WO2019013573A2

WO2019013573A2 - Method for preparing 2-hydroxy-gamma-butyrolactone or 2,4-dihydroxy-butyrate

Info

Publication number: WO2019013573A2
Application number: PCT/KR2018/007923
Authority: WO
Inventors: 박성훈; 김용환; 이성국; 심증엽; 유태현; 수만라마; 응웬하이남
Original assignee: 울산과학기술원
Priority date: 2017-07-12
Filing date: 2018-07-12
Publication date: 2019-01-17
Also published as: WO2019013573A9; KR20190007403A; KR102149044B1; WO2019013573A3

Abstract

The present invention suggests: a newly shown biosynthesis pathway using the production of homoserine as an intermediate stage for the preparation of 2-hydroxy gamma butyrol acetone (HGBL) and a precursor thereof, 2,4-dihydroxybutanoic acid; and a gene recombinant strain having the pathway. HGBL having a hydroxyl group substituted at the 2nd position thereof can be used as an important intermediate, which is usable as a resin for photoresist, a raw material for a medical product, and a material for coating a metal surface.

Description

【Specification】

Title of the Invention

Process for producing 2-hydroxy-gamma butyrolactone or 2,4-dihydroxy-butyrate

TECHNICAL FIELD

The present invention relates to a newly proposed biosynthetic pathway for the production of 2-hydroxy gamma butyrolactone (HGBL) and its precursor, 2, 4-dihydr oxybutanoic acid, present. In the case of HGBL in which hydroxyl group is substituted at position 2, it is an important intermediate that can be used as resin for photoresist, material for pharmaceutical raw materials and material for coating metal surface.

BACKGROUND ART [0002]

U.S. Pat. Nos. 4,994,597 and 5,087,751 (I 匪 e) disclose 3,4-dihydroxybutyric acid derivatives. Such an acid production method is distinguished from the present invention in which the hydrolysis of metal cyanide with 3, 4-dihydroxybutyl chloride is related to hydrolysis. The acid is an intermediate of ₃ -hydroxybutyrolactone.

(S) -3-hydroxybutyrolactone is a core 4-carbon intermediate for the production of intermediates for a variety of drugs including cholesterol lowering drugs, (S) -carnitine, anti-HIV protease inhibitors and a wide range of antibiotics.

(R) -3-hydroxybutyrolactone or (R) -3,4-dihydroxybutyric acid gamma-lactone are the core 4-carbon intermediates for the preparation of various drug intermediates. It can also be converted to 1-carnitine, a naturally occurring vitamin and a component used in many applications, including health food additives and tonic bales, treatment of various nervous systems and metabolic disorders. The market for carnitine is several hundred tons. It is produced in pure form in the form of d and 1. However, there is no direct synthetic route that has commercial value yet.

(S) -3-hydroxybutyrolactone can be prepared by the Hollingsworth process (U.S. Patent No. 5,374,773). (R) -3-hydroxybutyrolactone can not be prepared by this process since it is necessary to use a starting material with a 4-linked L-nuclear source. These substances are not known. A common lactone preparation process is known from the following patents:

U, .S. Patent No. 3, 024 _; , 250 to Klein et al. ,

U, .S. Patent No. 3 _; , 868,, 370 to Smith,

U.S. Patent No. 3 _; , 997 _; , 569 to Powel 1 -,

U.S. Patent No. A., 105, 674 to De Thomas et al.

U., p. Patent No. 4 _: , 155 _: , 919 to Ramioui lie et al

U ,, s. Patent No. 4 _; , 772 ", 729 to Rao,

U., p. Patent No. _, . , 940, 805 to Fisher et al. ,

U., p. Patent No. 5 _; , 292,, 939 to Hoi 1 ingsworth,

U., p. Patent No. 5,, 319,, 110 to Hoi 1 ingsworth,

U., p. Patent No. 5,, 374,, 773 to Hoi 1 ingsworth,

U., p. Patent No. 5, 502, 217 to Fuchikami et al.

These patents announce various lactone manufacturing processes. But all of them

The process for the preparation of gammabutyrolactone in the 2-hydroxy position is not mentioned.

DETAILED DESCRIPTION OF THE INVENTION

[Technical Problem]

The present invention relates to a process for the production of 2,4-dihydroxy-butyrate (2,4- 1 (1 < th > 13 6) or 2-hydroxy- Dihydroxy-butyrate or a salt thereof, which comprises the step of carrying out at least one step selected from the following (1) to (4) in a microorganism producing lactone (2-hydroxy gamma butyrolactone) Hydroxy-gamma-butyrolactone-producing microorganism variant.

(1) deletion of one or more genes selected from the group consisting of ptsG, eda, adhE, pflB, lysA, thrBC, metA, Lad, IdhA and / Overexpressing one or more genes, or both,

(2) overexpressing at least one gene selected from the group consisting of epd, dxs, and pdxj genes,

(3) overexpressing one or more genes of Ipc < RTI ID = 0.0 > and / or & (4) deletion of one or more genes selected from the group consisting of kgtP, dsdx, and ac genes.

The present invention also relates to a method for producing a mutant of any one of the above (1) to (4) in a genome of a microorganism that produces 2,4-dihydroxy-butyrate or 2-hydroxy-gamma- Dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone-producing microorganism variants.

The present invention also provides a method for producing a microorganism which comprises culturing a microorganism variant of the present invention comprising 2-hydroxy gamma butyrolactone or 2,4-dihydroxy butanoic acid, And a method for producing the same.

The present invention also relates to a pharmaceutical composition comprising 2-hydroxy gamma butyrolactone or 2,4-dihydroxy butanoic acid, which comprises a microorganism strain or culture thereof, By weight based on the total weight of the composition.

The present invention also relates to a polypeptide comprising the amino acid sequence of SEQ ID NO:

A transaminase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 14, and a transaminase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 15.

The present invention also provides a L-hydroxy-2-oxo-reductase mutant consisting of the amino acid sequence of SEQ ID NO: 17 and consisting of the amino acid sequence of L-hydroxy-2-oxo-reductase mutant Enzyme is provided.

The present invention also provides a D-hydroxy-2-oxo-reductase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 20, a D-hydroxy-2-oxo-reductase enzyme comprising the amino acid sequence of SEQ ID NO: Provide mutated enzymes.

The present invention also provides a lactonase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 22.

[Technical Solution]

Through pure biosynthesis from homoserine, pure isomers of optically active isoforms can be produced by reacting 2-hydroxygalactosidic acid butyrolactone with two isomers, or its precursor, 2,4-dihydroxy butanoic acid to provide. One example of the above method is illustrated schematically in Fig.

In one example, 2,4-dihydroxy butanoic acid, which is a precursor of 2-hydroxy gamma butyrolactone, is isolated from 2,4-dihydroxy butanoic acid when it is produced in the form of an optically active pure isomer or a mixture thereof After purification, it may be a method of producing the final 2-hydroxy gamma butyrolactone in the state of being optically active pure isomers or a mixture thereof by a chemical method.

The production method may include a step of removing the alpha-position amine group of homoserine, and the enzyme used for removing the alpha-position amine group of homoserine may be at least one selected from the group consisting of deaminase, dehydrogenase, and transaminase.

In one example, the production method may be to use a transaminase characterized by the use of a-ketoglutarate (a_KG) as an amino acceptor to receive an amino group from homoserine.

Also, the production method includes a pathway for regenerating the amino acceptor a-KG from glutamic acid produced from the α-KG and simultaneously using aspartate transaminase for the production of aspartic acid, a homoserine biosynthesis precursor .

In another example, the production method is a method wherein the oxygen bonded to the 2-carbon of 4-hydr oxy-2-ox-butanoic acid in the repellent pathway shown in FIG. 1 is reduced in a stereo- L-lactate dehydrogenase, D-lactate dehydrogenase, and black are used as the enzymes which convert to hydroxy group.

Another example is that the paraoxonase shown in Fig. 1 is expressed in a periplasm of a strain produced to produce an optically active 2-hydroxy gamma butyrolactone from homoserine by mutation of a gene having a lactonase activity (P0N1) derived from a human. Lt; / RTI > The strain may be a homoserine and a producing strain and a homoserine producing strain. Another example is 2-hydroxy gamma butyrolactone, which has optical activity on position 2 carbon from homoserine through the pathway shown in Figure 1, In order to efficiently produce 2,4-dihydroxy butanoic acid, a precursor which is an organic acid precursor, as shown in FIG. 4, a gene mutation strain produced to efficiently produce homoserine from sugar is provided. The strain may be a homoserine and a producing strain and a homoserine producing strain.

The microorganism for producing the mutant strain may be one or more microorganisms selected from the group consisting of Escherichia coli, yeast coryzae, and the like.

The microorganism may be a microorganism that is improved by using one or more of the following methods, individually or in combination:

Overexpression of phosphoenol pyruvate carboxylase (ppc) gene, which efficiently converts lphosphoenol pyruvate (PEP) to oxaloacetic acid (0AA);

2. overexpression of acetyl-CoA synthase (acc) gene to help reuse microbes by converting acetate produced into fermentation into acetyl CoA;

3. Elimination of the iclR gene, which inhibits glyoxylate shunt gene expression, to increase the activity of the lyoxylate shunt;

4. Improves the activity of apspartate kinase to increase aspartyl phosphate conversion efficiency of apspartic acid. To improve the expression of the thrABC gene coding for apspartate kinase, it removes the riboswitch of the thrABC operon, which is activated by isoleucine, and also increases the strength of the promoter. Furthermore, to prevent the feedback inhibition of apspartate kinase enzyme by threonine and lysine, it is necessary to express the mutated enzyme so that it does not undergo feedback inhibition;

5. Elimination of lysA coding for diaminopimelate decarboxylase to remove lysine production;

6. Remove the metA gene encoding homoserine succinyltransferase to remove methionine production;

7. The produced homoserine does not convert to homoserine phosphate, but removes the thrB gene coding for homoserine kinase. The pathway of the above-described production method was introduced into the prepared homoserine and the production strain, and 2-hydroxy gamma butyro 1 act ne, which is optically active at position 2 carbon from the sugar, and its precursor, 2,4-dihydroxy butanoic acid Lt; RTI ID = 0.0 > a < / RTI > At this time, the strain may be characterized in that the biosynthesis pathway of vitamin B6 is enhanced so as to promote biosynthesis of transaminase and pyridoxal-5'-phosphate as a cofactor in order to increase the activity of transaminase.

