACAATCTCACACAGGAAACAG；

Ptrc-2：CTGTTTCCTGTGTGAGATTGTTATCCGCTC。

The recombinant plasmid pTR1-fxpk was subjected to sequencing verification. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR1-fxpk only has the difference that the DNA molecule shown in the sequence 5 of the sequence table is replaced by the DNA molecule shown in the sequence 6 of the sequence table.

Secondly, preparing recombinant bacteria

The recombinant plasmid pTR-fxpk was introduced into strain Z188 △ pfk to obtain a recombinant strain, which was designated strain Z188 △ pfk (pTR-fxpk).

The recombinant plasmid pTR1-fxpk was introduced into strain Z188 △ pfk to obtain a recombinant strain named strain Z188 △ pfk (pTR 1-fxpk).

Thirdly, comparing the growth performance of the strains

The test strains are Corynebacterium glutamicum Z188, strain Z188 △ pfk, strain Z188 △ pfk (pTR-fxpk) and strain Z188 △ pfk (pTR1-fxpk), respectively.

The test strains were inoculated into liquid CGXII mineral salt medium (OD of the initial System)_600nmThe resulting cells were subjected to shaking culture at 30 ℃ and 850rpm, sampled at different times (200. mu.L each), and the absorbance (OD) at 600nm was measured with a microplate reader_600nmValue).

The results are shown in figure 1, the strain Z188 △ pfk hardly grows in a liquid CGXII inorganic salt culture medium, the strain Z188 △ pfk (pTR-FXPK) and the strain Z188 △ pfk (pTR1-FXPK) can normally grow, the higher the expression level of the FXPK gene is, the faster the growth speed of the strain is, and the results show that the increase of the FXPK enzyme activity/content can promote the growth of the strain, so that the mutant protein with the improved enzyme activity can be screened from a mutant library in a growth enrichment way.

Example 3 obtaining of a mutein with increased enzymatic Activity

Firstly, constructing a fxpk gene mutant library

1. And (3) performing error-prone PCR amplification by using the recombinant plasmid pTR-fxpk as a template and adopting a primer pair consisting of F1 and R1. Error-prone PCR amplification using

DNA polymerase (Beijing holotype gold organism). Three reactions are respectively arrangedThe system contains 0.2mM, 0.5mM or 0.8mM manganese chloride, respectively. After error-prone PCR amplification was completed, the three reaction systems were combined.

2. Taking the product in the step 1, carrying out double enzyme digestion by using restriction enzymes EcoRI and BamHI, and recovering the enzyme digestion product.

3. Taking the recombinant plasmid pTR-fxpk, carrying out double enzyme digestion by using restriction enzymes EcoRI and BamHI, and recovering a vector framework.

4. And (3) connecting the enzyme digestion product in the step (2) with the vector skeleton in the step (3) to obtain the recombinant plasmid.

5. And (4) introducing the recombinant plasmid obtained in the step (4) into a strain Z188 △ pfk to obtain a recombinant strain.

Since the error-prone PCR amplification generates a plurality of mutant genes of the fxpk gene, a plurality of recombinant plasmids (about 1 ten thousand) are obtained in the step 4 to form a fxpk gene mutant recombinant plasmid library, and correspondingly, a plurality of recombinant bacteria are obtained in the step 5 to form a fxpk gene mutant recombinant bacteria library.

9 fxpk gene mutation recombinant bacterium libraries are constructed by the same method and are sequentially named as M1 recombinant bacterium libraries to M9 recombinant bacterium libraries.

II, obtaining FXPK enzyme activity improved mutant by growth enrichment

9 pools of fxpk gene-mutated recombinant bacteria (1 ml of medium per well) were cultured in 24-well plates using liquid CGXII mineral salt medium, and were transferred every 48 hours (1% inoculum) by shaking culture at 850rpm at 30 ℃. After each incubation, 200. mu.L of the suspension was transferred to a microplate and absorbance (OD) at 600nm was measured using a microplate reader_600nmValues) strain Z188 △ pfk (pTR-fxpk) was used as a control strain the results are shown in fig. 2. with serial subcultures, the M2, M4, M7 and M8 recombinant pools were all enriched to strains capable of accelerated growth.

Sequencing analysis is respectively carried out on the M2 recombinant bacterium library, the M4 recombinant bacterium library, the M7 recombinant bacterium library and the M8 recombinant bacterium library, a mutant gene of the fxpk gene is screened from the M2 recombinant bacterium library, the M4 recombinant bacterium library and the M7 recombinant bacterium library respectively, and mutant genes of 2 fxpk genes are screened from the M8 recombinant bacterium library. Thus, 5 muteins of FXPK proteins were obtained. The respective muteins were named M21 protein, M41 protein, M71 protein, M81 protein and M82 protein, respectively. The mutant amino acids of each mutant protein compared with FXPK protein, and the mutant nucleotides of each mutant gene compared with FXPK gene (shown by nucleotides 26 to 2503 in sequence 4 of the sequence table) are shown in Table 4.

TABLE 4

^(1-14)Indicates that the nucleotide mutation results in mutation of the corresponding amino acid,^(-)indicating that the nucleotide mutation did not result in the occurrence of an amino acid mutation.

Example 4 construction of respective recombinant plasmids for expressing respective proteins

The FXPK protein is shown as a sequence 3 in a sequence table. The fxpk gene is shown as a sequence 4 in the sequence table.

Firstly, preparing each recombinant plasmid respectively, and sequencing and verifying.

Recombinant plasmid pTR-M21. The recombinant plasmid pTR-M21 differed only in the replacement of the fxpk gene with the M21D gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the M21D gene has the following 5-nucleotide mutation: the 17 th nucleotide is mutated from T to C, the 358 th nucleotide is mutated from A to G, the 691 th nucleotide is mutated from G to A, the 1190 th nucleotide is mutated from A to G, and the 2027 th nucleotide is mutated from A to G. The M21D gene encodes the M21 protein. Compared with FXPK protein, M21 protein is mutated by the following 5 amino acid residues: the 6 th amino acid residue is mutated from I to T, the 120 th amino acid residue is mutated from T to A, the 231 th amino acid residue is mutated from E to K, the 397 th amino acid residue is mutated from K to R, and the 676 th amino acid residue is mutated from D to G.

Recombinant plasmid pTR-M41. The recombinant plasmid pTR-M41 differed only in the replacement of the fxpk gene with the M41D gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the M41D gene has the following 2-nucleotide mutation: the 4 th nucleotide is mutated from A to G, and the 2353 th nucleotide is mutated from T to C. The M41D gene encodes the M41 protein. Compared with FXPK protein, M41 protein is mutated by the following 2 amino acid residues: the 2 nd amino acid residue is mutated from T to A, and the 785 th amino acid residue is mutated from F to L.

Recombinant plasmid pTR-M71. The recombinant plasmid pTR-M71 differed only in the replacement of the fxpk gene with the M71D gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the M71D gene has the following 3-nucleotide mutation: the 40 th nucleotide is mutated from A to G, the 1481 th nucleotide is mutated from G to A, and the 2401 th nucleotide is mutated from T to C. The M71D gene encodes the M71 protein. Compared with FXPK protein, M71 protein is mutated by the following 3 amino acid residues: the 14 th amino acid residue N is mutated into D, the 494 th amino acid residue is mutated into H from R, and the 801 th amino acid residue is mutated into R from W.

