KR102149044B1 - Method of producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid - Google Patents

Abstract

The present invention provides a newly proposed biosynthetic pathway that takes homoserine production as an intermediate step for the production of 2-hydroxy gamma butyrolactone (HGBL) and its precursor, 2,4-dihydroxybutanoic acid, and a recombinant strain having this pathway. In the case of HGBL with a hydroxyl group substituted at the second position, it can be used as an important intermediate that can be used as a resin for photoresist, a raw material for pharmaceuticals, and a material for coating metal surfaces.

Description

Method for producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid TECHNICAL FIELD [Method of producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid]

The present invention provides a newly proposed biosynthetic pathway that takes homoserine production as an intermediate step for the production of 2-hydroxy gamma butyrolactone (HGBL) and its precursor, 2,4-dihydroxybutanoic acid, and a recombinant strain having this pathway. In the case of HGBL with a hydroxyl group substituted at the second position, it is an important intermediate that can be used as a resin for photoresist, a raw material for pharmaceuticals, and a material for coating metal surfaces.

U.S. Patents 4,994,597 and 5,087,751 (Inone) disclose 3,4-dihydroxybutyric acid derivatives. This acid preparation method is distinguished from the present invention in which the reaction and hydrolysis of metal cyanide and 3,4-dihydroxy butyl chloride are involved. The acid is an intermediate of 3-hydroxybutyrolactone.

(S)-3-hydroxybutyrolactone is a key 4-carbon intermediate for the manufacture of intermediates for a variety of drugs, including cholesterol lowering drugs, (S)-carnitine, anti-HIV protease inhibitors, and a wide range of antibiotics.

(R)-3-hydroxybutyrolactone or (R)-3,4-dihydroxybutyric acid gamma lactone is a key 4-carbon intermediate for the manufacture of various pharmaceutical intermediates. It can also be converted to 1-carnitine, a naturally occurring vitamin, and ingredients used in a number of applications including health food additives and tonic supplements, treatment of various nervous system and metabolic disorders. The carnitine market is in the hundreds of tons. It is prepared as a purely separated product in the form d and l. However, there are no direct synthetic routes of commercial value yet.

(S)-3-hydroxybutyrolactone can be prepared by the Hollingsworth process (US Patent 5,374,773). (R)-3-hydroxybutyrolactone cannot be prepared by this process since it is necessary to use a starting material having a 4-linked L-hexose. This material is unknown.

The general lactone production method is known by the following patents:

U.S. Patent No. 3,024,250 to Klein et al.,

U.S. Patent No. 3,868,370 to Smith,

U.S. Patent No. 3,997,569 to Powell,

U.S. Patent No. 4,105,674 to De Thomas et al.,

U.S. Patent No. 4,155,919 to Ramiouille et al.,

U.S. Patent No. 4,772,729 to Rao,

U.S. Patent No. 4,940,805 to Fisher et al.,

U.S. Patent No. 5,292,939 to Hollingsworth,

U.S. Patent No. 5,319,110 to Hollingsworth,

U.S. Patent No. 5,374,773 to Hollingsworth,

U.S. Patent No. 5,502,217 to Fuchikami et al.

These patents disclose various lactone manufacturing processes. However, neither of these mentions the production process of gammabutyrolactone at the 2-hydroxy position.

The present invention uses glucose as a carbon source, and uses 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone having optical activity at position 2 carbon. gamma butyrolactone), comprising the step of mutating the microorganism by performing one or more steps selected from the following (1) to (4), 2,4-dihydroxy-butyrate or 2-hydroxy- It provides a method for producing a gamma-butyrolactone producing microbial variant.

(1) deletion of one or more genes selected from the group consisting of ptsG, eda, adhE, pf1B, lysA, thrBC, metA, LacI, ldhA, and iclR genes, or one or more selected from the group consisting of acs, ppc, and metL genes Overexpressing a gene, or performing both,

(2) overexpressing one or more genes selected from the group consisting of epd, dxs, and pdxj genes,

(3) overexpressing one or more genes of lpd and ducA , and

(4) Deleting one or more genes selected from the group consisting of kgtP, dsdx, and actP genes.

In addition, the present invention is the genome of a microorganism producing 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone, in the genome of any one or more of the above (1) to (4). Is introduced, 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone producing microbial variant is provided.

In addition, the present invention comprises the step of culturing the microorganism variant, 2-hydroxy gamma butyrolactone (2-hydroxy gamma butyrolactone) or 2,4-dihydroxy butyrate (2,4-dihydroxy butanoic acid) It provides the production method of

In addition, the present invention comprises a microbial variant or a culture thereof, 2-hydroxy gamma butyrolactone (2-hydroxy gamma butyrolactone) or 2,4-dihydroxy butyrate (2,4-dihydroxy butanoic acid) It provides a composition for the production of.

In addition, the present invention provides a transaminase mutant consisting of the amino acid sequence of SEQ ID NO: 13, a transaminase mutant consisting of the amino acid sequence of SEQ ID NO: 14, and a transaminase mutant consisting of the amino acid sequence of SEQ ID NO: 15. .

In addition, the present invention consists of the amino acid sequence of SEQ ID NO: 17, L-hydroxy-2-oxo-reductase mutant enzyme, consisting of the amino acid sequence of SEQ ID NO: 18, L-hydroxy-2-oxo-reductase It provides mutagenic enzymes.

In addition, the present invention, consisting of the amino acid sequence of SEQ ID NO: 20, D-hydroxy-2-oxo-reductase mutant enzyme, consisting of the amino acid sequence of SEQ ID NO: 21, D-hydroxy-2-oxo-reductase It provides mutagenic enzymes.

In addition, the present invention provides a lactonase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 22.

Provides a method of producing a pure isomer with optical activity or 2-hydroxy gamma butyrolactone in which two isomers are mixed or 2,4-dihydroxy butanoic acid, a precursor thereof, through a biosynthetic pathway from homoserine. An example of the method is schematically illustrated in FIG. 1.

In one example, the production method is to separate and purify 2,4-dihydroxy butanoic acid when 2,4-dihydroxy butanoic acid, which is a precursor of 2-hydroxy gamma butyrolactone, is produced in a state as an optically active pure isomer or a mixture thereof. Then, it may be a method of producing the final 2-hydroxy gamma butyrolactone in the state of a pure optically active isomer or a mixture thereof by a chemical method.

The production method may include the step of removing the alpha-position amine group of the homoserine, and the enzyme used to remove the alpha-position amine group of the homoserine may be at least one selected from the group consisting of deaminase, dehydrogenase, and transaminase.

In one example, the production method may be to use a transaminase characterized by using α-ketoglutarate (α-KG) as an amino acceptor receiving an amino group from a homoserine.

In addition, the production method includes a pathway characterized by simultaneously using aspartate transaminase for the production of aspartic acid, a precursor of homoserine biosynthesis, while regenerating α-KG, an amino acceptor from glutamic acid produced from α-KG. I can.

In another example, the production method is a stereo-specific or non-specific reduction of oxygen bound to carbon 2 of 4-hydroxy-2-ox-butanoic acid in the reaction pathway shown in FIG. 1 to convert to a hydroxy group. The enzyme may include a pathway characterized by using L-lactate dehydrogenase and D-lactate dehydrogenase, or a combination enzyme thereof.

In another example, the paraoxonase shown in FIG. 1 is used by mutating a gene (PON1) having lactonase activity derived from human and is expressed in the periplasm of a strain designed to produce optically active 2-hydroxy gamma butyrolactone from homoserine. It provides a strain. The strain may be a homoserine over-producing strain having a homoserine over-producing characteristic.

In another example, in order to efficiently produce 2-hydroxy gamma butyrolactone having optical activity at the position 2 carbon from homoserine through the pathway shown in FIG. 1 and 2,4-dihydroxy butanoic acid, which is a precursor thereof, FIG. 4 As shown in, a genetically mutated strain designed to efficiently produce homoserine from sugar is provided. The strain may be a homoserine over-producing strain having a homoserine over-producing characteristic.

As a microorganism for producing the mutant strain, at least one microorganism selected from the group consisting of E. coli, yeast, Corynebacterium, etc. may be used.

The microorganism may be a microorganism characterized in that it is improved by using one or more selected from the following methods individually or in combination:

1. Overexpression of the phosphoenolpyruvate carboxylase (ppc) gene, which efficiently converts phosphoenolpyruvate (PEP) to oxaloacetic acid (OAA);

2. Overexpression of the acetyl-CoA synthase (acc) gene, which converts acetate produced during fermentation into acetyl CoA and helps microorganisms reuse it;

3. Removal of the iclR gene, which inhibits the expression of the glyoxylate shunt gene, to increase the activity of glyoxylate shunt;

4. To increase the efficiency of conversion of apspartic acid to aspartyl phosphate, the activity of apspartate kinase is improved. In order to enhance the expression of the thrABC gene encoding the apspartate kinase, the riboswitch of the thrABC operon, which is activated by isoleucine, is removed and the promoter strength is raised. Furthermore, in order to prevent the apspartate kinase enzyme from receiving feedback inhibition by threonine and lysine, the mutated enzyme was expressed so as not to receive feedback inhibition;

5. Removal of lysA coding for diaminopimelate decarboxylase to eliminate lysine production;

6. Remove the metA gene encoding homoserine succinyltransferase to eliminate methodine production;

7. The thrB gene coding for homoserine kinase was removed so that the produced homoserine was not converted to homoserine phosphate.

The above-described production method was introduced into the produced homoserine-overproducing strain to produce 2-hydroxy gamma butyrolactone having optical activity at the position 2 carbon from sugar, or 2,4-dihydroxy butanoic acid, a precursor thereof. Strains are provided. In this case, the strain may be characterized by enhancing the vitamin B6 biosynthetic pathway so that the biosynthesis of pyridoxal-5'-phosphate, a cofactor of transaminase, is promoted in order to increase the activity of transaminase.

The prepared strain may be a strain characterized by overexpressing a cell membrane transfer protein of 2,4-dihydroxybutanoic acid in order to quickly secrete 2,4-dihydroxybutanoic acid biosynthesized from sugar through homoserine out of cells.

In addition, there is provided a method of culturing the above-described strain to produce a pure isomer having optical activity or 2-hydroxy gamma butyrolactone in which two isomers are mixed and/or 2,4-dihydroxy butanoic acid, a precursor thereof, from a culture medium.

In the above method, in order to effectively produce 2-hydroxy gamma butyrolactone and/or 2,4-dihydroxy butanoic acid, which is a precursor thereof, yeast extract and ammonium salt are added as nitrogen sources, as well as amino acids specifically required by this strain, namely It may be characterized by culturing using a medium to which methionine, lysine, threonine, and isoleucine are appropriately added.

The culture is fed-batch for production of high concentration 2-hydroxy gamma butyrolactone and/or 2,4-dihydroxy butanoic acid, which is a precursor thereof, using a bioreactor, in the group consisting of sugar, methionine, lysine, threonine, and isoleucine during fermentation. It may be performed by adding one or more selected mixtures (eg, a mixture of methionine, lysine, threonine, and isoleucine).

The present invention uses glucose as a carbon source to produce optically pure 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone. 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone production comprising the step of mutating the microorganism by performing one or more steps selected from the following (1) to (4) on the microorganism It provides a method for producing a microbial variant.

(1) deletion of one or more genes selected from the group consisting of ptsG, eda, adhE, pf1B, lysA, thrB, metA, LacI, ldhA, and iclR genes, or one or more selected from the group consisting of acs, ppc, and metL genes Overexpressing a gene, or performing both,

(2) overexpressing one or more genes selected from the group consisting of epd, dxs , and pdx genes,

(3) overexpressing one or more genes of lpd and ducA , and

(4) Deleting one or more genes selected from the group consisting of kgtP, dsdx, and actP genes.

The type of the carbon source is not particularly limited, but it is appropriate that it is glucose.

The term "optically pure" refers to (2S)-2,4-dihydroxy-butyrate or (2R)-2,4-dihydroxy-butyrate or (2S)-2-hydroxy gamma butyro. The optical purity of each lactone or (2R)-2-hydroxy gamma butyrolactone is 90% to 100%, preferably 95% to 100%, more preferably 97% to 100%, for example 99% to It means 100%.

According to an example of the present invention, the microorganism producing the 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone is Although the type is not particularly limited, it may be one or more selected from the group consisting of E. coli , yeast, and Corynebacterium, and preferably E. coli.

According to one embodiment, performing one or more steps selected from (1) to (4) to mutate the microorganism may be performed simultaneously or sequentially, and each step is not necessarily performed in a time-series order. , The order of mutations (1) to (4) may be arbitrarily determined and performed, or two or more steps may be performed simultaneously and the remaining steps may be performed sequentially.

Preferably, the step of mutating the microorganism may be performed by including one or more steps selected from steps (1) and (2) to (4), and most preferably

It may include all steps (1) to (4).

According to an example of the present invention, lysA, thrBC, and metA among the genes that can be removed in step (1) are used to increase the accumulation of homoserine, an intermediate in microorganisms, for the purpose of inhibiting lysine, methionine, and threonine production pathways. To remove. Specifically, lysA encoding Diaminopimelate decboxylase, a gene encoding homoserine acid basic enzyme, met A encoding Homoserinesuccinyl Transferase, and thrBC encoding Homoserine Kinase and Threonine Synthase, respectively , can be removed.

Among the genes that can be removed in step (1), the ldhA, adhE, and pflB genes may be removed to prevent the production of by-products such as lactic acid, ethanol, and formic acid. Removal of these genes prevents by-product production and increases the carbon flux to the homoserine.

Among the genes that can be removed in step (1), the iclR gene is removed to increase the activity of glyoxylate shunt, which is one of the methods for promoting acetate reuse. The removal method may be a conventional method, but preferably pop- It can be removed by in pop-out method.

Among the genes that can be removed in step (1), the ptsG gene may be removed in order to remove overflow metabolism of glucose metabolism and to prevent the use of phosphoenol pyruvate (PEP) for cell membrane delivery of glucose. In this case, glucose is transported into the cell by other transfer proteins such as GalP, and it can be expected to prevent Carbon Catabolite Repression and prevent the generation of by-products due to overflow metabolism. The gene can be removed by a conventional method, but preferably, the gene can be removed by the MAGE method.

Among the genes that can be removed in step (1), the eda gene is a gene that encodes KHG/KDG aldolase, and when this gene is removed, the ED pathway is removed, thus facilitating the use of the EMP (Embden-Meyerhof-Parnas pathway) pathway. It can increase the carbon flux to oxaloacetate. The gene removal method may use a conventional method, but preferably, the MAGE method may be used.

Among the genes that can be removed in step (1), the lacI gene is to remove the lacI inhibitor for Lac promoter utilization, and the method of removing the gene may use a conventional method, but preferably the MAGE method can be used. have.

In the step (1), the gene overexpression may be performed using a conventional method. For example, a method such as introducing a large amount of a vector containing a gene into a microbial cell, or replacing an overexpression promoter may be used.

Specifically, the overexpression of the acs gene in step (1) may be to increase the expression of the acs gene in order to minimize the production of acetic acid. Deletion of the pta-ack and poxB genes is also possible, but deletion of these genes, particularly the deletion of the pta-ack gene, has a bad effect on cell growth, and thus was excluded.

The method of increasing the expression of the acs gene can be used without limitation, a method commonly used in the related art, but preferably the promoter of the acs- expressing gene can be replaced with a gene overexpression promoter, and the lac promoter, tac promoter, trc promoter Etc. can be used, preferably, it is appropriate to substitute the trc promoter.

(1) over-expression of the ppc gene in the step is intended to increase the expression of the ppc gene coding for the key enzyme of anaplerotic route phosphoenol pyruvate carboxylase In order to prevent the acetate generated improve the carbon flux into the homoserine, conventional gene The expression increase method can be used, and the promoter of the ppc gene can be replaced with a gene overexpression promoter, and preferably the existing promoter can be replaced with synthetic promoter 8 (SEQ ID NO: 23, TTTCAATTTAATCATCCGGCTCGTATAATGTGTGGA) to increase expression. For this, you can use the pop-in pop-out method.

The overexpression of the metL gene in step (1) is to optimize the pathway after aspartic acid known as a bottleneck in the homoserine production pathway. It is known that three aspartate kinases, namely AKI, AKII, and AKIII, play an important role in the production of homoserine. Among them, only two enzymes, AKII and AKIII, are known to show good activity at high homoserine concentrations. Among AKII and AKIII, AKII is It is known that it has aspartate kinase and serine dehydrogenase activity at the same time, which is more advantageous than AKIII. Therefore, the mutant strain of the present invention can overexpress the metL gene encoding the AKII enzyme.

The method for overexpressing the metL gene may be performed using a conventional method, preferably pUCPK plasmid, which is a medium copy plasmid. In this case, two types of lac promoter and trc promoter can be used to control the expression size of metL .

The genes to be deleted or overexpressed are summarized in Table 1.

According to an embodiment of the present invention, the step (1) deletes all of the ptsG, eda, adhE, pf1B, lysA, thrB, metA, LacI, ldhA, and iclR genes , and all of the acs, ppc, and metL genes. It may be to include the step of overexpressing.

According to an example of the present invention, step (2) is performed to increase the production of Vitamin B6, and in the case of E. coli, PLP (Pyridoxal-5-Phosphate) depends on DXP (1-deoxy-D-xylulose 5-phosphate) It is biosynthesized through pathways, and the rate of PLP biosynthesis is regulated by proteins encoded by epd, dxs, and pdxJ genes. Therefore, one or more of these three genes can be overexpressed to improve the rate of PLP biosynthesis. As for the overexpression method, a conventional method may be used, preferably, it is appropriate to replace the existing promoter with a synthetic promoter 9 (Table 5), and a Pop-in pop-out method may be used. The primers usable at this time are shown in Table 14.

Preferably, in step (2) , it is preferable to overexpress all of the epd, dxs, and pdxj genes.

In an example of the present invention, the increase in the expression level of ldp and dcuA in step (3) is performed to increase the extracellular transport rate of 2,4-dihydroxy-butyrate (DHB), and the organic acid membrane After selecting the importer and exporter by querying among the transport proteins, especially lactic acid and low molecular weight carboxylic acid transport proteins, the expression levels of the two most likely exporters, ldp and/or dcuA proteins To increase.

The method of increasing the expression of these proteins can use a conventional method, preferably a promoter (promoter) can be substituted, and since excessive expression of the membrane protein interferes with cell growth, the intermediate strength synthetic promoter SP5 (Synthetic promoter) It is preferable to use 5) or the like.

Preferably, the step (3) may overexpress all of the lpd and ducA genes.

In an example of the present invention, step (4) is performed to inhibit reintroduction of 2,4-dihydroxy-butyrate (DHB) into cells, and is expected to be the most likely importer 3 Any one or more of kgtP, dsdx, and actP , which are genes encoding dog membrane proteins, can be removed. Table 18 shows the primer sequences that can be used at this time.

Preferably, the step (4) may remove all of the kgtP, dsdx , and actP genes.

The mutant strains prepared using step (1) are listed in Table 2 (EcW1 to EcW13), and the mutant strains prepared by performing steps (1) and (2) are listed in Table 15 (EcW13 to EcW16), and (1) ), (2), (3) or/and (4) the mutant strains prepared by performing them are summarized in Table 19 (EcW16 to EcW20).

According to an embodiment of the present invention, the method for preparing the microbial variant further comprises the step of promoting the conversion of 4-hydroxy-2-oxo-butyrate from homoserine. Can be.

The step of promoting the conversion means to promote the conversion of 4-hydroxy-2-oxo-butyrate by removing the alpha-position amine group of homoserine, and specifically, treatment with transaminase. Thus, it may include the step of removing the alpha-position amine group of homoserine. The transaminase may be transformed by introducing a large amount of a vector containing the gene encoding the same into a microorganism, or a method of replacing the promoter of the gene encoding the transaminase with an overexpression promoter.

The type of transaminase is not particularly limited, but may be an enzyme using pyruvate as an amino group acceptor, specifically an enzyme consisting of the amino acid sequence of SEQ ID NO: 12, and the amino acid sequence of SEQ ID NO: 13 At least one selected from the group consisting of an enzyme consisting of, an enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and an enzyme consisting of the amino acid sequence of SEQ ID NO: 15 may be used, and preferably, an enzyme or sequence consisting of the amino acid sequence of SEQ ID NO: 13 It is preferable to use an enzyme consisting of the amino acid sequence of SEQ ID NO: 14 or an enzyme consisting of the amino acid sequence of SEQ ID NO: 15.

The gene encoding the enzyme composed of the amino acid sequence of SEQ ID NO: 12 may be composed of the nucleotide sequence of SEQ ID NO: 1, and the gene encoding the enzyme composed of the amino acid sequence of SEQ ID NO: 13 is composed of the nucleotide sequence of SEQ ID NO: 2 In addition, the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 14 may be a nucleotide sequence of SEQ ID NO: 3, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 15 is the nucleotide sequence of SEQ ID NO: 4 It may have been done.

According to an example of the present invention, the method for preparing the microorganism variant may further include a step of promoting conversion of 4-hydroxy-2-oxo-butyrate to 2,4-dihydroxy-butyrate. .

The step of promoting the conversion to 2,4-dihydroxy-butyrate means promoting the reduction of a ketone group located at carbon 2 of 4-hydroxy-2-oxo-butyrate. Transformation by introducing a vector containing a gene encoding a reductase reducing 4-hydroxy-2-oxo-butyrate into a microorganism, or replacing the promoter of the gene encoding a reductase with an overexpression promoter Method, etc. can be used.

According to an example of the present invention, 2,4-dihydroxy-butyrate prepared by the reduction reaction is pure optical isomers (2S)-2,4-dihydroxy-butyrate and (2R)-2 ,4-dihydroxy-butyrate may be one or more selected from the group consisting of, racemates, optical isomer mixtures may be prepared, (2S)-2,4-dihydroxy-butyrate or (2R) Each 100% pure single compound of -2,4-dihydroxy-butylate can be prepared. The kind of optical isomer of 2,4-dihydroxy-butyrate can be appropriately selected and prepared according to the application of the compound.

L-hydroxy-2-oxo-reductase (L-hydroxy-2-oxo-reductase) is overexpressed to accelerate the conversion of (2S)-2,4-dihydroxy-butyrate, and (2R) D-hydroxy-2-oxo-reductase can be overexpressed to facilitate conversion to -2,4-dihydroxy-butyrate.

According to a preferred embodiment of the present invention, the L-hydroxy-2-oxo-reductase is an enzyme consisting of the amino acid sequence of SEQ ID NO: 16, an enzyme consisting of the amino acid sequence of SEQ ID NO: 17, and the amino acid sequence of SEQ ID NO: 18. It may include one or more selected from the group consisting of enzymes, preferably an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 or/and an enzyme consisting of the amino acid sequence of SEQ ID NO: 18. The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 16 may be composed of the nucleotide sequence of SEQ ID NO: 5, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 17 is composed of the nucleotide sequence of SEQ ID NO: 6 The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 18 may be formed of the nucleotide sequence of SEQ ID NO: 7.

According to another example of the present invention, the D-hydroxy-2-oxo-reductase is an enzyme consisting of the amino acid sequence of SEQ ID NO: 19, an enzyme consisting of the amino acid sequence of SEQ ID NO: 20, and the amino acid of SEQ ID NO: 21 It may include one or more selected from the group consisting of enzymes consisting of a sequence, preferably an enzyme consisting of the amino acid sequence of SEQ ID NO: 20, or/and an enzyme consisting of the amino acid sequence of SEQ ID NO: 21. The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 19 may be composed of the nucleotide sequence of SEQ ID NO: 8, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 20 is composed of the nucleotide sequence of SEQ ID NO: 9 The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 21 may be formed of the nucleotide sequence of SEQ ID NO: 10.

According to an example of the present invention, the method may further comprise the step of promoting the production of 2-hydroxy-gamma-butyrolactone by promoting lactonation in 2,4-dihydroxy-butyrate. have. The promotion of lactonization may be performed by promoting the expression of lactonase, and the expression promoting method is to increase the amount of lactonase by introducing an excessive amount of a vector containing the lactonase gene into cells or the lactonase gene. Various methods can be used, such as substituting an overexpression promoter for a promoter that expresses.

Preferably, the promotion of lactonization may be performed by promoting the expression of lactonase consisting of the amino acid sequence of SEQ ID NO: 22, and the gene encoding lactonase consisting of the amino acid sequence of SEQ ID NO: 22 is It may be composed of the nucleotide sequence of SEQ ID NO: 11.

The resulting 2-hydroxy-gamma-butyrolactone is at least one selected from the group consisting of pure optical isomers (2S)-2-hydroxy gamma butyrolactone and (2R)-2-hydroxy gamma butyrolactone It may be, preferably (2S)-2-hydroxy gamma butyrolactone or (2R)-2-hydroxy gamma butyrolactone.

(2S)-2-hydroxy gamma butyrolactone or (2R)-2-hydroxy gamma butyrolactone produced by the above method has an optical purity of 90% to 100%, preferably 95% to 100%, More preferably, it may be 99% to 100%.

According to an example of the present invention, any one of (1) to (4) in the genome of a microorganism producing the 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone It is possible to provide a 2,4-dihydroxy-butylate or 2-hydroxy-gamma-butyrolactone-producing microbial variant into which the above genetic mutation has been introduced.

(1) one or more deletions selected from the group consisting of ptsG , eda , adhE , pf1B , lysA , thrB C, metA , LacI , ldhA , and iclR genes, or one or more genes selected from the group consisting of acs , ppc , and metL genes Overexpressing, or performing both;

(2) overexpression of one or more genes selected from the group consisting of epd , dxs , and pdx j genes,

(3) overexpression of one or more genes of ldp and ducA ,

(4) deletion of one or more genes selected from the group consisting of kgtP , dsdx , and actP genes.

According to an example of the present invention, the microbial variant is preferably pts, eda, lacI, thrB, metA, lysA, adhE, pflB, ldhA, and iclR genes are deleted, acs gene overexpression, and ppc gene overexpression Microbial variants can be prepared. The microbial variant may be the EcW13 strain shown in Table 15, preferably a strain of accession number KCCM12281P.

According to another example of the present invention, the microbial variant is in the genome of a microorganism producing 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone, ptsG, eda, adhE , pf1B, lysA, thrBC, metA, LacI, ldhA, iclR, kgtP, dsd, and actP genes are deleted, and acs, ppc, metL, epd, dxs, pdxj, ldp, and ducA genes are overexpressed. If it can be prepared, the microbial variant may be a strain of accession number KCCM12282P as the EcW20 strain tested in the following examples.

According to an example of the present invention, the microbial variant may further include one or more genes selected from the following (1) to (4) or a recombinant vector including the same.

(1) selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13, a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 15 One or more transaminase mutase-encoding genes,

(2) At least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 Enzyme encoding gene,

(3) At least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 21 An enzyme encoding gene, and

(4) A gene encoding a lactonease enzyme consisting of the amino acid sequence of SEQ ID NO: 22.

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 13 may be composed of the nucleotide sequence of SEQ ID NO: 2, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 14 may be composed of the nucleotide sequence of SEQ ID NO: 3 And, the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 15 may be one consisting of the nucleotide sequence of SEQ ID NO: 4,

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 17 may be composed of the nucleotide sequence of SEQ ID NO: 6, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 18 may be composed of the nucleotide sequence of SEQ ID NO: 7 And

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 19 may be composed of the nucleotide sequence of SEQ ID NO: 9, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 20 may be composed of the nucleotide sequence of SEQ ID NO: 10 have.