The prepared strain may be a strain characterized by overexpressing the cell membrane transfer protein of 2,4-dihydroxybutanoic acid to rapidly release 2,4-dihydroxybutanoic acid biosynthesized from the sugar via homoserine to the outside of the cell.

Also, a method for producing 2-hydroxy gamma butyrolactone and / or its precursor, 2,4-dihydroxy butanoic acid, which is pure isomeric black having two optically active isomers, is provided from the culture solution by culturing the strain described above do.

This method is particularly useful for the production of 2-hydroxygalactosyl butyrate and / or its precursor, 2,4-dihydroxy butanoic acid, by adding yeast extract and ammonium salt as a nitrogen source, And then culturing the cells using a medium supplemented with amino acids such as methionine, lysine, threonine, and isoleucine.

The cultivation was carried out in the presence of glucose, methionine, lysine, threonine, and isoleucine in the middle of fermentation for the production of high concentration 2-hydroxy gamma butyrolactone and / or its precursor 2,4-dihydroxy butanoic acid (E.g., a mixture of methionine, lysine, threonine, and isoleucine).

The present invention relates to the production of optically pure 2,4-dihydroxybutyrate or 2-hydroxy gamma-butyrolactone using glucose as a carbon source (1) 4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone-producing microorganism variant, comprising the step of carrying out one or more steps selected from the group consisting of: to provide.

(1) deletion of one or more genes selected from the group consisting of ptsG, eda, adhE, pflB, lysA, thrB, metA, Lad, IdhA and iclR genes,

Overexpressing one or more genes selected from the group consisting of PPC and metL genes, or both,

(2) overexpressing one or more genes selected from the group consisting of epd, dxs, and ρ τ genes,

(3) over-expressing one or more genes of lpd and ckicA, and

(4) deletion of one or more genes selected from the group consisting of kgtP, dsdx, and aci genes.

The kind of the carbon source is not particularly limited,

It is appropriate that it is glucose.

The term " optically pure " refers to (2S) -2, 4-dihydroxy-butyrate or (2R) -2,4- dihydroxybutyrate or (2S) The optical purity of each of lactone or (2R) -2-hydroxy-gamma butyrolactone is 90% to 100%, preferably 95% to 100%, more preferably 97% to 100% 100%.

According to one embodiment of the present invention, the microorganism producing the 2,4-dihydroxybutyrate or 2-hydroxy gamma-butyrolactone is Although there is no particular limitation on the kind, E. coli 0? (E. coli), yeast (Yeast), and Corynebacterium (Corynebacterium), preferably E. coli.

According to one embodiment, performing one or more steps selected from (1) to (4) to mutate the microorganism may be performed concurrently or sequentially, and it is not necessary to perform each step in a clockwise sequence , (1) to (4) may be arbitrarily determined and performed, and two or more steps may be simultaneously performed and the remaining steps may be sequentially performed. Preferably, the step of mutating the microorganism may be carried out, and the step (2) to (4)

(1) to (4).

According to one embodiment of the present invention, lysA, thrBC, and metA among the genes that can be removed in the step (1) are used for the purpose of inhibiting lysine, methionine, and threonine production pathway in order to increase the accumulation of homoserine, To remove it. Specifically, it is possible to remove one or more of lysA encoding diaminopimelate decoxyase, metk encoding Homoserine inesuccinyl Transferase, and thrBC encoding Homoserine ine Kinase and Threonine Synthase, respectively, which are genes encoding homoserine acid basic enzyme,

Among the genes that can be removed in step (1), MiA, adhE, and /? Gene may be removed to prevent the production of by-products such as lactic acid, ethane, and formic acid. Removal of these genes prevents by-product formation and increases the carbon flux to homoserine,

The / cH? Gene among the genes that can be removed in the above step (1) is removed in order to enhance the activity of the glyoxylate shunt, which is one of the methods for promoting acetal reuse. The removal can be carried out by a conventional method, You can remove it with the pop-in pop-out method.

Among the genes that can be removed in the above step (1), the ptsG gene may be removed to eliminate the overflow metabolism of glucose metabolism and to prevent the use of phosphoenolpyruvate (PEP) for glucose cell membrane transport. In this case, glucose is transported into cells by other transport proteins such as GalP, and prevention of Carbon Catabolite Repression and prevention of by-product formation by overflow metabolism can be expected. The gene may be removed by a conventional method, but preferably by the MAGE method.

Among the genes that can be removed in the above step (1), the eda gene is a gene coding for KHG / KDG aldolase. When the gene is deleted, the ED pathway The use of the EMP (Embden-Meyerhof-Parnas pathway) pathway is facilitated and the carbon flux to oxaloacetate can be applied. As a method for removing the gene, a conventional method can be used, but the MAGE method can be preferably used.

Among the genes that can be removed in the above step (1), the lacl gene removes the lacl inhibitor for the utilization of the Lac promoter (promoter utilization). The gene can be removed by a conventional method, have.

The overexpression of the gene in the step (1) may be performed by a conventional method. For example, a large amount of a vector containing a gene in a microbial cell may be introduced, or an over-expression promoter substitution method or the like may be used.

Specifically, in step (1), overexpression of the 3CS gene may increase the expression of the acs gene in order to minimize the production of acetic acid. pTA-ack and poxB genes can also be deleted, but the deletion of these genes, especially the deletion of genes, often adversely affects cell growth.

The method of increasing the expression of the acs gene can be used without limitation in a method commonly used in the related art. Preferably, the promoter of the 3CS expression gene can be converted into a gene overexpressing promoter, and the lac promoter, the tac promoter, the trc promoter Etc., and it is preferable to substitute with a re-promoter.

Overexpression of the ppc gene in step (1) is intended to increase the expression of the ppc gene encoding phosphoenol pyruvate carboxylase, which is the key enzyme of the anapl-erotic pathway, to inhibit acetate production and improve the carbon flux to homoserine. A gene expression increasing method can be used and the promoter of the ppc gene can be converted into a gene overexpressing promoter and preferably the expression can be increased by replacing a conventional promoter with a synthetic promoter 8 (SEQ ID NO: 23, TTTCAATTTAATCATCCGGCTCGTATAATGTGTGGA). You can use the pop-in pop-out method to do this.

Overexpression of the metL gene in the above step (1) This is to optimize the pathway after aspartic acid, known as bottleneck. It is known that three aspartate kinases AKI, AKII and AKIII play an important role in homoserine production. Of these AKII and AKIII, only two enzymes are known to exhibit good activity at high homoserine concentrations. Among AKI and AKIII, Aspartate kinase and serine dehydrogenase activity are known to be more advantageous than ΑΚΙΠ. Therefore, the mutant strain of the present invention can overexpress the metL gene coding for the AKII enzyme.

The overexpression of the metL gene can be carried out by conventional methods, and can be over expressed using a medium copy plasmid, pUCPK plasmid. In this case, two lac promoters and trc promoters can be used to control metL ^ expression size.

The genes for over-expressing or over-expressing the genes are summarized in Table 1. According to one embodiment of the present invention, the step (1) comprises deleting all of the ptsG, eda, adhE, pflB, lysA, thrB, etA, Lac I, IdhA and / lt; RTI ID = 0.0 > metL < / RTI > gene.

According to one embodiment of the present invention, the step (2) is carried out to increase the production of Vitamin B6. In the case of Escherichia coli, the PLP (Pyridoxal-5-Phosphate) is dependent on D-deoxy-D-xylulose 5-phosphate Pathway, and the rate of PLP biosynthesis is regulated by the proteins encoded by the epd, dxs, pdxJ genes and the like. Thus, one or more of these three genes may be overexpressed to improve the rate of PLP biosynthesis. For the over-expression method, a conventional method can be used. Preferably, it is appropriate to replace the existing promoter with the synthetic promoter 9 (Table 5), and a pop-in pop-out method can be used. Table 14 shows the primers usable at this time.

Preferably, step (2) above preferably overexpresses all epd, dxs, and pdxj genes.

In one embodiment of the present invention, the increase in the expression level of ldp, ifcu ^ in step (3) increases the extracellular delivery rate of 2,4-dihydroxy-butyrate (DHB) In this study, we selected importer and exporter as a query among organic acid membrane transfer protein, especially l act ic acid and low molecular weight carboxyl acid transfer protein. Then, two most promising exporters, ldp and ldp, / DcuA < / RTI > protein.

As a method for increasing the expression of these proteins, conventional methods can be used, preferably promoters can be substituted, and overexpression of the membrane protein interferes with cell growth, so that a mid-level synthetic promoter SP5 (Synthet ic promoter 5) or the like is preferably used.

Preferably, the step (3) comprises the steps of lpd, and all of the ducA gene

Overexpression.

In one embodiment of the present invention, step (4) is performed to inhibit intracellular re-introduction of 2, 4-dihydroxy-butyrate (DHB) Any one or more of the genes encoding the protein, kgtP, dsdx and actP, can be removed. The primer sequences usable at this time are shown in Table 18. < tb >< TABLE > Preferably, the 4 step may be to remove all of the ⁵ kgtP, dsdx, and ac gene.

The mutant strains prepared by carrying out the mutant strains prepared in the above step (1) through the steps (1) and (2) in Table 2 (EcWl to EcW13) are shown in Table 15 (EcW13 to EcW16) The strains prepared by performing the steps of (1), (2), (3) or / or (4) were listed in Table 19 (EcW16 to EcW20).

According to one embodiment of the present invention, the method for producing a microorganism variant further comprises the step of promoting the conversion of 4-hydroxy-2-oxo-butyrate from homoserine Lt; / RTI >

The step of promoting the conversion means that the conversion of 4-hydroxy-2-oxo-butylate is promoted by removing the alpha-position amine group of homoserine, and specifically, transaminase And removing the alpha-position amine group of the homoserine. The transaminase can be obtained by introducing a large amount of a vector containing a gene encoding the gene into a microorganism and transforming the transaminase, And a method of replacing the promoter of the gene encoding with the over-expression promoter.

The transaminase may be an enzyme using pyruvate as an amino acceptor, specifically, an enzyme consisting of the amino acid sequence of SEQ ID NO: 12, an amino acid sequence of SEQ ID NO: 13 An enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and an enzyme consisting of the amino acid sequence of SEQ ID NO: 15, preferably an enzyme consisting of the amino acid sequence of SEQ ID NO: 13 An enzyme consisting of the amino acid sequence of SEQ ID NO: 14 or an enzyme consisting of the amino acid sequence of SEQ ID NO: 15 is preferably used.