Recombinant plasmid pTR-M81. The recombinant plasmid pTR-M81 differed only in the replacement of the fxpk gene with the M81D gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the M81D gene has the following mutations of 4 nucleotides: the 60 th nucleotide is mutated from A to T, the 778 th nucleotide is mutated from C to T, the 1024 th nucleotide is mutated from G to A, and the 1401 st nucleotide is mutated from G to A. The M81D gene encodes the M81 protein. Compared with FXPK protein, M81 protein is mutated by the following 4 amino acid residues: the 20 th amino acid residue is mutated from E to D, the 260 th amino acid residue is mutated from H to Y, the 342 th amino acid residue is mutated from E to K, and the 467 th amino acid residue is mutated from M to I.

Recombinant plasmid pTR-M82. The recombinant plasmid pTR-M82 differed only in the replacement of the fxpk gene with the M82D gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the M82D gene has the following 3-nucleotide mutation: the 60 th nucleotide is mutated from A to T, the 778 th nucleotide is mutated from C to T, and the 1024 th nucleotide is mutated from G to A. The M82D gene encodes the M82 protein. Compared with FXPK protein, M82 protein is mutated by the following 3 amino acid residues: the 20 th amino acid residue is mutated from E to D, the 260 th amino acid residue is mutated from H to Y, and the 342 th amino acid residue is mutated from E to K.

Recombinant plasmid pTR-T2A. The recombinant plasmid pTR-T2A differs from the recombinant plasmid pTR-fxpk only in that the fxpk gene is replaced by the T2A gene. Compared with the fxpk gene, the T2A gene has 1 nucleotide mutation as follows: the 4 th nucleotide is mutated from A to G. The T2A gene encodes the T2A protein. Compared with FXPK protein, T2A protein is mutated by 1 amino acid residue as follows: the 2 nd amino acid residue is mutated from T to A.

Recombinant plasmid pTR-I6T. The recombinant plasmid pTR-I6T differs from the recombinant plasmid pTR-fxpk only in that the fxpk gene is replaced by the I6T gene. Compared with the fxpk gene, the I6T gene has 1 nucleotide mutation as follows: the 17 th nucleotide is mutated from T to C. The I6T gene encodes the I6T protein. Compared with FXPK protein, the I6T protein is mutated by 1 amino acid residue as follows: the 6 th amino acid residue is mutated from I to T.

Recombinant plasmid pTR-H260Y. The recombinant plasmid pTR-H260Y differed only in the replacement of the fxpk gene with the H260Y gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the H260Y gene has 1 nucleotide mutation as follows: 778 th nucleotide is mutated from C to T. The H260Y gene encodes the H260Y protein. Compared with FXPK protein, the H260Y protein is mutated by 1 amino acid residue: the 260 th amino acid residue is mutated from H to Y.

Recombinant plasmid pTR-T2A/I6T. The recombinant plasmid pTR-T2A/I6T differed only in the replacement of the fxpk gene with the T2A/I6T gene compared to the recombinant plasmid pTR-fxpk. Compared with the fxpk gene, the T2A/I6T gene has the following 2-nucleotide mutation: the 4 th nucleotide is mutated from A to G, and the 17 th nucleotide is mutated from T to C. The T2A/I6T gene encodes the T2A/I6T protein. Compared with FXPK protein, T2A/I6T protein is mutated by 2 amino acid residues as follows: the 2 nd amino acid residue is mutated from T to A, and the 6 th amino acid residue is mutated from I to T.

The recombinant plasmid pTR-T2A/I6T/H260Y. Compared with the recombinant plasmid pTR-fxpk, the recombinant plasmid pTR-T2A/I6T/H260Y only has the difference that the fxpk gene is replaced by the T2A/I6T/H260Y gene. Compared with the fxpk gene, the T2A/I6T/H260Y gene has the following 3-nucleotide mutation: the 4 th nucleotide is mutated from A to G, the 17 th nucleotide is mutated from T to C, and the 778 th nucleotide is mutated from C to T. The T2A/I6T/H260Y gene encodes T2A/I6T/H260Y protein. Compared with FXPK protein, T2A/I6T/H260Y protein is mutated by 3 amino acid residues: the 2 nd amino acid residue is mutated from T to A, the 6 th amino acid residue is mutated from I to T, and the 260 th amino acid residue is mutated from H to Y.

Secondly, preparing a recombinant plasmid pET-fxpk.

The DNA molecule shown as the 4 th-2475 th nucleotide in the sequence 4 of the sequence table is inserted between the NdeI and XhoI restriction enzyme recognition sequences of the plasmid pET-30a (+) to obtain the recombinant plasmid pET-fxpk. The recombinant plasmid pET-fxpk has a specific DNA molecule B through sequencing verification. The specific DNA molecule B sequentially consists of the following five elements from upstream to downstream: NdeI enzyme digestion recognition sequence 'CATATG' (wherein ATG is used as the initiation codon of the fusion gene), DNA molecules shown as 4 th-2475 th nucleotides in the sequence 4 of the sequence table (namely, the fxpk gene with the initiation codon and the termination codon removed), XhoI enzyme digestion recognition sequence 'CTCGAG', His₆The tag coding sequence "CACCACCACCACCACCAC", stop codon "TGA". Fusion gene expression FXPK-His in recombinant plasmid₆A protein. FXPK-His₆The protein sequentially consists of the following elements from N end to C end: FXPK protein, LE (encoded by XhoI restriction enzyme recognition sequence), His₆And (4) a label.

And thirdly, preparing each recombinant plasmid respectively, and sequencing and verifying.

Recombinant plasmid pET-M21. The recombinant plasmid pET-M21 differed only in that the fxpk gene from which the stop codon was removed was replaced with the M21D gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid M21-His₆A protein. M21-His₆The protein sequentially consists of the following elements from N end to C end: m21 protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-M41. The recombinant plasmid pET-M41 differed only in that the fxpk gene from which the stop codon was removed was replaced with the M41D gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid M41-His₆A protein. M41-His₆The protein sequentially consists of the following elements from N end to C end: m41 protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-M71. The recombinant plasmid pET-M71 differed only in that the fxpk gene from which the stop codon was removed was replaced with the M71D gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid M71-His₆A protein. M71-His₆The protein sequentially consists of the following elements from N end to C end: m71 protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-M81. The recombinant plasmid pET-M81 differed only in that the fxpk gene from which the stop codon was removed was replaced with the M81D gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid M81-His₆A protein. M81-His₆The protein sequentially consists of the following elements from N end to C end: m81 protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-M82. The recombinant plasmid pET-M82 differed only in that the fxpk gene from which the stop codon was removed was replaced with the M82D gene from which the stop codon was removed, as compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid M82-His₆A protein. M82-His₆The protein sequentially consists of the following elements from N end to C end: m82 protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-T2A. The recombinant plasmid pET-T2A differed only in that the fxpk gene from which the stop codon was removed was replaced with the T2A gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid T2A-His₆A protein. T2A-His₆The protein sequentially consists of the following elements from N end to C end: T2A protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-I6T. The recombinant plasmid pET-I6T differed only in that the fxpk gene from which the stop codon was removed was replaced with the I6T gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid I6T-His₆A protein. I6T-His₆The protein sequentially consists of the following elements from N end to C end: I6T protein, LE (XhoI restriction recognition sequence code)、His₆And (4) a label.