According to an embodiment of the present invention, the microbial variant is composed of homoserine, 4-hydroxy-2-oxo butyrate, 2,4-dihydroxy-butyrate, and 2-hydroxy-gamma-butyrolactone. It may be a microbial variant that produces an excess of one or more selected from the group.

According to an example of the present invention, 2-hydroxy gamma butyrolactone or 2,4-dihydroxy butyrate (2,4) comprising the step of culturing the above-described microbial variant. -dihydroxy butanoic acid) production method is provided.

The microbial variant used in the production method may further include one or more genes selected from the following (1) to (4) or a recombinant vector comprising the same.

(1) at least one transaminase mutant encoding gene selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14,

(2) At least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 Enzyme encoding gene,

(3) At least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 21 An enzyme encoding gene, and

(4) A gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 22.

According to one embodiment of the present invention, the step of culturing in the production method may be performed in a medium containing a yeast extract and an ammonium salt as a nitrogen source.

According to another example, after the culturing step, sugar and at least one amino acid selected from the group consisting of methionine, lysine, threonine, and isoleucine is added to the fed-batch diet. It may further include a step of fermentation, and furthermore, the pure optical isomer (2S)-2,4-dihydroxy butyrate or (2R)-2,4-dihydroxy butyrate is produced in the fermentation step. After that, pure (2S)-2-hydroxy-gamma-butyrolactone or (2R)-2-hydroxy-gamma- through a chemical change step of lowering the pH to a range of 1.0 to 3.0, preferably pH 1.0 to 2.0. It can be converted to butyrolactone.

For example, after producing (2S)-2,4-dihydroxy butyrate, (2S) having an optical purity of 95% to 100%, preferably 97% to 100% by lowering the pH to 1.0 to 3.0 -2-hydroxy-gamma-butyrolactone can be obtained, and after producing (2R)-2,4-dihydroxy butyrate, the pH is lowered to 1.0 to 3.0, and the optical purity is 95% to 100%, preferably Preferably, 97% to 100% of (2R)-2-hydroxy-gamma-butyrolactone can be obtained.

An example of the present invention is, 2-hydroxy gamma butyrolactone (2-hydroxy gamma butyrolactone) or 2,4-dihydroxy butyrate (2,4- It provides a composition for the production of dihydroxy butanoic acid).

The microbial variant may further include one or more genes selected from the following (1) to (4) or a recombinant vector including the same.

(1) At least one transaminase mutant encoding gene selected from the group consisting of a gene consisting of a nucleotide sequence encoding an enzyme consisting of the amino acid of SEQ ID NO: 13 and a gene consisting of a nucleotide sequence encoding an enzyme consisting of an amino acid of SEQ ID NO: 14 ,

(2) At least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 Enzyme encoding gene,

(3) At least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 21 An enzyme encoding gene, and

(4) A gene encoding a lactonase enzyme consisting of the amino acid sequence of SEQ ID NO: 22.

An example of the present invention provides a transaminase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 13. The gene encoding the transaminase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 2.

An example of the present invention provides a transaminase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 14. The gene encoding the transaminase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 3.

An example of the present invention provides a transaminase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 15. The gene encoding the transaminase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 4.

An example of the present invention provides an L-hydroxy-2-oxo-reductase mutase consisting of the amino acid sequence of SEQ ID NO: 17. The gene encoding the L-hydroxy-2-oxo-reductase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 6.

An example of the present invention provides an L-hydroxy-2-oxo-reductase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 18. The gene encoding the L-hydroxy-2-oxo-reductase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 7.

An example of the present invention provides a D-hydroxy-2-oxo-reductase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 20. The gene encoding the D-hydroxy-2-oxo-reductase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 9.

An example of the present invention provides a D-hydroxy-2-oxo-reductase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 21. The gene encoding the D-hydroxy-2-oxo-reductase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 10.

An example of the present invention provides a lactonase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 22. The gene encoding the lactonase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 11.

The present invention produces a large amount of 2-hydroxy gamma butyrolactone (HGBL) and a mutant strain overexpressing 2,4-dihydroxybutanoic acid, a precursor thereof, and 2-hydroxy gamma butyrolactone (HGBL) using the same, and 2,4-dihydroxybutanoic acid, a precursor thereof. Provides a way to do it. In addition, when using the variant and mutant enzyme of the present invention, 2-hydroxy-gamma-butyrolactone can be prepared as a pure optical isomer in the (R) or (S) form. As the above isomers, these compounds can be particularly usefully applied as intermediates for photoresists for semiconductors and coating materials for metal surfaces in addition to intermediates for pharmaceuticals, pesticides, seasonings and flavors.

1 shows a novel biosynthetic pathway for biosynthesizing optically pure 2-hydroxy gamma butyrolactone and 2,4-dihydroxybutanoic acid, an organic acid precursor thereof, from homoserine.
Figure 2 shows a pathway for biosynthesizing 4-hydroxy-2-oxo-butanoate from homoserine using homoserine dehydrogenase.
3 shows a pathway for biosynthesizing 4-hydroxy-2-oxo-butanoate from homoserine using homoserine transaminase and aspartate transaminase.
Figure 4 shows a strain improvement strategy for mass production of homoserine using glucose, and a strategy for biosynthesizing 2-hydroxy gamma butyrolactone and 2,4-dihydroxybutanoic acid, a precursor thereof, from this.
5 shows the results of measuring the relative activity of a synthetic promoter synthesized for enhancing or regulating gene expression in Table 5 using GFP.
6A is a result of electrophoresis of the entire strain lysate producing enzymes TA1, TA2, TA3, and TA6 under denaturing conditions, indicating that the four types of TA1, TA2, TA3, and TA6 are produced only in insoluble forms.
Figure 6b is a supernatant obtained by centrifuging the lysate of strains producing a total of 11 enzymes, such as TA4, TA5, TA7, YA8, TA9, TA10, TA11, TA12, TA13, TA14 and TA15, and denaturing proteins present in the supernatant. As a result of electrophoresis under conditions, it was shown that TA4, TA5, TA7, YA8, TA9, TA10, TA11, TA12, TA13, TA14 and TA15 enzymes were obtained in a soluble state.
7A shows that only five enzymes, such as TA4, TA5, TA10, TA11, and TA15, among 11 transaminase enzymes expressed in a soluble form, exhibited activity against homoserine, of which TA4 was the highest. Indicates that it has activity.
7B is a result of electrophoresis of the result of pure separation of TA4 enzyme showing the highest activity against homoserine through affinity chromatography and purification.
8 shows the results of confirming the performance of the reporter strain for transaminase screening. The E. coli BL21 (DE3) wild strain and the reporter strain containing the pET-TA4 gene recombination plasmid were cultured in a medium containing small amounts (0.5 mM) of methionine and threonine, and 10 mM of homoserine, respectively. The reporter strain having the TA4 enzyme expression plasmid showed rapid growth compared to the wild strain without the plasmid, and the strain growth rate increased when 1.0 mM was added compared to the case where the amount of IPTG was added, that is, 0.5 mM was added. That is, when TA4 enzyme is present, homoserine is used as a nitrogen source for cell growth.
9 is a result of comparing the amino acid sequence of the aspartic acid amino acid transferase (PDB ID: 1ASM) and TA4 enzyme present in E. coli.
FIG. 10 shows a three-dimensional structure of TA4 through homology modeling using the crystal structure of E. coli aspartic acid amino acid transferase (PDB ID: 1ASM) as a template, and PYMOL viewer (http://www.pymol.org). ) Represents the protein structure identified.
FIG. 11 shows four amino acids (Ile17, Gly38, Asn194, Arg386) that interact with maleic acid carboxylic acid (aspartic acid residue carboxylic acid) in the structure of E. coli aspartic acid amino acid transferase (1ASM). , Four amino acids (Lys14, Gly40, Asn178, Try364) that are expected to interact with the carboxylic acid of the aspartic acid residue in the TA4 enzyme were selected and shown through the compared TA4 model structure.
12 shows the activity of the mutant enzymes of TA4-1 to TA4-6. Among them, TA4-1 has an amino acid sequence mutation of Y364Q and TA4-2 of N174D, and shows high activity. TA4-6 is an enzyme having both the mutations of TA4-1 and TA4-2, and exhibited the highest activity of 20 U/mg protein.
13 shows the results of analyzing the enzymatic activities of the eight LDH enzymes shown in Table 9 using pyruvate and OHB as substrates.
14 is a result of constructing a three-dimensional structure of Ae_ldhA through homology modeling using the crystal structure (PDB ID: 2G8Y) of Escherichia coli lactic acid dehydrogenase as a template, and the Ae_ldhA model uses MOE (Molecular Operating Environment). Produced, and evaluated through PROCHECK and ProSA online structural analysis It shows the protein structure confirmed using the PYMOL viewer (http://www.pymol.org).
Figure 15a is a docking simulation (docking simulation) using the Triangular Matching method at the enzyme active site of Ae_ldhA1 for the structure of the dermal acid and the HOB structure (Pubchem Database) for the design of the Ae_ldhA variant, and using this, the amino acid residues of the enzyme and The results of examining the interaction with dermal acid are shown.
15B shows the results of examining the interaction between amino acid residues of enzymes and HOB using docking simulation.
FIG. 16 shows the results of measuring the activity of the Ae_ldhA mutant enzyme obtained by site-directed mutagenesis by observing the degree of oxidation of NADH at absorbance at 340 nm. The activity of the mutant enzyme was compared with that of the wild enzyme and expressed as relative activity. The specific activity (1U) of the enzyme was defined as the amount of enzyme required to oxidize 1 μmol of NADH to NAD in 1 minute.
17 shows the results of analysis of the (D)-lactate dehydrogenase enzyme activity in the nine strains shown in Table 12 using pyruvate and OHB as substrates.
18 shows amino acid residues to be engineered using the crystal structure of the Lb-LDH enzyme listed in the PDB databank.
19 shows the results of measuring the activity of the mutant enzyme of the OHB D-reductase enzyme by observing the degree of oxidation of NADH at the absorbance of 340 nm, and the specific activity (1U) of the enzyme is 1 μmol of NADH for 1 minute. It was defined as the amount of enzyme required for oxidation to. The activity of the mutant enzyme was compared with that of the wild enzyme and expressed as relative activity.
20A shows the structure of a biosynthetic gene acting on a DXP-dependent pathway through which PLP is biosynthesized in E.
20B shows the biosynthetic pathway of the DXP-dependent pathway through which PLP is biosynthesized in E. coli. The abbreviations of metabolites are as follows. G6P; glusoe-6-phosphate; E4P, erythrose-4-phosphate; GA3P, glyceraldehyde-3-phosphate; 4PE, 4-phospho-D-erythronate; 3P4K, 3-hydroxy-4-phosphohydroxy-alpha-ketobutyrate; 4PT, 4-phosphohydroxy-L-threonine; 2A3B, 3-hydroxy-1-amino-acetone phosphate; DXS, deoxyxylulose-5-phosphate. Italics indicate enzyme names: EPD, erythrose-4-phosphate dehydrogenase; PdxB, 4-phospho-D-erythronate; SerC, 3-phosphoserine aminotransferas; PdxA, 4-phosphohydroxy-L-threonine dehydrogenase; PdxJ, PNP synthase; Dxs, 1-deoxyxylulose 5-phosphate synthase; PdhH, PNP oxidase.
FIG. 21 is a plasmid map used to produce L-form DHB, showing the case of using TA4-1 as transaminase, and ldh-2 and ldh-8 as lactase dehydrogenase.
Figure 22 is a result of L-DHB production through flask culture, the concentration of DHB produced after culturing the EcW20 (pDHB-L) strain into which the recombinant pBAD_TA4-1_LDH2 (pDHB-L) plasmid was introduced at various arabinose concentrations (g /L) was measured.'Control' represents an EcW20 strain that does not have a pBAD_TA4-1_LDH2 (pDHB-L) plasmid.
Figure 23 is a result of D-DHB production through flask culture, the concentration of DNB generated after culturing the EcW20 (pDHB-D) strain into which the genetically recombined pBAD_TA4-1_LDH8 (pDHB-D) plasmid was introduced at various arabinose concentrations (g /L) was measured. 'Control' represents an EcW20 strain that does not have a pBAD_TA4-1_LDH8 (pDHB-D) plasmid.
24A shows the results of a fed-batch bioreactor experiment of EcW20 (pDHB-L) strain for the production of L-form 2,4-dihydroxybutyric acid.
24B shows the results of a fed-batch bioreactor experiment of EcW20 (pDHB-D) strain for the production of D-form 2,4-dihydroxybutyric acid.
FIG. 25 shows a map of the pACYC_Pon1 plasmid expressing lactonase required to convert 2,4-dihydroxybutyric acid to HGBL. The pon1 (G3C9) gene was expressed by the tac promoter and was designed to have a lead sequence necessary for the protein produced to move to the cell membrane.
Figure 26a is a result of a two-stage cultivation of a bioreactor for the production of L-DHB and HGBL. When using Glucose as a substrate, the production amount and biomass of 2,4-DHB and HGBL of L-form generated over time Is shown.
Figure 26b is a result of a two-stage cultivation of a bioreactor for the production of D-DHB and HGBL, when using Glucose as a substrate, the production amount and biomass of 2,4-DHB and HGBL of D-form generated over time Is shown. The production of D-HGBL was very low, less than 0.1 g/L, because the activity of Pon1 enzyme was very low against 2,4-DHB.

A novel biosynthetic pathway comprising a total of three steps to biosynthesize 2-hydroxy gamma butyrolactone from homoserine is proposed in FIG. 1. Specifically, the reaction of each step is as follows.

Step 1: Removal of alpha-position amine in homoserine

Step 2: Reduction reaction (reduction of oxygen bound to carbon 2)

Step 3: Lactonization

The first reaction can be catalyzed by homoserine deaminase or homoserine transaminase enzyme, and the reaction by homoserine deaminase is shown in FIG. 2, and homoserine transami The reaction by naise is shown in Fig. 3, respectively.

The enzymes that remove the alpha-position amine group of the amino acid shown in FIG. 2 include glutamate deaminase (dehydrogenase) showing high activity against glutamate, and serine deaminase showing high activity against serine. (serine deaminase), and amino acid oxidase, which is very low in activity, but exhibits little activity to many other amino acids, can be used, and these enzymes are directly used in the reaction of FIG. 2 or mutated to have high activity. Can be used after

In the transamination reaction shown in FIG. 3, a mutant alanine aminotransferase, which is designed to have activity against homoserine through mutation, and similar amino transferases can be used. In addition, α-ketoglutarate (α-KG) can be used as an amino acceptor that receives amino groups from homoserine (α-KG/glutamic acid pair is most widely used for this purpose in transaminase reactions), and from glutamic acid produced from α-KG. It is preferable to use aspartate transaminase at the same time to regenerate the amino acceptor α-KG and to produce aspartic acid, a precursor of homoserine biosynthesis.

L-lactate dehydrogenase and D-lactate dehydrogenase may be used as enzymes for the second step reaction shown in FIG. 1. Depending on the enzyme used, the hydroxy group is bound to the carbon at position 2 in the form of (R) or (S), and accordingly, the isomer in the form (R) or (S) of the resulting 2-hydroxy gamma butyrolactone is obtained. .

The paraoxonase shown in FIG. 1 can be used by mutating a human-derived lactonase activity gene (PON1), and since the reaction of PON1 is reversible and lactone can be produced only at acidic pH, it is preferable to express it in periplasm, not in the cytoplasm.

In order to efficiently produce 2-hydroxy gamma butyrolactone and its organic acid precursor from homoserine through the pathway shown in FIG. 1, as shown in FIG. 4, it is necessary to develop a genetically modified microorganism that efficiently produces homoserine from sugar. Escherichia coli may be preferentially used as the microorganism, but various microorganisms such as yeast and corynebacteria may be used. These host cells can be improved by using the following methods individually or in combination.

1. Overexpression of the phosphoenolpyruvate carboxylase ( ppc ) gene, which efficiently converts phosphoenolpyruvate (PEP) to oxaloacetic acid (OAA);

2. Overexpression of the acetyl-CoA synthase ( acc ) gene, which converts acetate produced during fermentation into acetyl CoA, which helps microorganisms reuse it;

3. Removal of the iclR gene, which inhibits the expression of the glyoxylate shunt gene, to increase glyoxylate shunt activity;

4. Overexpression of aspartate transaminase to increase the conversion efficiency of oxaloacetate to asprtic acid;

5. To increase the efficiency of conversion of apspartic acid to aspartyl phosphate, the activity of apspartate kinase is improved. In order to enhance the expression of the thrABC gene encoding the apspartate kinase, the riboswitch of the thrABC operon, which is activated by isoleucine, is removed and the promoter strength is raised. Furthermore, the apspartate kinase enzyme is expressed mutated to prevent feedback inhibition by threonine and lysine;

6. Removal of lysA encoding diaminopimelate dcarboxylase to eliminate lysine production;

7. Remove the metA gene coding for homoserine succinyltransferase to eliminate methionine production;

8. The thrB gene coding for homoserine kinase was removed so that the produced homoserine was not converted to homoserine phosphate.

When the production of homoserine is activated, a gene encoding the deaminase enzyme shown in Fig. 2 or the transaminase enzyme shown in Fig. 3 is expressed in order to convert homoserine to 4-hydroxy-2-oxo-butanoic acid (HOB). Furthermore, to promote the biosynthesis of pyridoxal-5'-phosphate (a type of vitamin B6), a cofactor of transaminase, it is recommended to use a strain that has enhanced the biosynthesis pathway of vitamine B6.

Furthermore, the strain engineered to efficiently biosynthesize HOB from homoserine can additionally express homoserine dehydrogenase and/or PON1 to produce 2,4-dihydroxy-butanoic acid (dHBA) and 2-hydroxy gamma butyrolactone (HGBL). In general, since the biological reaction of converting dHBA to HGBL using PON1 is low in efficiency, dHBA may be biologically produced and then separated and purified to chemically convert to HGBL. In this case, it is desirable to overexpress the membrane transfer protein of dHBA in order to quickly secrete dHBA produced in the microorganism out of the cell.

In this way, when a microorganism engineered to produce dHBA or HGBL through conversion of the homoserine suggested in FIG. 1 in the strain with enhanced homoserine biosynthesis pathway proposed in FIG. 4 is cultured with sugar as the main carbon source, the target products dHBA and HGBL can be produced. have. At this time, yeast extract and ammonium salt should be added as nitrogen sources in the medium for efficient cultivation of microorganisms and efficient production of the target product, as well as amino acids specially required by this strain, namely methionine, lysine, threonine, and isoleucine. There is. In addition, in high concentration production using a bioreactor, it is desirable to appropriately add a sugar and amino acid mixture in the middle of fermentation in a fed-batch manner.

4 schematically shows a strategy for improving strain for mass production of homoserine using glucose, and a strategy for biosynthesizing 2-hydroxy gamma butyrolactone and 2,4-dihydroxybutanoic acid, a precursor thereof, from this. In Fig. 4, green arrows indicate reactions to be strengthened, red arrows indicate mechanisms for inhibiting enzyme production or enzyme activity, apricot X marks indicate removal of inhibitory reactions or gene removal, and small italic letters indicate target genes for manipulation. .

Hereinafter, specific examples will be described. The present invention is not limited by the following examples.

Example 1: Preparation of homoserine producing strain

(1) Homoserine pathway is well known for synthesizing amino acids of the aspartate family. To increase the accumulation of homoserine, lysine (lys), methionine (met) and threonine (thr) production pathways were eliminated. Specifically, the last-stage enzyme of lysine biosynthesis, i.e., lysA encoding diaminopimelate decarboxylase, metA encoding homoserinesuccinyl transferase, and homoserine kinase ) And thrBC encoding threonine synthase were removed (Table 1).

(2) In addition, ldhA , adhE , and pflB genes were removed to prevent the production of by-products such as lactic acid, ethanol, and formic acid. By removing these genes, we tried to prevent the formation of by-products and increase the carbon flux to homoserine.

(3) Next, the expression of the acs gene was increased to minimize the production of acetic acid. In order to increase the expression of Acs, the acs- expressing gene promoter was changed to the trc promoter.

(4) As one of the methods to promote acetate reuse, iclR gene, a negative regulator, was removed by pop-in pop-out method to enhance the activity of glyoxylate shunt.

(5) Synthetic promoter 8: SP8) (SEQ ID NO: 23: TTTCAATTTAATCATCCGGCTCGTATAATGTGTGGA) to prevent acetate production and improve the carbon flux to homoserine, the expression of the ppc gene encoding phosphoenol pyruvate carboxylase, a key enzyme in the anaplerotic pathway. Increased using To this end, the promoter of the ppc gene was substituted with synthetic promoter 8 by pop-in pop-out method.

(6) To eliminate overflow metabolism of glucose metabolism and to prevent the use of phosphoenol pyruvate (PEP) for glucose transduction to the cell membrane, the ptsG gene was removed by the MAGE method. In this case, glucose is transported into the cell by other transfer proteins such as GalP, and effects such as prevention of Carbon Catabolite Repression and generation of by-products due to overflow metabolism can be expected.

(7) The ED pathway was removed by deleting the eda gene encoding KHG/KDG aldolase in order to increase the carbon flux to oxaloacetate in the pathway using the EMP pathway. The MAGE method was used.

(8) Finally, the route after aspartic acid, known as the bottleneck of the homoserine production route, was optimized. It is known that three aspartate kinases, namely AKI, AKII, and AKIII, play an important role in the production of homoserine. Of these, only two enzymes AKII and AKIII show excellent activity at high homoserine concentrations. In addition, among AKII and AKIII, AKII is known to be more advantageous than AKIII because it has both aspartate kinase and serine dehydrogenase activities. Therefore, in this strain development, the metL gene encoding the AKII enzyme was overexpressed using the medium copy plasmid, pUCPK plasmid. At this time, two types of promoters were used: the lac promoter and the trc promoter to control the expression size of metL .

Table 1 below shows a competition pathway gene that was removed, substituted, or overexpressed in order to overexpress homoserine, the purpose of removal, and the method of removal.

Deletion (Chromosome) Purpose Method One Δpts Increase carbon flux toward　　 Homoserine MAGE 2 Δeda 3 ΔadhE Deletion of　 Ethanol production pathway 4 ΔpflB Deletion of　 Formate production pathway 5 ΔlysA Deletion of　 Lysine production pathway 6 ΔthrB Deletion of　 Threonine production pathway 7 ΔmetA Deletion of　 Methionine production pathway 8 ΔlacI Remove of lac I repressor for promoter utilization 9 ΔldhA Deletion of Lactate production pathway Pop in-pop-out 10 ΔiclR Deletion of repression in glyoylate shunt Substitution (Chromosome) Purpose Method 11 ΔPacs::Ptrc Reduce acetate formation and increase carbon flux to homoserine Pop in-Pop out 12 ΔPppc::Psyn8 Increase anaplerotic flux (PEP top OAA) Pop in-Pop out Overexpression (Plasmid) Purpose Method 13 pUCPK-P trc - metL Remove the bottleneck of homoserine production Plasmid
cloning

E. coli W3110 strain and BL21 (DE3) were purchased from Korean Collection for Type Cultures (KCTC). The E. coli TOP10 strain was used for cloning and maintenance of the plasmid. For gene removal, multiplex automated genome engineering (MAGE) techniques and pop-in pop-out techniques were used.

Table 2 below shows the types of Homoserine-overproducing mutant E. coli strains developed by the present inventors.

Table 2 below shows the types of Homoserine-overproducing mutant E. coli strains developed by the present inventors.

Strains Description Source E. coli TOP10 WT DSM, Germany E. coli W3110 WT DSM, Germany WT E. coli W3110 DSM, Germany EcW1 Δpts This study EcW2 Δpts Δeda This study EcW3 Δpts Δeda ΔlacI This study EcW4 Δpts Δeda ΔlacI ΔthrB This study EcW5 Δpts Δeda ΔlacI ΔthrB ΔmetA This study EcW6 Δpts Δeda ΔlacI ΔthrB ΔmetA ΔlysA This study EcW7 Δpts Δeda ΔlacI ΔthrB ΔmetA ΔlysA ΔadhE This study EcW8 Δpts Δeda ΔlacI ΔthrB ΔmetA ΔlysA ΔadhE ΔpflB This study EcW9 Δpts Δeda ΔlacI ΔthrB ΔmetA ΔlysA ΔadhE ΔpflB ΔldhA This study EcW10 Δpts Δeda ΔlacI ΔthrB ΔmetA ΔlysA ΔadhE ΔpflB ΔldhA ΔiclR This study EcW11 Ec10, replacing acs native promoter by P trc promoter This study EcW12 Ec11, replacing ppc native promoter by synthetic promoter 8 This study EcW13 Ec12, pUCPK-P trc - metL This study

The genome isolation kit was purchased from Promega (Madison, WI, USA). High-fidelity pfu-a polymerase was purchased from Invitrogen (Seoul, Korea). DNA cleavage enzyme and DNA improving enzyme were purchased from New England Bio-LAb (Beverly, MA, USA). Miniprep and DNA gel extraction kit were purchased from Cosmotech (Seoul, Korea). The primers used for gene amplification were synthesized by Macrogene (Seoul, Korea). Yeast extract, tryptone, trypcase soy broth, peptone, and the like were purchased from Difco (Becton-Dickinson, NJ, USA). All other reagents and enzymes were purchased from Sigma-Aldrich (St. Louis, MO, USA).

1-1 Gene deletion and substitution using the MAGE method

The MAGE (Multiplex Automated Genome Engineering) method is a very powerful tool for in vivo genome editing. In this method, single-stranded DNA (ssDNA) corresponding to the target chromosome is immediately introduced into the strain to be engineered. When targeting multiple sites, several types of ssDNA can be introduced at once or sequentially.

In this experiment, beta-protein, which acts as a recombinase, was introduced into the pSIM5 plasmid, and it was added to E. coli by electroporation. Synthetic ssDNA oligos were constructed so that the homology arm overlapping the chromosome target gene sequence to be removed, that is, the 5'-terminal homolgy arm and the 3'terminal homology arm (Table 3). Oligos that have homology with the chromosome in the cell bind to the lagging strand of the target gene during chromosomal replication and cause mutations in the target gene through homologous recombination.

For the MAGE experiment, single colonies grown on agar solid medium were picked and incubated for 12 hours in LB+Cm medium at 30 degrees Celsius. Then, 100 microliters of this culture solution was transferred to a new LB+Cm medium and cultured at 30 degrees Celsius until 0.6 OD (600 nm). After that, the culture tube was left at 42 degrees Celsius for 15 minutes, and then placed in ice water for 30 minutes. After that, the prepared competent cells were centrifuged at 4°C and 5000 rpm for 10 minutes and washed three times with cold distilled water. Then, the cell pellet was suspended in 100 mL of 10% glycerol solution. Thereafter, 50 uM of ssDNA oligo was mixed with the cell suspension, and then electroporated after placing it in an elctro cuvette. After that, the mixture was transferred to a culture tube, 5 mL of LB was added, and incubated for 3 hours at 30 degrees Celsius (1st cycle). After repeating this process 6-10 times (6-10 cycles), 100 uL of cell culture solution was plated on an agar plate and incubated overnight. The generated colonies were screened by PCR, and mutants in which the gene was deleted were identified and secured.

Table 3 below shows the types of primers used for gene removal or cloning.