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 12 may be composed of the nucleotide sequence of SEQ ID NO: 1, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 13 may be the nucleotide sequence of SEQ ID NO: The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 14 may be composed of the nucleotide sequence of SEQ ID NO: 3, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 15 may be the nucleotide sequence of SEQ ID NO: .

According to one example of the present invention, the method for producing a microorganism variant may further include a step of promoting conversion of 4-hydroxy-2-oxo-butyrate to 2,4-dihydroxy-butyrate .

The step of promoting the conversion to ₂ , 4-dihydroxy-butyrate means promoting the reduction of the ketone group located at the 2-carbon of 4-hydroxy-2-oxo-butylate. A large amount of a vector containing a gene encoding a reductase that reduces 4-hydroxy-2-oxo-butylate is introduced into a microorganism and transformed, or a promoter of a gene encoding reductase is replaced with an over-expression promoter Method or the like can be used.

According to one embodiment of the present invention, the 2,4-dihydroxy-butyrate produced by the reduction reaction is 2,4-dihydroxy- (2S) -2, 4-dihydroxy-butyrate and (2R) -2, 4-dihydroxy-butyrate being the pure optical isomers One or more, racemates, optical isomeric waxes may be prepared,

(2S) -2, 4-dihydroxy-butyrate or (2R) -2, 4-dihydroxy-butyrate, respectively. The kind of the optical isomer of 2,4-dihydroxy-butyrate may be selected depending on the intended use of the compound.

Over-expression of L-hydroxy-2-oxo-reductase to promote the conversion of (2S) -2, 4-dihydroxy- D-hydroxy-2-oxo-reductase may be overexpressed in order to promote the conversion of D-hydroxy-2-oxo-reductase to 4-dihydroxy-butyrate.

According to a preferred embodiment of the present invention, the L-hydroxy-2-oxo-reductase comprises an enzyme consisting of the amino acid sequence of SEQ ID NO: 16,

17 and an enzyme consisting of the amino acid sequence of SEQ ID NO: 18, preferably an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and / or an enzyme consisting of the amino acid sequence of SEQ ID NO: 18 May be an enzyme consisting of an amino acid sequence. The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 16 may be composed of the nucleotide sequence of SEQ ID NO: 5, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 17 may be the nucleotide sequence of SEQ ID NO: And the gene coding for the enzyme consisting of the amino acid sequence of SEQ ID NO: 18 may be composed of the nucleotide sequence of SEQ ID NO:

According to another embodiment of the present invention, the D-hydroxy-2-oxo-reductase comprises an enzyme consisting of the amino acid sequence of SEQ ID NO: 19,

An enzyme consisting of an amino acid sequence of SEQ ID NO: 20, and an enzyme consisting of an amino acid sequence of SEQ ID NO: 21, preferably an amino acid sequence of SEQ ID NO: 20, and / An enzyme comprising an amino acid sequence. The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 19 may be composed of the nucleotide sequence of SEQ ID NO: 8, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: And the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 21 may be composed of the nucleotide sequence of SEQ ID NO:

According to one embodiment of the present invention, the method may further comprise the step of promoting lactonization to 2, 4-dihydroxy-butyrate to promote the production of 2-hydroxy-gamma-butyrolactone have. The lactoneization promoting may be performed by promoting the expression of l actonase. The expression promoting method may be carried out by introducing a vector containing a lactonase gene into an excessive cell to increase the amount of lactonase, A variety of methods can be used, such as replacing the promoter expressing the gene with an over-expression promoter. Preferably, the promoting of the lactonization may be carried out by promoting the expression of l actonase comprising the amino acid sequence of SEQ ID NO: 22, and the gene encoding the lactonase comprising the amino acid sequence of SEQ ID NO: 22 May comprise the nucleotide sequence of SEQ ID NO: 11. The resulting 2-hydroxy-gamma-butyrolactone is at least one compound selected from the group consisting of pure optical isomers (2S) -2-hydroxy gamma butyrolactone and (2R) -2 ^: hydroxy gamma butyrolactone number and, preferably, _(2S) - _{2-hydroxy-gamma} -butyrolactone or _(2R) in-lock may tonil ₂ _-hydroxy-gamma -butyrolactone.

(2S) -2-hydroxy gamma butyrolactone produced by the above method or

(2R) -2-hydroxy gamma butyrolactone may have an optical purity of 90% to 100%, preferably 95% to 100%, more preferably 99% to 100%. According to one embodiment of the present invention, the genome of the microorganism producing the 2,4-dihydroxy-butyrate or the 2-hydroxy-gamma-butyrolactone is added to any one of (1) to (4) 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone-producing microorganism variant into which the above-mentioned gene mutation has been introduced.

(1) one or more deletions selected from the group consisting of ptsG, eda, adhE, pflB, lysA, thrBZ, metA, Lad, IdhA, and / c / Overexpressing one or more genes selected, Or both;

(2) overexpression of one or more genes selected from the group consisting of epd, dxs, and pdxi genes,

(3) overexpression of one or more genes of Idp and ducA,

(4) deletion of one or more genes selected from the group consisting of kgtP, dsdx, and ac 尸 genes.

According to the foot of example, the microbial mutants are preferably pt s, eda, l ad, thrB, metA, lysA, adhE, pf IB, IdhA, and ic lR gene is deleted, overexpression of the _acs gene, and ppc It is possible to produce a microorganism variant in which the gene is distinguished. The microorganism variant may be the EcW13 strain shown in Table 15, preferably the strain of Accession No. KCCM12281P. According to another embodiment of the present invention, the microorganism variant is selected from the group consisting of ptsG, eda, adhE (2, 4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone) , microbial mutants in which pflB, lysA, thrBC, metA, Lac I, IdhA, iclR, kgtP, dsd and aci genes are deleted and acs, ppc, metL, epd, dxs, pdxj, Idp and ciucA genes are overexpressed , The microorganism variant may be a strain of EcW20, which was tested in the following Examples, and the strain of KCCM12282P.

According to one embodiment of the present invention, the microbial mutant may further comprise one or more genes selected from the following (1) to (4) or a recombinant vector comprising the same.

(1) a gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 13, a gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and a gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 15 One or more transaminase mutant enzyme encoding genes,

(2) at least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: Enzyme-encoding genes, (3) at least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: An enzyme-encoding gene, and

(4) A gene encoding the lactonase enzyme comprising the amino acid sequence of SEQ ID NO: 22.

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 13 may be composed of the nucleotide sequence of SEQ ID NO: 2, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 14 may be composed of the nucleotide sequence of SEQ ID NO: The gene coding for the enzyme consisting of the amino acid sequence of SEQ ID NO: 15 may be composed of the nucleotide sequence of SEQ ID NO: 4,

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 17 may be composed of the nucleotide sequence of SEQ ID NO: 6, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 18 may be composed of the nucleotide sequence of SEQ ID NO: And ^'

The gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 19 may be composed of the nucleotide sequence of SEQ ID NO: 9, and the gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 20 may be the nucleotide sequence of SEQ ID NO: have.

According to one embodiment of the present invention, the microorganism variant is selected from the group consisting of homoserine, 4-hydroxy-2-oxobutyrate, 2,4-dihydroxy-butyrate, and 2-hydroxy-gamma-butyrolactone Lt; RTI ID = 0.0 > 1, < / RTI >

According to an embodiment of the present invention, there is provided a method for producing a microorganism which comprises culturing the above-described microorganism variant as described above, wherein 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutyrate -dihydroxy butanoic acid. < / RTI >

The microorganism variant used in the production method may be one or more genes selected from the following (1) to (4) or a recombinant vector containing the same It may be additionally included.

(1) at least one transaminase mutant encoding gene selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13 and an enzyme encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14,

(2) at least one L-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: Enzyme-encoding genes,

(3) at least one D-hydroxy-2-oxo-reductase mutation selected from the group consisting of a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: An enzyme-encoding gene, and

(4) a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 22.

According to one embodiment of the present invention, the step of culturing in the production method may be performed in a culture medium containing yeast extract and ammonium salt as a nitrogen source.

According to another embodiment, after the step of culturing, at least one amino acid selected from the group consisting of a sugar and methionine, lysine, threonine, and isoleucine is added, (2S) -2, 4-dihydroxybutyrate or (2R) -2, 4-dihydroxybutyrate as the pure optical isomer in the fermentation step (2S) _2-hydroxy-gamma-butyrolactone or (2R) -2-hydroxy-gamma-butyrolactone through a chemical modification step which is lowered to a pH of 1.0 to 3.0, preferably a pH of 1.0 to 2.0, Butyrolactone. &Lt; / RTI >

For example, after producing (2S) -2, 4-dihydroxybutyrate, the pH is lowered to 1.0 to 3.0 to obtain (2S) -2-hydroxybutyrate having an optical purity of 95% to 100%, preferably 97% Hydroxy-gamma-butyrolactone, and (2R) -2, 4- (2R) -2-hydroxy-gamma-butyrolactone having an optical purity of 95% to 100%, preferably 97% to 100% by lowering the pH to 1.0 to 3.0 after producing dihydroxybutyrate .

One example of the present invention is a microorganism which comprises 2-hydroxygamma butyrolactone or 2, 4-dihydroxybutyrate (2 , 4-dihydroxy butanoic acid).

The microorganism variant may further comprise one or more genes selected from the following (1) to (4) or a recombinant vector comprising the same.

(1) a gene consisting of a nucleotide sequence encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13 and a gene consisting of a nucleotide sequence encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14; and at least one transaminase mutant enzyme encoding gene ,

An example of the present invention provides a transaminase mutant enzyme comprising the amino acid sequence of SEQ ID NO: The gene encoding the transaminase mutant enzyme may be one comprising the nucleotide sequence of SEQ ID NO: 2.

An example of the present invention provides a transaminase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 14. The gene coding for the transaminase mutant enzyme may be composed of the nucleotide sequence of SEQ ID NO: 3.

An example of the present invention is a polypeptide comprising the amino acid sequence of SEQ ID NO: Thereby providing a transaminase mutant enzyme. The gene coding for the transaminase mutant enzyme may comprise the nucleotide sequence of SEQ ID NO: 4. An example of the present invention provides an L-hydroxy-2-oxo-lyudatease mutant enzyme consisting of the amino acid sequence of SEQ ID NO: The gene coding for the L-hydroxy-2-oxo-lyudatease mutant enzyme may comprise the nucleotide sequence of SEQ ID NO: 6.