Recombinant plasmid pET-N14D. The recombinant plasmid pET-N14D differed only in that the fxpk gene from which the stop codon was removed was replaced with the N14D gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Compared with the fxpk gene, the N14D gene has the following 1-nucleotide mutation: the 40 th nucleotide is mutated from A to G. The N14D gene encodes the N14D protein. Compared with FXPK protein, the N14D protein is mutated by 1 amino acid residue: the 14 th amino acid residue N is mutated into D. Fusion gene expression in recombinant plasmid N14D-His₆A protein. N14D-His₆The protein sequentially consists of the following elements from N end to C end: N14D protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-E20D. The recombinant plasmid pET-E20D differed only in that the fxpk gene from which the stop codon was removed was replaced with the E20D gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Compared with the fxpk gene, the E20D gene has the following 1-nucleotide mutation: the 60 th nucleotide is mutated from A to T. The E20D gene encodes the E20D protein. Compared with FXPK protein, E20D protein is mutated by 1 amino acid residue as follows: the 20 th amino acid residue is mutated from E to D. Expression of the fusion Gene in the recombinant plasmid E20D-His₆A protein. E20D-His₆The protein sequentially consists of the following elements from N end to C end: E20D protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-T120A. The recombinant plasmid pET-T120A differed only in that the fxpk gene from which the stop codon was removed was replaced with the T120A gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Compared with the fxpk gene, the T120A gene has 1 nucleotide mutation as follows: the 358 th nucleotide is mutated from A to G. The T120A gene encodes the T120A protein. Compared with FXPK protein, T120A protein is mutated by 1 amino acid residue: the 120 th amino acid residue is A from mutation T. Fusion gene expression in recombinant plasmid T120A-His₆A protein. T120A-His₆The protein sequentially consists of the following elements from N end to C end: T120A protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-E231K. The recombinant plasmid pET-E231K differed only in that the fxpk gene from which the stop codon was removed was replaced with the E231K gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Compared with the fxpk gene, the E231K gene has the following 1-nucleotide mutation: the 691 nucleotide is mutated from G to A. The E231K gene encodes the E231K protein. Compared with FXPK protein, E231K protein is mutated by 1 amino acid residue as follows: the 231 th amino acid residue is mutated from E to K. Expression of fusion Gene in recombinant plasmid E231K-His₆A protein. E231K-His₆The protein sequentially consists of the following elements from N end to C end: E231K protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-H260Y. The recombinant plasmid pET-H260Y differed only in that the fxpk gene from which the stop codon was removed was replaced with the H260Y gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Fusion gene expression in recombinant plasmid H260Y-His₆A protein. H260Y-His₆The protein sequentially consists of the following elements from N end to C end: H260Y protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-E342K. The recombinant plasmid pET-E342K differed from the recombinant plasmid pET-fxpk only in that the fxpk gene from which the stop codon was removed was replaced with the E342K gene from which the stop codon was removed. Compared with the fxpk gene, the E342K gene has the following 1-nucleotide mutation: the 1024 th nucleotide is mutated from G to A. The E342K gene encodes the E342K protein. Compared with FXPK protein, E342K protein is mutated by 1 amino acid residue as follows: the 342 nd amino acid residue is mutated from E to K. The fusion gene in the recombinant plasmid expresses E342K-His₆A protein. E342K-His₆The protein sequentially consists of the following elements from N end to C end: E342K protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-K397R. The recombinant plasmid pET-K397R differed from the recombinant plasmid pET-fxpk only in that the fxpk gene from which the stop codon was removed was replaced with the K397R gene from which the stop codon was removed. K397R gene in contrast to the fxpk geneThe following 1 nucleotide mutations occurred: the 1190 th nucleotide is mutated from A to G. The K397R gene encodes the K397R protein. Compared with FXPK protein, K397R protein is mutated by 1 amino acid residue: the amino acid residue 397 is mutated from K to R. Fusion gene expression in recombinant plasmid K397R-His₆A protein. K397R-His₆The protein sequentially consists of the following elements from N end to C end: K397R protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-D676G. The recombinant plasmid pET-D676G differed only in that the fxpk gene from which the stop codon was removed was replaced with the D676G gene from which the stop codon was removed, compared to the recombinant plasmid pET-fxpk. Compared with the fxpk gene, the D676G gene has 1 nucleotide mutation as follows: the 2027 th nucleotide is mutated from A to G. The D676G gene encodes D676G protein. Compared with FXPK protein, D676G protein is mutated by 1 amino acid residue as follows: the 676 th amino acid residue is mutated from D to G. Fusion gene expression D676G-His in recombinant plasmid₆A protein. D676G-His₆The protein sequentially consists of the following elements from N end to C end: D676G protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-F785L. The recombinant plasmid pET-F785L differed only in that the fxpk gene from which the stop codon was removed was replaced with the F785L gene from which the stop codon was removed, as compared to the recombinant plasmid pET-fxpk. Compared with the fxpk gene, the F785L gene is mutated by 1 nucleotide as follows: the 2353 th nucleotide is mutated from T to C. The F785L gene encodes the F785L protein. Compared with FXPK protein, F785L protein is mutated by 1 amino acid residue: the 785 amino acid residue was mutated from F to L. Fusion gene expression in recombinant plasmid F785L-His₆A protein. F785L-His₆The protein sequentially consists of the following elements from N end to C end: F785L protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-W801R. The recombinant plasmid pET-W801R differed only in that the fxpk gene from which the stop codon was removed was replaced with the W801R gene from which the stop codon was removed, as compared with the recombinant plasmid pET-fxpk. W801 in comparison with the fxpk GeneThe R gene is mutated by 1 nucleotide: the 2401 th nucleotide is mutated from T to C. The W801R gene encodes the W801R protein. Compared with FXPK protein, W801R protein is mutated by 1 amino acid residue: the 801 th amino acid residue is mutated from W to R. Expression of fusion Gene in recombinant plasmid W801R-His₆A protein. W801R-His₆The protein sequentially consists of the following elements from N end to C end: W801R protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-T2A/I6T. The recombinant plasmid pET-T2A/I6T differs from the recombinant plasmid pET-fxpk only in the replacement of the fxpk gene with the T2A/I6T gene. Fusion gene expression in recombinant plasmid T2A/I6T-His₆A protein. T2A/I6T-His₆The protein sequentially consists of the following elements from N end to C end: T2A/I6T protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-T2A/H260Y. The recombinant plasmid pET-T2A/H260Y differs from the recombinant plasmid pET-fxpk only in that the fxpk gene from which the stop codon was removed is replaced with the T2A/H260Y gene from which the stop codon was removed. Compared with the fxpk gene, the T2A/H260Y gene has the following 2-nucleotide mutation: the 4 th nucleotide is mutated from A to G, and the 778 th nucleotide is mutated from C to T. The T2A/H260Y gene encodes T2A/H260Y protein. Compared with FXPK protein, T2A/H260Y protein is mutated by 2 amino acid residues as follows: the 2 nd amino acid residue is mutated from T to A, and the 260 nd amino acid residue is mutated from H to Y. Fusion gene expression in recombinant plasmid T2A/H260Y-His₆A protein. T2A/H260Y-His₆The protein sequentially consists of the following elements from N end to C end: T2A/H260Y protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Recombinant plasmid pET-I6T/H260Y. The recombinant plasmid pET-I6T/H260Y differs from the recombinant plasmid pET-fxpk only in that the fxpk gene from which the stop codon was removed is replaced with the I6T/H260Y gene from which the stop codon was removed. Compared with the fxpk gene, the I6T/H260Y gene has the following 2-nucleotide mutation: the 17 th nucleotide is mutated from T to C, and the 778 th nucleotide is mutated from C to T. The I6T/H260Y gene encodes I6T/H260Y protein. And FXPKCompared with the protein, the I6T/H260Y protein has the following 2 amino acid residue mutations: the 6 th amino acid residue is mutated from I to T, and the 260 th amino acid residue is mutated from H to Y. Fusion gene expression in recombinant plasmid I6T/H260Y-His₆A protein. I6T/H260Y-His₆The protein sequentially consists of the following elements from N end to C end: I6T/H260Y protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