Primer Description Sequence number Primer for gene　　 deletion using MAGE pts_RP cggaaccgcctgcttctgccataacatgcgatacaacggcggTTAcagcagaatacctgcgataggcagtacggataccggcagcatc 24 pts_seq_FP Ggcgtcggttccgcgaatttc 25 pts_seq_RP Ggtgcagaccaaacggtacc 26 eda_FP caactgcacactcggtacgcagagtcacttccagaacgcgcaTTAcaccgcgtgttccagtttttttaccacgataaccggtacaacc 27 eda_RP ggttgtaccggttatcgtggtaaaaaaactggaacacgcggtgTAAtgcgcgttctggaagtgactctgcgtaccgagtgtgcagttg 28 eda_seq_FP Ccgatggcaaaagcgttgg 29 eda_seq_RP Cgcgccagcttagtaatgc 30 poxB_RP ggcaggggtgaaacgcatctggggagtcacaggcgactctctgaacTAAccatcgagtggatgtccacccgccacgaagaagtggcggcc 31 poxB_seq_FP Tggaataacgcagcagttg 32 poxB_seq_RP Ggtcttagtgacagtcttaatc 33 pta_FP gaccagcgtcagccttggcgtgatccgtgcaatggaacgcaaaTAActcagccgcgtaccggtggcgatgcgcccgatcagactacg 34 pta_RP cgtagtctgatcgggcgcatcgccaccggtacgcggctgagTTAtttgcgttccattgcacggatcacgccaaggctgacgctggtc 35 pta_seq_FP Ggcgttcgtctgagcgttttc 36 pta_seq_RP Ggattcttgcagcttcgcc 37 ackA_FP gaaatttgccatcatcgatgcagtaaatggtgaagagtaccttTGAaagcacgtatcaaatggaaaatggacggcaataaacaggaagc 38 ackA_RP gcttcctgtttattgccgtccattttccatttgatacgtgcttTCAaaggtactcttcaccatttactgcatcgatgatggcaaatttc 39 ackA_seq_FP Tctggtttagccgaatgtttcc 40 ackA_seq_RP Atgttcagttcttctaccgg 41 ldhA_RP gcaacaggtgaacgagtcctttggctttgagctggaattttttTAActgccaatggctgcgaagcggtatgtattttcgtaaacgatg 42 ldhA_seq_FP Ttttccggtgtcagcggg 43 ldhA_seq_RP Gactttctgctgacgg 44 adhE_RP gtaaaaaaagcccagcgtgaatatgccagtttcactcaagagcaaTAActgctgcagatgctcgaatcccactcgcgaaaatggccgttg 45 adhE_seq_FP Ggagctgtatgcggctttaac 46 adhE_seq_RP Gtagacaaaatcttccgcgccg 47 pflB_RP ccaaaggtgactggcagaatgaagtaaacgtccgtgacttcattTAAagtccttcctggctggcgctactgaagcgaccaccaccctg 48 pflB_seq_FP Tgcagagaagtgaactgtgcc 49 pflB_seq_RP Cagaaaaactacactccgtacg 50 iclR_FP Cccggcttgttgcgccagttccgtgagtgccacactgccattcagccacgcgttaaagactgaacctgtccagtcgctggtgcggtggc 51 iclR_RP Gccaccgcaccagcgactggacaggttcagtctttaacgcgtggctgaatggcagtgtggcactcacggaactggcgcaacaagccggg 52 iclR_seq_FP Gcgcgtttgggcgagatc 53 iclR_seq_RP Ctgaaattactggagtgg 54 lysA_FP ggctttctgtgcaaagcgcaccacatcaaactgtttcagcgctgTTAgacccacaccgggcagccaaattcagcgggcaaacgcagcag 55 lysA_RP ctgctgcgtttgcccgctgaatttggctgcccggtgtgggtcTAAcagcgctgaaacagtttgatgtggtgcgctttgcacagaaagcc 56 lysA_seq_FP Cctgttccagatgggcataatc 57 lysA_seq_RP Gggtctacgatgcgcaaattattcg 58 thrB_RP cttatcggcaaagcgtccgaggttgttgagactgaatgtctctgTTAtgcaccatcaacaggtgtcaccgccgccccgagcacatcaaac 59 thrB_seq_FP Ttgctcggagatgtagtcacgg 60 thrB_seq_RP Gcgatactgcgccggtaaaatag 61 metA_FP Gaagaaaacgtctttgtgatgacaacttctcgtgcgtctggttaattaacctgatgccgaagaagattgaaactgaaaatcagtttctg 62 metA_RP Cagaaactgattttcagtttcaatcttcttcggcatcaggttaattaaccagacgcacgagaagttgtcatcacaaagacgttttcttc 63 metA_seq_FP Ctggtcaggaaattcgtccac 64 metA_seq_RP Cgaatcaacgctgccggaaag 65 lacI_RP cttatcagaccgtttcccgcgtggtgaaccaggccagccacgttTGAcgatggcggagctgaattacattcccaaccgcgtggcacaac 66 lacI_seq_FP Gatatttatgccagccagcc 67 lacI_seq_RP Ccacgtttctgcgaaaacgcggg 68 Primer for gene　　 deletion using Pop-in Pop-out method US-Ptrc-acs-FP gtttaatcggtacccggggatcgcggccgccgcgcccttcctgccagtcaattttc 69 US-Ptrc-acs-RP Cttttaagaaggagatatacatatgagccaaattcacaaacacacc 70 Ptrc-acs-FP Ggtgtgtttgtgaatttggctcatatgtatatctccttcttaaaag 71 Ptrc-acs-RP Cggcgtgcgtttatttttatccttgtcatcgactgcacggtgcaccaatgc 72 DS-Ptrc-acs-FP Gcattggtgcaccgtgcagtcgatgacaaggataaaaataaacgcacgccg 73 DS-Ptrc-acs-RP Gggcgcgcgccattctccggtcgactctagatcatgccgtcatcccac 74 US-ldhA-FP Atcgcggccgctgtctgttttgcggtc 75 US-ldhA-RP Ctggagaaagtcttatgtaatcttgccgctcccc 76 DS-ldhA-FP Ggggagcggcaagattacataagactttctccag 77 DS-ldhA-RP Ctagaggatcccaagcagaatcaagttctaccg 78 Gn-ldhA-FP Gatggtacggcgattgggatg 79 Gn-ldhA-RP Gccagggagaaaaaatcag 80 US-iclR-FP Ctgcgcggacgctgaggatcccggtgatcccgtcctctcacg 81 US-iclR-RP Ttcgaaccccagagtcccgcctgccgctcgtaggtcctg 82 DS-iclR-FP Gcaggacctacgagcggcaggcgggactctggggttcgaaatg 83 DS-iclR-RP Tgcctgcaggtcgactctagattatttgttaactgttaattgtccttgttc 84 Gn-iclR-FP Ctgaacagcaggtcgtcc 85 Gn-iclR-RP Gcgtcgaaaccttcgatg 86

1-2. Gene deletion or gene replacement by pop-in pop-out method

The pKOV plasmid with sacB-Km cassette was used to remove the ldhA and iclR genes (Table 4). Specifically, fragments having 600-700 bp upstream and downstream regions of the target gene were PCR amplified from E. coli W3110 chromosome using the corresponding primers (Table 3). After confirming the sequence of this fragment, it was inserted into the pKOV plasmid using the Gene Art Seamless Cloning and Assembly Kit (Invitrogen, USA). Afterwards, recombinant pKOV plasmid was introduced into E. coli 3110, the gene was deleted through homology recombination, and pKOV plasmid was removed through sugar culture. Finally, it was screened by PCR method, and the mutant strains in which the gene was deleted were identified and secured.

1-3. Plasmid construction used for genetic manipulation

Plasmids used for gene deletion, promoter substitution, and gene overexpression by pop-in pop-out or MAGE method are shown in Table 4 below. In order to construct the recombinant plasmid, first, the open reading frame (ORF) of the target gene was PCR amplified and overlap amplified using an appropriate primer (Table 3). The thus-obtained DNA fragment was cut with a restriction enzyme and cloned into the corresponding plasmids, namely, pUCPK, pET-T7p, pBbA1k, pTrc-99a, and the like. After that, this plasmid was introduced into the host strain.

Plasmid Description Source pSIM5 MAGE, β recombinant protein, Cm25 Addgene, USA pUCPK Overexpression, lac promoter, medium copy, K50 Addgene, USA pET Overexpression, T7 promoter, high copy, K50 Addgene, USA pBbA1k Overexpression, trc promoter, medium copy, K50 Addgene, USA pTrc-99a Overexpression, trc promoter, low copy, K50 Addgene, USA pKOV Pop in-Pop out, Cm25 Addgene, USA pUCPK- metL Ptrc- metL This study

1-4. Synthetic promoter library construction and activity measurement used for gene expression

A number of promoters were used to enhance or control gene expression. In the case of promoters having the same sequence, gene instability greatly increased, so a library of synthetic promoters of different sequences was constructed (Table 5). In addition, their relative activity was measured using GFP (Fig. 5). A total of 9 promoters were synthesized and selected, and their activities had a range of approximately 4 times.

Promoter Base sequence Sequence number SP1 AAAAAGAGTATTGACTTCGCATCTTTTTGTACCTATAATGTGTGGA 87 SP2 AAAAAATTTATTTGCTTATTAATTCATCCGGCTCGTATATGTGTGGA 88 SP3 TTGACATCAGGAAAATTTTTCTGTATAATGTGTGGA 89 SP4 TTGACAATTAATCATCCGGCTCGTAATTTATGTGGA 90 SP5 AAAAAATTTATTTGCTTTCGCATCTTTTTGTACCTATAAGTGTGGA 91 SP6 AAAAAATTTATTTGCTTTCGCATCTTTTTGTACCTGTAATGTGTGGA 92 SP7 TTCACTTTTAATCATCCGGCTCGTATAATGTGTGGA 93 SP8 TTTCAATTTAATCATCCGGCTCGTATAATGTGTGGA 94 SP9 TTCCCTATTAATCATCCGGCTCGTATAATGTGTGGA 95

Example 2: for removing the amino group of homoserine Transaminase ( TA ) Enzyme screening and mutant enzyme production

2-1. Screening of transaminase (TA) enzyme

Enzyme security

The transaminase (TA) enzyme plays an important role in living organisms and has been studied in various ways for a long time, but the TA enzyme specific to homoserine has not been identified as it has no role in vivo. In general, since many enzymes have activity against compounds similar to biological substrates, 17 of the known TA enzymes among aspatate transaminase, alanine transaminase, branched chain transaminase and aromatic transaminase were selected to investigate the activity against homoserine (Table 6). ). These enzymes were obtained from E. coli , Enterobacter spp ., Bacillus subtilis , Mesorhizobium loti , Agrobacterium tumefaciens , Pseudomonas denitrificans, P. putida and P. fluorescens, etc.:

Gene Enzyme Source Acc. No. Primer Sequence number aspAT Aspatate transaminase M.　　 loti ANN59010.1 F: gaccatggaattcatggaagagtttcacaaggtc 96 R: acagccaagcttttaccggtgggcggacagc 97 aspAT Aspatate transaminase M.　　 loti ANN57047.1 F: gaccatggaattcatgctccacacgatttcg 98 R: agtttggatcctcacttggcgaggaacg 99 aspAT Aspatate transaminase A.　　 tumefaciens ACM26415.1 F: gaccatggaattcatggaagagtttcataaag 100 R: agtttggatccttaagaacgatgagcg 101 aspAT Aspatate transaminase B. subtilis AQR85543.1 F: ttcagaattcaaaagatcttttaagaaggagatatacatatgcagagcaaaggcg 102 R: agtttggatccttaatggtgatggtgatggtg 103 aspAT Aspatate transaminase E. coli AVI55449.1 F: gaccatggaattcatgactgaaccccgttcag 104 R: acagccaagcttttagtccgccttcgccggc 105 bcAT branched chain transaminase D. mccartyi AQY72500.1 F: gaaggagatatacatatggctagcatgac 106 R: ctttgttagcagccggatctcagtggtggtggtgg 107 bcAT branched chain transaminase E. coli AVI53929.1 F: aagaaggagatatacatatggctagcatgactgg 108 R: ccggatctcagtggtggtggtggtggtgctcg 109 bcAT branched chain transaminase E. spp AOL13801.1 F: taagaaggagatatacatatggctagcatgactgg 110 R: gtgctcgagttgattaacttgatctaaccagccgtat 111 aroAT acromatic　　 transaminase E. coli AUV21492.1 F: taagaaggagatatacatatgtttcaaaaagttg 112 R: gtgctcgagttgattaagcagataatcg 113 aroAT acromatic　　 transaminase E. coli AVI54196.1
F: gaccatggaattcatggctgacactcgccctg 114 R: aacagccaagcttttattccgcgttttcgtg 115 alaAT alanine transaminase P. denitrificans AGI22743.1 F: cagaattcaaaagatcttttaagaaggagatatacatatgactgaaccccg 116 R: agatccttactcgagtttggatccttagtccgccttcgcc 117 alaAT alanine transaminase P. putida AE015451.2 F: cagaattcaaaagatcttttaagaaggagatatacatatggccaacccaggttcg 118 R: ctcgagtttggatccttacttacgagtcaggcc 119 alaC alanine transaminase E. coli AAN66442.1 F: Ttcagaattcaaaagatcttttaagaaggagatatacatatggctgacactcgc 120 R: cgagtttggatccttattccgcgttttcgtg 121 alaC alanine transaminase E. coli AAN66442.1
A140P-Y275D F: ttcagaattcaaaagatcttttaagaaggagatatacatatggctgacactcgc 122 R: cgagtttggatccttattccgcgttttcgtg 123 aspAT aspatate transaminase P. denitrificans AGI22891.1 F: ttcagaattcaaaagatcttttaagaaggagatatacatatgctcggacccggcg 124 tcgagtttggatcctcagcgattctggtgcgcg 125 aroAT acromatic transaminase P. denitrificans AGI22971.1 F: gtggtggtggtggtggtgctcgagcagtttcaggcgcagcgc 126 R: aactttaagaaggagatatacatatgatgagcaagttctggagtccc 127 aroAT acromatic transaminase P. fluorescens AUM68313.1 F: gtggtggtggtggtggtgctcgaggagttcgccgagggc 128 R: actttaagaaggagatatacatatgatgagtaaattctggagcccg 129

Production of enzymes

The enzymes of Table 6 were expressed in E. coli BL21 (DE3) host. LB medium was used, and 50 mg/L of kanamycin was used for the maintenance and preservation of plasmid. PET as an expression vector and T7 as a promoter were used. For the cloning of the TA gene, the coding sequence was amplified from the genomic DNA of the corresponding microorganism, and the pET vector included His-tag (C-terminal), and then cloned into the E. coli Top10 strain using seamless cloning and assembly kit (Invitrogen). . According to the obtained TA gene type, the plasmid was named pET/TAi (i = 1 ~ 17), and after confirming the sequence (Macrogen, Seoul Korea), it was introduced into E. coli BL21 (DE3), an enzyme-producing strain.

Gene Enzyme Source Acc. No. pET/TAi aspAT Aspatate transaminase M.　　 loti ANN59010.1 TA1 aspAT Aspatate transaminase M.　　 loti ANN57047.1 TA2 aspAT Aspatate transaminase A.　　 tumefaciens ACM26415.1 TA3 aspAT Aspatate transaminase B. subtilis AQR85543.1 TA4 aspAT Aspatate transaminase E. coli AVI55449.1 TA5 bcAT branched chain transaminase D. mccartyi AQY72500.1 TA6 bcAT branched chain transaminase E. coli AVI53929.1 TA7 bcAT branched chain transaminase E. spp AOL13801.1 TA8 aroAT acromatic　　 transaminase E. coli AUV21492.1 TA9 aroAT acromatic　　 transaminase E. coli AVI54196.1
TA10 alaAT alanine transaminase P. denitrificans AGI22743.1 TA11 alaAT alanine transaminase P. putida AE015451.2 TA12 alaC alanine transaminase E. coli AAN66442.1 TA13 alaC alanine transaminase E. coli AAN66442.1
A140P-Y275D TA14 aspAT aspatate transaminase P. denitrificans AGI22891.1 TA15 aroAT acromatic transaminase P. denitrificans AGI22971.1 TA16 aroAT acromatic transaminase P. fluorescens AUM68313.1 TA17

Recombinant strains producing TA for enzyme production were cultured in LB medium containing 50 mg/L kanamycin. A 20 mL liquid volume, 250 mL flask was used, and cultured at 20°C and 200 rpm. When the cell concentration reached 0.6 OD (600 nm), 0.1 mM of IPTG was added as an inducer, and the cells were further cultured for 10 hours thereafter. Thereafter, the cells were centrifuged (10,000 g, 10 minutes), washed with 100 mM phosphate buffer (pH 7.0), and suspended in a binding buffer (20 mM phosphate buffer, 0.5 M NaCl, 20 mM imidazole). After that, the cells were crushed with a sonicator and centrifuged to remove the uncrushed portion and solid content, and only the solution portion was collected and used for cell activity and protein analysis using SDS-PAGE.

Pure separation of the enzyme was performed using a Ni-NTA-HP resin filled column (17-5248-01; GE Healthcare, Sweden). The previously obtained microbial disruption solution was collected and purified by putting it in a column to obtain an enzyme solution. After that, dialysis was performed using a 10 kDa cut-off membrane to remove the salt contained in the solution. The obtained enzyme was subjected to electrophoresis under denaturing or non-naturing conditions (Figs. 6a and 6b). And after adding glycerol to 20%, it was stored at -80℃.

Enzyme activity measurement

Homoserine activity was measured using pyruvate and 2-oxoglutarate as amine acceptors, respectively:

(i) Homoserine + pyruvate　 ↔　 2-oxo-4-hydroxybutyric acid + alanine

(ii) Homoserine + 2-oxoglutarate　 ↔　 2-oxo-4-hydroxybutyric acid + glutamate

Enzyme activity could be measured by production of alanine or glutamate as a product, or consumption of pyruvate and 2-oxoglutarate as reactants. When 2-oxoglutarate was used as a recipient for all enzymes, the enzyme activity was not observed. Therefore, TA activity was investigated using the reaction of (i), that is, a reaction to receive pyruvate. The product alanine was measured by HPLC after modification with OPA.

To measure TA activity, a reaction solution was prepared to contain 50 mM phosphate buffer (pH 7.0), 0.1 mM cofactor pyridoxal phosphate (PLP), 10 mM homoserine, and an appropriate amount of TA enzyme. The solution was incubated at 37°C for about 5 minutes, and then 10 mM of pyruvate was added to initiate the reaction. After 10 minutes of reaction, 12 mM of perchloric acid was added to stop the reaction, followed by centrifugation at 10,000 g for 5 minutes. After that, a 5 μL sample was taken, mixed with 12.5 μL of OPA solution (25 mg OPA, 50 μL 2-mercaptoethanol, pH 9.5 0.5 mM saturated sodium borate solution, 4.5 mL methanol), incubated at room temperature, and filtered. The alanine modified by OPA was quantitatively analyzed by HPLC equipped with a Zorbax eclipse XBD-C18 column. Alanine derivative modified with OPA had a retention time of 10.5 minutes and was analyzed with a 338 nm DAD detector. Protein quantification was performed using the Bradford method and bovine serum albumin as a standard. Analysis was performed 3 times and the average value was shown.

According to FIG. 6A, four types of TA1, TA2, TA3, and TA6 were produced in an insoluble form, so they were not used for measuring activity. Among other enzymes, only five (TA4, TA5, TA10, TA11, and TA15) exhibited activity against homoserine. These were purely separated through affinity chromatography to measure their activity (Fig. 7a). TA4 showed the highest activity, that is, the activity of 3 U/mg protein.

2-2 TA4 enzyme engineering

Since the TA4 enzyme showed the highest activity, the enzyme with increased activity was obtained by mutating this enzyme. First, a mutant enzyme library was constructed, and high-activity enzyme variants were secured using a high throughput screening (HTS) method related to cell growth.

Development and investigation of Reporter strain

Homoserine transaminase converts pyruvate into alanine, and the amino group of alanine is used to produce other amino acids by alanine transaminase. That is, homoserine may be used as the sole nitrogen source for cell growth, and in this case, the cell growth rate may vary depending on the activity of homoserine transaminase to be developed by the present inventors.

To investigate this strategy, an E. coli BL21 (DE3) strain having a pET-TA4 gene recombination plasmid was cultured at different IPTG concentrations (FIG. 8). This is because the expression of the TA4 gene is regulated by the T7 promoter and the activity of the TA4 enzyme can be controlled by the IPTG concentration. An M9 minimal medium without nitrogen source was used, and 10 mM homoserine as a nitrogen source, and small amounts (0.5 mM) of threonine and methionine were added respectively to induce microbial growth. As shown in FIG. 8, the recombinant strain having the TA4 enzyme showed a high growth rate, and the degree was most evident when the amount of IPTG added was high, for example, 1.0 mM. That is, it was confirmed that homoserine TA screening was possible through a strain using homoserine as a nitrogen source.

TA4 enzyme library construction

Using the crystal structure of E. coli aspartic acid amino acid transferase (PDB ID: 1ASM) as a template, a three-dimensional structure of TA4 was constructed through homology modeling. For the structure and sequence of the 1ASM, refer to https://www.rcsb.org/structure/1ASM. The 1ASM structure has pyridoxal phosphate (PLP) as a coenzyme and maleic acid as a substrate analog. This model was created using MOE (Molecular Operating Environment) and evaluated through PROCHECK and ProSA online structural analysis. The protein structure was confirmed using the PYMOL viewer (http://www.pymol.org) (FIG. 10).

From the 1ASM structure, four amino acids (Ile17, Gly38, Asn194, Arg386) interacting with the carboxylic acid of maleic acid (the carboxylic acid of the aspartic acid residue) were identified. Four amino acids (Lys14, Gly40, Asn178, Try364) expected to interact with the acid were selected (FIG. 11).

The TA4 enzyme mutant library was constructed using the information of FIGS. 10 and 11. TA4 library was constructed by randomly modifying four amino acids (Lys14, Gly40, Asn178, Try364) of TA4, which are expected to interact with the carboxylic acid of the aspartic acid residue, by assembly PCR method. At this time, the pET30b/TA4 plasmid was used as a template, and the primers used are shown in Table 8. Using restriction enzymes XbaI and XhoI sites, PCR products from primers 1 and 2 were cloned into the pET30b plasmid. The resulting TA4 library was transformed with E. coli DH10β, and the plasmid was isolated and purified. Table 8 below shows the primer sequences used to prepare the TA4 mutase library.

Among the primer sequences below, the meanings of the letters m, n, and k are as follows.

m: a (Adenine, adenine) or c (Cytosine, cytosine)

n: a (Adenine, adenine) or g (Guanine, guanine) or c (Cytosine, cytosine) or t (thymine, thymine)

k: g (Guanine, guanine) or t (thymine, thymine)

No. Primer Sequence Sequence number One TA Library F ctcactataggggaattgtgagcggataac 130 2 TA Library R gctagttattgctcagcggtggcagc 131 3 TA K14 F gaaggaattgcctNNKcaattcttcgcttc 132 4 TA K14 R gaagcgaagaattgMNNaggcaattccttc 133 5 TA G40 F caatctgggacagNNKaatccagatcagc 134 6 TA G40 R gctgatctggattMNNctgtcccagattg 135 7 TA N178 F gaattatccgaatNNKccgactggagctg 136 8 TA N178 R cagctccagtcggMNNattcggataattc 137 9 TA Y364 F gaatatggcgagggcNNKgtcagagtcg 138 10 TA Y364 R cgactctgacMNNgccctcgccatattc 139

TA4 enzyme library screening and excellent enzyme development

The prepared library was transformed with E. coli BL21 (DE3), and then cultured overnight in 50 mL LB medium. Thereafter, the cell pellet was obtained by centrifugation and washed three times with 100 mM phosphate buffer, and then inoculated to an OD of 0.05 in M9 minimal medium (including 50 um/mL kanamycin) containing 20 mM homoserine as a nitrogen source. after. After incubation at 37°C and 200 rpm for 3 hours, 0.05 mM IPTG was added to induce TA4 enzyme. When the OD value reached 0.5, the culture solution was diluted 100 times and cultured again. After repeating the culture-dilution cycle 10 times, the culture solution was spread on LB agar medium containing 50 μg/mL kanamycin, and 50 well-growing colonies were taken and cultured purely in M9 medium. Thereafter, as a result of examining their gene sequence, a total of 5 mutants were obtained, and these were designated as TA4-1 to TA4-5, respectively.

Next, the obtained enzyme was measured by pure separation through affinity chromatography. Finally, the two TA4 variants (TA4-1, TA4-2) showed high activity, and in particular, TA4-1 was about 5 times higher than that of the wild type. It showed high 15 U/mg protein activity. TA4-1 has an amino acid sequence mutation of Y364Q and TA4-2 of N178D (Fig. 12) . This result is the result obtained through modeling, that is, Y364 and N178 show the importance of sites that interact with homoserine, with the fact that they are well aligned with N194 and R386 of 1ASM.

Next, the TA4-6 enzyme, which has both the mutations of the TA4-1 and TA4-2 enzymes, was produced using the site-directed mutagenesis method. TA4-6 enzyme showed the highest activity, 20 U/mg protein.

In the subsequent experiments, the most active TA4-1 and TA4-6 variants were used.

Example 3: Screening of (2S)-L-reductase enzyme of 2-Oxo-4-hydroxy butyric acid (OHB) and production of mutant enzyme

3-1. Screening of OHB L-reductase enzyme

Securing OHB L-reductase enzyme

When OHB is reduced to a prochiral compound, it is converted to 2,4-dihydroxy butyric acid (DHB) having an L (2S) or D (2R) hydroxy group at position 2. OHB reductase belongs to 2-hydroxy acid dehydrogenase, including lactate dehydrogenase (EC1.1.1.27, EC1.1.1.28), malate dehydrogenase (EC1.1.1.37, EC1.1.1.82, EC1.1.1.299) and Branched chain (D), (L)-2-hydroxyacid dehydrogenase (EC1.1.1.272, EC1.1.1.345) are well known. First, in order to produce the L-form isomer, Alcaligeneseutrophus H16, Cupriavidus basilensis , Achromobacter xylosoxidans , Burkholderiaglumae , Escherichia fergusonii , Escherichia coli , Lactobacillusmali and Escherichia coli K-12 are expected to have high activity against OHB (L)-lactate de Enzymes were selected (Table 9).

Table 9 shows the (L)-lactate dehydrogenase candidate enzymes for OHB 2S-reductase enzyme screening.