One example of the present invention provides an L-hydroxy-2-oxo-lyudatease mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 18. The gene coding for the L-hydroxy-2-oxo-reductase mutant may be a nucleotide sequence of SEQ ID NO: 7.

An example of the present invention provides a D-hydroxy-2-oxo-lyudatease mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 20. The gene encoding the D-hydroxy-2-oxo-reductase mutant enzyme may be one comprising the nucleotide sequence of SEQ ID NO:

An example of the present invention provides a D-hydroxy-2-oxo-lyudatease mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 21. The gene coding for the D-hydroxy-2-oxo-reductase mutant enzyme has the amino acid sequence of SEQ ID NO: 10

Base sequence.

An example of the present invention provides a lactonase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 22. The gene coding for the lactonase mutation enzyme may comprise the nucleotide sequence of SEQ ID NO: 11.

[Effects of the Invention】

The present invention relates to a mutant which overexpresses 2-hydroxy gamma butyrolactone (HGBL) and its precursor, 2,4-dihydroxybutanoic acid, and a 2-hydroxy gamma butyrolactone (HGBL) 4-dihydroxybutanoic acid. In addition, when the mutant and the mutant enzyme of the present invention are used, 2-hydroxy-gamma-butyrolactone can be made into a pure optical isomer of (R) or (S) form. These isomers as well as intermediates for pharmaceuticals, pesticides, seasonings and perfumes, especially photoresists for semiconductors, intermediates for coating materials on metal surfaces Can be usefully exploited.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows a novel biosynthetic pathway for biosynthesis of optically pure 2-hydroxy gamma butyrolactone and its organic acid precursor 2,4-dihydroxybutanoic acid from homoserine ine.

FIG. 2 shows a pathway for biosynthesis of 4-hydroxy-2-oxo-butanoate from homoserine ine using homoserine dehydrogenase.

FIG. 3 shows a pathway for biosynthesis of 4-hydroxy-2-oxo-butanoate using homoserine transaminase and aspartate transaminase from homoserine ine.

FIG. 4 shows a strategy for producing a large amount of homoserine using glucose and a strategy for biosynthesis of 2-hydroxy gamma butyrolactone and its precursor, 2,4-dihydroxybutanoic acid. FIG. 5 shows the results of measurement of the relative activity of a synthetic promoter synthesized for improving or controlling gene expression shown in Table 5 using GFP.

FIG. 6A shows the result of electrophoresis of the strain-cleaved excision product producing the TA1, TA2, TA3 and TA6 enzymes under denaturing conditions, indicating that 4 types of TA ^ TA2, TA3 and TA6 are enzymatically produced only in insoluble form.

FIG. 6B is a block diagram of an embodiment of the present invention, wherein TA4, TA5, TA7, YA8, TA9, TAIO, TAll, TA12, TA13,

TA5, TA7, YA8, TA9, TAIO, TA11, TA12, TA12, and TA12 were obtained as a result of centrifugation of the lysate of strains producing 11 kinds of enzymes such as TA15 and TA15, TA13, TA14 and TA15 enzymes are obtained in a soluble state.

FIG. 7A shows eleven transaminase enzymes expressed in soluble form

Only five enzymes such as TA4, TA5, TAIO, TAll and TA15 exhibited activity against homoserine, indicating that TA4 has the highest activity.

FIG. 7B shows the results of purification of the TA4 enzyme, which exhibits the highest activity for homoserine, by pure separation using affinity chromatography, and electrophoresis Results.

FIG. 8 shows the results of confirming the performance of a reporter strain for transaminase screening. Reporter strains harboring E. coli BL21 (DE3) wild-type strains and pET-TA4 recombinant plasmids were cultured in medium containing small amounts (0.5 mM) of methionine, threonine and 10 mM of homoserine, respectively. The reporter strain with the TA4 enzyme - expressing plasmid showed faster growth than the wild - type strain without the plasmid, and the growth rate of the strain was increased when 1.0 mM was added in the case of high IPTG addition. That is, when TA4 enzyme is present, homoserine is used as a nitrogen source for cell growth.

9 is a result of comparing the amino acid sequence of the TA4 enzyme with the aspartic acid amino acid transferase (PDB ID: 1 ASM) present in E. coli.

10 shows the structure of TA4 through homology modeling using the crystal structure of E. coli aspartic acid amino acid transferase (PDB ID: 1 ASM) as a template, and the PYM0L viewer (http: // www. org), respectively.

FIG. 11 shows four amino acids (I lel7, Gly38, Asnl94, Arg386) which are interacting with carboxylic acid (carboxylic acid of aspartic acid residue) of maleic acid in E. coli aspartic acid amino acid transferase (1ASM) , And the TA4 model structure as compared with that of the aspartic acid residue in the TA4 enzyme

(Lysl4, Gly40 Asnl78, Try364), which are expected to interact with carboxylic acids.

Fig. 12 shows the activity of mutant enzymes TA4-1 to TA4-6. TA4-1 had Y364Q, TA4-2 had N174D amino acid sequence variation and showed high activity. TA4-6 was the enzyme with TA4-1 and TA4-2 mutations and showed the highest activity of 20 U / mg protein.

FIG. 13 shows the results of analysis of enzymatic activity of the eight LDH enzymes shown in Table 9 using pyruvate and 0HB as substrates.

14 shows a three-dimensional structure of Ae_ldhA by homology modeling using a crystal structure (PDB ID: 2G8Y) of E. coli lactate dehydrogenase as a template As a result, the Ae_ldhA model was constructed using Molecular Operating Environment (M0E), and evaluated using the PROCHECK and ProSA online structure analysis and the protein structure identified using the PYM0L viewer (http: // www. Pymol.org) will be.

FIG. 15A shows the structure of the skin leucine and HOB structure (Pubchem Database) for the Ae_ldhA mutant design by performing a docking simulation using the triangular matching method at the enzyme active site of Ae_ld l, And skin lean acid.

FIG. 15B shows the result of examining the interaction between amino acid residues of the enzyme and HOB using a docking simulation.

16 shows the activity of the Ae_ldhA mutant enzyme obtained by site-directed mutagenesis and the results of measurement of the degree of oxidation of NADH observed at 340 nm absorbance. The activity of the mutant enzyme was shown to be relative to the activity of the wild enzyme. The specific activity (1 U) of the enzyme was defined as the amount of enzyme required to oxidize 1 μηη 1 of NADH to NAD for 1 min.

17 shows the results of analysis of the (D) -lactate dehydrogenase enzyme activity in the nine strains shown in Table 12 using pyruvate and 0HB as substrates. FIG. 18 shows the amino acid residues to be engineered using the crystal structure of the Lb-LDH enzyme shown in the PDB databank.

19 shows the activity of the mutant enzyme of the OHB D-reductase enzyme measured by measuring the degree of oxidation of NADH at an absorbance of 340 nm. The specific activity (1 U) of the enzyme was determined by adding 1 μM NADH to NAD + As the amount of enzyme required to oxidize. The activity of the mutant enzyme was shown to be relative to the activity of the wild enzyme.

20A shows the structure of a biosynthetic gene acting on a DXP-dependent pathway in which PLP is biosynthesized in E. coli.

20B shows a biosynthetic pathway of DXP-dependent pathway in which PLP is biosynthesized in E. coli. Abbreviations for metabolites are as follows. G6P; glucose-6-phosphate; E4P, erythrose-4-phosphate, GA3P, glutamic acid dehyde-3- phosphate; 4PE, 4-phospho-D-erythronate; 3P4K, 3Phoxy ᅳ 4 pho s phohydr oxy- alpha-ketobutyrate; 4PT, 4 ᅳ phosphohydroxy ᅳ L ᅳ threonine; 2A3B, 3 ᅳ hydroxy ᅳ lamin, acetone phosphate; DXS, deoxyxylulose-5-phosphate. Italic indicates the enzyme name: EPD, erythrose-4-phosphate dehydrogenase; PdxB, 4-phospho-D-erythronate; SerC, 3-phosphoserine ine aminotransferases; PdxA, 4-phosphohydroxy-L-threonine dehydrogenase; PdxJ, PNP synthase; Dxs, 1-deoxyxylulose 5-phosphate synthase, PdhH, PNP oxidase.

Fig. 21 shows the plasmid map used for producing L-form DHB, TA4-1 as transaminase, and ldh-2 and ldh-8 as lactase dehydrogenase, respectively.

22 shows the results of the production of L-DHB by flask culture and the concentration of DHB produced after incubation of EcW20 (pDHB-L) strain in which recombinant pBAD_TA4-l_LDH2 (pDHB-L) plasmid was introduced at various arabinose concentrations / L) was measured. 'Control' represents the EcW20 strain which does not have the pBAD_TA4-I_LDH2 (pDHB-L) plasmid.

23 shows the concentration (g / L) of DNB produced after culturing the EcW20 (pDHB_D) strain in which recombinant pBAD_TA4-l_LDH8 (pDHB-D) plasmid was introduced at various arabinose concentrations as a result of D-DHB production through flask culture ) Were measured. 'Control' represents an EcW20 strain that does not have the pBAD_TA4-l_LDH8 (pDHB-D) plasmid.

FIG. 24A shows the results of a flow-through bioassay of EcW20 (pDHB-L) strain for the production of L-form 2, 4-dihydroxybutyric acid.

24B shows the results of a flow-through biotite assay of the EcW20 (pDHB-D) strain for the production of D-form 2, 4-dihydroxybutyric acid.

Figure 25 shows the pACYC_Ponl plasmid map expressing lactonase necessary to convert 2,4-dihydroxybutyr ic acid to HGBL. And (G3C9) genes were expressed by the tac promoter, and the produced proteins were designed to have the necessary lead sequence to move to the cell membrane.

FIG. 26A shows a two-stage bioreactor culture for the production of L-DHB and HGBL As a result, the amount of 2, 4-DHB and HGBL produced and biomass of L-form, which are produced with time in the case of using glucose as a substrate, are shown.

FIG. 26B shows the result of D-form 2, 4-DHB and HGBL production with time as a result of the biotransformant culture for the production of D-DHB and HGBL, . The yield of D-HGBL was very low, below 0.1 g / L, because the activity of Ponl enzyme was very low for 2,4-DHB.

DETAILED DESCRIPTION OF THE INVENTION

A novel biosynthetic pathway consisting of three steps of biosynthesis of 2-hydroxy gamma butyrolactone from homoserine was proposed in FIG. Specifically, the reaction of each step is as follows.