The recombinant plasmid pET-T2A/I6T/H260Y. The recombinant plasmid pET-T2A/I6T/H260Y differs from the recombinant plasmid pET-fxpk only in the replacement of the fxpk gene with the T2A/I6T/H260Y gene. The fusion gene in the recombinant plasmid expresses T2A/I6T/H260Y-His₆A protein. T2A/I6T/H260Y-His₆The protein sequentially consists of the following elements from N end to C end: T2A/I6T/H260Y protein, LE (encoded by XhoI restriction recognition sequence), His₆And (4) a label.

Example 5 preparation of respective proteins and determination of enzyme Activity thereof as phosphoketolase

The recombinant plasmid was introduced into E.coli BL21(DE3) to obtain a recombinant strain. Culturing the recombinant bacteria by adopting a liquid LB culture medium, and carrying out shaking culture at 37 ℃ and 200rpm until the culture reaches OD_600nmThen IPTG was added to the medium to give a concentration of 0.4mM in the system, followed by shaking culture at 200rpm at 20 ℃ for 18 hours and centrifugation at 7000g for 5min at 4 ℃ to collect the cells. The cells were washed, then sonicated, and then the supernatant was collected and purified of His with SpinTrap columns (available from GE, product No. 28-4013-53)₆The buffer system of the labeled protein was then replaced with PBS buffer at pH 7.2.

The recombinant plasmid pET-FXPK is prepared by the steps₆A protein. The recombinant plasmid pET-M21 is prepared by the steps to obtain M21-His₆A protein. The recombinant plasmid pET-M41 is prepared by the steps to obtain M41-His₆A protein. The recombinant plasmid pET-M71 is prepared by the steps to obtain M71-His₆A protein. The recombinant plasmid pET-M81 is prepared by the steps to obtain M81-His₆A protein. The recombinant plasmid pET-M82 is prepared by the steps to obtain M82-His₆A protein. Recombinant plasmid pET-T2A was prepared by the above procedureObtaining T2A-His₆A protein. The recombinant plasmid pET-I6T is prepared by the steps to obtain I6T-His₆A protein. The recombinant plasmid pET-N14D is prepared by the steps to obtain N14D-His₆A protein. The recombinant plasmid pET-E20D is prepared by the steps to obtain E20D-His₆A protein. The recombinant plasmid pET-T120A is prepared by the steps to obtain the recombinant plasmid T120A-His₆A protein. The recombinant plasmid pET-E231K is prepared by the steps to obtain E231K-His₆A protein. The recombinant plasmid pET-H260Y is prepared by the steps to obtain H260Y-His₆A protein. The recombinant plasmid pET-E342K is prepared by the steps to obtain E342K-His₆A protein. The recombinant plasmid pET-K397R is prepared by the steps to obtain K397R-His₆A protein. The recombinant plasmid pET-D676G was prepared by the above steps to obtain D676G-His₆A protein. The recombinant plasmid pET-F785L is prepared by the steps to obtain F785L-His₆A protein. The recombinant plasmid pET-W801R is prepared by the steps to obtain W801R-His₆A protein. The recombinant plasmid pET-T2A/I6T/I6T is prepared by the steps to obtain T2A/I6T-His₆A protein. The recombinant plasmid pET-T2A/H260Y is prepared by the steps to obtain T2A/H260Y-His₆A protein. The recombinant plasmid pET-I6T/H260Y is prepared by the steps to obtain I6T/H260Y-His₆A protein. The recombinant plasmid pET-T2A/I6T/H260Y/I6T/H260Y is prepared by the steps to obtain T2A/I6T/H260Y-His₆A protein.

Protein quantification was performed using BCA protein quantification kit from ThermoFisher.

Separately determining each His₆Reactivity of the tagged protein to fructose 6-phosphate. The reaction principle is as follows: the substrate fructose-6-phosphate is catalyzed by the test protein to form acetyl phosphate, which reacts with hydroxylamine to form hydroxamic acid, which reacts with ferric chloride to form a red compound that can be detected at 505 nm. Reaction system: 49. mu.l of phosphate buffer (pH6.5, 100mM), 1. mu.l of 10mM thiamine pyrophosphate aqueous solution, 0.1. mu.l of 100mM MgCl₂Aqueous solution, 0.1. mu.l of 0.7M cysteine hydrochloride aqueous solution, 30. mu.l of 100mM fructose-6-phosphate aqueous solution, 20. mu.l of test protein solution. Firstly, placing a reaction system in a water bath at 30 ℃ for reaction for 10 minutes; however, the device is not suitable for use in a kitchenThen adding 80 mul of 2mol/L hydroxylamine aqueous solution, uniformly mixing, and standing for 10 minutes at room temperature; then 55. mu.l of a 15g/100ml aqueous solution of trichloroacetic acid, 55. mu.l of a 4mol/L aqueous solution of hydrochloric acid, 55. mu.l of 5g/100ml FeCl₃·6H₂O water solution, and then standing and reacting for 1 minute at room temperature; then, 200. mu.l of the sample was sampled and the absorbance (OD) at 505nm was measured_505nmValue). One enzyme activity unit (U) is defined as: in a reaction time of 1 minute, the enzyme required for the formation of 1. mu. mol of acetyl phosphate was produced.

The enzyme activity (U) is divided by the protein amount (mg) to obtain the specific enzyme activity (U/mg).

Each of the above prepared has His₆The specific activity of the tagged protein as phosphoketolase is shown in FIG. 3. In FIG. 3, FXPK represents FXPK-His₆Protein, M21 represents M21-His₆Protein, M41 represents M41-His₆Protein, and so on. The enzyme activity of each mutant protein as phosphoketolase is higher than that of wild FXPK protein, and the enzyme activity of T2A/I6T protein and T2A/I6T/H260Y protein is highest.

Example 6 comparison of glutamic acid-producing ability of recombinant bacteria expressing respective proteins

The recombinant plasmids are respectively introduced into corynebacterium glutamicum Z188 to obtain each recombinant bacterium. The recombinant plasmids were as follows: recombinant plasmid pTR-fxpk, recombinant plasmid pTR-M21, recombinant plasmid pTR-M41, recombinant plasmid pTR-M71, recombinant plasmid pTR-M81, recombinant plasmid pTR-M82, recombinant plasmid pTR-T2A, recombinant plasmid pTR-I6T, recombinant plasmid pTR-H260Y, recombinant plasmid pTR-T2A/I6T and recombinant plasmid pTR-T2A/I6T/H260Y.

And (3) detecting the ability of the test strain to produce glutamic acid by fermentation. The test strains were as follows: corynebacterium glutamicum Z188 and the respective recombinant bacteria prepared above.