Gene Source Acc. no. Primer　　 sequence (FP/RP) Sequence number lactate dehdydrogenases ( ldhO ) Alcaligenes eutrophus(Ae) YP　　 725182.1 ATAACATATGAAGATCTCCCTCACCAGCGC 140 TAATAGGATCCTCAGTGATGGTGATGGTGATGGGCCG TGGGGACGGCCACGTTG 141 malate/L-lactate dehydrogenase ( ldh-2 ) Cupriavidus basilensis(Cb) WP　　 043344208.1 ATAACATATGAAGATAACACTGCAATC 142 TAATA GGATCC TCAGTGGTGATGATGGTGATGGCCCGCCGGCAGTGCCACGCCAAGTTC 143 malate/L-lactate dehydrogenase ( ldh-2 ) Achromobacter xylosoxidans(Ax) WP　　 006389860.1 ATAACATATGAAGATCTCCATTACCCAAG 144 TAATA GGATCC TCAGTGGTGATGATGGTGATGAGGCAACGCGTCAGC 145 malate/L-lactate dehydrogenase ( ldh-2 ) Burkholderia glumae(Bg) YP　　 002909484.1 ATAACATATGCAGATATCCCTCGACGATG 146 TAATA GGATCC CTAGTGGTGATGATGGTGATGGGCCCGTGCGGCCGGCGGCACCACGCCGAGTTCGTC 147 malate/L-lactate dehydrogenase ( ldh-2 ) Escherichia fergusonii(Ef) WP　　 002431747.1 ATAACATATGTATGGGTACAGATACCTTC 148 TAATA GGATCC TTAGTGGTGATGATGGTGATGATGCTGATTCCTGAGGATGTAAC 149 D-2-hydroxyacid dehydrogenase ( ldh-2 ) Escherichia coli(Ec) WP024240865.1 ATAACATATGATGTCATTACAAATTGCTG 150 TAATA GGATCC TCAGTGGTGATGATGGTGATGTCCAGCTAATGCTGATTCCTG 151 D-2-hydroxyacid dehydrogenase ( ldhA ) Lactobacillus mali(Lm) WP　　 003689565.1 ATAACATATGACAAGAATAATTGCTTATCATG 152 TAATA GGATCC TTAGTGGTGATGATGGTGATGTTCTCCCTTGAAACTTATTTCATGTG 153 D-lactate dehydrogenase ( ldhA ) Escherichia coli K-12 (Eck) NP　　 415898.1 ATAACATATGAAACTCGCCGTTTATAG 154 TAATA GGATCC TTAGTGGTGATGATGGTGATGAACCAGTTCGTTCGGGCAG 155

As a result of comparing the amino acid sequences of the selected enzymes, it showed a high similarity of 44-66%. However, enzymes derived from A. eutrophus , L.mali and E. coli showed low similarity.

Measurement of production and activity of OHB L-reductase enzyme

The E. coli BL21 (DE3) star strain was used as a host strain for enzyme expression, and the E. coli DH5α strain was used as a host for cloning and plasmid preservation. An LB medium containing 50 μg/mL of kanamycin was used for general culture and cloning and then for culturing the recombinant strain. For gene expression and enzyme production, pET plasmid and T7 promoter were used. The Ldh gene was amplified by PCR, and a His-tag was attached to the C-terminus. The PCR fragment was placed in a pET vector (Table 10), cloned into an E. coli DH5α strain, and then introduced into E. coli BL21 (DE3) star after confirming the gene sequence. In order to promote the soluble expression of the Ldh gene, the pG-Tf2 plasmid expressing Chaperon was additionally introduced.

For the production of LDH enzyme, recombinant BL21 (pET-Xx-LDH, Xx is a plasmid having LDH gene shown in Table 9) strain was aerobicly cultured in LB medium containing 50 μg/mL kanamycin. The culture temperature was 30°C, the stirring speed was 100 rpm, and 250 mL of medium was added to a 1 L flask. When the cell concentration reached 0.5 OD, 0.1 mM IPTG was added and incubated for an additional 10 hours. After that, the cells were centrifuged, washed three times with 25 mM phosphate buffer (pH 7.0), suspended in binding buffer (20 mM pH 7.0 phosphate buffer, 0.5 M NaCl, 10 mM imidazole), and disrupted using a sonicator. I did. The cell lysate was centrifuged at 4°C for 30 minutes at 25,000 g to remove the insoluble portion, and the soluble portion was collected and used for enzyme activity analysis or further enzyme separation.

LDH enzyme activity was analyzed using pyruvate and OHB as substrates. Since OHB was not commercially available, it was synthesized from homoserine. That is, a 125 mM homoserine solution was prepared in a pH 7.8, 100 mL Tris buffer solution, mixed with 1.25 U/mL snake venom (L)-amino acid oxidase enzyme and 4400 U/mL catalase enzyme, followed by 90 minutes at 37°C. Reacted. Thereafter, the reaction solution was filtered through an Ultracentrifugal filter (10 kDa, Amicon) to obtain OHB. To measure the enzyme activity, the enzyme reaction solution was prepared by mixing 60 mM Hepes buffer (pH 7.0), 50 mM NaCl, 5 mM MgCl ₂ , 5 mM fructose-1,6-bisphosphate, and an appropriate amount of enzyme, and 2 at 37°C. Incubated for minutes. Thereafter, 0.1 mM of NAD(P)H and an appropriate amount of OHB or pyruvate were added to initiate the reaction. Enzyme activity was calculated using the reduction rate of NAD(P)H and the extinction coefficient.

In Table 10 below, plasmids for OHB L-reductase screening are described.

Plasmids Description Source pACYC-Deut lacIq; expression vector; p15A-ori; His6-N; CmR pACYC-tac Replacment of T7 promoter of pACYC-Deut by tac promoter pET-Deut lacIq; expression vector; f1-ori; KanR pET-Ae-LDH pET containing LDH from Alcaligenes eutrophus This study pET-Cb-LDH pET containing LDH from Cupriavidus basilensis This study pET-Ax-LDH pET containing LDH from Achromobacter xylosoxidans This study pET-Bg-LDH pET containing LDH from Burkholderia glumae This study pET-Ef-LDH pET containing LDH from Escherichia fergusonii This study pET-Ec-LDH pET containing LDH from Escherichia coli This study pET-Lm-LDH pET containing LDH from Lactobacillus mali This study pET-LDHA1 pET containing mutant enzyme LDH I48S from Alcaligenes eutrophus This study pET-LDHA2 pET containing mutant enzyme LDH I48T from Alcaligenes eutrophus This study pET-LDHA3 pET containing mutant enzyme LDH I48N from Alcaligenes eutrophus This study pET-LDHA4 pET containing mutant enzyme LDH I48D from Alcaligenes eutrophus This study pET-LDHA5 pET containing mutant enzyme LDH I48K from Alcaligenes eutrophus This study

Most of the enzymes had a high activity against pyruvate and, in comparison, a low activity against OHB (Fig. 13). When pyruvate was used as a substrate, Ec/Eck-LDH showed the highest activity at 6 μmol/mg protein/min. For OHB, Ae-LDH showed the highest activity of 1.8 μmol/mg protein/min. Therefore, Ae-LDH was selected to produce a mutant enzyme having high activity against OHB.

Measurement of optical activity of OHB L-reductase enzyme products

In order to determine whether the hydroxy group at position 2 of DHB produced by Ae-LDH was (R) or (S), an optically active HPLC and colorimetric analysis kit were used. First, HPLC analysis was performed on the produced lactate. Agilent's chiral column (EC 250/4 NUCLEOSIL Chiral-1, Germany) was used, the analysis temperature was 35 ℃, the mobile phase was 0.2 mM CuSO ₄ and the flow rate was 0.5 ml min ¹ . In this condition, L-lactate peaked at about 7.3 minutes and D-Lactate peaked at about 9.0 minutes. All lactate produced by Ae-LDH appeared in L-form. In addition, it was confirmed with a commercially available lactate analysis kit (BioVision, CA, USA), and the produced lactate was also confirmed as L-form.

For DHB produced by the reduction reaction of OHB, the chirality of the OH group at position 2 was also investigated. However, in the case of DHB, there is no commercial product, and further, an optically pure compound could not be obtained. Thus, racemic 2-hydroxy gamma butyrolactone (HGBL) in which the 2nd position OH group is mixed in R-form and S-form was purchased (Sigma-Aldrich, MO, USA) and chemically decomposed to synthesize racemic DHB. The synthesis method was as follows.

After dissolving racemic HGBL in metahnol, the same amount of NaOH was added and reacted at room temperature for 18 hours. And dried after vacuum filtration. As a result of confirming by NMR, 100% conversion was confirmed.

When the same chiral column used for the chirality analysis of lactate was used, the DHB synthesized from HGBL showed two HPLC peaks at 9.9 and 11.3 minutes. In the case of lactate, L-form appeared before D-form, so it was expected that L-form appeared first in DHB as well. As a result of analyzing racemic DHB synthesized from HGBL by colorimetric method, L-form and D-form were obtained in a ratio of about 1:1. The lactate assay kit was originally designed to analyze lactate, but it was estimated that the chirality of DHB was also analyzed due to the similarity of the chemical structure between DHB and lactate. DHB analysis of the OHB product reacted with Ae-LDH was performed simultaneously using a chiral column and a colorimetric analysis kit. In the case of HPLC analysis, only one peak was obtained and the retention time appeared in the 9.9 minute time zone estimated as L-form. In addition, only L-form was obtained from colorimetric analysis. Therefore, DHB obtained by reaction with Ae-LDH was confirmed as optically pure L-form or (S)-form isomer.

3-2. Development of a variant of OHB L-reductase enzyme using site-directed mutagenesis

First, using the crystal structure of E. coli lactate dehydrogenase (PDB ID: 2G8Y) as a template, a three-dimensional structure of Ae_ldhA was constructed through homology modeling. The Ae_ldhA model was produced using MOE (Molecular Operating Environment) and evaluated through PROCHECK and ProSA online structural analysis. Protein structure was confirmed using the PYMOL viewer (http://www.pymol.org) (FIG. 14).

For the design of the Ae_ldhA variant, the structure of the dermic acid and the HOB structure (Pubchem Database) was subjected to a docking simulation using the Triangular Matching method at the enzyme active site of Ae_ldhA1. The interaction with and was examined (FIG. 15).

Based on the docking simulation results, it was assumed that the Ile48 position could play an important role in the interaction with the methyl group of dermatic acid or the hydroxyethyl group of HOB, and this was assumed to be hydrophilic (Ser, Thr, Asn) or charged amino acids ( Asp, Lys). Since HOB is larger than dermic acid, amino acids to be substituted are limited to amino acids having a small residue among the same type.

Mutation at the Ile48 site was performed using a site directed mutagenesis kit. Table 11 below shows the primer sequences used for site directed mutagenesis of Ae-LdhA. Plasmid expressing mutated Ae_ldhA (pET24ma-Ae-ldhO, Reference: Zhang et al. “NADH-dependent lactate dehydrogenase from Alcaligenes eutrophus H16 reduces 2-oxoadipate to 2-hydroxyadipate” Biotechnology and Bioprocess Engineering, 19: 1048-1057 (2014)) was cloned into pET plasmid, the sequence was confirmed (Macrogen, Seoul, Korea), and was transformed into E. coli BL21 (DE3) and expressed. The enzyme present in the cell lysate was purified using Ni-NTA resin, and the salt was removed using a 10 kDa molecular cutoff membrane. Then, it was filtered again with an Ultra-15 30K centrifugal filter (Amicon, Merck Millipore Co., Darmstadt, Germany) and stored at -80°C.

Primers Base sequence Sequence number LDH1_FP ctatatcagccacggcctgtcgagtctgcccaactaccgcaccgccctcg 156 LDH1_RP cgagggcggtgcggtagttgggcagactcgacaggccgtggctgatatag 157 LDH2_FP ctatatcagccacggcctgtcgactctgcccaactaccgcaccgccctcg 158 LDH2_RP cgagggcggtgcggtagttgggcagagtcgacaggccgtggctgatatag 159 LDH3_FP ctatatcagccacggcctgtcgaatctgcccaactaccgcaccgccctcg 160 LDH3_RP cgagggcggtgcggtagttgggcagattcgacaggccgtggctgatatag 161 LDH4_FP ctatatcagccacggcctgtcggacctgcccaactaccgcaccgccctcg 162 LDH4_RP cgagggcggtgcggtagttgggcaggtccgacaggccgtggctgatatag 163 LDH5_FP ctatatcagccacggcctgtcgaatctgcccaactaccgcaccgccctcg 164 LDH5_RP cgagggcggtgcggtagttgggcagattcgacaggccgtggctgatatag 165

The activity of the enzyme was measured by observing the absorbance of 340 nm for the degree of oxidation of NADH, and the specific activity (1U) of the enzyme was defined as the amount of enzyme required to oxidize 1 μmol of NADH to NAD for 1 minute. All of the mutant enzymes showed decreased activity against pyruvate and OHB. I48K enzyme showed a 5-fold or more reduced activity against pyruvate, and other enzymes showed a 0.8-3-fold reduced activity (FIG. 16). Most of the activity against OHB was also reduced. However, in the case of I48T (LDH2), the activity against pyruvate decreased by about 50%, but the activity against OHB was slight but slightly increased. In other words, it was found that the selectivity for OHB increased more than two times compared to pyruvate. LDH2 was selected for future experiments.

Example 4: Screening of (2R)-D-reductase enzyme of 2-Oxo-4-hydroxy butyric acid (OHB) and production of mutant enzyme

4-1. Screening of OHB D-reductase enzyme

Securing OHB D-reductase enzyme

Referring to the case of L-reductase, OHB 2R-reductase enzyme was screened for D-lactate dehydrogenase. E. coli , Pediococcus acidilactici , Pseudomonas aeruginosa , Leuconostoc mesenteroides cremoris , Lactobacillus bulgaricus , L. jensenii , Oenococcus oenii , L. plantarum , L. reuteri, and L. casei are expected to have high activity against OHB (D-). Lactate dehydrogenase enzymes were selected (Table 12).

Table 12 shows the (D)-lactate dehydrogenase candidate enzymes for OHB D-reductase enzyme screening.

Gene Source Acc. no. Primer sequence (FP /RP) Sequence number D-lactate dehydrogenases ( ldh ) Escherichia　　 coli K-12 NP 415898.1 ATAA CATATG AAACTCGCCGTTTATAG 166 TAATA GGATCC TTAGTGGTGATGATGGTGATGAACCAGTTCGTTCGGGCAG 167 D-lactate dehydrogenases Lactobacillus　　 helveticus WP 003628108.1 1 ATAA CATATG ACAAAGGTTTTTGC 168 TAATA GGATCC TCAGTGGTGATGATGGTGATGAAACTTGTTCTTGTTCAAAGCAAC 169 D-lactate/D-glycerate dehydrogenase ( ldhD ) Pediococcus　　 acidilactici X70925.1 ATAA CATATG AAGATTATTGCTTATGG 170 TAATA GGATCC TCAGTGGTGATGATGGTGATGCTCAAACTTAACTTCATTCTTTG 171 D-lactate dehydrogenases ( ldhD ) Pseudomonas　　 aeruginosa NP_249618.1 ATAACATATGCGCATCCTGTTCTTCAG 172 TAATA GGATCC CTAGTGGTGATGATGGTGATGGGCCCGGACCCGATTGCG 173 D-lactate dehydrogenases ( ldhD ) Clostridium　　 perfringens 13 NP_561446.1 ATAA CATATG ATGATAAAATTAGTATGTTAT 174 TAATA GGATCC TTAGTGGTGATGATGGTGATGATGATGCTATTGCATTTTTACAAGTATTTC 175 D-lactate dehydrogenases ( ldhD ) Lactobacillus　　 reuteri ZP_03974385.1 ATAA CATATG AAAGGAATGGGAAAAC 176 TAATA GGATCC TCAGTGGTGATGATGGTGATGCATTCTTATTTCATTTCGTG 177 D-lactate dehydrogenases ( ldhD ) Leuconostoc　　 mesenteroides cremoris ZP_03913173.1 ATAA CATATG AAGATTTTTGCTTACG 178 TAATA GGATCC TTAGTGGTGATGATGGTGATGATATTCAACAGCAATAGCTGG 179 D-lactate dehydrogenases ( ldhD ) Oenococcus　　 oeni ZP_01544962.1 ATAA CATATG AAAATTTATGCTTATG 180 TAATA GGATCC TTAGTGGTGATGATGGTGATGGAATTTAACGAGATTCTTGTCTC 181 D-lactate dehydrogenases ( ldhD ) Lactobacillus　　 delbrueckii subsp. bulgaricus CAI96942.1 ATAA CATATGACTAAAATTTTTGCTTAC 182 TAATA GGATCC TTAGTGGTGATGATGGTGATGGAAACTCCAGTTAAGGTTGGC 183

Measurement of production and activity of OHB D-reductase enzyme

As in the case of L-LDH, the E. coli BL21(DE3) star strain was used as the host strain for enzyme expression, and the E. coli DH5α strain was used as the host for cloning and plasmid preservation. An LB medium containing 50 ug/mL of kanamycin was used for normal culture and cloning and then for culturing the recombinant strain. For gene expression and enzyme production, pET plasmid and T7 promoter were used. The Ldh gene was amplified by PCR using the primers shown in Table 10 below, and at this time, a His-tag was attached to the C-terminus. The PCR fragment was placed in a pET vector, cloned into E. coli DH5a strain, and then introduced into E. coli BL21 (DE3) star after confirming the gene sequence. In order to promote the soluble expression of the Ldh gene, the pG-Tf2 plasmid expressing Chaperon was additionally introduced.

For the production of D-LDH enzyme, the recombinant BL21 (pET-Xx-LDH) strain was aerobicly cultured in LB medium containing 50 μg/mL kanamycin. The culture temperature was 30ºC, the stirring speed was 100 rpm, and 250 mL of medium was added to a 1 L flask. When the cell concentration reached 0.5 OD, 0.1 mM IPTG was added and incubated for an additional 10 hours. After that, the cells were centrifuged, washed three times with 25 mM phosphate buffer (pH 7.0), suspended in binding buffer (20 mM pH 7.0 phosphate buffer, 0.5 M NaCl, 10 mM imidazole), and disrupted using a sonicator. I did. The cell lysate was centrifuged at 4°C for 30 minutes at 25,000 g to remove the insoluble portion, and the soluble portion was collected and used for enzyme activity analysis or further enzyme separation.

D-LDH enzyme activity was measured in the same manner as in the case of L-LDH. It was analyzed using pyruvate and OHB as substrates. Like L-LDH, most of the enzymes had 3-10 times higher activity against pyruvate and lower activity against OHB (FIG. 17 ). Compared to L-LDH, the overall activity of D-LDH was 3-5 times lower. Lb-LDH and Lp-LDH showed the highest activity of 2.2 μmol/mg protein/min. For OHB, Lb-LDH showed the highest activity of 0.8 μmol/mg protein/min. The selectivity for pyruvate and OHB was about 1:0.2 level. Lb-LDH was selected to produce a D-reductase mutant enzyme having high activity against OHB.

Measurement of optical activity of OHB D-reductase enzyme products

In order to find out whether the hydroxy group at position 2 of DHB produced by Lb-LDH was (R) or (S), an optically active HPLC and colorimetric analysis kit were used. In the case of HPLC analysis of the OHB product reacted with Lb-LDH, only one peak was obtained, and the retention time appeared at the 11.3 minute time zone estimated to be D-form. In addition, only D-form was obtained from colorimetric analysis. Therefore, DHB obtained by reaction with Lb-LDH was confirmed as optically pure D-form or (R)-form isomer.

4-2. Development of a variant of OHB D-reductase enzyme using site-directed mutagenesis

Amino acid residues to be engineered were identified using the crystal structure of the Lb-LDH enzyme shown in the PDB databank (Fig. 18). That is, through docking with pyruvic acid, it was confirmed that three residues such as His296, Arg235, and Glu264 exist in the active site of reaction with pyruvate, and additionally, two hydrophobic amino acid residues, Val78 and Tyr101, exist around the active site. These hydrophobic residues are highly likely to act as interfering factors in the reaction with OHB, so they were converted into (small) hydrophilic amino residues (Ser, Thr, Asn, Asp, Lys).

Mutation was performed using a site directed mutagenesis kit. Table 13 shows the primer sequences used for site-directed mutagenesis of Lb-LDH. The plasmid expressing the mutated Lb-LDH was cloned into pET plasmid, the sequence was confirmed (Macrogen, Seoul, Korea), and was transformed into E. coli BL21 (DE3) and expressed. The enzyme present in the cell lysate was purified using Ni-NTA resin, and the salt was removed using a 10 kDa molecular cutoff membrane. Then, it was filtered again with an Ultra-15 30K centrifugal filter (Amicon, Merck Millipore Co., Darmstadt, Germany) and stored at -80°C.

Table 13 below shows the primer sequences used for site-directed mutagenesis of Lb-LDH.

Primers Base sequence Sequence number LDH6_FP catcactaagatgagcctgcgtaactccggtgttgacaacatcgacatggcta 184 LDH6_RP tagccatgtcgatgttgtcaacaccggagttacgcaggctcatcttagtgatg 185 LDH7_FP catcactaagatgagcctgcgtaacaacggtgttgacaacatcgacatggcta 186 LDH7_RP tagccatgtcgatgttgtcaacaccgttgttacgcaggctcatcttagtgatg 187 LDH8_FP catcactaagatgagcctgcgtaacaccggtgttgacaacatcgacatggcta 188 LDH8_RP tagccatgtcgatgttgtcaacaccggtgttacgcaggctcatcttagtgatg 189 LDH9_FP catcactaagatgagcctgcgtaacgacggtgttgacaacatcgacatggcta 190 LDH9_RP tagccatgtcgatgttgtcaacaccgtcgttacgcaggctcatcttagtgatg 191 LDH10_FP catcactaagatgagcctgcgtaacaagggtgttgacaacatcgacatggcta 192 LDH10_RP tagccatgtcgatgttgtcaacacccttgttacgcaggctcatcttagtgatg 193

The activity of the enzyme was measured by observing the absorbance of 340 nm for the degree of oxidation of NADH, and the specific activity (1U) of the enzyme was defined as the amount of enzyme required to oxidize 1 μmol of NADH to NAD+ for 1 minute. All of the mutant enzymes showed decreased activity against pyruvate and OHB. Among them, V78D (LDH-9) showed a nearly four-fold decrease in activity against pyruvate. The best enzyme was V78T (LDH-8), and about 45% activity was decreased for pyruvate, whereas about 10% activity was increased for HOB (FIG. 19). In a future experiment, V78T (LDH-8) was selected as the OHB D-reductase enzyme.

Example 5: Preparation of strain for producing DHB (2,4-dihydroxybutyric acid)

For the optimal production of DHB, transaminase and OHB reductase should be optimally expressed. In addition, to increase TA activity, not only the expression of the TA enzyme itself, but also pyridoxal-5-phosphate (PLP), a cofactor of the TA reaction, that is, vitamin B6 biosynthesis must be increased. Furthermore, the extracellular transport rate of DHB should be increased. To this end, the strain prepared for homoserine production in Example 1 was additionally modified to prepare a DHB-producing strain.

5-1. Increased production of vitamin B6

In the case of E. coli, PLP is biosynthesized through a DXP-dependent pathway, and in this case, it is known that the rate of PLP biosynthesis is regulated by proteins encoded by epd, dxs, and pdxJ genes (FIG. 20). In order to improve the speed of PLP biosynthesis, the promoters of these three genes were replaced with synthetic promoter 5 (Table 5), and the Pop-in pop-out method was used. The primers used are shown in Table 14 below. Table 14 shows the primer sequences used to increase the expression of epd, dxs, and pdxJ genes in order to increase vitamin B6 biosynthesis.

As a result, three strains with enhanced PLP biosynthesis were obtained (Table 15).

Primers Base sequence Sequence number US-Psp5-epd-FP atctaagcggccgcggaattatgcaattcgtggtac 194 US-Psp5-epd-RP aaaaaatttatttgctttcgcatctttttgtacctataagtgtggaatgaccgtacgcgtagcgataaatg 195 Psp5-epd-FP gccagtttagtatcgacc 196 Psp5-epd-RP acaaaagcatgatcctgttgaagatgcg 197 DS- Psp5-epd-FP catttatcgctacgcgtacggtcattccacacttataggtacaaaaagatgcgaaagcaaataaatttttttc 198 DS- Psp5-epd-RP tagtaatctagaggagttggcatctttctgcgatttc 199 US-Psp5-dxs-FP atctaagcggccgctcgacatttcattgtcgttgag 200 US-Psp5-dxs-RP caaaaaatttatttgctttcgcatctttttgtacctataagtgtggaatgagttttgatattgccaaatac 201 Psp5-dsx-FP gtaaagcttaccggaaagcagctgt 202 Psp5-dsx-RP agcaactcgaagcctgcgttaag 203 DS- Psp5-dxs-FP tccacacttataggtacaaaaagatgcgaaagcaaataaattttttcggcaccctggcgttttcccaacgttgcag 204 DS- Psp5-dsx-RP tagtaatctagaggtcatatgttcggcgttagcacaaac 205 US-Psp5-pdxj-FP atctaagcggccgcggcttgcggcaaaggtcg 206 US-Psp5-pdxj-RP aaaaaatttatttgctttcgcatctttttgtacctataagtgtggaatggctgaattactgttaggcgtc 207 Psp5- pdxj-FP ctttcacgttgtgataggtcag 208 Psp5- pdxj-RP aaaaaatttatttgctttcgcatctttttgtacctataagtgtggaatggctgaattactgttaggcgtc 209 DS-Psp5-pdxj-FP gacgcctaacagtaattcagccattccacacttataggtacaaaaagatgcgaaagc 210 DS-Psp5-pdxj-RP cgatctttaagagtaactccgatg 211

Strain name characteristic Etc EcW13 pts eda lacI thrB metA lysA adhE pflB ldhA iclR; replacing acs native promoter by P trc promoter; replacing ppc native promoter by synthetic promoter 8; pUCPK-P trc - metL This study EcW14 Ec13, ΔP _epd ::P _SP5 This study EcW15 Ec14, ΔP _dxs ::P _SP5 This study EcW16 Ec15, ΔP _pdxJ ::P _SP5 This study

The EcW13 strain was deposited with the Korea Microbiology Conservation Center located in Seodaemun-gu, Seoul on June 22, 2018, and was awarded the deposit number KCCM12281P, and the EcW20 strain was deposited and deposited with the Korea Microbiology Conservation Center on June 22, 2018. Has been awarded the number KCCM12282P.

5-2. DHB cell membrane transport protein expression control

In order to increase the extracellular transport rate of DHB, the transport protein candidates were first screened. Known organic acid membrane transport proteins, particularly lactic acid and low molecular weight carboxylic acid transport proteins, were used as queries to select importers and exporters. Table 16 shows a list of proteins selected as 2,4-DHB exporter candidates, and Table 17 shows a list of proteins selected as 2,4-DHB importer candidates.

Protein　　 Names Gene MFS type transporter YhjX Probable formate transporter focA Lactate premease lldp Inner membrane metabolite transporter yhjE C4-dicarboxylate transporter dcuA C4-dicarboxylate transporter dcuB C4-dicarboxylate transporter dcuC

Protein　　 Names Gene Alpha-ketoglutarate　　 permease kgtP Glycolate　　 permease glcA Acetate　　 symporter/ inner membrane protein actP Proline　　 symporter putP Pantothenate　　 synmporte panF Succinate　　 and acetate symporter satP Short　　 chain fatty acid transporter atoE DSdX　　 permease dsdX Uncharacterized yhbM

Among these , the expression levels of the two most probable exporters, ldp and dcuA, were increased using a synthetic promoter. Since excessive expression of the membrane protein interferes with cell growth, SP5, a synthetic promoter of intermediate strength, was used. In addition, the three membrane proteins, kgtP, dsdx, and actP, which are expected to be most likely by importer, were removed. Table 18 shows the primer sequences used for transporter engineering.