Step 1: Removal of alpha position amine from homoserine

Step 2: Reduction reaction (oxygen reduction bound to carbon # 2)

Step 3: Lactoni zat ion

The first reaction may be catalyzed by a homoserine ine deaminase or a homoserine transaminase enzyme, and the homoserine diamine-catalyzed reaction is shown in FIG. 2

And the reaction by homoserine transaminase was shown in FIG. 3, respectively.

As an enzyme that removes the alpha-position amine group of the amino acid shown in FIG. 2, glutamate having high activity on glutamate

Glutamate deaminase (dehydrogenase), and

Serine deaminase, which shows high activity in serine, and amino acid oxidase, which is very active but slightly active in many other amino acids, can be used. These enzymes can be used directly or after being mutated to have high activity.

In the transaminat ion reaction shown in Fig. 3, the mutant alanine aminotransferase prepared to have activity against homoserine ine Similar amino transferases can be used. Also

Amino acceptors that receive an amino group from homoser ine include a-ketoglutarate

(α-KG / glutamic acid pair is most widely used for this purpose in the transaminase reaction), oHCG, which is an amino acceptor from glutamic acid produced from α-KG, is regenerated and homoserine ine biosynthesis It is desirable to use aspartate transaminase for the production of the precursor aspartic acid.

As the enzyme of the second step reaction shown in Fig. 1, L-lactate

dehydrogenase and D-lactate dehydrogenase can be used. Depending on the enzyme used, the hydroxy group is bound to the 2-position carbon in the (R) or (S) form and the structure of the 2-hydroxy gamma butyrolactone

(R) or (S) -form isomer is obtained.

The paraoxonase shown in FIG. 1 can be used by mutating a gene (P0N1) having a lactonase activity from a human, and it is preferable to express it in a non-cytoplasmic periplasm since P0N1 is reversible and lactone can be produced only at an acidic pH.

In order to efficiently produce 2-hydroxy gamma butyrolactone and its organic acid precursor from homoserine in the pathway shown in FIG. 1, it is necessary to develop a gene-mutant microorganism that efficiently produces homoserine ine from glucose as shown in FIG. As this microorganism, Escherichia coli can be preferentially used, but various microorganisms such as yeast, Corynebacterium can be used. These host cells can be modified by using the following methods individually or in combination.

1. overexpression of the phosphoenol pyruvate carboxylase ippc gene, which efficiently converts phosphoenol pyruvate (PEP) to oxaloacetic acid (0AA);

2. overexpression of acetyl-CoA synthase iacc gene which helps convert microorganisms into acetyl-CoA during fermentation;

3. To increase the activity of glyoxylate shunt, glyoxylate shunt gene Removal of the / c / gene to suppress expression;

Overexpression of aspartate transaminase to increase the conversion efficiency of oxaloacetate to asprtic acid;

5. Improve the activity of apspartate kinase to increase aspartyl phosphate conversion efficiency of Apspart ic acid. iAr ¾ coding for apspartate kinase: functioning by isoleucine to improve gene expression

Removes operon riboswitches and boosts promoter strength. Further, the apspartate kinase enzyme is allowed to express the mutated enzyme to prevent feedback inhibition by threonine and lysine;

6. coding for diaminopimelate dcarboxylase to remove lysine production / remove ya4;

7. Homoserine to eliminate methionine production

succinyl trans ferase-9-coding the met A gene;

8. Remove the gene encoding homoserine kinase so that homoserine produced is not converted to homoserine phosphate.

In order to convert homoserine to 4-hydroxy-2-oxo-butanoic acid (HOB) when the homoserine production is activated, the deaminase enzyme shown in Fig. 2 or the gene encoding the transaminase enzyme shown in Fig. 3

Expressionist! Furthermore, it is recommended to use a strain that has enhanced the vitamine B6 biosynthetic pathway to promote the biosynthesis of pyridoxal 1 -5 '-phosphate (a kind of vitamin B6), a cofactor of transaminase.

Furthermore, strains engineered to efficiently biosynthesize HOB from homoserine can produce 2,4-dihydroxy-butanoic acid (dHBA) and 2-hydroxy gamma butyrolactone (HGBL) by additionally expressing homoserine dehydrogenase and / or P0N1. In general, biologic reactions that convert dHBA to HGBL using P0N1 all are less efficient, so dHBA

Biologically produced, purified and chemically converted to HGBL. In this case, it is preferable to overexpress the membrane transfer protein of dHBA in order to rapidly secrete the dHBA produced in the microorganism out of the cell.

Thus, the homoserine biosynthetic pathway suggested in Fig. When the homozygous transformation of the proposed homoserine in FIG. 1 is performed, a microorganism that has been engineered to produce dHBA or HGBL can be cultured as a main carbon source to produce dHBA and HGBL as target products. In order to efficiently cultivate the microorganism and efficiently produce the desired product, yeast extract and ammonium salt are added to the culture medium as a nitrogen source, and the amino acid,

methionine, lysine, threonine, and isoleucine. In addition, in the high-concentration production using the biological repulse, the sugar and the amino acid mixture are appropriately added in the middle of fermentation

desirable.

FIG. 4 schematically shows a strategy for producing a large amount of homoserine using glucose, and a strategy for biosynthesis of 2-hydroxy gamma butyrolactone and its precursor, 2,4-dihydroxybutanoic acid. In Fig. 4, the green arrow indicates the antagonism to be strengthened, the red arrow indicates the mechanism of inhibiting enzyme production or enzymatic activity, the apricot X mark indicates the elimination or elimination of the repelling antagonist, .

Hereinafter, specific examples will be described. The present invention is not limited by the following examples.

Example 1: Production of homoserine-producing strain

(1) The homoserine pathway is known to synthesize aspartate amino acids. To increase the accumulation of homoserine, lysine, methionine (met) and threonine (thr) production pathways were removed. Specifically, the last step of lysine biosynthesis, namely, lysA encoding diaminopimelate decarboxylase, metA encoding homoserinesuccinyl transferase, and homoserine kinase (homoserine kinase) ) And thrB (threonine synthase encoding) (Table 1).

(2) The ldhA, adhE and pflB genes were also removed to prevent the production of by-products such as lactic acid, ethanol, and formic acid. By removing these genes, we intended to increase the carbon flux to homoserine by preventing the formation of by-products. (3) Next, expression of the acs gene was increased to minimize the production of acetic acid. To increase the expression of Acs, the acs expression gene promoter was changed to the trc promoter.

(4) As a method for promoting acetyl reuse, a negative regulator gene was removed by pop-in pop-out method to enhance the activity of glyoxylate shunt.

(5) Expression of the ppc gene encoding phosphoenol pyruvate carboxylase, which is the key enzyme of the anapl erotic pathway, to inhibit acetate formation and improve the carbon flux to homoserine in the synthetic promoter 8 (SP8) (SEQ ID NO: 23) mcMmMTCATCCG (TCGTATMTGTGTGGA). For this purpose, the promoter of the ppc gene was replaced with the synthetic promoter 8 by the pop-in pop-out method.

(6) The ptsG gene was removed by the MAGE method in order to eliminate the overflow metabolism of glucose metabolism and to prevent the use of phosphoenol pyruvate (PEP) for glucose cell membrane transport. In this case, glucose is transported into cells by other transport proteins such as GalP, and prevention of Carbon Cat abolite repression and prevention of by-product formation by overflow metabolism can be expected.

(7) In order to raise the carbon flux to oxaloacetate in the corresponding pathway using the EMP pathway, the ED pathway was deleted by deletion of the eda gene coding for KHG / KDG aldolase. MAGE method was used.

(8) Finally, we optimized the pathway after aspartic acid, known as the bottleneck of the homoserine production pathway. Three homologous aspartate kinases AKI, AKII and AKIII are known to play an important role in homoserine production. Only two enzymes, AKII and ΑΚΠΙ, exhibit superior activity at high homoserine concentrations. It is also known that ΑΚΠ among ΑΚΠ and ΑΚΙΠ have aspartate kinase and serine dehydrogenase activity, which is more advantageous than ΑΚΙΠ. Therefore, in this strain development, metL gene coding for ΑΚΠ enzyme was overexpressed using pUCPK plasmid, a medium copy plasmid. Two types of lac promoter and trc promoter were used to control metL ^ \ expression size. In Table 1 below, competing pathway genes for deletion, substitution or overexpression, and methods for elimination and removal of homoserine were shown.

[Table 1]

Escherichia coli W3110 strain and BL2KDE3) were purchased from Korean Collection for Type Cultures (KCTC). Escherichia coli TOPIO strain is a plasmid cloning and maintenance. Multiplex automated genome engineering (MAGE) and pop-in pop-out methods were used for gene deletion. The present inventors developed a mutant E. coli Homoserine and production ^■ Note the type shown in Table 2 below.

[Table 2]

Dielectric isolation kit was purchased from Promega (Madison, WI, USA). High-f idelity pfu-a polymerase was purchased from Invitrogen (Seoul, Korea). DNA cleavage enzymes and DNA enhancers were obtained from New England Bio-LAb (Beverly, Mass., USA). Miniprep and DNA gel extraction kit were purchased from Cosmotech (Seoul, Korea). The primers used for gene amplification were synthesized in Macrogene (Seoul, Korea). Yeast extract, tryptone, trip case soy broth, and peptone were purchased from Difco (Bee ton-Dickinson, NJ, USA). All other reagents and enzymes were purchased from Sigma-Aldrich (St. Louis, MO, USA).

1-1 Gene deletion and substitution using MAGE method

MAGE (Multiplex Automated Genome Engineering) method is very powerful to in vivo genome editing. In this method, single-stranded DNA (ssDNA) corresponding to the target chromosome is directly introduced into the strain to be engineered. If you are targeting multiple sites, you may also be able to mock different kinds of ssDNA either simultaneously or sequentially.

In this experiment, beta- protein, which plays a role of recombinase, was introduced into pSIM5 plasmid and inserted into E. coli by electroporation method. The synthetic ssDNA oligos were constructed so that a homology arm, 5 '-terminal homolgy arm and 3' terminal homology arm, overlap with the target gene sequence to be deleted (Table 3). Oligos with chromosomal homology within the cell bind to the lagging strand of the target gene during chromosome replication and cause mutation in the target gene through homologous recombinat ion.