Seed culture medium: 50g/L of glucose, 0.7g/L of phosphoric acid, 0.8g/L of magnesium sulfate heptahydrate, 10g/L of ammonium sulfate, 84g/L of 3- (N-malineline) propanesulfonic acid, 3g/L of corn flour, 10g/L of urea, 1g/L of peptone, 0.5g/L of yeast powder and the balance of water, and the pH value is adjusted to 7.0 by using sodium hydroxide. The fermentation medium differs from the seed medium only in that no peptone and yeast powder are added.

A single clone of a test strain is taken and inoculated into 5ml of seed culture medium, and the seed liquid is obtained after shaking culture at the temperature of 30 ℃ and the rpm of 850 for 12 hours. Taking a 96-well plate, adding 150 mu l of fermentation medium into each well, then inoculating the seed solution with the inoculation amount of 10%, then culturing for 33 hours at 30 ℃ and 850rpm in a shaking way, then detecting the glutamic acid yield (glutamic acid content in each liter of system) and the glucose consumption by using an SBA-40D biosensor analyzer, and calculating the conversion rate from glucose to glutamic acid.

The results are shown in FIG. 4. It can be seen that the tested FXPK mutant proteins are both able to increase the production and conversion of glutamate compared to the wild type FXPK protein.

Example 7 Effect of the respective proteins on succinic acid production by fermentation of E.coli

The recombinant plasmids and the recombinant plasmid pTR-fxpk constructed in the first step of the embodiment 4 are used for transforming the succinic acid producing strains of escherichia coli (CGMCC No.5107, CGMCC No.5108 or CGMCC No.5109, Chinese patent ZL201110264353.9) so as to obtain the succinic acid producing strains carrying wild-type fxpk genes and different fxpk mutant genes. The ability of the strain to produce succinic acid was tested using the fermentation conditions for succinic acid production described in chinese patent ZL 201110264353.9. Compared with wild FXPK, the protease activity of each FXPK mutant is obviously improved. Compared with a parallel strain carrying wild type fxpk genes, the strain carrying each fxpk mutant gene has obviously improved succinic acid production capacity and obviously improved saccharic acid conversion rate.

Example 8 Effect of the respective proteins on the fermentative production of Glutamine by Corynebacterium glutamicum

Glutamine can be produced by mutating glutamine synthetase with Y405F on the basis of the glutamic acid-producing strain Z188 according to the literature report (Liu, Q., et al.2008.appl Microbiol Biotechnol 77(6): 1297-1304.). Each of the recombinant plasmids constructed in step one of example 4 and the recombinant plasmid pTR-fxpk was transformed into a constructed glutamine producing strain, and the ability of the strain to produce glutamine was tested using the glutamine fermentation conditions described in the literature (Liu, Q., et al.2008.appl Microbiol Biotechnol 77(6): 1297-1304.). Compared with wild FXPK, the protease activity of each FXPK mutant is obviously improved. Compared with a parallel strain carrying wild type fxpk genes, the strain carrying each fxpk mutant gene has obviously improved glutamine producing capability and obviously improved saccharic acid conversion rate.

Example 9 Effect of the respective proteins on proline production by fermentation of E.coli

Coli proline producing strain DH5 α (pSW2) is e.coli DH5 α carrying plasmid pSW2, wherein plasmid pSW2 is constructed by ligating the gene of glutamate kinase proB74 [ proB (NCBI-GI:16128228) Asp 107 to Asn ] and the gene of glutamate semialdehyde dehydrogenase proA (NCBI-GI:16128229) to plasmid puc19 (example 5 in chinese patent 2014107400221).

The recombinant plasmids constructed in the first step of example 4 and the recombinant plasmid pTR-FXPK are used for transforming an Escherichia coli proline-producing strain DH5 α (pSW 2). The strain is tested for the capacity of producing proline by using the fermentation conditions described in example 5 of Chinese patent 2014107400221.

Example 10 Effect of the respective proteins on the fermentative production of trans-4-hydroxy-L-proline in E.coli

Coli trans-4-hydroxy-L-proline producing strain DH5 α (pSW3) is E.coli DH5 α carrying plasmid pSW3, wherein plasmid pSW3 is constructed by further connecting L-proline-4-hydroxylase to plasmid pSW2 in the patent (Chinese patent No. 2014107400221).

The recombinant plasmids constructed in the first step of example 4 and the recombinant plasmid pTR-FXPK are used for transforming an escherichia coli trans-4-hydroxy-L-proline producing strain DH5 α (pSW3), the fermentation conditions described in example 5 of Chinese patent 2014107400221 are used for testing the capacity of the strain for producing trans-4-hydroxy-L-proline, the protease activity of each FXPK mutant is obviously improved compared with wild-type FXPK, the capacity of the strain carrying each FXPK mutant gene for producing trans-4-hydroxy-L-proline is obviously improved compared with a parallel strain carrying the wild-type FXPK gene, and the saccharic acid conversion rate is obviously improved.

Example 11 Effect of the respective proteins on citric acid production by fermentation of Aspergillus niger

Using the recombinant plasmid pTR-Fxpk as a template, Fxpk-Fm (Fxpk-Fm: att)ctcgagATGACCTCTCCGGTTATCG) and Fxpk-Rm (Fxpk-Rm: aatgcatgcTCATTCGTTGTCACCCG) to amplify the wild-type fxpk gene, and adding XhoI and SphI enzyme cutting sites at the 5 'end and the 3' end respectively. Then, the gene is inserted into an Aspergillus niger expression plasmid pSilent-1(Genbank ID: AB303070) by XhoI and SphI double enzyme digestion, and the Aspergillus niger expression plasmid pSil-fxpk of the fxpk gene with PtrpC as a promoter and TtrpC as a terminator is obtained.

An A.niger expression plasmid for the mutant gene was prepared from each recombinant plasmid constructed in step one of example 4, in accordance with the above-described method.

The plasmids were transformed into protoplasts of A.niger Co827(CICC 40347), respectively. The ability of recombinant aspergillus niger to produce citric acid was tested using the fermentation conditions described in the example of chinese patent 201710022533.3. Compared with wild FXPK, the protease activity of each FXPK mutant is obviously improved. Compared with a parallel strain carrying wild type fxpk genes, the strain carrying each fxpk mutant gene has obviously improved citric acid production capability and obviously improved sugar-acid conversion rate.