Primer (overexpression) Base sequence Sequence number US-Psp4-lldp-FP atctaagcggccgcgattggaatgcccatcgcac 212 US-Psp4-lldp-RP ttgacaattaatcatccggctcgtaatttatgtggaatgaatctctggcaacaaaactacg 213 Psp5-lldp-FP ccatctgaccaatctcaaagctgt 214 Psp5-lldp-RP ttgtgaacaaagcacctggtcgcg 215 DS- Psp4-lldp-FP tccacataaattacgagccggatgattaattgtcaattggtagggccaattcttgtg 216 DS- Psp4-lldp-RP tagtaatctagagaaagaagtcgaaaaaaacgaaatc 217 US-Psp4-ducA-FP atctaagcggccgcgttgatgattgcatagataacc 218 US- Psp4-ducA -RP ttgacaattaatcatccggctcgtaatttatgtggaatgcaggttgctggcggtctggactatctggttc 219 Psp4-ducA-FP ccatctgaccaatctcaaagctgt 220 Psp4-ducA-RP ttgtgaacaaagcacctggtcgcg 221 DS-Psp4-ducA -FP tccacataaattacgagccggatgattaattgtcaatgttttttaacaagttgatattagattg 222 DS-Psp4-ducA -RP tagtaatctagagaaagaagtcgaaaaaaacgaaatc 223 Primers (remove) Base sequence US-dsdx-FP atctaagcggccgcggtatccagcgacgattttagcg 224 US-dsdx-RP gtacgtctctttgcgcttacatatctcaccttcccctg
225 G-dsdx -FP gcgtgtaaagtcacctaatgc 226 G-dsdx -RP gggcatcagcagacatatg 227 DS-dsdx-FP caggggaaggtgagatatgtaagcgcaaagagacgtac 228 DS- dsdx-RP tagtaatctagacgctcataatgccgattgataac 229 US-kgtP-FP atctaagcggccgcggagctgatccgcgagcatac 230 US- kgtP -RP acggcaggagacataatggcatgtagtgacgggtcagttgccagac 231 G- kgtP -FP tggcgtctggatctggaaaacg 232 G- kgtP -RP tgtgtaagcgcagcgatgc 233 DS- kgtP -FP gtctggcaactgacccgtcactacatgccattatgtctcctgccgt 234 DS- kgtP-RP ta tagtaatctagagaagctgttttggcggatga 235 US-actP-FP atctaagcggccgccttatctttattaaggtaaac 236 US-actP -RP agtcctgcatgaggtacaagcatcatgtaatctctccccttccccggtcgtctg 237 G-actP -FP ctgtgggatttcgatagtat 238 G- actP -RP agcaacctgggcgatacctcgac 239 DS- actP -FP cagacgaccggggaaggggagagattacatgatgcttgtacctcatgcaggact 240 DS-actP-RP tagtaatctagaaagctgcttgaagagaagcag 241

Finally, the transporter and PLP biosynthetic pathway was changed DHB producing host strain E. coli was obtained as shown in Table 19 below.

Strain name characteristic Etc EcW16 pts eda lacI thrB metA lysA adhE pflB ldhA iclR; replacing acs native promoter by P trc promoter;replacing ppc native promoter by synthetic promoter 8; pUCPK-P trc - metL; ΔP _epd ::P _SP9 ΔP _dxs ::P _SP ΔP _pdxJ ::P _SP9 homoserine pathway, PLP biosynthetic pathway EcW17 EcW16, ΔP _ldp ::P _SP5 exporter expression EcW18 EcW16, ΔP _dcuA ::P _SP5 exporter expression EcW19 EcW16, ΔP _ldp ::P _SP5 ;ΔP _dcuA ::P _SP5 exporter expression EcW20 EcW19, Δ kgtP , Δ dsdx and Δ actP Remove Importer

Example 6: optically pure S- form or L-form 2,4-dihydroxy butyric acid (2,4- dihydroxybutyric acid, S- or R- DHB ) Production strain Production and fermentation

6-1. Genetic recombination plasmid construction for the production of DHB

Using a plasmid expressing pET-TA4-1 and LDH (pET-LDHA2 or pET-LDHD3), a recombinant plasmid expressing TA4-1 enzyme and OHB reductase enzyme at the same time was constructed. After PCR amplification of each gene fragment, overlap and ligation to the NdeI and EcoRI sites of the pBAD plasmid. Two new plasmids were obtained: pBAD_TA4-1_LDHA2 (hereinafter referred to as pDHB-L) plasmid for L-form DHB and pBAD_TA4-1_LDHD3 (hereinafter referred to as pDHB-D) plasmid for D-form DHB. In these two plasmids, the TA4-1 and OHB reductase genes were cloned under a promoter induced by Arabinose so that they were polycistronically transcribed at the same time (FIG. 21).

6-2. DHB production

For DHB production, the DHB production pathway plasmids pDHB-L and pDHB-D were introduced into the homoserine producing strain developed in Example 1, respectively. The homoserine-producing strain used was EcW20 (refer to Table 19) with 10 gene deletions ( pts, eda, lacI , thrB , metA, lysA, adhE, pflB, ldhA, iclR ) and 2 promoter substitutions (P acs ::P trc ) , P ppc ::P SP8 ), and the plasmid pUCPK-P trc - metL for overexpressing the metL gene. Furthermore, this strain was additionally introduced to enhance the expression of key enzymes in the production pathway for PLP overproduction, remove the importer membrane protein, and enhance the expression of the exporter membrane protein. The strains into which the DHB production pathway plasmid pDHB-L or pDHB-D was introduced into the EcW20 strain were respectively named EcW20 (pDHB-L) and EcW20 (pDHB-D).

First, L-DHB production was investigated through the EcW20 (pDHB-L) strain into which pDHBL was introduced. The EcW20 (pDHB-L) strain was cultured under aerobic conditions while stirring at 200 rpm in a 250 mL flask in a 50 mL medium volume. TPM2 medium using glucose as a carbon source (yeast extract, 2 g; MgSO ₄ 7-H ₂ O, 2 g; KH ₂ PO ₄ , 2 g; (NH ₄ ) ₂ SO ₄ , 10 g; L-methionine, 0.2 g ; L-lysine, 0.2g; L-Threonine, 0.2 g; L-isoleucine, 0.05 g; trace metal solution, 10 ml) was used. Glucose concentration was 10 g/L, and Kanamycin and ampicillin were added at 50 mg/L, respectively. Arabinose was added at different concentrations in the range of 0-1 g/L after 3 hours of culture.

As shown in Fig. 22, the EcW20 strain without the DHB production plasmid did not produce DHB at all. In the case of the EcW20 strain having the DHB production plasmid, the amount of DHB produced was changed according to the amount of arabinose added. That is, when arabinose was not added, a small amount of 0.005 g/L was obtained, whereas when arabinose was added at a concentration of 0.5 g/L, the largest amount was obtained at 0.33 g/L. When arabinose of higher 1 g/L was added, cell growth and glucose consumption were decreased, and DHB production was also lowered to 0.19 g/L. This is believed to be a side effect of overexpression of the enzyme in the DHB production pathway. All of the produced DHBs appeared in L-form.

D-DHB production was investigated through the EcW20 (pDHB-D) strain into which pDHBD was introduced in the same way. As in the case of L-DHB, the EcW20 strain without the DHB producing plasmid did not produce DHB at all. In the case of EcW20 (pDHB-D) strain, the amount of DHB produced was changed according to the amount of arabinose added. That is, when arabinose was not added, a small amount of 0.005 g/L was obtained, whereas when arabinose was added at a concentration of 0.5 g/L, the largest amount was obtained as 0.20 g/L. When arabinose of higher 1 g/L was added, cell growth and glucose consumption were decreased, and DHB production was also lowered to 0.17 g/L. This was judged as a side effect due to overexpression of the DHB production pathway enzyme. All of the produced DHBs appeared in D-form. Overall, a lower amount of D-DHB was produced than L-DHB. The reason was confirmed because the activity of the LdhD enzyme used in the production of the recombinant strain was lower than that of the LdhA activity. (Figure 22)

A bioreactor experiment was conducted using EcW20 (pDHB-L) and EcW20 (pDHB-D) strains (FIG. 24A). The reactor volume was 3 L, and the initial medium volume was 1 L. The same TPM2 medium as in the flask experiment was used, and glucose was added at an appropriate level during fermentation. In order to maintain aerobic conditions, air was injected at a speed of 1 vvm, and the stirring speed was properly adjusted between 500-900 rpm. Arabinose was added at 0.5 g/so after 6 hours incubation. Cells were grown from initial to 18 hours. DHB production started from 9 hours and continued until 48 hours after the culture was completed.

In FIGS. 24A and 24B, the solid line of the black circle signifies the cell concentration, the dotted line of the white circle signifies the product DHB, and the dotted line of the inverted triangle signifies the glucose concentration.

As a result, D-DHB and L-DHB differed in cell growth, product production, and final concentration. That is, in the case of L-DHB, the final cell concentration was 10 g/L and the final L-DHB concentration was 20 g/L. In contrast, in the case of D-DHB, the final cell concentration was 8 g/L and the final L-DHB concentration was 14 g/L.

Example 7: Preparation and fermentation of 2-hydroxy gamma butyrolactone (HGBL) producing strain

7-1 Construction of recombinant plasmid and recombinant strain for production of HGBL

In order to convert DHB to HGBL, lactonase enzyme is required. Paraoxonase was used as the lactonase enzyme, which requires calcium and is active against several substrates. Since this enzyme reaction is optimal in the acidic range, it is necessary to express it in the cell membrane or periplasmic space. Also, since this enzyme is of animal origin, appropriate mutation is required for microbial expression. Therefore, in this study, the pon1 gene variant (G3C9) was used and a signal sequence was attached to the N-terminus to be expressed in the periplasmic space. First, the pon1 (G3C9) gene was synthesized and then PCR amplified (FP, tagacacatatggctaaactgacagcg; RP, tacatactcgagttacagctcacagtaaagagctttg) and cloned into pACYC-Duet plasmid having a low copy number. The tac promoter was used for the expression of pon1 (G3C9) (Fig. 18). This plasmid was named pACYC_Pon1.

The obtained Pon1 plasmid was introduced into the two strains obtained previously, namely, the strains for producing L-DHB and D-DHB, respectively. In this case, since it is not desirable to increase the extracellular transport rate of DHB, EcW16 was used as a host cell (Table 19), and the plasmid for producing DHB from homoserine was the same as in the case of DHB production, pDHB-L and pDHB-D. Was used (Figure 21). And these strains were named EcW16 (pHGBL-L), EcW16 (pHGBL-D), respectively.

7-2 Operation of bioreactor for production of HGBL

Two-stage culture was performed for HGBL production. First, DHB was produced in the first stage of culture, and then HGBL was produced by lowering the pH in the second stage. After obtaining a single strain on agar medium, starter culture was performed using LB medium. And seed culture was performed using TPM2 medium as described above. This culture was carried out in TPM2 medium by inoculating seed culture cells in the exponential growth phase.

In the case of L-DHB, about 16 g/L of DHB was produced during a single stage culture for 48 hours. Cell concentration and glucose consumption rate were also decreased compared to fermentation for L-DHB production. The lack of transporter engineering, the introduction of plasmids for pon1 expression, and production of additional proteins, especially pon1 membrane proteins, were presumed to be the cause.

In the case of D-DHB, about 9 g/L of DHB was produced during a single stage culture for 48 hours. Cell concentration and glucose consumption rate were also decreased compared to fermentation for the production of D-DHB. The introduction of plasmids for pon1 expression and production of additional proteins, especially pon1 membrane proteins, were presumed to be the cause. In addition, L-DHB was obtained at a higher concentration than D-DHB, which is presumed to be because the activity of 2-oxo-reductase was significantly higher in L-form than D-form as described above.

Thereafter, in order to convert the produced DHB into HGBL, the pH of the culture solution was lowered to 6.2 using a hydrochloric acid solution, and the culture was continued. As a result, in the case of L-HGBL, about 5 g/L of lactone could be obtained through an additional culture for about 24 hours. Most of the DHB remained unconverted to HGBL (Figure 26A).

On the other hand, the same experiment was performed to obtain D-HGBL (FIG. 26B), that is, 48 hours 1 stage culture followed by 24 hours 2 stage culture at pH 6.2. Unlike the case of L-HGBL, only a very low concentration of 0.3 g/L was obtained. The reason was presumed that the used pon1 enzyme was only active in L-form DHB.

2,4-dihydroxy butyric acid was converted to Lactone through chemical reaction. In this case, the culture medium after the first stage of culture shown in FIGS. 23 and 24 was centrifuged to remove the cells, and the pH was dropped to 1.0 by adding hydrochloric acid solution to the culture solution. Then, it was allowed to react for 10 hours. In this case, about 50% of both L-DHB and D-DHB were converted to lactone. As a result, about 9 g/L of L-HGBL and about 6 g/L of D-HGBL were obtained. From this, it was found that the use of acid-catalyzed chemical reaction for both D-form and L-form for esterification of DHB is more efficient than using pon1 enzyme.

Depositary institution name: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12281P

Consignment Date: 20180622

Depositary institution name: Korea Microorganism Conservation Center (overseas)