For MAGE experiments, single colonies were grown in agar solid medium and cultured in LB + Qn medium for 12 hours at 30 ° C. Then, 100 microliter of this culture was transferred to new LB + Cm medium and cultured at 30 ° C. until it reached 0.6 OD (600 nm). The culture tube was then left at 42 ° C for 15 minutes and then placed in ice water for 30 minutes. The competent cells were centrifuged at 4 ^° C and 5000 rpm for 10 min and washed three times with cold distilled water. The cell pellet was suspended in 100 mL of 10% glycerol solution. Then, 50 μM of ssDNA oligo was mixed with the cell suspension, placed in an elctro cuvette and electroporated. Then, the resulting suspension was transferred to a culture tube, and 5 mL of LB was added thereto and cultured at 30 ° C. for 3 hours (first cycle). Such The procedure was repeated 6-10 times (6-10 cycles) and 100 uL of cell culture was plated on agar platel and incubated overnight. The generated colonies were screened by PCR method and mutant strains deficient in the genes were identified and secured.

Table 3 below shows the types of primers used for gene removal or cloning.

[Table 3]

Apta_FP gacca cgtcagccttggcgtgatccgtgcaatggaacgcaaaTAActcagccgcgtaccggtggcg

34 atgcgcccgatcagactacg

Apta_RP cgtagtctgatcgggcgcatcgccaccggtacgcggctgagTTAtttgcgttccattgcacggatca

35 cgccaaggctgacgctggtc

ᅀ pta-seq Ggcgt t cgtctgagcgt tttc 36 _FP

Apta_seq Ggattcttgcagcttcgcc

37 _RP

AackA_FP gaaatttgccatcatcgatgcagtaaatggtgaagagtaccttTGAaagcacgtatcaaatggaaaa

38 t gacggcaat aaacaggaagc

ᅀ ackA 1 RP gcttcctgtttattgccgtccattttccatttgatacgtgcttTCAaaggtactcttcaccatttac

39 tgcatcgatgatggcaaatttc

AackA_se Tctggtttagccgaatgtttcc

40 q_FP

AackA_se Atgt cagttcttctaccgg

41 q_RP

AldhA_RP gcaacaggtgaacgagt cctt tggctttgagct gaat tttt tTAActgccaatggctgcgaagcgg

42 tatgattattcgtaaacgatg

AldhA_se Tt t tccggtgtcagcggg

43 q_FP

AldhA-se Gactttctgctgacgg

44 q_RP

AadhE_RP gtaaaaaaagcccagcgtgaatatgccagtttcactcaagagcaaTAAct ctgcagatgctcgaat

45 cccactcgcgaaaatggccgttg

ᅀ adhE_se Ggagc tgtat gcggc ttt aac

46 q_FP

AadhE_se Gtagacaaaatcttccgcgccg

47 q_RP

ApflB_RP ccaaaggtgactggcagaatgaagtaaacgtccgtgacttcattTAAagtccttcctggctggcgct

48 actgaagcgaccaccaccctg ApflB_se Tgcagagaagtgaactgtgcc

49 q_FP

ApflB_se Cagaaaaactacactccgtacg

50 q_RP

ᅀ iclR- FP Cccggcttgttgcgccagttccgtgagtgccacactgccattcagccacgcgttaaagactgaacct

51 gtccagtcgctggtgcggtggc

ᅀ iclR_RP Gccaccgcaccagcgactggacaggttcagtctttaacgcgtggctgaatggcagtgtggcactcac

52 ggaactggcgcaacaagccggg

AiclR_se Gcgcgtttgggcgagatc

53 q_FP

ᅀ iclR_se Ctgaaattactggagtgg

54 q_RP

Alysa_FP ggctttctgtgcaaagcgcaccacatcaaactgtttcagcgctgTTAgacccacaccgggcagccaa

55 attcagcgggcaaacgcagcag

Alysa_RP ctgctgcgtttgcccgctgaatttggctgcccggtgtgggtcTAAcagcgctgaaacagtttgatgt

56 ggtgcgct t tgcacagaaagcc

ᅀ lysA_se Cctgtt ccagatgggcat aat c

57 q_FP

Mace-se. Gggtctacgat cgcaaat tattcg

58 q_RP

AthrB_RP cttatcggcaaagcgtccgaggttgttgagactgaatgtctctgTTAtgcaccatcaacaggtgtca

59 ccgccgccccgagcacatcaaac

AthrB_se Tt get cggagatgt agtcacgg

60 q_FP

ᅀ thrB-se Gcgat actgcgccggtaaaat ag

61 q_RP

AmetA_FP Gaagaaaacgtctttgtgatgacaacttctcgtgcgtctggttaattaacctgatgccgaagaagat

62 tgaaactgaaaatcagtttctg

AmetA_RP Cagaaactgattttcagtttcaatcttcttcggcatcaggttaattaaccagacgcacgagaagttg

63 tcatcacaaagacgttttcttc AmetA_se Ctggt caggaaat t cgt ccac

64 q_FP

AmetA_se Cgaatcaacgctgccggaaag

65 q_RP

AlacI_RP cttatcagaccgtt tcccgcgtggtgaaccaggccagccacgttTGAcgatggcggagctgaattac 66 attcccaaccgcgtggcacaac

Alacl_se Gatatttatgccagccagcc 67 q_FP

ᅀ lacl_se Ccacgt 11 c t gcgaaaacgcggg 68 q_RP

Primer for gene deletion using Pop-in Pop-out method

US-Ptrc-acs- gtttaatcggtacccggggatcgcggccgccgcgcccttcctgccagtcaattttc 69 FP

US-Ptrc-acs- Cttttaagaaggagatatacatatgagccaaattcacaaacacacc

70 RP

Ptrc-acs-FP Ggtgtgtttgtgaatttggctcatatgtatatctccttcttaaaag 71

Ptrc-acs-RP Cggcgtgcgtttatttttatccttgtcatcgactgcacggtgcaccaatgc 72

DS-Ptrc-acs- Gcattggtgcaccgtgcagtcgatgacaaggataaaaataaacgcacgccg

73 FP

DS-Ptrc-acs- Gggcgcgcgccat tct ccggt cgactctagat catgccgt catcccac

74 RP

US-ldhA-FP At cgcggccgc tgtctgtttt cggt c 75

US-ldhA-RP Ctggagaaagtcttatgtaatcttgccgctcccc 76

DS-ldhA-FP Ggggagcggcaagattacataagactttctccag 77

DS-ldhA-RP Ct agaggatcccaagcagaat caagt tctaccg 78

Gn-ldhA-FP Gatggtacggcgattgggatg 79

Gn-ldhA-RP Gccagggagaaaaaaatcag 80

US-iclR-FP Ctgcgcggacgctgaggatcccggtgatcccgtcctctcacg 81

US-iclR-RP Ttcgaaccccagagtcccgcctgccgctcgtaggtcctg 82

DS-iclR-FP Gcaggacct acgagcggcaggcgggac t ctggggt t cgaaatg 83 DS-iclR-RP Tgcctgcaggtcgactctagattatttgttaactgttaattgtccttgttc 84

Gn-iclR-FP Ctgaacagcaggtcgtcc 85

Gn-iclR-RP Gcgtcgaaaccttcgatg 86

1-2. To remove the gene deletion or gene replacement ldhA and iclR genes by the pop-in pop-out method, the pKOV plasmid with sacB-Km cassette was used (Table 4). Specifically, a fragment with an upstream and downstream region of 600-700 bp of the target gene was amplified by PCR using the corresponding primers from the E. coli W3110 chromosome (Table 3). The sequence of this fragment was inserted into the pKOV plasmid using the early Gene Art Seamless Cloning and Assembly Kit (Invitrogen, USA). Then, recombinant pKOV lasmid was introduced into E. coli 3110, and the corresponding gene was deleted by homology recombination. The pKOV plasmid was removed through sugar culture. Finally, we screened by PCR method and identified mutant strains in which genes were deleted.

1-3. Plasmid production used in gene manipulation

Plasmids used for gene deletion, promoter substitution, gene overexpression by pop-in pop-out or MAGE method are shown in Table 4 below. In order to construct a recombinant plasmid, open reading frame (0RF) of the target gene was amplified by PCR using the appropriate primer (Table 3). Thus cutting the resulting DNA fragment with a restriction enzyme cloning was the plasmid, or the like that is pUCPK, _P ET-T7p, pBbAlk, _P Trc-99a. This plasmid was then introduced into the corresponding host strain.

[Table 4]

Plasmid Description Source

Overexpression, trc promoter, medium copy, K50, T50 promoter, high copy, T50 promoter, high copy, pSIM5 MAGE, β recombinant protein, Cm25 Addgene, USA pUCPK Overexpression, lac promoter, Addgene, USA pTrc-99a Overexpression, trc promoter, low copy, K50 Addgene, USA pKOV Pop ^" in-Pop out, Cm25 Addgene, USA p iCPK-wetl Ptrc-metL Thi s study

1-4. Production and activity measurement of synthetic promoter library used for gene expression

A number of promoters were used to enhance or control gene expression. In the case of the promoter having the same sequence, the gene instability was greatly increased, and a library of synthetically promoters of different sequences was constructed (Table 5). And their relative activities were measured using GFP (Fig. 5). A total of 9 promoters were synthesized and selected, and their activities ranged from about 4 times.

[Table 5]

Example 2: Screening of transaminate (TA) enzyme for the removal of amino group of homoserine and production of mutant enzyme

2-1. Screening of transaminate (TA) enzymes

Securing enzyme

Transaminate (TA) enzymes play an important role in life and have been studied extensively for a long time, but the TA enzyme specific for homoserine ine has not yet been revealed in vivo. In general, many enzymes 17 of the known TA enzymes, aspartate transaminase, alanine transaminase, branched chain transaminase, and aromatic transaminase, were selected for activity against homoserine (Table 6). These enzymes were obtained from E. coli, Enterobacter spp., Baci 1 lus subtilis, Mesorhizobium loti, Agrobacterium tumefaciens, Pseudomonas denitri ficans, P. puti da and P. // i / oresce2s ^'

asp aspatate P. AGI228 F:

AT transaminase denitrific 91.1 t tcagaat t caaaagat ctttt aagaaggagat at 124

.ans acatatgctcggacccggcg

tcgagtttggatcctcagcgattctggtgcgcg 125 aro acromat ic P. AGI229 F:

AT transaminase denitrific 71.1 gtggtggtggtggtggtgctcgagcagtttcaggc 126 ans gcagcgc

R:

aacttt aagaaggagat at acatatgatgagcaag 127 ttctggagtccc

aro acromat ic P. AUM683 F:

AT transaminase fluorescen 13.1 gtggtggtggtggtggtgctcgaggagttcgccga 128 s gggc

R:

act tt aagaaggagat at acat at gat gagtaaat 129 tctggagcccg production of enzymes

E. coli BL2KDE3) expresses the enzyme of Table 6 in the host. LB medium was used and kanamycin 50 mg / L was used for the maintenance and preservation of plasmids. PET as an expression vector and T7 as a promoter. For the TA gene cloning, the coding sequence was amplified from the genomic DNA of the microorganism, cloned into the E. coli Top 10 strain using the seamless cloning and assembly kit (Invitrogen) with the pET vector containing His-tag Respectively. The plasmids were named pET / TAi (i = 1-17) according to the type of TA gene obtained. Sequence was confirmed (Macrogen, Seoul Korea) and introduced into E. coli BL21 (DE3), an enzyme producing strain.