SEQUENCE LISTING

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> phosphoketolase with improved activity and use thereof in the production of metabolites

<130>GNCYX200753

<160>6

<170>PatentIn version 3.5

<210>1

<211>346

<212>PRT

<213>Corynebacterium glutamicum

<400>1

Met Glu Asp Met Arg Ile Ala Thr Leu Thr Ser Gly Gly Asp Cys Pro

1 5 10 15

Gly Leu Asn Ala Val Ile Arg Gly Ile Val Arg Thr Ala Ser Asn Glu

20 25 30

Phe Gly Ser Thr Val Val Gly Tyr Gln Asp Gly Trp Glu Gly Leu Leu

35 40 45

Ala Asp Arg Arg Val Gln Leu Tyr Asp Asp Glu Asp Ile Asp Arg Ile

50 55 60

Leu Leu Arg Gly Gly Thr Ile Leu Gly Thr Gly Arg Leu His Pro Asp

65 70 75 80

Lys Phe Lys Ala Gly Ile Asp Gln Ile Lys Ala Asn Leu Glu Asp Ala

85 90 95

Gly Ile Asp Ala Leu Ile Pro Ile Gly Gly Glu Gly Thr Leu Lys Gly

100 105 110

Ala Lys Trp Leu Ser Asp Asn Gly Ile Pro Val Val Gly Val Pro Lys

115 120 125

Thr Ile Asp Asn Asp Val Asn Gly Thr Asp Phe Thr Phe Gly Phe Asp

130 135 140

Thr Ala Val Ala Val Ala Thr Asp Ala Val Asp Arg Leu His Thr Thr

145 150 155 160

Ala Glu Ser His Asn Arg Val Met Ile Val Glu Val Met Gly Arg His

165 170 175

Val Gly Trp Ile Ala Leu His Ala Gly Met Ala Gly Gly Ala His Tyr

180 185 190

Thr Val Ile Pro Glu Val Pro Phe Asp Ile Ala Glu Ile Cys Lys Ala

195 200 205

Met Glu Arg Arg Phe Gln Met Gly Glu Lys Tyr Gly Ile Ile Val Val

210 215 220

Ala Glu Gly Ala Leu Pro Arg Glu Gly Thr Met Glu Leu Arg Glu Gly

225 230 235 240

His Ile Asp Gln Phe Gly His Lys Thr Phe Thr Gly Ile Gly Gln Gln

245 250 255

Ile Ala Asp Glu Ile His Ala Arg Leu Gly His Asp Val Arg Thr Thr

260 265 270

Val Leu Gly His Ile Gln Arg Gly Gly Thr Pro Thr Ala Phe Asp Arg

275 280 285

Val Leu Ala Thr Arg Tyr Gly Val Arg Ala Ala Arg Ala Cys His Glu

290 295 300

Gly Ser Phe Asp Lys Val Val Ala Leu Lys Gly Glu Arg Ile Glu Met

305 310 315 320

Ile Thr Phe Glu Asp Ala Val Gly Thr Leu Lys Glu Val Pro Phe Glu

325330 335

Arg Trp Val Thr Ala Gln Ala Met Phe Gly

340 345

<210>2

<211>3041

<212>DNA

<213>Corynebacterium glutamicum

<400>2

accgaggacc agtggcaggc ctccaagcgg gagttcaatg agcaaaatga ggcagaagaa 60

ctcgtgctca gcaaggcata agggcaaggg gttctagaaa gaccaacgga cgtgttttcc 120

cagctcccat tggtttaaaa agctcatttc gaggcctgaa cgtgcgaatc aggacaaaac 180

tcgagtagcc cggaatgatt ttggtttcct tctgcgagtt cgccatgtgg ctgcggtaaa 240

actgccccgg aaccggaata tctcgacgcc acagaacgcc atttgcgggc cttaacaccc 300

cgtgggcata ccttttaccg attccagata ttcggtcgct tatattgcct agtgtgattc 360

caaacagaaa actggggcga cctctaataa gagtcgcccc gataagtttt ttaccgtaat 420

tattactggg agtcagatac tgcgtaagca atcgcagcag cgccagcggt cacagtaaga 480

actgcaggcc acgcgccaat cttcttggca agtgggtggg acaggccaaa tgcaccaacg 540

taggttgtca gcaggccagt agctactgca ggacccttct tttcattcca gcttcgtgca 600

gcaagcgctc cggatgctgc caatggaatg gtgcccagtg ggcgaatgcc ggattcacgg 660

gcagtcaacc aaccgccgat caaacctgct gcgacgacgg tggcagtgct gacctgggat 720

gcctttttca atttcatttc catggtgagc cagtctagag acaaaatttt tccgcggggt 780

tttcttgatc tgatccgaca agccaatggg ggaaaaaatg tgtccgacca aaaattgtgc 840

agcacaccac atgcccgctc ggacaatgtc gatttgttaa tgaaactgca gctctggcga 900

ttaaataagg tggtcagaga caatttttcg gccggtcaac ccctgtgatt ttcttatttt 960

tgggtgattg ttccggcgcg ggtgttgtga tgggtttaat atggaagaca tgcgaattgc 1020

tactctcacg tcaggcggcg actgccccgg actaaacgcc gtcatccgag gaatcgtccg 1080

cacagccagc aatgaatttg gctccaccgt cgttggttat caagacggtt gggaaggact 1140

gttagccgat cgtcgcgtac agctgtatga cgatgaagat attgaccgaa tcctccttcg 1200

aggcggcacc attttgggca ctggtcgcct ccatccggac aagtttaagg ccggaattga 1260

tcagattaag gccaacttag aagacgccgg catcgatgcc cttattccaa tcggtggcga 1320

aggaaccctg aagggtgcca agtggctgtc tgataacggt atccctgttg tcggtgtccc 1380

aaagaccatt gacaatgacg tgaatggcac tgacttcacc ttcggtttcg atactgctgt 1440

tgcagtggct accgacgctg ttgaccgcct gcacaccacc gctgaatctc acaaccgtgt 1500

gatgattgtg gaggtcatgg gccgccacgt gggttggatt gctctgcacg caggtatggc 1560

cggcggtgct cactacaccg ttatcccaga agttcctttc gatattgcag agatctgcaa 1620

ggcgatggaa cgtcgcttcc agatgggcga gaagtacggc attatcgtcg ttgcggaagg 1680

tgcattgcca cgcgaaggca ccatggaact tcgtgaaggc cacattgacc agttcggcca 1740

caagaccttc accggaatcg gccagcagat tgctgatgaa atccatgcgc gcctcggtca 1800

cgatgttcgt accaccgttc ttggccacat tcagcgtggt ggaaccccga ctgctttcga 1860

ccgtgttctg gccactcgtt atggtgttcg ggcagctcgt gcatgccatg agggaagctt 1920

tgacaaggtt gttgccttga agggtgagcg catcgagatg atcacctttg aagatgccgt 1980

cggaaccttg aaggaagttc cattcgagcg ctgggttact gcccaggcaa tgtttggata 2040

gtttttcggg cttttatcaa cagccaataa cagctctttc gcccattgag gtggaggggc 2100

tgttttttca tgccgtaagg aaggtgcaag taagtgaaat caagtggcat agatccattg 2160

atgcttagac tgtgacctag gcttgacttt cgtgggggag tggggataag ttcatcttaa 2220

acacaatgca atcgattgca tttacattcc ttatcccaca ataggggtac cttccagaaa 2280

gttggtgagg agatggcttc cgaaacctcc agcccgaaga agcgggccac cacactcaaa 2340

gacatcgcgc aaacaacaca gctttcagtc agcacggtgt cccgggcatt ggccaacaac 2400

gcgagcattc cggaatccac acgcatccga gtggttgaag ccgctcaaaa gctgaactac 2460

cgtcccaatg cccaagctcg tgcattgcgg aagtcgagga cagacaccat cggtgtcatc 2520