Accession number: KCCM12282P

Consignment Date: 20180622

<110> UNIST(ULSAN NATIONAL INSTITUTE OF SCIENCE AND TECHNOLOGY) <120> Method of producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid <130> DPP20173744KR <150> 10-2017-0088465 <151> 2017-07-12 <160> 241 <170> KopatentIn 3.0 <210> 1 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase [Bacillus subtilis subsp. subtilis str. 168]: AQR85543.1) <400> 1 atgaaatttg aacagtctca tgtattgaag gaattgccta aacaattctt cgcttctctg 60 gtgcagaaag tgaaccgaaa gcttgcagaa ggacatgacg ttatcaatct gggacaggga 120 aatccagatc agccgactcc tgagcatatt gttgaggaga tgaaacgagc tgtcgctgat 180 cctgagaatc ataaatattc gtcttttcgc ggctcatacc gtctgaagtc agcggctgct 240 gcattttaca aaagagaata cggcattgat ctggatccgg aaaccgaagt cgctgtatta 300 ttcggcggaa aagccggtct agtcgagctc ccgcaatgct tgttgaatcc cggtgatacg 360 attttagttc ccgatccggg ttatcctgat tactggtcgg gtgtcacact tgcaaaagca 420 aagatggaaa tgatgccgct cgtaaaggac agagcgtttc tccctgatta cagcagcata 480 accgctgaaa taagggaaca ggcgaaattg atgtatttga attatccgaa taatccgact 540 ggagctgttg ctacttccga gttctttgaa gataccgtgc gttttgcggc tgaaaacgga 600 atctgcgtcg ttcacgattt tgcttacggc gctgtaggat ttgacggctg caagccttta 660 agctttttgc agactgaagg tgcgaaggat atcggaattg aaatttacac gctgtcaaaa 720 acgtataata tggcaggatg gcgggttggc tttgccgtcg gaaacgcttc ggtcattgaa 780 gcgatcaatc tttatcaaga ccatatgttt gtcagtcttt tcagagcgac tcaggaggct 840 gcagcagagg cactgttagc cgatcagacg tgtgtggcag agcaaaatgc caggtatgag 900 agcaggagaa acgcttggat cacggcatgc cgggaaatcg gctgggatgt aacagctccc 960 gcaggttctt tttttgcatg gctgcctgtg cctgaaggct atacttctga gcagttctca 1020 gatcttttgc tggaaaaagc gaatgtggca gttgcggctg gaaacggctt cggtgaatat 1080 ggcgagggct acgtcagagt cggactttta acaagtgaag aaagacttaa ggaagccgct 1140 tatcgaattg gcaaactgaa cctgtttacc caaaaaagca ttgacaagac cttataa 1197 <210> 2 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase: AQR85543.1 (Y364Q)) <400> 2 atgaaatttg aacagtctca tgtattgaag gaattgccta aacaattctt cgcttctctg 60 gtgcagaaag tgaaccgaaa gcttgcagaa ggacatgacg ttatcaatct gggacaggga 120 aatccagatc agccgactcc tgagcatatt gttgaggaga tgaaacgagc tgtcgctgat 180 cctgagaatc ataaatattc gtcttttcgc ggctcatacc gtctgaagtc agcggctgct 240 gcattttaca aaagagaata cggcattgat ctggatccgg aaaccgaagt cgctgtatta 300 ttcggcggaa aagccggtct agtcgagctc ccgcaatgct tgttgaatcc cggtgatacg 360 attttagttc ccgatccggg ttatcctgat tactggtcgg gtgtcacact tgcaaaagca 420 aagatggaaa tgatgccgct cgtaaaggac agagcgtttc tccctgatta cagcagcata 480 accgctgaaa taagggaaca ggcgaaattg atgtatttga attatccgaa taatccgact 540 ggagctgttg ctacttccga gttctttgaa gataccgtgc gttttgcggc tgaaaacgga 600 atctgcgtcg ttcacgattt tgcttacggc gctgtaggat ttgacggctg caagccttta 660 agctttttgc agactgaagg tgcgaaggat atcggaattg aaatttacac gctgtcaaaa 720 acgtataata tggcaggatg gcgggttggc tttgccgtcg gaaacgcttc ggtcattgaa 780 gcgatcaatc tttatcaaga ccatatgttt gtcagtcttt tcagagcgac tcaggaggct 840 gcagcagagg cactgttagc cgatcagacg tgtgtggcag agcaaaatgc caggtatgag 900 agcaggagaa acgcttggat cacggcatgc cgggaaatcg gctgggatgt aacagctccc 960 gcaggttctt tttttgcatg gctgcctgtg cctgaaggct atacttctga gcagttctca 1020 gatcttttgc tggaaaaagc gaatgtggca gttgcggctg gaaacggctt cggtgaatat 1080 ggcgagggcc aggtcagagt cggactttta acaagtgaag aaagacttaa ggaagccgct 1140 tatcgaattg gcaaactgaa cctgtttacc caaaaaagca ttgacaagac cttataa 1197 <210> 3 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase: AQR85543.1 (N174D)) <400> 3 atgaaatttg aacagtctca tgtattgaag gaattgccta aacaattctt cgcttctctg 60 gtgcagaaag tgaaccgaaa gcttgcagaa ggacatgacg ttatcaatct gggacaggga 120 aatccagatc agccgactcc tgagcatatt gttgaggaga tgaaacgagc tgtcgctgat 180 cctgagaatc ataaatattc gtcttttcgc ggctcatacc gtctgaagtc agcggctgct 240 gcattttaca aaagagaata cggcattgat ctggatccgg aaaccgaagt cgctgtatta 300 ttcggcggaa aagccggtct agtcgagctc ccgcaatgct tgttgaatcc cggtgatacg 360 attttagttc ccgatccggg ttatcctgat tactggtcgg gtgtcacact tgcaaaagca 420 aagatggaaa tgatgccgct cgtaaaggac agagcgtttc tccctgatta cagcagcata 480 accgctgaaa taagggaaca ggcgaaattg atgtatttga attatccgaa tgacccgact 540 ggagctgttg ctacttccga gttctttgaa gataccgtgc gttttgcggc tgaaaacgga 600 atctgcgtcg ttcacgattt tgcttacggc gctgtaggat ttgacggctg caagccttta 660 agctttttgc agactgaagg tgcgaaggat atcggaattg aaatttacac gctgtcaaaa 720 acgtataata tggcaggatg gcgggttggc tttgccgtcg gaaacgcttc ggtcattgaa 780 gcgatcaatc tttatcaaga ccatatgttt gtcagtcttt tcagagcgac tcaggaggct 840 gcagcagagg cactgttagc cgatcagacg tgtgtggcag agcaaaatgc caggtatgag 900 agcaggagaa acgcttggat cacggcatgc cgggaaatcg gctgggatgt aacagctccc 960 gcaggttctt tttttgcatg gctgcctgtg cctgaaggct atacttctga gcagttctca 1020 gatcttttgc tggaaaaagc gaatgtggca gttgcggctg gaaacggctt cggtgaatat 1080 ggcgagggcc aggtcagagt cggactttta acaagtgaag aaagacttaa ggaagccgct 1140 tatcgaattg gcaaactgaa cctgtttacc caaaaaagca ttgacaagac cttataa 1197 <210> 4 <211> 1196 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase: AQR85543.1 (N174D Y364Q)) <400> 4 atgaaatttg aacagtctca tgtattgaag gaattgccta aacaattctt cgcttctctg 60 gtgcagaaag tgaaccgaaa gcttgcagaa ggacatgacg ttatcaatct gggacaggga 120 aatccagatc agccgactcc tgagcatatt gttgaggaga tgaaacgagc tgtcgctgat 180 cctgagaatc ataaatattc gtcttttcgc ggctcatacc gtctgaagtc agcggctgct 240 gcattttaca aaagagaata cggcattgat ctggatccgg aaaccgaagt cgctgtatta 300 ttcggcggaa aagccggtct agtcgagctc ccgcaatgct tgttgaatcc cggtgatacg 360 attttagttc ccgatccggg ttatcctgat tactggtcgg gtgtcacact tgcaaaagca 420 aagatggaaa tgatgccgct cgtaaaggac agagcgtttc tccctgatta cagcagcata 480 accgctgaaa taagggaaca ggcgaaattg atgtatttga attatccgaa tgacccgact 540 ggagctgttg ctacttccga gttctttgaa gataccgtgc gttttgcggc tgaaaacgga 600 atctgcgtcg ttcacgattt tgcttacggc gctgtaggat ttgacggctg caagccttta 660 agctttttgc agactgaagg tgcgaaggat atcggaattg aaatttacac gctgtcaaaa 720 acgtataata tggcaggatg gcgggttggc tttgccgtcg gaaacgcttc ggtcattgaa 780 gcgatcaatc tttatcaaga ccatatgttt gtcagtcttt tcagagcgac tcaggaggct 840 gcagcagagg cactgttagc cgatcagacg tgtgtggcag agcaaaatgc caggtatgag 900 agcaggagaa acgcttggat cacggcatgc cgggaaatcg gctgggatgt aacagctccc 960 gcaggttctt tttttgcatg gctgcctgtg cctgaaggct atacttctga gcagttctca 1020 gatcttttgc tggaaaaagc gaatgtggca gttgcggctg gaaacggctt cggtgaatat 1080 ggcgagggcc aggtcgagtc ggacttttaa caagtgaaga aagacttaag gaagccgctt 1140 atcgaattgg caaactgaac ctgtttaccc aaaaaagcat tgacaagacc ttataa 1196 <210> 5 <211> 1050 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (L-lactate dehydrogenase [Alcaligenes eutrophus]: YP_725182.1) <400> 5 atgaagatct ccctcaccag cgcccgccag cttgcccgcg acatcctcgc cgcgcagcag 60 gtgcccgccg acatcgctga cgacgtggcc gagcacctgg tcgaatccga ccgctgcggc 120 tatatcagcc acggcctgtc gatcctgccc aactaccgca ccgccctcga cggccacagc 180 gtcaacccgc aaggccgcgc caaatgcgtg ctggaccagg gcacgctgat ggtgttcgac 240 ggcgacggcg gcttcggcca gcacgtgggc aagtccgtga tgcaagcagc gatcgagcgc 300 gtgcgccagc atggccactg catcgtcact ctgcgccgct cgcaccatct cggccgcatg 360 ggccactacg gcgagatggc ggccgccgcc ggctttgtgc tgctgagctt caccaacgtg 420 atcaaccgcg cgccggtggt ggcgccgttc ggcggccgcg tggcgcggct caccaccaac 480 ccgctgtgtt tcgccggccc gatgcccaac gggcggccgc ctctggtggt ggacatcgcc 540 accagcgcga ttgccatcaa caaggcccgt gtgctggccg agaaaggcga gccggcgccc 600 gaaggcagca tcatcggcgc cgacggcaac cccaccaccg acgcgtcaac catgttcggc 660 gaacaccccg gcgcgctgct gccctttggc ggccacaagg gctacgcact gggcgttgtg 720 gccgagctgc tggcgggcgt gctgtccggc ggcggtacca tccagccaga caatccgcgc 780 ggcggcgtgg ccaccaacaa cctgttcgcg gtgctgctca atcccgcgct ggacctgggc 840 ctggactggc agagcgccga ggtcgaggcg ttcgtgcgct acctgcacga cacaccgccg 900 gcgccgggcg tcgaccgcgt gcagtacccc ggcgagtacg aggccgccaa ccgggcgcag 960 gccagcgaca cgctaaacat caacccggcc atctggcgca atcttgagcg cctggcgcag 1020 tcgctcaacg tggccgtccc cacggcctga 1050 <210> 6 <211> 1050 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (L-lactate dehydrogenase: YP_725182.1 (I48N)) <400> 6 atgaagatct ccctcaccag cgcccgccag cttgcccgcg acatcctcgc cgcgcagcag 60 gtgcccgccg acatcgctga cgacgtggcc gagcacctgg tcgaatccga ccgctgcggc 120 tatatcagcc acggcctgtc gaatctgccc aactaccgca ccgccctcga cggccacagc 180 gtcaacccgc aaggccgcgc caaatgcgtg ctggaccagg gcacgctgat ggtgttcgac 240 ggcgacggcg gcttcggcca gcacgtgggc aagtccgtga tgcaagcagc gatcgagcgc 300 gtgcgccagc atggccactg catcgtcact ctgcgccgct cgcaccatct cggccgcatg 360 ggccactacg gcgagatggc ggccgccgcc ggctttgtgc tgctgagctt caccaacgtg 420 atcaaccgcg cgccggtggt ggcgccgttc ggcggccgcg tggcgcggct caccaccaac 480 ccgctgtgtt tcgccggccc gatgcccaac gggcggccgc ctctggtggt ggacatcgcc 540 accagcgcga ttgccatcaa caaggcccgt gtgctggccg agaaaggcga gccggcgccc 600 gaaggcagca tcatcggcgc cgacggcaac cccaccaccg acgcgtcaac catgttcggc 660 gaacaccccg gcgcgctgct gccctttggc ggccacaagg gctacgcact gggcgttgtg 720 gccgagctgc tggcgggcgt gctgtccggc ggcggtacca tccagccaga caatccgcgc 780 ggcggcgtgg ccaccaacaa cctgttcgcg gtgctgctca atcccgcgct ggacctgggc 840 ctggactggc agagcgccga ggtcgaggcg ttcgtgcgct acctgcacga cacaccgccg 900 gcgccgggcg tcgaccgcgt gcagtacccc ggcgagtacg aggccgccaa ccgggcgcag 960 gccagcgaca cgctaaacat caacccggcc atctggcgca atcttgagcg cctggcgcag 1020 tcgctcaacg tggccgtccc cacggcctga 1050 <210> 7 <211> 1050 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (L-lactate dehydrogenase: YP_725182.1(I48T)) <400> 7 atgaagatct ccctcaccag cgcccgccag cttgcccgcg acatcctcgc cgcgcagcag 60 gtgcccgccg acatcgctga cgacgtggcc gagcacctgg tcgaatccga ccgctgcggc 120 tatatcagcc acggcctgtc gactctgccc aactaccgca ccgccctcga cggccacagc 180 gtcaacccgc aaggccgcgc caaatgcgtg ctggaccagg gcacgctgat ggtgttcgac 240 ggcgacggcg gcttcggcca gcacgtgggc aagtccgtga tgcaagcagc gatcgagcgc 300 gtgcgccagc atggccactg catcgtcact ctgcgccgct cgcaccatct cggccgcatg 360 ggccactacg gcgagatggc ggccgccgcc ggctttgtgc tgctgagctt caccaacgtg 420 atcaaccgcg cgccggtggt ggcgccgttc ggcggccgcg tggcgcggct caccaccaac 480 ccgctgtgtt tcgccggccc gatgcccaac gggcggccgc ctctggtggt ggacatcgcc 540 accagcgcga ttgccatcaa caaggcccgt gtgctggccg agaaaggcga gccggcgccc 600 gaaggcagca tcatcggcgc cgacggcaac cccaccaccg acgcgtcaac catgttcggc 660 gaacaccccg gcgcgctgct gccctttggc ggccacaagg gctacgcact gggcgttgtg 720 gccgagctgc tggcgggcgt gctgtccggc ggcggtacca tccagccaga caatccgcgc 780 ggcggcgtgg ccaccaacaa cctgttcgcg gtgctgctca atcccgcgct ggacctgggc 840 ctggactggc agagcgccga ggtcgaggcg ttcgtgcgct acctgcacga cacaccgccg 900 gcgccgggcg tcgaccgcgt gcagtacccc ggcgagtacg aggccgccaa ccgggcgcag 960 gccagcgaca cgctaaacat caacccggcc atctggcgca atcttgagcg cctggcgcag 1020 tcgctcaacg tggccgtccc cacggcctga 1050 <210> 8 <211> 1002 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase [Lactobacillus delbrueckii subsp. bulgaricus]: CAI96942.1) <400> 8 atgactaaaa tttttgctta cgcaattcgt gaagatgaaa agccattctt gaaggaatgg 60 gaagacgctc acaaggacgt cgaagttgaa tacactgaca agcttttgac cccagaaact 120 gttgctttgg caaagggtgc tgacggtgtt gttgtttacc aacaacttga ctacaccgct 180 gaaactctgc aagctttggc agacaacggc atcactaaga tgagcctgcg taacgttggt 240 gttgacaaca tcgacatggc taaggctaag gaacttggct tccaaatcac caacgttcca 300 gtttactcac caaacgccat cgcagaacac gctgctatcc aagctgcccg catcctgcgt 360 caagacaagg ctatggacga aaaggttgcc cgtcacgact tgcgttgggc accaactatc 420 ggccgtgaag ttcgcgacca agttgttggt gttataggta ctggccacat cggtcaagtc 480 ttcatgcaaa tcatggaagg cttcggcgct aaggttatcg cttacgacat cttccgcaac 540 ccagaattgg aaaagaaggg ctactacgta gactcacttg acgacctgta caagcaagct 600 gacgttattt ccctgcacgt tcctgacgtt ccagctaacg ttcacatgat caacgacgag 660 tcaatcgcta aaatgaagca agacgtagtt atcgttaacg tatcacgtgg tccattggtt 720 gacactgacg cggttatccg tggtttggac tcaggcaaga tcttcggtta cgcaatggac 780 gtttacgaag gtgaagttgg catcttcaac gaagactggg aaggcaagga attcccagac 840 gcacgtttag ctgacttaat cgctcgtcca aacgttctgg taactccaca cactgctttc 900 tacactactc acgctgttcg caacatggta gttaaggcct tcgacaacaa ccttgaattg 960 gttgaaggca aggaagctga aactccagtt aaggttggct aa 1002 <210> 9 <211> 1002 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase: CAI96942.1 (V79N)) <400> 9 atgactaaaa tttttgctta cgcaattcgt gaagatgaaa agccattctt gaaggaatgg 60 gaagacgctc acaaggacgt cgaagttgaa tacactgaca agcttttgac cccagaaact 120 gttgctttgg caaagggtgc tgacggtgtt gttgtttacc aacaacttga ctacaccgct 180 gaaactctgc aagctttggc agacaacggc atcactaaga tgagcctgcg taacaacggt 240 gttgacaaca tcgacatggc taaggctaag gaacttggct tccaaatcac caacgttcca 300 gtttactcac caaacgccat cgcagaacac gctgctatcc aagctgcccg catcctgcgt 360 caagacaagg ctatggacga aaaggttgcc cgtcacgact tgcgttgggc accaactatc 420 ggccgtgaag ttcgcgacca agttgttggt gttataggta ctggccacat cggtcaagtc 480 ttcatgcaaa tcatggaagg cttcggcgct aaggttatcg cttacgacat cttccgcaac 540 ccagaattgg aaaagaaggg ctactacgta gactcacttg acgacctgta caagcaagct 600 gacgttattt ccctgcacgt tcctgacgtt ccagctaacg ttcacatgat caacgacgag 660 tcaatcgcta aaatgaagca agacgtagtt atcgttaacg tatcacgtgg tccattggtt 720 gacactgacg cggttatccg tggtttggac tcaggcaaga tcttcggtta cgcaatggac 780 gtttacgaag gtgaagttgg catcttcaac gaagactggg aaggcaagga attcccagac 840 gcacgtttag ctgacttaat cgctcgtcca aacgttctgg taactccaca cactgctttc 900 tacactactc acgctgttcg caacatggta gttaaggcct tcgacaacaa ccttgaattg 960 gttgaaggca aggaagctga aactccagtt aaggttggct aa 1002 <210> 10 <211> 1002 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase: CAI96942.1 (V79T)) <400> 10 atgactaaaa tttttgctta cgcaattcgt gaagatgaaa agccattctt gaaggaatgg 60 gaagacgctc acaaggacgt cgaagttgaa tacactgaca agcttttgac cccagaaact 120 gttgctttgg caaagggtgc tgacggtgtt gttgtttacc aacaacttga ctacaccgct 180 gaaactctgc aagctttggc agacaacggc atcactaaga tgagcctgcg taacaccggt 240 gttgacaaca tcgacatggc taaggctaag gaacttggct tccaaatcac caacgttcca 300 gtttactcac caaacgccat cgcagaacac gctgctatcc aagctgcccg catcctgcgt 360 caagacaagg ctatggacga aaaggttgcc cgtcacgact tgcgttgggc accaactatc 420 ggccgtgaag ttcgcgacca agttgttggt gttataggta ctggccacat cggtcaagtc 480 ttcatgcaaa tcatggaagg cttcggcgct aaggttatcg cttacgacat cttccgcaac 540 ccagaattgg aaaagaaggg ctactacgta gactcacttg acgacctgta caagcaagct 600 gacgttattt ccctgcacgt tcctgacgtt ccagctaacg ttcacatgat caacgacgag 660 tcaatcgcta aaatgaagca agacgtagtt atcgttaacg tatcacgtgg tccattggtt 720 gacactgacg cggttatccg tggtttggac tcaggcaaga tcttcggtta cgcaatggac 780 gtttacgaag gtgaagttgg catcttcaac gaagactggg aaggcaagga attcccagac 840 gcacgtttag ctgacttaat cgctcgtcca aacgttctgg taactccaca cactgctttc 900 tacactactc acgctgttcg caacatggta gttaaggcct tcgacaacaa ccttgaattg 960 gttgaaggca aggaagctga aactccagtt aaggttggct aa 1002 <210> 11 <211> 1065 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Paraoxonase PON1 variant: AAR95986.1 G3C9) <400> 11 atggctaaac tgacagcgct cacactcttg gggctgggat tggcactctt cgatggacag 60 aagtcttctt tccaaacacg atttaatgtt caccgtgaag taactccagt ggaacttcct 120 aactgtaatt tagttaaagg ggttgacaat ggttctgaag acttggaaat actgcccaat 180 ggactggctt tcatcagctc cggattaaag tatcctggaa taatgagctt tgaccctgat 240 aagtctggaa agatacttct aatggacctg aatgaggaag acccagtagt gttggaactg 300 ggcattactg gaaatacatt ggatatatct tcatttaacc ctcatgggat tagcacattc 360 acagatgaag ataacactgt gtacctactg gtggtaaacc atccagactc ctcgtccacc 420 gtggaggtgt ttaaatttca agaagaagaa aaatcacttt tgcatctgaa aaccatcaga 480 cacaagcttc tgcctagtgt gaatgacatt gtcgctgtgg gacctgaaca cttttatgcc 540 acaaatgatc actattttgc tgacccttac ttaaaatcct gggaaatgca tttgggatta 600 gcgtggtcat ttgttactta ttatagtccc aatgatgttc gagtagtggc agaaggattt 660 gattttgcta acggaatcaa catctcacca gacggcaagt atgtctatat agctgagttg 720 ctggctcata agatccatgt gtatgaaaag cacgctaatt ggactttaac tccattgaag 780 tccctcgact ttgacaccct tgtggataac atctctgtgg atcctgtgac aggggacctc 840 tgggtgggat gccatcccaa cggaatgcga atcttctact atgacccaaa gaatcctccc 900 ggctcagagg tgcttcgaat ccaggacatt ttatccgaag agcccaaagt gacagtggtt 960 tatgcagaaa atggcactgt gttacagggc agcacggtgg ccgctgtgta caaagggaaa 1020 ctgctgattg gcacagtgtt tcacaaagct ctttactgtg agctg 1065 <210> 12 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase [Bacillus subtilis subsp. subtilis str. 168]: AQR85543.1 (TA4)) <400> 12 Met Lys Phe Glu Gln Ser His Val Leu Lys Glu Leu Pro Lys Gln Phe 1 5 10 15 Phe Ala Ser Leu Val Gln Lys Val Asn Arg Lys Leu Ala Glu Gly His 20 25 30 Asp Val Ile Asn Leu Gly Gln Gly Asn Pro Asp Gln Pro Thr Pro Glu 35 40 45 His Ile Val Glu Glu Met Lys Arg Ala Val Ala Asp Pro Glu Asn His 50 55 60 Lys Tyr Ser Ser Phe Arg Gly Ser Tyr Arg Leu Lys Ser Ala Ala Ala 65 70 75 80 Ala Phe Tyr Lys Arg Glu Tyr Gly Ile Asp Leu Asp Pro Glu Thr Glu 85 90 95 Val Ala Val Leu Phe Gly Gly Lys Ala Gly Leu Val Glu Leu Pro Gln 100 105 110 Cys Leu Leu Asn Pro Gly Asp Thr Ile Leu Val Pro Asp Pro Gly Tyr 115 120 125 Pro Asp Tyr Trp Ser Gly Val Thr Leu Ala Lys Ala Lys Met Glu Met 130 135 140 Met Pro Leu Val Lys Asp Arg Ala Phe Leu Pro Asp Tyr Ser Ser Ile 145 150 155 160 Thr Ala Glu Ile Arg Glu Gln Ala Lys Leu Met Tyr Leu Asn Tyr Pro 165 170 175 Asn Asn Pro Thr Gly Ala Val Ala Thr Ser Glu Phe Phe Glu Asp Thr 180 185 190 Val Arg Phe Ala Ala Glu Asn Gly Ile Cys Val Val His Asp Phe Ala 195 200 205 Tyr Gly Ala Val Gly Phe Asp Gly Cys Lys Pro Leu Ser Phe Leu Gln 210 215 220 Thr Glu Gly Ala Lys Asp Ile Gly Ile Glu Ile Tyr Thr Leu Ser Lys 225 230 235 240 Thr Tyr Asn Met Ala Gly Trp Arg Val Gly Phe Ala Val Gly Asn Ala 245 250 255 Ser Val Ile Glu Ala Ile Asn Leu Tyr Gln Asp His Met Phe Val Ser 260 265 270 Leu Phe Arg Ala Thr Gln Glu Ala Ala Ala Glu Ala Leu Leu Ala Asp 275 280 285 Gln Thr Cys Val Ala Glu Gln Asn Ala Arg Tyr Glu Ser Arg Arg Asn 290 295 300 Ala Trp Ile Thr Ala Cys Arg Glu Ile Gly Trp Asp Val Thr Ala Pro 305 310 315 320 Ala Gly Ser Phe Phe Ala Trp Leu Pro Val Pro Glu Gly Tyr Thr Ser 325 330 335 Glu Gln Phe Ser Asp Leu Leu Leu Glu Lys Ala Asn Val Ala Val Ala 340 345 350 Ala Gly Asn Gly Phe Gly Glu Tyr Gly Glu Gly Tyr Val Arg Val Gly 355 360 365 Leu Leu Thr Ser Glu Glu Arg Leu Lys Glu Ala Ala Tyr Arg Ile Gly 370 375 380 Lys Leu Asn Leu Phe Thr Gln Lys Ser Ile Asp Lys Thr Leu 385 390 395 <210> 13 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase: AQR85543.1 (Y364Q)_TA4-1) <400> 13 Met Lys Phe Glu Gln Ser His Val Leu Lys Glu Leu Pro Lys Gln Phe 1 5 10 15 Phe Ala Ser Leu Val Gln Lys Val Asn Arg Lys Leu Ala Glu Gly His 20 25 30 Asp Val Ile Asn Leu Gly Gln Gly Asn Pro Asp Gln Pro Thr Pro Glu 35 40 45 His Ile Val Glu Glu Met Lys Arg Ala Val Ala Asp Pro Glu Asn His 50 55 60 Lys Tyr Ser Ser Phe Arg Gly Ser Tyr Arg Leu Lys Ser Ala Ala Ala 65 70 75 80 Ala Phe Tyr Lys Arg Glu Tyr Gly Ile Asp Leu Asp Pro Glu Thr Glu 85 90 95 Val Ala Val Leu Phe Gly Gly Lys Ala Gly Leu Val Glu Leu Pro Gln 100 105 110 Cys Leu Leu Asn Pro Gly Asp Thr Ile Leu Val Pro Asp Pro Gly Tyr 115 120 125 Pro Asp Tyr Trp Ser Gly Val Thr Leu Ala Lys Ala Lys Met Glu Met 130 135 140 Met Pro Leu Val Lys Asp Arg Ala Phe Leu Pro Asp Tyr Ser Ser Ile 145 150 155 160 Thr Ala Glu Ile Arg Glu Gln Ala Lys Leu Met Tyr Leu Asn Tyr Pro 165 170 175 Asn Asn Pro Thr Gly Ala Val Ala Thr Ser Glu Phe Phe Glu Asp Thr 180 185 190 Val Arg Phe Ala Ala Glu Asn Gly Ile Cys Val Val His Asp Phe Ala 195 200 205 Tyr Gly Ala Val Gly Phe Asp Gly Cys Lys Pro Leu Ser Phe Leu Gln 210 215 220 Thr Glu Gly Ala Lys Asp Ile Gly Ile Glu Ile Tyr Thr Leu Ser Lys 225 230 235 240 Thr Tyr Asn Met Ala Gly Trp Arg Val Gly Phe Ala Val Gly Asn Ala 245 250 255 Ser Val Ile Glu Ala Ile Asn Leu Tyr Gln Asp His Met Phe Val Ser 260 265 270 Leu Phe Arg Ala Thr Gln Glu Ala Ala Ala Glu Ala Leu Leu Ala Asp 275 280 285 Gln Thr Cys Val Ala Glu Gln Asn Ala Arg Tyr Glu Ser Arg Arg Asn 290 295 300 Ala Trp Ile Thr Ala Cys Arg Glu Ile Gly Trp Asp Val Thr Ala Pro 305 310 315 320 Ala Gly Ser Phe Phe Ala Trp Leu Pro Val Pro Glu Gly Tyr Thr Ser 325 330 335 Glu Gln Phe Ser Asp Leu Leu Leu Glu Lys Ala Asn Val Ala Val Ala 340 345 350 Ala Gly Asn Gly Phe Gly Glu Tyr Gly Glu Gly Gln Val Arg Val Gly 355 360 365 Leu Leu Thr Ser Glu Glu Arg Leu Lys Glu Ala Ala Tyr Arg Ile Gly 370 375 380 Lys Leu Asn Leu Phe Thr Gln Lys Ser Ile Asp Lys Thr Leu 385 390 395 <210> 14 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase: AQR85543.1 (N174D)_TA4-2) <400> 14 Met Lys Phe Glu Gln Ser His Val Leu Lys Glu Leu Pro Lys Gln Phe 1 5 10 15 Phe Ala Ser Leu Val Gln Lys Val Asn Arg Lys Leu Ala Glu Gly His 20 25 30 Asp Val Ile Asn Leu Gly Gln Gly Asn Pro Asp Gln Pro Thr Pro Glu 35 40 45 His Ile Val Glu Glu Met Lys Arg Ala Val Ala Asp Pro Glu Asn His 50 55 60 Lys Tyr Ser Ser Phe Arg Gly Ser Tyr Arg Leu Lys Ser Ala Ala Ala 65 70 75 80 Ala Phe Tyr Lys Arg Glu Tyr Gly Ile Asp Leu Asp Pro Glu Thr Glu 85 90 95 Val Ala Val Leu Phe Gly Gly Lys Ala Gly Leu Val Glu Leu Pro Gln 100 105 110 Cys Leu Leu Asn Pro Gly Asp Thr Ile Leu Val Pro Asp Pro Gly Tyr 115 120 125 Pro Asp Tyr Trp Ser Gly Val Thr Leu Ala Lys Ala Lys Met Glu Met 130 135 140 Met Pro Leu Val Lys Asp Arg Ala Phe Leu Pro Asp Tyr Ser Ser Ile 145 150 155 160 Thr Ala Glu Ile Arg Glu Gln Ala Lys Leu Met Tyr Leu Asp Tyr Pro 165 170 175 Asn Asn Pro Thr Gly Ala Val Ala Thr Ser Glu Phe Phe Glu Asp Thr 180 185 190 Val Arg Phe Ala Ala Glu Asn Gly Ile Cys Val Val His Asp Phe Ala 195 200 205 Tyr Gly Ala Val Gly Phe Asp Gly Cys Lys Pro Leu Ser Phe Leu Gln 210 215 220 Thr Glu Gly Ala Lys Asp Ile Gly Ile Glu Ile Tyr Thr Leu Ser Lys 225 230 235 240 Thr Tyr Asn Met Ala Gly Trp Arg Val Gly Phe Ala Val Gly Asn Ala 245 250 255 Ser Val Ile Glu Ala Ile Asn Leu Tyr Gln Asp His Met Phe Val Ser 260 265 270 Leu Phe Arg Ala Thr Gln Glu Ala Ala Ala Glu Ala Leu Leu Ala Asp 275 280 285 Gln Thr Cys Val Ala Glu Gln Asn Ala Arg Tyr Glu Ser Arg Arg Asn 290 295 300 Ala Trp Ile Thr Ala Cys Arg Glu Ile Gly Trp Asp Val Thr Ala Pro 305 310 315 320 Ala Gly Ser Phe Phe Ala Trp Leu Pro Val Pro Glu Gly Tyr Thr Ser 325 330 335 Glu Gln Phe Ser Asp Leu Leu Leu Glu Lys Ala Asn Val Ala Val Ala 340 345 350 Ala Gly Asn Gly Phe Gly Glu Tyr Gly Glu Gly Gln Val Arg Val Gly 355 360 365 Leu Leu Thr Ser Glu Glu Arg Leu Lys Glu Ala Ala Tyr Arg Ile Gly 370 375 380 Lys Leu Asn Leu Phe Thr Gln Lys Ser Ile Asp Lys Thr Leu 385 390 395 <210> 15 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (Asparate aminotransferase: AQR85543.1 (N174D Y364Q)_TA4-6) <400> 15 Met Lys Phe Glu Gln Ser His Val Leu Lys Glu Leu Pro Lys Gln Phe 1 5 10 15 Phe Ala Ser Leu Val Gln Lys Val Asn Arg Lys Leu Ala Glu Gly His 20 25 30 Asp Val Ile Asn Leu Gly Gln Gly Asn Pro Asp Gln Pro Thr Pro Glu 35 40 45 His Ile Val Glu Glu Met Lys Arg Ala Val Ala Asp Pro Glu Asn His 50 55 60 Lys Tyr Ser Ser Phe Arg Gly Ser Tyr Arg Leu Lys Ser Ala Ala Ala 65 70 75 80 Ala Phe Tyr Lys Arg Glu Tyr Gly Ile Asp Leu Asp Pro Glu Thr Glu 85 90 95 Val Ala Val Leu Phe Gly Gly Lys Ala Gly Leu Val Glu Leu Pro Gln 100 105 110 Cys Leu Leu Asn Pro Gly Asp Thr Ile Leu Val Pro Asp Pro Gly Tyr 115 120 125 Pro Asp Tyr Trp Ser Gly Val Thr Leu Ala Lys Ala Lys Met Glu Met 130 135 140 Met Pro Leu Val Lys Asp Arg Ala Phe Leu Pro Asp Tyr Ser Ser Ile 145 150 155 160 Thr Ala Glu Ile Arg Glu Gln Ala Lys Leu Met Tyr Leu Asp Tyr Pro 165 170 175 Asn Asn Pro Thr Gly Ala Val Ala Thr Ser Glu Phe Phe Glu Asp Thr 180 185 190 Val Arg Phe Ala Ala Glu Asn Gly Ile Cys Val Val His Asp Phe Ala 195 200 205 Tyr Gly Ala Val Gly Phe Asp Gly Cys Lys Pro Leu Ser Phe Leu Gln 210 215 220 Thr Glu Gly Ala Lys Asp Ile Gly Ile Glu Ile Tyr Thr Leu Ser Lys 225 230 235 240 Thr Tyr Asn Met Ala Gly Trp Arg Val Gly Phe Ala Val Gly Asn Ala 245 250 255 Ser Val Ile Glu Ala Ile Asn Leu Tyr Gln Asp His Met Phe Val Ser 260 265 270 Leu Phe Arg Ala Thr Gln Glu Ala Ala Ala Glu Ala Leu Leu Ala Asp 275 280 285 Gln Thr Cys Val Ala Glu Gln Asn Ala Arg Tyr Glu Ser Arg Arg Asn 290 295 300 Ala Trp Ile Thr Ala Cys Arg Glu Ile Gly Trp Asp Val Thr Ala Pro 305 310 315 320 Ala Gly Ser Phe Phe Ala Trp Leu Pro Val Pro Glu Gly Tyr Thr Ser 325 330 335 Glu Gln Phe Ser Asp Leu Leu Leu Glu Lys Ala Asn Val Ala Val Ala 340 345 350 Ala Gly Asn Gly Phe Gly Glu Tyr Gly Glu Gly Gln Val Arg Val Gly 355 360 365 Leu Leu Thr Ser Glu Glu Arg Leu Lys Glu Ala Ala Tyr Arg Ile Gly 370 375 380 Lys Leu Asn Leu Phe Thr Gln Lys Ser Ile Asp Lys Thr Leu 385 390 395 <210> 16 <211> 349 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (L-lactate dehydrogenase [Alcaligenes eutrophus]: YP_725182.1_) <400> 16 Met Lys Ile Ser Leu Thr Ser Ala Arg Gln Leu Ala Arg Asp Ile Leu 1 5 10 15 Ala Ala Gln Gln Val Pro Ala Asp Ile Ala Asp Asp Val Ala Glu His 20 25 30 Leu Val Glu Ser Asp Arg Cys Gly Tyr Ile Ser His Gly Leu Ser Ile 35 40 45 Leu Pro Asn Tyr Arg Thr Ala Leu Asp Gly His Ser Val Asn Pro Gln 50 55 60 Gly Arg Ala Lys Cys Val Leu Asp Gln Gly Thr Leu Met Val Phe Asp 65 70 75 80 Gly Asp Gly Gly Phe Gly Gln His Val Gly Lys Ser Val Met Gln Ala 85 90 95 Ala Ile Glu Arg Val Arg Gln His Gly His Cys Ile Val Thr Leu Arg 100 105 110 Arg Ser His His Leu Gly Arg Met Gly His Tyr Gly Glu Met Ala Ala 115 120 125 Ala Ala Gly Phe Val Leu Leu Ser Phe Thr Asn Val Ile Asn Arg Ala 130 135 140 Pro Val Val Ala Pro Phe Gly Gly Arg Val Ala Arg Leu Thr Thr Asn 145 150 155 160 Pro Leu Cys Phe Ala Gly Pro Met Pro Asn Gly Arg Pro Pro Leu Val 165 170 175 Val Asp Ile Ala Thr Ser Ala Ile Ala Ile Asn Lys Ala Arg Val Leu 180 185 190 Ala Glu Lys Gly Glu Pro Ala Pro Glu Gly Ser Ile Ile Gly Ala Asp 195 200 205 Gly Asn Pro Thr Thr Asp Ala Ser Thr Met Phe Gly Glu His Pro Gly 210 215 220 Ala Leu Leu Pro Phe Gly Gly His Lys Gly Tyr Ala Leu Gly Val Val 225 230 235 240 Ala Glu Leu Leu Ala Gly Val Leu Ser Gly Gly Gly Thr Ile Gln Pro 245 250 255 Asp Asn Pro Arg Gly Gly Val Ala Thr Asn Asn Leu Phe Ala Val Leu 260 265 270 Leu Asn Pro Ala Leu Asp Leu Gly Leu Asp Trp Gln Ser Ala Glu Val 275 280 285 Glu Ala Phe Val Arg Tyr Leu His Asp Thr Pro Pro Ala Pro Gly Val 290 295 300 Asp Arg Val Gln Tyr Pro Gly Glu Tyr Glu Ala Ala Asn Arg Ala Gln 305 310 315 320 Ala Ser Asp Thr Leu Asn Ile Asn Pro Ala Ile Trp Arg Asn Leu Glu 325 330 335 Arg Leu Ala Gln Ser Leu Asn Val Ala Val Pro Thr Ala 340 345 <210> 17 <211> 349 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (L-lactate dehydrogenase: YP_725182.1 (I48T)) <400> 17 Met Lys Ile Ser Leu Thr Ser Ala Arg Gln Leu Ala Arg Asp Ile Leu 1 5 10 15 Ala Ala Gln Gln Val Pro Ala Asp Ile Ala Asp Asp Val Ala Glu His 20 25 30 Leu Val Glu Ser Asp Arg Cys Gly Tyr Ile Ser His Gly Leu Ser Thr 35 40 45 Leu Pro Asn Tyr Arg Thr Ala Leu Asp Gly His Ser Val Asn Pro Gln 50 55 60 Gly Arg Ala Lys Cys Val Leu Asp Gln Gly Thr Leu Met Val Phe Asp 65 70 75 80 Gly Asp Gly Gly Phe Gly Gln His Val Gly Lys Ser Val Met Gln Ala 85 90 95 Ala Ile Glu Arg Val Arg Gln His Gly His Cys Ile Val Thr Leu Arg 100 105 110 Arg Ser His His Leu Gly Arg Met Gly His Tyr Gly Glu Met Ala Ala 115 120 125 Ala Ala Gly Phe Val Leu Leu Ser Phe Thr Asn Val Ile Asn Arg Ala 130 135 140 Pro Val Val Ala Pro Phe Gly Gly Arg Val Ala Arg Leu Thr Thr Asn 145 150 155 160 Pro Leu Cys Phe Ala Gly Pro Met Pro Asn Gly Arg Pro Pro Leu Val 165 170 175 Val Asp Ile Ala Thr Ser Ala Ile Ala Ile Asn Lys Ala Arg Val Leu 180 185 190 Ala Glu Lys Gly Glu Pro Ala Pro Glu Gly Ser Ile Ile Gly Ala Asp 195 200 205 Gly Asn Pro Thr Thr Asp Ala Ser Thr Met Phe Gly Glu His Pro Gly 210 215 220 Ala Leu Leu Pro Phe Gly Gly His Lys Gly Tyr Ala Leu Gly Val Val 225 230 235 240 Ala Glu Leu Leu Ala Gly Val Leu Ser Gly Gly Gly Thr Ile Gln Pro 245 250 255 Asp Asn Pro Arg Gly Gly Val Ala Thr Asn Asn Leu Phe Ala Val Leu 260 265 270 Leu Asn Pro Ala Leu Asp Leu Gly Leu Asp Trp Gln Ser Ala Glu Val 275 280 285 Glu Ala Phe Val Arg Tyr Leu His Asp Thr Pro Pro Ala Pro Gly Val 290 295 300 Asp Arg Val Gln Tyr Pro Gly Glu Tyr Glu Ala Ala Asn Arg Ala Gln 305 310 315 320 Ala Ser Asp Thr Leu Asn Ile Asn Pro Ala Ile Trp Arg Asn Leu Glu 325 330 335 Arg Leu Ala Gln Ser Leu Asn Val Ala Val Pro Thr Ala 340 345 <210> 18 <211> 349 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (L-lactate dehydrogenase: YP_725182.1(I48N)) <400> 18 Met Lys Ile Ser Leu Thr Ser Ala Arg Gln Leu Ala Arg Asp Ile Leu 1 5 10 15 Ala Ala Gln Gln Val Pro Ala Asp Ile Ala Asp Asp Val Ala Glu His 20 25 30 Leu Val Glu Ser Asp Arg Cys Gly Tyr Ile Ser His Gly Leu Ser Asn 35 40 45 Leu Pro Asn Tyr Arg Thr Ala Leu Asp Gly His Ser Val Asn Pro Gln 50 55 60 Gly Arg Ala Lys Cys Val Leu Asp Gln Gly Thr Leu Met Val Phe Asp 65 70 75 80 Gly Asp Gly Gly Phe Gly Gln His Val Gly Lys Ser Val Met Gln Ala 85 90 95 Ala Ile Glu Arg Val Arg Gln His Gly His Cys Ile Val Thr Leu Arg 100 105 110 Arg Ser His His Leu Gly Arg Met Gly His Tyr Gly Glu Met Ala Ala 115 120 125 Ala Ala Gly Phe Val Leu Leu Ser Phe Thr Asn Val Ile Asn Arg Ala 130 135 140 Pro Val Val Ala Pro Phe Gly Gly Arg Val Ala Arg Leu Thr Thr Asn 145 150 155 160 Pro Leu Cys Phe Ala Gly Pro Met Pro Asn Gly Arg Pro Pro Leu Val 165 170 175 Val Asp Ile Ala Thr Ser Ala Ile Ala Ile Asn Lys Ala Arg Val Leu 180 185 190 Ala Glu Lys Gly Glu Pro Ala Pro Glu Gly Ser Ile Ile Gly Ala Asp 195 200 205 Gly Asn Pro Thr Thr Asp Ala Ser Thr Met Phe Gly Glu His Pro Gly 210 215 220 Ala Leu Leu Pro Phe Gly Gly His Lys Gly Tyr Ala Leu Gly Val Val 225 230 235 240 Ala Glu Leu Leu Ala Gly Val Leu Ser Gly Gly Gly Thr Ile Gln Pro 245 250 255 Asp Asn Pro Arg Gly Gly Val Ala Thr Asn Asn Leu Phe Ala Val Leu 260 265 270 Leu Asn Pro Ala Leu Asp Leu Gly Leu Asp Trp Gln Ser Ala Glu Val 275 280 285 Glu Ala Phe Val Arg Tyr Leu His Asp Thr Pro Pro Ala Pro Gly Val 290 295 300 Asp Arg Val Gln Tyr Pro Gly Glu Tyr Glu Ala Ala Asn Arg Ala Gln 305 310 315 320 Ala Ser Asp Thr Leu Asn Ile Asn Pro Ala Ile Trp Arg Asn Leu Glu 325 330 335 Arg Leu Ala Gln Ser Leu Asn Val Ala Val Pro Thr Ala 340 345 <210> 19 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase [Lactobacillus delbrueckii subsp. bulgaricus]: CAI96942.1) <400> 19 Met Thr Lys Ile Phe Ala Tyr Ala Ile Arg Glu Asp Glu Lys Pro Phe 1 5 10 15 Leu Lys Glu Trp Glu Asp Ala His Lys Asp Val Glu Val Glu Tyr Thr 20 25 30 Asp Lys Leu Leu Thr Pro Glu Thr Val Ala Leu Ala Lys Gly Ala Asp 35 40 45 Gly Val Val Val Tyr Gln Gln Leu Asp Tyr Thr Ala Glu Thr Leu Gln 50 55 60 Ala Leu Ala Asp Asn Gly Ile Thr Lys Met Ser Leu Arg Asn Val Gly 65 70 75 80 Val Asp Asn Ile Asp Met Ala Lys Ala Lys Glu Leu Gly Phe Gln Ile 85 90 95 Thr Asn Val Pro Val Tyr Ser Pro Asn Ala Ile Ala Glu His Ala Ala 100 105 110 Ile Gln Ala Ala Arg Ile Leu Arg Gln Asp Lys Ala Met Asp Glu Lys 115 120 125 Val Ala Arg His Asp Leu Arg Trp Ala Pro Thr Ile Gly Arg Glu Val 130 135 140 Arg Asp Gln Val Val Gly Val Ile Gly Thr Gly His Ile Gly Gln Val 145 150 155 160 Phe Met Gln Ile Met Glu Gly Phe Gly Ala Lys Val Ile Ala Tyr Asp 165 170 175 Ile Phe Arg Asn Pro Glu Leu Glu Lys Lys Gly Tyr Tyr Val Asp Ser 180 185 190 Leu Asp Asp Leu Tyr Lys Gln Ala Asp Val Ile Ser Leu His Val Pro 195 200 205 Asp Val Pro Ala Asn Val His Met Ile Asn Asp Glu Ser Ile Ala Lys 210 215 220 Met Lys Gln Asp Val Val Ile Val Asn Val Ser Arg Gly Pro Leu Val 225 230 235 240 Asp Thr Asp Ala Val Ile Arg Gly Leu Asp Ser Gly Lys Ile Phe Gly 245 250 255 Tyr Ala Met Asp Val Tyr Glu Gly Glu Val Gly Ile Phe Asn Glu Asp 260 265 270 Trp Glu Gly Lys Glu Phe Pro Asp Ala Arg Leu Ala Asp Leu Ile Ala 275 280 285 Arg Pro Asn Val Leu Val Thr Pro His Thr Ala Phe Tyr Thr Thr His 290 295 300 Ala Val Arg Asn Met Val Val Lys Ala Phe Asp Asn Asn Leu Glu Leu 305 310 315 320 Val Glu Gly Lys Glu Ala Glu Thr Pro Val Lys Val Gly 325 330 <210> 20 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase: CAI96942.1 (V79T)) <400> 20 Met Thr Lys Ile Phe Ala Tyr Ala Ile Arg Glu Asp Glu Lys Pro Phe 1 5 10 15 Leu Lys Glu Trp Glu Asp Ala His Lys Asp Val Glu Val Glu Tyr Thr 20 25 30 Asp Lys Leu Leu Thr Pro Glu Thr Val Ala Leu Ala Lys Gly Ala Asp 35 40 45 Gly Val Val Val Tyr Gln Gln Leu Asp Tyr Thr Ala Glu Thr Leu Gln 50 55 60 Ala Leu Ala Asp Asn Gly Ile Thr Lys Met Ser Leu Arg Asn Thr Gly 65 70 75 80 Val Asp Asn Ile Asp Met Ala Lys Ala Lys Glu Leu Gly Phe Gln Ile 85 90 95 Thr Asn Val Pro Val Tyr Ser Pro Asn Ala Ile Ala Glu His Ala Ala 100 105 110 Ile Gln Ala Ala Arg Ile Leu Arg Gln Asp Lys Ala Met Asp Glu Lys 115 120 125 Val Ala Arg His Asp Leu Arg Trp Ala Pro Thr Ile Gly Arg Glu Val 130 135 140 Arg Asp Gln Val Val Gly Val Ile Gly Thr Gly His Ile Gly Gln Val 145 150 155 160 Phe Met Gln Ile Met Glu Gly Phe Gly Ala Lys Val Ile Ala Tyr Asp 165 170 175 Ile Phe Arg Asn Pro Glu Leu Glu Lys Lys Gly Tyr Tyr Val Asp Ser 180 185 190 Leu Asp Asp Leu Tyr Lys Gln Ala Asp Val Ile Ser Leu His Val Pro 195 200 205 Asp Val Pro Ala Asn Val His Met Ile Asn Asp Glu Ser Ile Ala Lys 210 215 220 Met Lys Gln Asp Val Val Ile Val Asn Val Ser Arg Gly Pro Leu Val 225 230 235 240 Asp Thr Asp Ala Val Ile Arg Gly Leu Asp Ser Gly Lys Ile Phe Gly 245 250 255 Tyr Ala Met Asp Val Tyr Glu Gly Glu Val Gly Ile Phe Asn Glu Asp 260 265 270 Trp Glu Gly Lys Glu Phe Pro Asp Ala Arg Leu Ala Asp Leu Ile Ala 275 280 285 Arg Pro Asn Val Leu Val Thr Pro His Thr Ala Phe Tyr Thr Thr His 290 295 300 Ala Val Arg Asn Met Val Val Lys Ala Phe Asp Asn Asn Leu Glu Leu 305 310 315 320 Val Glu Gly Lys Glu Ala Glu Thr Pro Val Lys Val Gly 325 330 <210> 21 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase: CAI96942.1 (V79N)) <400> 21 Met Thr Lys Ile Phe Ala Tyr Ala Ile Arg Glu Asp Glu Lys Pro Phe 1 5 10 15 Leu Lys Glu Trp Glu Asp Ala His Lys Asp Val Glu Val Glu Tyr Thr 20 25 30 Asp Lys Leu Leu Thr Pro Glu Thr Val Ala Leu Ala Lys Gly Ala Asp 35 40 45 Gly Val Val Val Tyr Gln Gln Leu Asp Tyr Thr Ala Glu Thr Leu Gln 50 55 60 Ala Leu Ala Asp Asn Gly Ile Thr Lys Met Ser Leu Arg Asn Asn Gly 65 70 75 80 Val Asp Asn Ile Asp Met Ala Lys Ala Lys Glu Leu Gly Phe Gln Ile 85 90 95 Thr Asn Val Pro Val Tyr Ser Pro Asn Ala Ile Ala Glu His Ala Ala 100 105 110 Ile Gln Ala Ala Arg Ile Leu Arg Gln Asp Lys Ala Met Asp Glu Lys 115 120 125 Val Ala Arg His Asp Leu Arg Trp Ala Pro Thr Ile Gly Arg Glu Val 130 135 140 Arg Asp Gln Val Val Gly Val Ile Gly Thr Gly His Ile Gly Gln Val 145 150 155 160 Phe Met Gln Ile Met Glu Gly Phe Gly Ala Lys Val Ile Ala Tyr Asp 165 170 175 Ile Phe Arg Asn Pro Glu Leu Glu Lys Lys Gly Tyr Tyr Val Asp Ser 180 185 190 Leu Asp Asp Leu Tyr Lys Gln Ala Asp Val Ile Ser Leu His Val Pro 195 200 205 Asp Val Pro Ala Asn Val His Met Ile Asn Asp Glu Ser Ile Ala Lys 210 215 220 Met Lys Gln Asp Val Val Ile Val Asn Val Ser Arg Gly Pro Leu Val 225 230 235 240 Asp Thr Asp Ala Val Ile Arg Gly Leu Asp Ser Gly Lys Ile Phe Gly 245 250 255 Tyr Ala Met Asp Val Tyr Glu Gly Glu Val Gly Ile Phe Asn Glu Asp 260 265 270 Trp Glu Gly Lys Glu Phe Pro Asp Ala Arg Leu Ala Asp Leu Ile Ala 275 280 285 Arg Pro Asn Val Leu Val Thr Pro His Thr Ala Phe Tyr Thr Thr His 290 295 300 Ala Val Arg Asn Met Val Val Lys Ala Phe Asp Asn Asn Leu Glu Leu 305 310 315 320 Val Glu Gly Lys Glu Ala Glu Thr Pro Val Lys Val Gly 325 330 <210> 22 <211> 355 