[Table τ_

Gene Enzyme Source Acc. No. pET / TAi aspAT Aspatate transaminase M. loti ANN59010.1 ΓΑ1 aspAT Aspatate transaminase M. loti ANN57047.1 ΓΑ2 asp AT Aspatate transaminase A. tumefaciens ACM26415.1 ΓΑ3 aspAT Aspatate transaminase B. subtilis AQR85543.1 ΓΑ4 aspAT Aspatate transaminase E. coli AVI 55449.1 ΓΑ5 bcAT branched chain D. McCarty AQY72500. 1 ΓΑ6

transaminase

bcAT branched chain E. coli AVI53929.1 ΓΑ7

transaminase

bcAT branched chain E. spp A0L13801.1 ΓΑ8

transaminase

aroAT acromat ic transaminase E. coli AUV21492.1 ΓΑ9 aroAT acromat ic transaminase E. coli AVI54196.1 TA10 alaAT alanine transaminase P. den i tr i cans AGI 22743.1 TA11 alaAT alanine transaminase P. puti da AE015451.2 TA12 alaC alanine transaminase E. coli AAN66442.1 TA13 alanine transaminase E. coli AAN66442.1 TA14

A140P-Y275D

aspAT 'aspatate transaminase P. denitr ficans AGI22891.1 TA15 aroAT acromat ic transaminase P. den i tr ifi cans AGI 22971.1 TA16 aroAT acromat ic transaminase P. fluorescens AUM68313.1 TA17 The recombinant strain producing TA for enzyme production is 50 and cultured in LB medium containing mg / L kanamycin. Liquid volume 20 mL, 250 mL flasks were used and cultured at 20 ^° C and 200 rpm. When the cell concentration reached 0.6 OD (600 nm), 0.1 mM IPTG was added to the inducer and then further cultured for 10 hours. The cells were then centrifuged (10,000 g, 10 min), washed with 100 mM phosphate buffer solution (pH 7.0) and the binding complete solution (20 mM Phosphate buffer solution, 0.5 M NaCl, 20 mM imidazole). Then, the cells were disrupted with a sonicator and centrifuged to remove the unfragmented portion and solids, and the collected solution was used for protein analysis using cell activity and SDS-PAGE.

The pure separation of the enzyme was carried out on a Ni-NTA-HP resin packing column (17-5248-01; GE

Healthcare, Sweden). The fraction of the microbial crushing solution obtained was collected and purified in a column to obtain an enzyme solution. After that, dialysis was performed using a 10 kDa cut-off membrane to remove salts contained in the solution. The resulting enzyme was electrophoresed under denaturing black non-naturing conditions (FIGS. 6A and 6B). Then, glycerol was added at 20% and stored at -80 ^° C.

Enzyme activity measurement

Activity against homoserine was measured using pyruvate and 2-oxoglutarate as amine acceptors, respectively:

(i) Homoserine + pyruvate 2-oxo-4-hydroxybutyrate acid + domain

(ii) Homoserine + 2-oxoglutarate <- 2_oxo_4 ᅳ hydroxybutyr ic acid + glutamate

Enzyme activity could be measured by production of alanine or glutamate as a product or consumption of pyruvate, 2-oxoglutarate as a reactant. When all enzymes were used to receive 2-oxoglutarate, the enzyme activity was not observed. Therefore, the TA activity was investigated using the reaction of (i), pyruvate. The product, alanine, was determined by HPLC after being modified with 0PA.

TA activity was measured using a 50 mM phosphate buffer solution (pH 7.0), 0.1 mM cofactor pyridoxal phosphate (PLP), 10 mM homoserine, and an appropriate amount of TA enzyme. The solution was incubated at 37 ° C for about 5 minutes and then added with 10 mM pyruvate. After 10 minutes of reaction, 12 mM perchloric acid was added to stop the reaction and centrifuged at 10,000 g for 5 minutes. A 5 μL sample was then taken to obtain 12.5 μ! OPA solution (25 mg OPA, 50 yL 2-mercaptoethanol, pH 9.5 0.5 mM saturated sodium borate solution, 4.5 mL methanol) was incubated at room temperature and filtered. The alanine modified by 0PA was quantitatively analyzed by HPLC on a Zorbax eclipse XBD-C18 column. The alanine derivative modified with 0PA had a retention time of 10.5 minutes and was analyzed with a 338 nm DAD detector. Protein quantification was performed by Bradford method using bovine serum albumin as standard. The analysis was performed 3 times and the mean value was shown.

According to Fig. 6A, four types of TAl, TA2, TA3, and TA6 were produced in insoluble form, and thus were not used for activity measurement. Of the other enzymes, only 5 (TA4, TA5, TA10, TA11, TA15) showed activity against homoserine. These were purified by affinity chromatography to determine their activity (FIG. 7A). TA4 showed the highest activity, i.e., 3 U / mg protein.

2-2 Enzyme engineering of TA4

Since TA4 enzyme showed the highest activity, this enzyme was mutated to obtain an enzyme with increased activity. First, a mutant enzyme library was constructed and highly active enzyme mutants were obtained using high throughput screening (HTS) method related to cell growth.

Development and investigation of Reporter strain

Homoserine transaminase converts pyruvate to alanine, and alanine amino group is used to produce other amino acids by alanine transaminase. That is, homoserine can be used as the only source of nitrogen for cell growth, and the rate of cell growth in this case can vary depending on the activity of the homoserine transaminase that we are developing.

To investigate this strategy, E. coli BL21 (DE3) strains harboring pET-TA4 gene recombinant plasmids were cultured with different IPTG concentrations (FIG. 8). The expression of the TA4 gene is regulated by the T7 promoter and the activity of the TA4 enzyme can be regulated by the IPTG concentration. M9 minimal medium with no nitrogen source 10 mM homoserine as a nitrogen source, and a small amount (0.5 mM) of threonine and methionine were added to induce microbial growth, respectively. As shown in FIG. 8, the recombinant strain having the TA4 enzyme exhibited a high growth rate, and the degree was most apparent when the IPTG content was high, for example, at 1.0 mM. That is, it was confirmed that homoserine TA can be screened through a strain using homoserine as a nitrogen source.

TA4 enzyme library production

The 3D structure of TA4 was constructed by homology modeling using the crystal structure of E. coli aspartic acid amino acid transferase (PDB ID: 1 ASM) as a template. The structure and sequence of the 1ASM can be found at https: // www. Refer to rcsb.org/structure/lASM. 1ASM structure has pyruvate phosphodiester (p _yr idoxal-5 '-phosphate (PLP) as coenzyme and maleic acid as substrate analogue. This model was created using MOE (Molecular Operating Environment) and evaluated through PROCHECK and ProSA online structure analysis. The protein structure was confirmed using a PYM0L viewer (http://www.pymo 1. org) (FIG. 10).

Was from 1ASM structure confirmed acid (aspartic acid residue of a carboxylic acid) and the cross-four amino acids (I lel7, Gly38, Asnl94, Ar g 386) that the action of maleic acid, aspartic acid via the eu TA4 model structure Four amino acids (Lysl4, Gly40, Asnl78, Try364) expected to interact with the carboxylic acid of the residue were selected (Fig. 11).

Using the information in FIG. 10 and FIG. 11, the TA4 enzyme mutant libary was constructed. TA4 library was constructed by randomly modifying four amino acids of TA4 (Lysl4, Gly40, Asnl78, Try364) expected to interact with the carboxylic acid of aspartic acid residues by means of the assemble PCR method. In this case, we used the _P ET30b / TA4 plasmid as a template, the primers used are shown in Table 8. eu. Using the restriction enzyme Xbal and Xhol sites, the PCR products from primers 1 and 2 were cloned into a pET30b plasmid. The resulting TA4 library was transformed with E. coli E ⁾ 10 and the plasmid And purified. Table 8 below shows the primer sequences used in the construction of the TA4 mutant enzyme library.

The meanings of the letters m, n, k among the primer sequences shown below are as follows.

m: a (Adenine, adenine) or c (Cytosine, cytosine)

n: a (adenine, adenine) or g (guanine, guanine) or c (cytosine, cytosine) or t (thymine, thymine)

k: g (guanine, guanine) or t (thymine, thymine)

[Table 8]

TA4 enzyme library screening and excellent enzyme development

The prepared library was transformed with E. coli BL2 DE3) and then cultured overnight in 50 mL of LB medium. After the cell pellet was centrifuged, it was washed 3 times with 100 mM phosphate buffer solution, and then inoculated to 0 M 0.05 minimal medium (including 50 um / mL kanamycin) with 20 mM homoserine as a nitrogen source. after. After culturing at 37 rpm for 3 hours at 200 rpm, TA4 enzyme was induced by adding 0.05 mM IPTG. When the 0D value reached 0.5, the culture was diluted 100-fold and then re-cultured. Such a culture-dilution cycle was repeated 10 times After repetition, the culture was spread on an LB agar medium containing 50 ug / mL kanamycin, and 50 colonies were grown on a well grown M9 medium. A total of five mutants were obtained from these gene sequences and named TA4-1 to TA4-5, respectively.

Next, the obtained enzyme was purified by affinity chromatography. Finally, two TA4 variants (TA4-1 and TA4-2) showed high activity, and TA4-1 was 5 times more abundant than the wildtype High 15 U / mg protein activity. TA4-1 has Y364Q and TA4-2 has amino acid sequence variation of N178D (Fig. 12). These results demonstrate the importance of sites that interact with homoserine, with the results obtained through model ling, that Y364 and N178 are well aligned with N194 and R386 of 1ASM.

Next, TA4-6 enzyme with both TA4-1 and TA4-2 enzyme mutations was constructed by site-directed mutagenesis. TA4-6 enzyme showed the highest activity, 20 U / mg protein.