attccaaaca ttgagaaccc atatttctcc tcactagcag catcgattca aaaagctgct 2580

cgtgaagctg gggtgtccac cattttgtcc aactctgaag aaaacccaga gctgcttggt 2640

cagactttgg cgatcatgga tgaccaacgc ctcgatggaa tcatcgtggt gccacacatt 2700

cagtcagagg aacaagtcac tgacttggtt accaggggag tgccagtagt gctggcagac 2760

cgtagttttg ttaactcgtc tattccttcg gttacctcag atccagttcc gggcatgact 2820

gaagctgtgg acttactcct ggcagctgac gtgcaattgg gctaccttgc cggcccgcag 2880

gatacttcca ctggtcagct gcgtcttaac acttttgaaa gactatgcgt ggaccgcggc 2940

atcgtcggag catctgtcta ttacggtggc taccgccaag aatctggata tgacggcatc 3000

aaggtgctga tcaaacaggg agccaatgcg attatcgctg g 3041

<210>3

<211>825

<212>PRT

<213>Bifidobacterium

<400>3

Met Thr Ser Pro Val Ile Gly Thr Pro Trp Lys Lys Leu Asn Ala Pro

1 5 10 15

Val Ser Glu Glu Ala Ile Glu Gly Val Asp Lys Tyr Trp Arg Ala Ala

20 25 30

Asn Tyr Leu Ser Ile Gly Gln Ile Tyr Leu Arg Ser Asn Pro Leu Met

35 40 45

Lys Glu Pro Phe Thr Arg Glu Asp Val Lys His Arg Leu Val Gly His

50 55 60

Trp Gly Thr Thr Pro Gly Leu Asn Phe Leu Ile Gly His Ile Asn Arg

65 70 75 80

Leu Ile Ala Asp His Gln Gln Asn Thr Val Ile Ile Met Gly Pro Gly

85 90 95

His Gly Gly Pro Ala Gly Thr Ala Gln Ser Tyr Leu Asp Gly Thr Tyr

100 105 110

Thr Glu Tyr Phe Pro Asn Ile Thr Lys Asp Glu Ala Gly Leu Gln Lys

115 120 125

Phe Phe Arg Gln Phe Ser Tyr Pro Gly Gly Ile Pro Ser His Tyr Ala

130 135 140

Pro Glu Thr Pro Gly Ser Ile His Glu Gly Gly Glu Leu Gly Tyr Ala

145 150 155 160

Leu Ser His Ala Tyr Gly Ala Val Met Asn Asn Pro Ser Leu Phe Val

165 170 175

Pro Ala Ile Val Gly Asp Gly Glu Ala Glu Thr Gly Pro Leu Ala Thr

180 185 190

Gly Trp Gln Ser Asn Lys Leu Ile Asn Pro Arg Thr Asp Gly Ile Val

195 200 205

Leu Pro Ile Leu His Leu Asn Gly Tyr Lys Ile Ala Asn Pro Thr Ile

210 215 220

Leu Ser Arg Ile Ser Asp Glu Glu Leu His Glu Phe Phe His Gly Met

225 230 235 240

Gly Tyr Glu Pro Tyr Glu Phe Val Ala Gly Phe Asp Asn Glu Asp His

245 250 255

Leu Ser Ile His Arg Arg Phe Ala Glu Leu Phe Glu Thr Val Phe Asp

260 265 270

Glu Ile Cys Asp Ile Lys Ala Ala Ala Gln Thr Asp Asp Met Thr Arg

275 280 285

Pro Phe Tyr Pro Met Ile Ile Phe Arg Thr Pro Lys Gly Trp Thr Cys

290 295 300

Pro Lys Phe Ile Asp Gly Lys Lys Thr Glu Gly Ser Trp Arg Ser His

305 310 315 320

Gln Val Pro Leu Ala Ser Ala Arg Asp Thr Glu Ala His Phe Glu Val

325 330 335

Leu Lys Asn Trp Leu Glu Ser Tyr Lys Pro Glu Glu Leu Phe Asp Glu

340 345 350

Asn Gly Ala Val Lys Pro Glu Val Thr Ala Phe Met Pro Thr Gly Glu

355 360 365

Leu Arg Ile Gly Glu Asn Pro Asn Ala Asn Gly Gly Arg Ile Arg Glu

370 375 380

Glu Leu Lys Leu Pro Lys Leu Glu Asp Tyr Glu Val Lys Glu Val Ala

385 390 395 400

Glu Tyr Gly His Gly Trp Gly Gln Leu Glu Ala Thr Arg Arg Leu Gly

405 410 415

Val Tyr Thr Arg Asp Ile Ile Lys Asn Asn Pro Asp Ser Phe Arg Ile

420 425 430

Phe Gly Pro Asp Glu Thr Ala Ser Asn Arg Leu Gln Ala Ala Tyr Asp

435 440 445

Val Thr Asn Lys Gln Trp Asp Ala Gly Tyr Leu Ser Ala Gln Val Asp

450 455 460

Glu His Met Ala Val Thr Gly Gln Val Thr Glu Gln Leu Ser Glu His

465 470 475 480

Gln Met Glu Gly Phe Leu Glu Gly Tyr Leu Leu Thr Gly Arg His Gly

485 490 495

Ile Trp Ser Ser Tyr Glu Ser Phe Val His Val Ile Asp Ser Met Leu

500 505 510

Asn Gln His Ala Lys Trp Leu Glu Ala Thr Val Arg Glu Ile Pro Trp

515 520 525

Arg Lys Pro Ile Ser Ser Met Asn Leu Leu Val Ser Ser His Val Trp

530 535 540

Arg Gln Asp His Asn Gly Phe Ser His Gln Asp Pro Gly Val Thr Ser

545 550 555 560

Val Leu Leu Asn Lys Cys Phe Asn Asn Asp His Val Ile Gly Ile Tyr

565 570 575

Phe Pro Val Asp Ser Asn Met Leu Leu Ala Val Ala Glu Lys Cys Tyr

580 585 590

Lys Ser Thr Asn Lys Ile Asn Ala Ile Ile Ala Gly Lys Gln Pro Ala

595 600 605

Ala Thr Trp Leu Thr Leu Asp Glu Ala Arg Ala Glu Leu Glu Lys Gly

610 615 620

Ala Ala Glu Trp Lys Trp Ala Ser Asn Val Lys Ser Asn Asp Glu Ala

625 630 635 640

Gln Ile Val Leu Ala Ala Thr Gly Asp Val Pro Thr Gln Glu Ile Met

645 650 655

Ala Ala Ala Asp Lys Leu Asp Ala Met Gly Ile Lys Phe Lys Val Val

660 665 670

Asn Val Val Asp Leu Val Lys Leu Gln Ser Ala Lys Glu Asn Asn Glu

675 680 685

Ala Leu Ser Asp Glu Glu Phe Ala Glu Leu Phe Thr Glu Asp Lys Pro

690 695 700

Val Leu Phe Ala Tyr His Ser Tyr Ala Arg Asp Val Arg Gly Leu Ile

705 710 715 720

Tyr Asp Arg Pro Asn His Asp Asn Phe Asn Val His Gly Tyr Glu Glu

725 730 735

Gln Gly Ser Thr Thr Thr Pro Tyr Asp Met Val Arg Val Asn Asn Ile

740 745 750

Asp Arg Tyr Glu Leu Gln Ala Glu Ala Leu Arg Met Ile Asp Ala Asp

755 760 765

Lys Tyr Ala Asp Lys Ile Asn Glu Leu Glu Ala Phe Arg Gln Glu Ala

770 775 780

Phe Gln Phe Ala Val Asp Asn Gly Tyr Asp His Pro Asp Tyr Thr Asp

785 790 795 800

Trp Val Tyr Ser Gly Val Asn Thr Asn Lys Gln Gly Ala Ile Ser Ala

805 810 815

Thr Ala Ala Thr Ala Gly Asp Asn Glu

820 825

<210>4

<211>2478

<212>DNA

<213>Bifidobacterium

<400>4

atgacctctc cggttatcgg taccccgtgg aaaaaactga acgcgccggt ttctgaagaa 60

gcgatcgaag gtgttgacaa atactggcgt gcggcgaact acctgtctat cggtcagatc 120

tacctgcgtt ctaacccgct gatgaaagaa ccgttcaccc gtgaagacgt taaacaccgt 180