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (Paraoxonase PON1 variant: AAR95986.1_G3C9) <400> 22 Met Ala Lys Leu Thr Ala Leu Thr Leu Leu Gly Leu Gly Leu Ala Leu 1 5 10 15 Phe Asp Gly Gln Lys Ser Ser Phe Gln Thr Arg Phe Asn Val His Arg 20 25 30 Glu Val Thr Pro Val Glu Leu Pro Asn Cys Asn Leu Val Lys Gly Val 35 40 45 Asp Asn Gly Ser Glu Asp Leu Glu Ile Leu Pro Asn Gly Leu Ala Phe 50 55 60 Ile Ser Ser Gly Leu Lys Tyr Pro Gly Ile Met Ser Phe Asp Pro Asp 65 70 75 80 Lys Ser Gly Lys Ile Leu Leu Met Asp Leu Asn Glu Glu Asp Pro Val 85 90 95 Val Leu Glu Leu Gly Ile Thr Gly Asn Thr Leu Asp Ile Ser Ser Phe 100 105 110 Asn Pro His Gly Ile Ser Thr Phe Thr Asp Glu Asp Asn Thr Val Tyr 115 120 125 Leu Leu Val Val Asn His Pro Asp Ser Ser Ser Thr Val Glu Val Phe 130 135 140 Lys Phe Gln Glu Glu Glu Lys Ser Leu Leu His Leu Lys Thr Ile Arg 145 150 155 160 His Lys Leu Leu Pro Ser Val Asn Asp Ile Val Ala Val Gly Pro Glu 165 170 175 His Phe Tyr Ala Thr Asn Asp His Tyr Phe Ala Asp Pro Tyr Leu Lys 180 185 190 Ser Trp Glu Met His Leu Gly Leu Ala Trp Ser Phe Val Thr Tyr Tyr 195 200 205 Ser Pro Asn Asp Val Arg Val Val Ala Glu Gly Phe Asp Phe Ala Asn 210 215 220 Gly Ile Asn Ile Ser Pro Asp Gly Lys Tyr Val Tyr Ile Ala Glu Leu 225 230 235 240 Leu Ala His Lys Ile His Val Tyr Glu Lys His Ala Asn Trp Thr Leu 245 250 255 Thr Pro Leu Lys Ser Leu Asp Phe Asp Thr Leu Val Asp Asn Ile Ser 260 265 270 Val Asp Pro Val Thr Gly Asp Leu Trp Val Gly Cys His Pro Asn Gly 275 280 285 Met Arg Ile Phe Tyr Tyr Asp Pro Lys Asn Pro Pro Gly Ser Glu Val 290 295 300 Leu Arg Ile Gln Asp Ile Leu Ser Glu Glu Pro Lys Val Thr Val Val 305 310 315 320 Tyr Ala Glu Asn Gly Thr Val Leu Gln Gly Ser Thr Val Ala Ala Val 325 330 335 Tyr Lys Gly Lys Leu Leu Ile Gly Thr Val Phe His Lys Ala Leu Tyr 340 345 350 Cys Glu Leu 355 <210> 23 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (synthetic promoter 8) <400> 23 tttcaattta atcatccggc tcgtataatg tgtgga 36 <210> 24 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pts_RP primer) <400> 24 cggaaccgcc tgcttctgcc ataacatgcg atacaacggc ggttacagca gaatacctgc 60 gataggcagt acggataccg gcagcatc 88 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pts_seq_FP primer) <400> 25 ggcgtcggtt ccgcgaattt c 21 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pts_seq_RP primer) <400> 26 ggtgcagacc aaacggtacc 20 <210> 27 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta eda_FP primer) <400> 27 caactgcaca ctcggtacgc agagtcactt ccagaacgcg cattacaccg cgtgttccag 60 tttttttacc acgataaccg gtacaacc 88 <210> 28 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta eda_RP primer) <400> 28 ggttgtaccg gttatcgtgg taaaaaaact ggaacacgcg gtgtaatgcg cgttctggaa 60 gtgactctgc gtaccgagtg tgcagttg 88 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta eda_seq_FP primer) <400> 29 ccgatggcaa aagcgttgg 19 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta eda_seq_RP primer) <400> 30 cgcgccagct tagtaatgc 19 <210> 31 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta poxB_RP primer) <400> 31 ggcaggggtg aaacgcatct ggggagtcac aggcgactct ctgaactaac catcgagtgg 60 atgtccaccc gccacgaaga agtggcggcc 90 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta poxB_seq_FP primer) <400> 32 tggaataacg cagcagttg 19 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta poxB_seq_RPprimer) <400> 33 ggtcttagtg acagtcttaa tc 22 <210> 34 <211> 87 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pta_FP primer) <400> 34 gaccagcgtc agccttggcg tgatccgtgc aatggaacgc aaataactca gccgcgtacc 60 ggtggcgatg cgcccgatca gactacg 87 <210> 35 <211> 87 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pta_RP primer) <400> 35 cgtagtctga tcgggcgcat cgccaccggt acgcggctga gttatttgcg ttccattgca 60 cggatcacgc caaggctgac gctggtc 87 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pta_seq_FP) <400> 36 ggcgttcgtc tgagcgtttt c 21 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pta_seq_RP) <400> 37 ggattcttgc agcttcgcc 19 <210> 38 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ackA_FP) <400> 38 gaaatttgcc atcatcgatg cagtaaatgg tgaagagtac ctttgaaagc acgtatcaaa 60 tggaaaatgg acggcaataa acaggaagc 89 <210> 39 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ackA_RP) <400> 39 gcttcctgtt tattgccgtc cattttccat ttgatacgtg ctttcaaagg tactcttcac 60 catttactgc atcgatgatg gcaaatttc 89 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ackA_seq_FP) <400> 40 tctggtttag ccgaatgttt cc 22 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ackA_seq_RP) <400> 41 atgttcagtt cttctaccgg 20 <210> 42 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ldhA_RP) <400> 42 gcaacaggtg aacgagtcct ttggctttga gctggaattt ttttaactgc caatggctgc 60 gaagcggtat gtattttcgt aaacgatg 88 <210> 43 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ldhA_seq_FP) <400> 43 ttttccggtg tcagcggg 18 <210> 44 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta ldhA_seq_RP) <400> 44 gactttctgc tgacgg 16 <210> 45 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta adhE_RP) <400> 45 gtaaaaaaag cccagcgtga atatgccagt ttcactcaag agcaataact gctgcagatg 60 ctcgaatccc actcgcgaaa atggccgttg 90 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta adhE_seq_FP) <400> 46 ggagctgtat gcggctttaa c 21 <210> 47 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta adhE_seq_RP) <400> 47 gtagacaaaa tcttccgcgc cg 22 <210> 48 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pflB_RP) <400> 48 ccaaaggtga ctggcagaat gaagtaaacg tccgtgactt catttaaagt ccttcctggc 60 tggcgctact gaagcgacca ccaccctg 88 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pflB_seq_FP) <400> 49 tgcagagaag tgaactgtgc c 21 <210> 50 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta pflB_seq_RP) <400> 50 cagaaaaact acactccgta cg 22 <210> 51 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta iclR_FP) <400> 51 cccggcttgt tgcgccagtt ccgtgagtgc cacactgcca ttcagccacg cgttaaagac 60 tgaacctgtc cagtcgctgg tgcggtggc 89 <210> 52 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta iclR_RP) <400> 52 gccaccgcac cagcgactgg acaggttcag tctttaacgc gtggctgaat ggcagtgtgg 60 cactcacgga actggcgcaa caagccggg 89 <210> 53 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta iclR_seq_FP) <400> 53 gcgcgtttgg gcgagatc 18 <210> 54 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta iclR_seq_RP) <400> 54 ctgaaattac tggagtgg 18 <210> 55 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lysA_FP) <400> 55 ggctttctgt gcaaagcgca ccacatcaaa ctgtttcagc gctgttagac ccacaccggg 60 cagccaaatt cagcgggcaa acgcagcag 89 <210> 56 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lysA_RP) <400> 56 ctgctgcgtt tgcccgctga atttggctgc ccggtgtggg tctaacagcg ctgaaacagt 60 ttgatgtggt gcgctttgca cagaaagcc 89 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lysA_seq_FP) <400> 57 cctgttccag atgggcataa tc 22 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lysA_seq_RP) <400> 58 gggtctacga tgcgcaaatt attcg 25 <210> 59 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta thrB_RP) <400> 59 cttatcggca aagcgtccga ggttgttgag actgaatgtc tctgttatgc accatcaaca 60 ggtgtcaccg ccgccccgag cacatcaaac 90 <210> 60 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta thrB_seq_FP) <400> 60 ttgctcggag atgtagtcac gg 22 <210> 61 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta thrB_seq_RP) <400> 61 gcgatactgc gccggtaaaa tag 23 <210> 62 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta metA_FP) <400> 62 gaagaaaacg tctttgtgat gacaacttct cgtgcgtctg gttaattaac ctgatgccga 60 agaagattga aactgaaaat cagtttctg 89 <210> 63 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta metA_RP) <400> 63 cagaaactga ttttcagttt caatcttctt cggcatcagg ttaattaacc agacgcacga 60 gaagttgtca tcacaaagac gttttcttc 89 <210> 64 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta metA_seq_FP) <400> 64 ctggtcagga aattcgtcca c 21 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta metA_seq_RP) <400> 65 cgaatcaacg ctgccggaaa g 21 <210> 66 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lacI_RP) <400> 66 cttatcagac cgtttcccgc gtggtgaacc aggccagcca cgtttgacga tggcggagct 60 gaattacatt cccaaccgcg tggcacaac 89 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lacI_seq_FP) <400> 67 gatatttatg ccagccagcc 20 <210> 68 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (delta lacI_seq_RP) <400> 68 ccacgtttct gcgaaaacgc ggg 23 <210> 69 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Ptrc-acs-FP) <400> 69 gtttaatcgg tacccgggga tcgcggccgc cgcgcccttc ctgccagtca attttc 56 <210> 70 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Ptrc-acs-RP) <400> 70 cttttaagaa ggagatatac atatgagcca aattcacaaa cacacc 46 <210> 71 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Ptrc-acs-FP) <400> 71 ggtgtgtttg tgaatttggc tcatatgtat atctccttct taaaag 46 <210> 72 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Ptrc-acs-RP) <400> 72 cggcgtgcgt ttatttttat ccttgtcatc gactgcacgg tgcaccaatg c 51 <210> 73 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-Ptrc-acs-FP) <400> 73 gcattggtgc accgtgcagt cgatgacaag gataaaaata aacgcacgcc g 51 <210> 74 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-Ptrc-acs-RP) <400> 74 gggcgcgcgc cattctccgg tcgactctag atcatgccgt catcccac 48 <210> 75 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-ldhA-FP) <400> 75 atcgcggccg ctgtctgttt tgcggtc 27 <210> 76 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-ldhA-RP) <400> 76 ctggagaaag tcttatgtaa tcttgccgct cccc 34 <210> 77 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-ldhA-FP) <400> 77 ggggagcggc aagattacat aagactttct ccag 34 <210> 78 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-ldhA-RP) <400> 78 ctagaggatc ccaagcagaa tcaagttcta ccg 33 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Gn-ldhA-FP) <400> 79 gatggtacgg cgattgggat g 21 <210> 80 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Gn-ldhA-RP) <400> 80 gccagggaga aaaaatcag 19 <210> 81 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-iclR-FP) <400> 81 ctgcgcggac gctgaggatc ccggtgatcc cgtcctctca cg 42 <210> 82 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-iclR-RP) <400> 82 ttcgaacccc agagtcccgc ctgccgctcg taggtcctg 39 <210> 83 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-iclR-FP) <400> 83 gcaggaccta cgagcggcag gcgggactct ggggttcgaa atg 43 <210> 84 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-iclR-RP) <400> 84 tgcctgcagg tcgactctag attatttgtt aactgttaat tgtccttgtt c 51 <210> 85 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Gn-iclR-FP) <400> 85 ctgaacagca ggtcgtcc 18 <210> 86 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Gn-iclR-RP) <400> 86 gcgtcgaaac cttcgatg 18 <210> 87 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP1 promoter) <400> 87 aaaaagagta ttgacttcgc atctttttgt acctataatg tgtgga 46 <210> 88 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP2 promoter) <400> 88 aaaaaattta tttgcttatt aattcatccg gctcgtatat gtgtgga 47 <210> 89 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP3 promoter) <400> 89 ttgacatcag gaaaattttt ctgtataatg tgtgga 36 <210> 90 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP4 promoter) <400> 90 ttgacaatta atcatccggc tcgtaattta tgtgga 36 <210> 91 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP5 promoter) <400> 91 aaaaaattta tttgctttcg catctttttg tacctataag tgtgga 46 <210> 92 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP6 promoter) <400> 92 aaaaaattta tttgctttcg catctttttg tacctgtaat gtgtgga 47 <210> 93 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP7 promoter) <400> 93 ttcactttta atcatccggc tcgtataatg tgtgga 36 <210> 94 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP8 promoter) <400> 94 tttcaattta atcatccggc tcgtataatg tgtgga 36 <210> 95 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (SP9 promoter) <400> 95 ttccctatta atcatccggc tcgtataatg tgtgga 36 <210> 96 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT_Aspatate transaminase_M.loti_ANN59010.1_F primer) <400> 96 gaccatggaa ttcatggaag agtttcacaa ggtc 34 <210> 97 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT_Aspatate transaminase_M.loti_ANN59010.1_R primer) <400> 97 acagccaagc ttttaccggt gggcggacag c 31 <210> 98 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase M. loti ANN57047.1_F primer) <400> 98 gaccatggaa ttcatgctcc acacgatttc g 31 <210> 99 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase M. loti ANN57047.1_R primer) <400> 99 agtttggatc ctcacttggc gaggaacg 28 <210> 100 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase A. tumefaciens ACM26415.1_F primer) <400> 100 gaccatggaa ttcatggaag agtttcataa ag 32 <210> 101 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase A. tumefaciens ACM26415.1_R primer) <400> 101 agtttggatc cttaagaacg atgagcg 27 <210> 102 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase B. subtilis AQR85543.1_F primer) <400> 102 ttcagaattc aaaagatctt ttaagaagga gatatacata tgcagagcaa aggcg 55 <210> 103 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase B. subtilis AQR85543.1_R primer) <400> 103 agtttggatc cttaatggtg atggtgatgg tg 32 <210> 104 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase E. coli AVI55449.1_F primer) <400> 104 gaccatggaa ttcatgactg aaccccgttc ag 32 <210> 105 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT Aspatate transaminase E. coli AVI55449.1_R primer) <400> 105 acagccaagc ttttagtccg ccttcgccgg c 31 <210> 106 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (bcAT branched chain transaminase D. mccartyi AQY72500.1_F primer) <400> 106 gaaggagata tacatatggc tagcatgac 29 <210> 107 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (bcAT branched chain transaminase D. mccartyi AQY72500.1_R primer) <400> 107 ctttgttagc agccggatct cagtggtggt ggtgg 35 <210> 108 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (bcAT branched chain transaminase E. coli AVI53929.1_F primer) <400> 108 aagaaggaga tatacatatg gctagcatga ctgg 34 <210> 109 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (bcAT branched chain transaminase E. coli AVI53929.1_R primer) <400> 109 ccggatctca gtggtggtgg tggtggtgct cg 32 <210> 110 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (bcAT branched chain transaminase E. spp AOL13801.1_F primer) <400> 110 taagaaggag atatacatat ggctagcatg actgg 35 <210> 111 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (bcAT branched chain transaminase E. spp AOL13801.1_R primer) <400> 111 gtgctcgagt tgattaactt gatctaacca gccgtat 37 <210> 112 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase E. coli AUV21492.1_F primer) <400> 112 taagaaggag atatacatat gtttcaaaaa gttg 34 <210> 113 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase E. coli AUV21492.1_R primer) <400> 113 gtgctcgagt tgattaagca gataatcg 28 <210> 114 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase E. coli AVI54196.1_F primer) <400> 114 gaccatggaa ttcatggctg acactcgccc tg 32 <210> 115 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase E. coli AVI54196.1_R primer) <400> 115 aacagccaag cttttattcc gcgttttcgt g 31 <210> 116 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaAT alanine transaminase P. denitrificans AGI22743.1_F primer) <400> 116 cagaattcaa aagatctttt aagaaggaga tatacatatg actgaacccc g 51 <210> 117 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaAT alanine transaminase P. denitrificans AGI22743.1_R primer) <400> 117 agatccttac tcgagtttgg atccttagtc cgccttcgcc 40 <210> 118 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaAT alanine transaminase P. putida AE015451.2_F primer) <400> 118 cagaattcaa aagatctttt aagaaggaga tatacatatg gccaacccag gttcg 55 <210> 119 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaAT alanine transaminase P. putida AE015451.2_R primer) <400> 119 ctcgagtttg gatccttact tacgagtcag gcc 33 <210> 120 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaC alanine transaminase E. coli AAN66442.1_F primer) <400> 120 ttcagaattc aaaagatctt ttaagaagga gatatacata tggctgacac tcgc 54 <210> 121 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaC alanine transaminase E. coli AAN66442.1_R primer) <400> 121 cgagtttgga tccttattcc gcgttttcgt g 31 <210> 122 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaC alanine transaminase E. coli AAN66442.1 A140P-Y275D_F primer) <400> 122 ttcagaattc aaaagatctt ttaagaagga gatatacata tggctgacac tcgc 54 <210> 123 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (alaC alanine transaminase E. coli AAN66442.1 A140P-Y275D_R primer) <400> 123 cgagtttgga tccttattcc gcgttttcgt g 31 <210> 124 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT aspatate transaminase P. denitrificans AGI22891.1_F primer) <400> 124 ttcagaattc aaaagatctt ttaagaagga gatatacata tgctcggacc cggcg 55 <210> 125 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aspAT aspatate transaminase P. denitrificans AGI22891.1_R primer) <400> 125 tcgagtttgg atcctcagcg attctggtgc gcg 33 <210> 126 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase P. denitrificans AGI22971.1_F primer) <400> 126 gtggtggtgg tggtggtgct cgagcagttt caggcgcagc gc 42 <210> 127 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase P. denitrificans AGI22971.1_R primer) <400> 127 aactttaaga aggagatata catatgatga gcaagttctg gagtccc 47 <210> 128 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase P. fluorescens AUM68313.1_F primer) <400> 128 gtggtggtgg tggtggtgct cgaggagttc gccgagggc 39 <210> 129 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (aroAT acromatic transaminase P. fluorescens AUM68313.1_R primer) <400> 129 actttaagaa ggagatatac atatgatgag taaattctgg agcccg 46 <210> 130 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA Library F) <400> 130 ctcactatag gggaattgtg agcggataac 30 <210> 131 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA Library R) <400> 131 gctagttatt gctcagcggt ggcagc 26 <210> 132 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA K14 F) <400> 132 gaaggaattg cctnnkcaat tcttcgcttc 30 <210> 133 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA K14 R) <400> 133 gaagcgaaga attgmnnagg caattccttc 30 <210> 134 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA G40 F) <400> 134 caatctggga cagnnkaatc cagatcagc 29 <210> 135 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA G40 R) <400> 135 gctgatctgg attmnnctgt cccagattg 29 <210> 136 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA N178 F) <400> 136 gaattatccg aatnnkccga ctggagctg 29 <210> 137 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA N178 R) <400> 137 cagctccagt cggmnnattc ggataattc 29 <210> 138 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA Y364 F) <400> 138 gaatatggcg agggcnnkgt cagagtcg 28 <210> 139 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (TA Y364 R) <400> 139 cgactctgac mnngccctcg ccatattc 28 <210> 140 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (lactate dehdydrogenases(ldhO) Alcaligenes eutrophus(Ae) YP725182.1_F primer) <400> 140 ataacatatg aagatctccc tcaccagcgc 30 <210> 141 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (lactate dehdydrogenases(ldhO) Alcaligenes eutrophus(Ae) YP725182.1_R primer) <400> 141 taataggatc ctcagtgatg gtgatggtga tgggccgtgg ggacggccac gttg 54 <210> 142 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Cupriavidus basilensis(Cb) WP 043344208.1_F primer) <400> 142 ataacatatg aagataacac tgcaatc 27 <210> 143 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Cupriavidus basilensis(Cb) WP 043344208.1_R primer) <400> 143 taataggatc ctcagtggtg atgatggtga tggcccgccg gcagtgccac gccaagttc 59 <210> 144 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Achromobacter xylosoxidans(Ax) WP 006389860.1_F primer) <400> 144 ataacatatg aagatctcca ttacccaag 29 <210> 145 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Achromobacter xylosoxidans(Ax) WP 006389860.1_R primer) <400> 145 taataggatc ctcagtggtg atgatggtga tgaggcaacg cgtcagc 47 <210> 146 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Burkholderia glumae(Bg) YP 002909484.1_F primer) <400> 146 ataacatatg cagatatccc tcgacgatg 29 <210> 147 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Burkholderia glumae(Bg) YP 002909484.1_R primer) <400> 147 taataggatc cctagtggtg atgatggtga tgggcccgtg cggccggcgg caccacgccg 60 agttcgtc 68 <210> 148 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Escherichia fergusonii(Ef) WP 002431747.1_F primer) <400> 148 ataacatatg tatgggtaca gataccttc 29 <210> 149 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (malate/L-lactate dehydrogenase (ldh-2) Escherichia fergusonii(Ef) WP 002431747.1_R primer) <400> 149 taataggatc cttagtggtg atgatggtga tgatgctgat tcctgaggat gtaac 55 <210> 150 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-2-hydroxyacid dehydrogenase (ldh-2) Escherichia coli(Ec) WP024240865.1_F primer) <400> 150 ataacatatg atgtcattac aaattgctg 29 <210> 151 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-2-hydroxyacid dehydrogenase (ldh-2) Escherichia coli(Ec) WP024240865.1_R primer) <400> 151 taataggatc ctcagtggtg atgatggtga tgtccagcta atgctgattc ctg 53 <210> 152 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-2-hydroxyacid dehydrogenase (ldhA) Lactobacillus mali(Lm) WP 003689565.1_F primer) <400> 152 ataacatatg acaagaataa ttgcttatca tg 32 <210> 153 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-2-hydroxyacid dehydrogenase (ldhA) Lactobacillus mali(Lm) WP 003689565.1_R primer) <400> 153 taataggatc cttagtggtg atgatggtga tgttctccct tgaaacttat ttcatgtg 58 <210> 154 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase(ldhA) Escherichia coli K-12(Eck) NP 415898.1_F primer) <400> 154 ataacatatg aaactcgccg tttatag 27 <210> 155 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenase(ldhA) Escherichia coli K-12(Eck) NP 415898.1_R primer) <400> 155 taataggatc cttagtggtg atgatggtga tgaaccagtt cgttcgggca g 51 <210> 156 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH1_FP) <400> 156 ctatatcagc cacggcctgt cgagtctgcc caactaccgc accgccctcg 50 <210> 157 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH1_RP) <400> 157 cgagggcggt gcggtagttg ggcagactcg acaggccgtg gctgatatag 50 <210> 158 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH2_FP) <400> 158 ctatatcagc cacggcctgt cgactctgcc caactaccgc accgccctcg 50 <210> 159 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH2_RP) <400> 159 cgagggcggt gcggtagttg ggcagagtcg acaggccgtg gctgatatag 50 <210> 160 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH3_FP) <400> 160 ctatatcagc cacggcctgt cgaatctgcc caactaccgc accgccctcg 50 <210> 161 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH3_RP) <400> 161 cgagggcggt gcggtagttg ggcagattcg acaggccgtg gctgatatag 50 <210> 162 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH4_FP) <400> 162 ctatatcagc cacggcctgt cggacctgcc caactaccgc accgccctcg 50 <210> 163 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH4_RP) <400> 163 cgagggcggt gcggtagttg ggcaggtccg acaggccgtg gctgatatag 50 <210> 164 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH5_FP) <400> 164 ctatatcagc cacggcctgt cgaatctgcc caactaccgc accgccctcg 50 <210> 165 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH5_RP) <400> 165 cgagggcggt gcggtagttg ggcagattcg acaggccgtg gctgatatag 50 <210> 166 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldh) Escherichia coli K-12 NP 415898.1_F primer) <400> 166 ataacatatg aaactcgccg tttatag 27 <210> 167 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldh) Escherichia coli K-12 NP 415898.1_R primer) <400> 167 taataggatc cttagtggtg atgatggtga tgaaccagtt cgttcgggca g 51 <210> 168 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases Lactobacillus helveticus WP 003628108.1 1_F primer) <400> 168 ataacatatg acaaaggttt ttgc 24 <210> 169 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases Lactobacillus helveticus WP 003628108.1 1_R primer) <400> 169 taataggatc ctcagtggtg atgatggtga tgaaacttgt tcttgttcaa agcaac 56 <210> 170 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate/D-glycerate dehydrogenase (ldhD) Pediococcus acidilactici X70925.1_F primer) <400> 170 ataacatatg aagattattg cttatgg 27 <210> 171 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate/D-glycerate dehydrogenase (ldhD) Pediococcus acidilactici X70925.1_R primer) <400> 171 taataggatc ctcagtggtg atgatggtga tgctcaaact taacttcatt ctttg 55 <210> 172 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Pseudomonas aeruginosa NP_249618.1_F primer) <400> 172 ataacatatg cgcatcctgt tcttcag 27 <210> 173 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Pseudomonas aeruginosa NP_249618.1_R primer) <400> 173 taataggatc cctagtggtg atgatggtga tgggcccgga cccgattgcg 50 <210> 174 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Clostridium perfringens 13 NP_561446.1_F primer) <400> 174 ataacatatg atgataaaat tagtatgtta t 31 <210> 175 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Clostridium perfringens 13 NP_561446.1_R primer) <400> 175 taataggatc cttagtggtg atgatggtga tgatgatgct attgcatttt tacaagtatt 60 tc 62 <210> 176 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Lactobacillus reuteri ZP_03974385.1_F primer) <400> 176 ataacatatg aaaggaatgg gaaaac 26 <210> 177 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Lactobacillus reuteri ZP_03974385.1_R primer) <400> 177 taataggatc ctcagtggtg atgatggtga tgcattctta tttcatttcg tg 52 <210> 178 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Leuconostoc mesenteroides cremoris ZP_03913173.1_F primer) <400> 178 ataacatatg aagatttttg cttacg 26 <210> 179 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Leuconostoc mesenteroides cremoris ZP_03913173.1_R primer) <400> 179 taataggatc cttagtggtg atgatggtga tgatattcaa cagcaatagc tgg 53 <210> 180 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Oenococcus oeni ZP_01544962.1_F primer) <400> 180 ataacatatg aaaatttatg cttatg 26 <210> 181 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Oenococcus oeni ZP_01544962.1_R primer) <400> 181 taataggatc cttagtggtg atgatggtga tggaatttaa cgagattctt gtctc 55 <210> 182 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Lactobacillus delbrueckii subsp. bulgaricus CAI96942.1_F primer) <400> 182 ataacatatg actaaaattt ttgcttac 28 <210> 183 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (D-lactate dehydrogenases (ldhD) Lactobacillus delbrueckii subsp. bulgaricus CAI96942.1_R primer) <400> 183 taataggatc cttagtggtg atgatggtga tggaaactcc agttaaggtt ggc 53 <210> 184 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH6_FP) <400> 184 catcactaag atgagcctgc gtaactccgg tgttgacaac atcgacatgg cta 53 <210> 185 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH6_RP) <400> 185 tagccatgtc gatgttgtca acaccggagt tacgcaggct catcttagtg atg 53 <210> 186 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH7_FP) <400> 186 catcactaag atgagcctgc gtaacaacgg tgttgacaac atcgacatgg cta 53 <210> 187 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH7_RP) <400> 187 tagccatgtc gatgttgtca acaccgttgt tacgcaggct catcttagtg atg 53 <210> 188 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH8_FP) <400> 188 catcactaag atgagcctgc gtaacaccgg tgttgacaac atcgacatgg cta 53 <210> 189 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH8_RP) <400> 189 tagccatgtc gatgttgtca acaccggtgt tacgcaggct catcttagtg atg 53 <210> 190 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH9_FP) <400> 190 catcactaag atgagcctgc gtaacgacgg tgttgacaac atcgacatgg cta 53 <210> 191 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH9_RP) <400> 191 tagccatgtc gatgttgtca acaccgtcgt tacgcaggct catcttagtg atg 53 <210> 192 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH10_FP) <400> 192 catcactaag atgagcctgc gtaacaaggg tgttgacaac atcgacatgg cta 53 <210> 193 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (LDH10_RP) <400> 193 tagccatgtc gatgttgtca acacccttgt tacgcaggct catcttagtg atg 53 <210> 194 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp5-epd-FP) <400> 194 atctaagcgg ccgcggaatt atgcaattcg tggtac 36 <210> 195 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp5-epd-RP) <400> 195 aaaaaattta tttgctttcg catctttttg tacctataag tgtggaatga ccgtacgcgt 60 agcgataaat g 71 <210> 196 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5-epd-FP) <400> 196 gccagtttag tatcgacc 18 <210> 197 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5-epd-RP) <400> 197 acaaaagcat gatcctgttg aagatgcg 28 <210> 198 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- Psp5-epd-FP) <400> 198 catttatcgc tacgcgtacg gtcattccac acttataggt acaaaaagat gcgaaagcaa 60 ataaattttt ttc 73 <210> 199 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- Psp5-epd-RP) <400> 199 tagtaatcta gaggagttgg catctttctg cgatttc 37 <210> 200 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp5-dxs-FP) <400> 200 atctaagcgg ccgctcgaca tttcattgtc gttgag 36 <210> 201 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp5-dxs-RP) <400> 201 caaaaaattt atttgctttc gcatcttttt gtacctataa gtgtggaatg agttttgata 60 ttgccaaata c 71 <210> 202 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5-dsx-FP) <400> 202 gtaaagctta ccggaaagca gctgt 25 <210> 203 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5-dsx-RP) <400> 203 agcaactcga agcctgcgtt aag 23 <210> 204 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- Psp5-dxs-FP) <400> 204 tccacactta taggtacaaa aagatgcgaa agcaaataaa ttttttcggc accctggcgt 60 tttcccaacg ttgcag 76 <210> 205 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- Psp5-dsx-RP) <400> 205 tagtaatcta gaggtcatat gttcggcgtt agcacaaac 39 <210> 206 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp5-pdxj-FP) <400> 206 atctaagcgg ccgcggcttg cggcaaaggt cg 32 <210> 207 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp5-pdxj-RP) <400> 207 aaaaaattta tttgctttcg catctttttg tacctataag tgtggaatgg ctgaattact 60 gttaggcgtc 70 <210> 208 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5- pdxj-FP) <400> 208 ctttcacgtt gtgataggtc ag 22 <210> 209 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5- pdxj-RP) <400> 209 aaaaaattta tttgctttcg catctttttg tacctataag tgtggaatgg ctgaattact 60 gttaggcgtc 70 <210> 210 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-Psp5-pdxj-FP) <400> 210 gacgcctaac agtaattcag ccattccaca cttataggta caaaaagatg cgaaagc 57 <210> 211 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-Psp5-pdxj-RP) <400> 211 cgatctttaa gagtaactcc gatg 24 <210> 212 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp4-lldp-FP) <400> 212 atctaagcgg ccgcgattgg aatgcccatc gcac 34 <210> 213 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp4-lldp-RP) <400> 213 ttgacaatta atcatccggc tcgtaattta tgtggaatga atctctggca acaaaactac 60 g 61 <210> 214 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5-lldp-FP) <400> 214 ccatctgacc aatctcaaag ctgt 24 <210> 215 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp5-lldp-RP) <400> 215 ttgtgaacaa agcacctggt cgcg 24 <210> 216 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- Psp4-lldp-FP) <400> 216 tccacataaa ttacgagccg gatgattaat tgtcaattgg tagggccaat tcttgtg 57 <210> 217 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- Psp4-lldp-RP) <400> 217 tagtaatcta gagaaagaag tcgaaaaaaa cgaaatc 37 <210> 218 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-Psp4-ducA-FP) <400> 218 atctaagcgg ccgcgttgat gattgcatag ataacc 36 <210> 219 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US- Psp4-ducA -RP) <400> 219 ttgacaatta atcatccggc tcgtaattta tgtggaatgc aggttgctgg cggtctggac 60 tatctggttc 70 <210> 220 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp4-ducA-FP) <400> 220 ccatctgacc aatctcaaag ctgt 24 <210> 221 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psp4-ducA-RP) <400> 221 ttgtgaacaa agcacctggt cgcg 24 <210> 222 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-Psp4-ducA -FP) <400> 222 tccacataaa ttacgagccg gatgattaat tgtcaatgtt ttttaacaag ttgatattag 60 attg 64 <210> 223 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-Psp4-ducA -RP) <400> 223 tagtaatcta gagaaagaag tcgaaaaaaa cgaaatc 37 <210> 224 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-dsdx-FP) <400> 224 atctaagcgg ccgcggtatc cagcgacgat tttagcg 37 <210> 225 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-dsdx-RP) <400> 225 gtacgtctct ttgcgcttac atatctcacc ttcccctg 38 <210> 226 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (G-dsdx -FP) <400> 226 gcgtgtaaag tcacctaatg c 21 <210> 227 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (G-dsdx -RP) <400> 227 gggcatcagc agacatatg 19 <210> 228 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-dsdx-FP) <400> 228 caggggaagg tgagatatgt aagcgcaaag agacgtac 38 <210> 229 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- dsdx-RP) <400> 229 tagtaatcta gacgctcata atgccgattg ataac 35 <210> 230 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-kgtP-FP) <400> 230 atctaagcgg ccgcggagct gatccgcgag catac 35 <210> 231 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US- kgtP -RP) <400> 231 acggcaggag acataatggc atgtagtgac gggtcagttg ccagac 46 <210> 232 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (G- kgtP -FP) <400> 232 tggcgtctgg atctggaaaa cg 22 <210> 233 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (G- kgtP -RP) <400> 233 tgtgtaagcg cagcgatgc 19 <210> 234 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- kgtP -FP) <400> 234 gtctggcaac tgacccgtca ctacatgcca ttatgtctcc tgccgt 46 <210> 235 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- kgtP-RP) <400> 235 tatagtaatc tagagaagct gttttggcgg atga 34 <210> 236 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US-actP-FP) <400> 236 atctaagcgg ccgccttatc tttattaagg taaac 35 <210> 237 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (US- actP -RP) <400> 237 agtcctgcat gaggtacaag catcatgtaa tctctcccct tccccggtcg tctg 54 <210> 238 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (G-actP -FP) <400> 238 ctgtgggatt tcgatagtat 20 <210> 239 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (G-actP -RP) <400> 239 agcaacctgg gcgatacctc gac 23 <210> 240 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS- actP -FP) <400> 240 cagacgaccg gggaagggga gagattacat gatgcttgta cctcatgcag gact 54 <210> 241 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (DS-actP-RP) <400> 241 tagtaatcta gaaagctgct tgaagagaag cag 33

Claims (41)

In microorganisms producing optically pure 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone using glucose as a carbon source ( 1) Deleting the ptsG, eda, adhE, pf1B, lysA, thrBC, metA, LacI, ldhA, and iclR genes , and performing the steps of overexpressing the acs, ppc, and metL genes to mutate the microorganism. , 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone production method for producing a microorganism variant. The method of claim 1, wherein the 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone-producing microorganism is E. coli , yeast, and Corynebacterium (Corynebacterium) is one or more selected from the group consisting of, the method. The method of claim 1, wherein the step of mutating the microorganism comprises one or more steps selected from the group consisting of the following (2) to (4) steps:
(2) overexpressing one or more genes selected from the group consisting of epd , dxs , and pdxj genes;
(3) overexpressing one or more genes of lpd and dcuA ; And
(4) Deleting one or more genes selected from the group consisting of kgtP , dsdx and actP genes. The method of claim 3, wherein the step of mutating the microorganism includes all steps (1) to (4). delete The method of any one of claims 3-4, wherein step (2) comprises overexpressing all of the epd, dxs , and pdx genes. The method according to any one of claims 3 to 4, wherein the step (3) comprises overexpressing all of the lpd and dcuA genes. The method according to any one of claims 3 to 4, wherein step (4) comprises deleting all of the kgtP , dsdx , and actP genes. The method of claim 1, wherein the microorganism producing 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone,
A method of promoting the conversion of 4-hydroxy-2-oxo-butyrate from homoserine. The method of claim 9, wherein the promotion of conversion of 4-hydroxy-2-oxo-butyrate from homoserine is that the alpha-position amine group of homoserine is removed by transaminase. The method of claim 10, wherein the transaminase is an enzyme that uses pyruvate as an amino group acceptor. The method of claim 11, wherein the transaminase is an enzyme consisting of the amino acid sequence of SEQ ID NO: 12, an enzyme consisting of the amino acid sequence of SEQ ID NO: 13, an enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and the amino acid sequence of SEQ ID NO: 15. The method comprising one or more selected from the group consisting of enzymes. The method of claim 9, wherein the microorganism producing the 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone is 4 -Catalyzed conversion of hydroxy-2-oxo-butyrate to 2,4-dihydroxy-butyrate. The method of claim 13, wherein the 2,4-dihydroxy-butyrate is from the group consisting of (2S)-2,4-dihydroxy-butyrate and (2R)2,4-dihydroxy-butyrate. One or more selected, method. The method of claim 13, wherein the acceleration of conversion to 2,4-dihydroxy-butyrate is L-4-hydroxy-2-oxo-reductase or D- 4-hydroxy-2-oxo-reductase (D-hydroxy-2-oxo-reductase) will be performed using the method. The method of claim 15, wherein the L-4-hydroxy-2-oxo-reductase is an enzyme consisting of the amino acid sequence of SEQ ID NO: 16, an enzyme consisting of the amino acid sequence of SEQ ID NO: 17, and the amino acid sequence of SEQ ID NO: 18. The method comprising one or more selected from the group consisting of enzymes. The method of claim 15, wherein the D-4-hydroxy-2-oxo-reductase is an enzyme consisting of the amino acid sequence of SEQ ID NO: 19, an enzyme consisting of the amino acid sequence of SEQ ID NO: 20, and the amino acid sequence of SEQ ID NO: 21. The method comprising at least one selected from the group consisting of enzymes. The method of claim 13, wherein the microorganism producing 2,4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone is 2, The method of claim 1, wherein the lactonation of 4-dihydroxy-butylate is promoted to promote the production of 2-hydroxy-gamma-butyrolactone. The method of claim 18, wherein the promotion of lactonization is performed by promoting the expression of lactonase consisting of the amino acid sequence of SEQ ID NO: 22. The method of claim 18, wherein the 2-hydroxy-gamma-butyrolactone is at least one selected from the group consisting of (2S)-2-hydroxy gamma butyrolactone and (2R)-2-hydroxy gamma butyrolactone. , Way. PtsG, eda, adhE, pf1B, lysA, thrBC, metA, LacI, ldhA, and in the genome of a microorganism producing 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone. A 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone producing microbial variant in which the iclR gene was deleted and a genetic mutation overexpressing the acs, ppc, and metL genes was introduced. In the genome of microorganisms producing 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone,
ptsG, eda, adhE, pf1B, lysA, thrBC, metA, LacI, ldhA, iclR, kgtP, dsdx, and actP genes are deleted,
A microbial variant in which the acs, ppc, metL, epd, dxs, pdxj, lpd, and ducA genes are overexpressed. The microbial variant according to claim 21, wherein the microbial variant is a strain of accession number KCCM12281P. The microbial variant according to claim 22, wherein the microbial variant is a strain of accession number KCCM12282P. The method of claim 21 or 22, wherein the microorganism producing 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone is the following (1), (2) and (4). A microbial variant that further comprises a gene or a recombinant vector comprising the gene, or the genes of (1), (3), and (4) or a recombinant vector comprising the gene:
(1) at least one transaminase mutant encoding gene selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14 and SEQ ID NO: 15,
(2) At least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 Enzyme encoding gene,
(3) At least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 21 An enzyme encoding gene, and
(4) A gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 22. The method of claim 21, wherein the microbial variant is selected from the group consisting of homoserine, 4-hydroxy-2-oxo butyrate, 2,4-dihydroxy-butyrate, and 2-hydroxy-gamma-butyrolactone. The microbial variant that produces one or more in excess. 2-hydroxy gamma butyrolactone (2-hydroxy gamma butyrolactone) or 2,4-dihydroxy butyrate comprising the step of culturing the microorganism variant of any one of claims 21 to 24 and 26 (2,4-dihydroxy butanoic acid) production method. The method of claim 27, wherein the microbial variant further comprises one or more genes selected from the following (1) to (4) or a recombinant vector comprising the same:
(1) At least one transami selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13, a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and an enzyme consisting of the amino acid sequence of SEQ ID NO: 15 A gene encoding a naise mutant enzyme,
(2) At least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 Enzyme encoding gene,
(3) At least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 21 An enzyme encoding gene, and
(4) A gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 22. The method of claim 27, wherein the culturing is performed in a medium containing yeast extract and ammonium salt as a nitrogen source. The fermentation according to claim 27, wherein after the culturing step, one or more amino acids selected from the group consisting of sugar and methionine, lysine, threonine, and isoleucine are added to ferment in a fed-batch manner. The production method further comprising the step of. The method of claim 30, wherein after producing the pure optical isomer (2S)-2,4-dihydroxy butyrate or (2R)-2,4-dihydroxy butyrate in the fermentation step, the pH is 1.0 to 3.0. The production method further comprises the step of chemically converting to (2S)-2-hydroxy-gamma-butyrolactone or (2R)-2-hydroxy-gamma-butyrolactone by lowering to. Any one of claims 21 to 24 and 26, comprising the microorganism variant or a culture thereof, 2-hydroxy gamma butyrolactone (2-hydroxy gamma butyrolactone) or 2,4-dihydroxy butyrate Composition for the production of (2,4-dihydroxy butanoic acid). The composition for production of claim 32, wherein the microbial variant further comprises one or more genes selected from the following (1) to (4) or a recombinant vector comprising the same:
(1) A gene consisting of a nucleotide sequence encoding an enzyme consisting of an amino acid of SEQ ID NO: 13, a gene consisting of a nucleotide sequence encoding an enzyme consisting of an amino acid of SEQ ID NO: 14, and a base encoding an enzyme consisting of an amino acid of SEQ ID NO: 15 At least one transaminase mutant encoding gene selected from the group consisting of genes consisting of sequences,
(2) At least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 Enzyme encoding gene,
(3) At least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 21 An enzyme encoding gene, and
(4) A gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 22. delete delete delete delete delete delete delete delete

Images