ctggttggtc actggggtac caccccgggt ctgaacttcc tgatcggtca catcaaccgt 240

ctgatcgcgg accaccagca gaacaccgtt atcatcatgg gtccgggtca cggtggtccg 300

gcgggtaccg cgcagtctta cctggacggt acctacaccg aatacttccc gaacatcacc 360

aaagacgaag cgggtctgca gaaattcttc cgtcagttct cttacccggg tggtatcccg 420

tctcactacg cgccggaaac cccgggttct atccacgaag gtggtgaact gggttacgcg 480

ctgtctcacg cgtacggtgc ggttatgaac aacccgtctc tgttcgttcc ggcgatcgtt 540

ggtgacggtg aagcggaaac cggtccgctg gcgaccggtt ggcagtctaa caaactgatc 600

aacccgcgta ccgacggtat cgttctgccg atcctgcacc tgaacggtta caaaatcgcg 660

aacccgacca tcctgtctcg tatctctgac gaagaactgc acgagttctt ccacggtatg 720

ggttacgaac cgtacgagtt cgttgcgggt ttcgacaacg aagaccacct gtctatccac 780

cgtcgtttcg cggaactgtt cgaaaccgtt ttcgacgaaa tctgcgacat caaagcggcg 840

gcgcagaccg acgacatgac ccgtccgttc tacccgatga tcatcttccg taccccgaaa 900

ggttggacct gcccgaaatt catcgacggt aaaaaaaccg aaggttcttg gcgttctcac 960

caggttccgc tggcgtctgc gcgtgacacc gaagcgcact tcgaagttct gaaaaactgg 1020

ctggaatctt acaaaccgga agaactgttc gacgaaaacg gtgcggttaa accggaagtt 1080

accgcgttca tgccgaccgg tgaactgcgt atcggtgaaa acccgaacgc gaacggtggt 1140

cgtatccgtg aagaactgaa actgccgaaa ctggaagact acgaagttaa agaagttgcg 1200

gaatacggtc acggttgggg tcagctggaa gcgacccgtc gtctgggtgt ttacacccgt 1260

gacatcatca aaaacaaccc ggactctttc cgtatcttcg gtccggacga aaccgcgtct 1320

aaccgtctgc aggcggcgta cgacgttacc aacaaacagt gggacgcggg ttacctgtct 1380

gcgcaggttg acgaacacat ggcggttacc ggtcaggtta ccgaacagct gtctgaacac 1440

cagatggaag gtttcctgga aggttacctg ctgaccggtc gtcacggtat ctggtcttct 1500

tacgaatctt tcgttcacgt tatcgactct atgctgaacc agcacgcgaa atggctggaa 1560

gcgaccgttc gtgaaatccc gtggcgtaaa ccgatctctt ctatgaacct gctggtttct 1620

tctcacgtttggcgtcagga ccacaacggt ttctctcacc aggacccggg tgttacctct 1680

gttctgctga acaaatgctt caacaacgac cacgttatcg gtatctactt cccggttgac 1740

tctaacatgc tgctggcggt tgcggaaaaa tgctacaaat ctaccaacaa aatcaacgcg 1800

atcatcgcgg gtaaacagcc ggcggcgacc tggctgaccc tggacgaagc gcgtgcggaa 1860

ctggaaaaag gtgcggcgga atggaaatgg gcgtctaacg ttaaatctaa cgacgaagcg 1920

cagatcgttc tggcggcgac cggtgacgtt ccgacccagg aaatcatggc ggcggcggac 1980

aaactggacg cgatgggtat caaattcaaa gttgttaacg ttgttgacct ggttaaactg 2040

cagtctgcga aagaaaacaa cgaagcgctg tctgacgaag agttcgcgga actgttcacc 2100

gaagacaaac cggttctgtt cgcgtaccac tcttacgcgc gtgacgttcg tggtctgatc 2160

tacgaccgtc cgaaccacga caacttcaac gttcacggtt acgaagaaca gggttctacc 2220

accaccccgt acgacatggt tcgtgttaac aacatcgacc gttacgaact gcaggcggaa 2280

gcgctgcgta tgatcgacgc ggacaaatac gcggacaaaa tcaacgaact ggaagcgttc 2340

cgtcaggaag cgttccagtt cgcggttgac aacggttacg accacccgga ctacaccgac 2400

tgggtttact ctggtgttaa caccaacaaa cagggtgcga tctctgcgac cgcggcgacc 2460

gcgggtgaca acgaatga 2478

<210>5

<211>252

<212>DNA

<213>Artificial sequence

<400>5

cgactgcacg gtgcaccaat gcttctggcg tcaggcagcc atcggaagct gtggtatggc 60

tgtgcaggtc gtaaatcact gcataattcg tgtcgctcaa ggcgcactcc cgttctggat 120

aatgtttttt gcgccgacat cataacggtt ctggcaaata ttctgaaatg agctgttgac 180

aattaatcat ccggctcgta taatgtgtgg aattgtgagc ggataacaat ttcacacagg 240

aaacagacca tg 252

<210>6

<211>252

<212>DNA

<213>Artificial sequence

<400>6

cgactgcacg gtgcaccaat gcttctggcg tcaggcagcc atcggaagct gtggtatggc 60

tgtgcaggtc gtaaatcact gcataattcg tgtcgctcaa ggcgcactcc cgttctggat 120

aatgtttttt gcgccgacat cataacggtt ctggcaaata ttctgaaatg agctgttgac 180

aattaatcat ccggctcgta taatgtgtgg aattgtgagc ggataacaat ctcacacagg 240

aaacagacca tg 252

Claims

1. The mutant protein is obtained by mutating phosphoketolase as follows: the 6 th amino acid residue corresponding to the sequence 3 is mutated from I to T.

2. A fusion protein obtained by fusing the mutant protein of claim 1 to a protein tag.

3. A polynucleotide encoding the mutant protein of claim 1 or a polynucleotide encoding the fusion protein of claim 2.

4. An expression cassette, recombinant vector, recombinant microorganism or recombinant cell ex vivo having the polynucleotide of claim 3.

5. The use of a specific substance for the preparation of a metabolite;

the specific substances are: a mutant protein according to claim 1, or a fusion protein according to claim 2, or a polynucleotide according to claim 3, or an expression cassette according to claim 4, or a recombinant vector according to claim 4, or a recombinant microorganism according to claim 4, or a recombinant cell according to claim 4 ex vivo;

the metabolite is a metabolite derived from acetyl-CoA.

6. A method for improving the enzymatic activity of phosphoketolase comprises the following steps:

phosphoketolase was mutated as follows: the 6 th amino acid residue corresponding to the sequence 3 is mutated from I to T.

7. A method of preparing a metabolite comprising the steps of: preparing a metabolite by culturing the recombinant microorganism of claim 4; the metabolite is a metabolite derived from acetyl-CoA.

8. The method of claim 7, wherein: the method further comprises the step of separating and purifying the metabolite from the culture system.