In the subsequent experiments, the most active TA4-1 and TA4-6 variants were used. Example 3: Screening and mutagenesis of (2S) -L-reductase enzyme of 2-Qxo-4-hydoxybutyric acid (0HB)

3-1. Screening of 0HB L-reductase enzyme

0HB L-reductase enzyme assurance

OH is converted to 2,4-dihydroxy butyric acid (DHB) with a L (2S) or D (2R) hydroxy group at position 2 when reduced to a prochiral compound. The 0HB reductase belongs to 2-hydroxy acid dehydrogenase, including lactate dehydrogenase (EC1.1.1.27, EC1.1.1.28), ma late dehydrogenase (EC1.1.37, EC1.1.82, EC1.1.299) And branched chain (D), (L) -2-hydroxyacid dehydrogenase (ECl.ll 272, ECl.1.1.345) are well known. First, the activity of 0HB is expected to be high from Alcaligenes eutrophus H16, Cupriavidus basi lensis, Achromobacter xylosoxidans, Burkholderiaglumae, Escherichia fergusonii, Escherichia coli, Lactobaci 1 lusmali and Escherichia coli K-12 to produce L-form isomer (L) -lactate dehydrogenase enzymes were selected (Table 9). (L) -l actate dehydrogenase candidate enzymes for OHB 2S reductase enzyme screening are shown in Table 9.

[Table 9]

Gene Source Acc. Pr primer sequence (FP / RP) sequence

0. Number l act ate dehdydr Alcal ige YP 725 ATAACATATGAAGATCTCCCTCACCAGCGC 140 ogemses i IdhO) nes 182. 1 TAATAGGATCCTCAGTGATGGTGATGGTGATGGGCCG 141 eutrophu TGGGGACGGCCACGTTG

s (Ae)

ma l ate / L- Cupriavi WP 043 ATAACATATGAAGATAACACTGCAATC 142 l actate dehydro dus 344208. 1 TAATAGGATCCTCAGTGGTGATGATGGTGATGGCCCG 143 genase (1 dh ᅳ 2) basil lens CCGGCAGTGCCACGCCAAGTTC

is (Cb)

mal ate / L- Achromob WP 006 ATAACATATGAAGATCTCCATTACCCAAG. 144 l actate dehydroacter 389860. 1 TAATAGGATCCTCAGTGGTGATGATGGTGATGAGGCA genase (ldH ^~ 2) xylosoxi ACGCGTCAGC 145 dans (Ax)

(ldh-2) glumae (B GTGCGGCCGGCGGCACCACGCCGAGTTCGTC 147 g) (SEQ ID NO: 2) ATAACATATGCAGATATCCCTCGACGATG 146 l actate dehydro eria 909484. 1 TAATAGGATCCCTAGTGGTGATGATGGTGATGGGCCC genase

mal ate / L- Escheric WP 002 ATAACATATGTATGGGTACAGATACCTTC. 148 l actate dehydro hi a 431747. 1 TAATAGGATCCTTAGTGGTGATGATGGTGATGATGCT genase (ldH 2) ferguson GATTCCTGAGGATGTAAC 149 ii (Ef)

D-2-Escheric WP024240 ATAACATATGATGTCATTACAAATTGCTG 150 hydroxyac id deh hi a 865. 1 TAATAGGATCCTCAGTGGTGATGATGGTGATGTCCAG ydrogenase (ldh 1 coli (Ec) CTAATGCTGATTCCTG 151 2) D-2-Lactobac WP 003 ATAACATATGACAAGAATAATTGCTTATCATG 152 hydroxyac id deh illus 689565. 1 TAATAGGATCCTTAGTGGTGATGATGGTGATGTTCTC

153 ydrogenase (ldM) mali (Lm) CCTTGAAACTTATTTCATGTG

D-escheric NP 415 ATAACATATGA CTCGCCGTTTATAG 154 l act ate dehydroh i a col i 898. 1 TAATAGGATCCTTAGTGGTGATGATGGTGATGAACCA genase (IdhA) K- GTTCGTTCGGGCAG 155

12 (Eck) The amino acid sequences of the selected enzymes were compared, showing a high similarity of 44-66%. However, eutrophus, L.mali and E. coli-derived enzymes showed low affinity.

Production and activity measurement of 0HB L-reductase enzyme

E. coli BL2KDE3 star strain was used as a host strain for E. coli expression and E. coli DH5a strain was used as a host for cloning and preservation of polar powder. LB medium containing kanamycin 50 pg / mL was used for culture of recombinant strains after general culture and cloning. PET plasmid and T7 promoter were used for gene expression and enzyme production. The Ldh gene was amplified by PCR and attached Hi s-tag to the C-terminus. The PCR fragment was inserted into a pET vector (Table 10), cloned into the E. coli strain DH5a, and sequenced into E. coli BL2KDE3 star. In order to promote the soluble expression of the Ldh gene, the pG-Tf2 plasmid expressing Chaperon was further introduced.

For LDH enzyme production, the recombinant BL21 (pET-Xx-LDH, Xx is a plasmid with the LDH gene shown in Table 9) was aerobically cultured in LB medium containing 50 ug / mL kanamycin. The incubation temperature was 30 ^° C, stirring speed was 100 rpm, and 250 mL medium was added to a 1 L flask. When the cell concentration reached 0.5 0D, 0.1 mM IPTG was added and incubated for an additional 10 hours. The cells were then centrifuged, washed three times with 25 mM phosphate buffer solution (pH 7.0), suspended in binding buffer (20 mM pH 7.0 phosphate buffer solution, 0.5 M NaCl, 10 mM imidazole) Respectively. The cell lysate was centrifuged at 25,000 g for 30 min at 4 ^° C to remove the insoluble portion, and the soluble portion was collected and used for enzyme activity analysis or additional enzyme separation.

LDH enzyme activity was analyzed using pyruvate and 0HB as substrates. 0HB was synthesized from homoserine since it was not commercially available. That is, 125 mM homoserine solution to pH 7.8, 100 mL Tris prepared by wancheung solution of 1.25 U / raL snake venom (L ) - from the amino acid oxidase enzyme with 4400 U / mL of 37 ^° C and then combined common and catalase enzyme 90 For a while. Then, the solution was filtered with an Ultracentrifugal filter (10 kDa, Amicon) filter to obtain 0HB. For enzyme activity, the enzyme solution was prepared by mixing 60 mM Hepes buffer (pH 7.0), 50 mM NaCl, 5 mM MgCl ₂ , 5 mM fructose-1, 6-bi sphosphate and an appropriate amount of enzyme at 37 ^° C for 2 min. After that, 0.1 mM NAD (P) H and an appropriate amount of 0HB black were added pyruvate to initiate the reaction. Enzyme activity was calculated using the rate of decrease of NAD (P) H and the extinction coefficient.

Table 10 below describes plasmids for OHB L-reductase screening.

[Table 10]

pET-Ef-LDH pET containing mutant LDH from Escherichia fergusoni i Thi s study containing pET-Ec-LDH pET containing Escherichia coli Thi s study enzyme LDH I48S from Thi s study

Al cali genes eutrophus

PET-LDHA2 containing pET containing mutant enzyme LDH I48T from Thi s study

Al cali genes eutrophus

PET-LDHA3 pET containing mutant enzyme LDH I48N from Thi s study

Al cali genes eutrophus

PET-LDHA4 containing pET containing mutant enzyme LDH I48D from Thi s study

Alcaligenes eutrophus

PET-LDHA5 containing pET containing mutant enzyme LDH I48 from Thi s study

Alcaligenes eutrophus Most enzymes had high activity on pyruvate and low activity on 0HB (Fig. 13). When pyruvate was used as a substrate, Ec / Eck-LDH showed the highest activity at 6 μmol / mg protein / min. For 0HB, Ae-LDH showed the highest activity of 1.8 μmol / mg protein / min. Therefore, Ae-LDH was selected and a mutant enzyme having high activity at 0HB was prepared.

Measurement of optical activity of OHB L-reductase enzyme product

To investigate whether the hydroxy group at position 2 of DHB produced by Ae-LDH is (R) or (S), it was analyzed using optically active HPLC and colorimetric analysis kit. HPox analysis was performed on the l actate generated first. The analytical temperature was 35 ^° C, 0.2 mM CuSO _{4 for the} mobile phase, and 0.5 ml mirf ¹ for the f low rate (Ag 250/4 NUCLEOSIL Chiral-1, Germany). At this condition, the peak appeared at about 7.3 minutes for L-lactate and about 9.0 minutes for D-lactate. The lactate produced by Ae-LDH was all L-form. Also commercially sold lactate assay kit (BioVision, CA, USA), and the lactate produced was also identified as L-form.

The chirality of position 0H in position 2 was also investigated for the DHB produced by the reduction reaction of 0HB. However, for DHB, there are no commercial products and further optically pure compounds were not available. Thus racemic DHB was synthesized by chemically degrading racemic 2-hydroxy gamma butyrolactone (HGBL) (Sigma-Aldrich, MO, USA) in position 2 OH at R-form and S_form. The synthesis method was as follows.

Racemic HGBL was dissolved in metahn, and the same amount of NaOH was added and reacted at room temperature for 18 hours. After vacuum filtration, it was dried. NMR analysis confirmed 100% conversion.

DHB synthesized from HGBL showed two HPLC peaks at 9.9 and 11.3 min when the same chiral column used for the chirality analysis of lactate was used. lactate, L-form was found earlier than D-form, and DHB was also expected to show L-form first. The racemic DHB synthesized from HGBL was analyzed by colorimetr ic method, and L-form and D-form were obtained at a ratio of about 1: 1. The lactate assay kit was originally designed to analyze lactate, but the chirality of DHB was also analyzed because of the chemical similarity between DHB and lactate. DHB analysis of 0HB products reacted with Ae-LDH was performed simultaneously using a chiral column and a colorimetric assay kit. For HPIX analysis, only one peak was obtained and retention time appeared at 9.9 min, which is estimated to be L-form. L-form was obtained in colorimetric analysis. Thus, the DHB obtained from the reaction with Ae-LDH was identified as optically pure L-form or (S) -form isomer.

3-2. Site-directed mutagenesis was used to develop a mutant of 0HB L reductase enzyme

First, using the crystal structure of E. coli lactate dehydrogenase (PDB ID: 2G8Y) as a template, the three-dimensional structure of Ae_ldhA was identified through homology modeling

Respectively. Ae_ldhA model uses Molecular Operating Environment (M0E) Through PR0CHECK and ProSA online structure analysis,

Respectively. The protein structure was confirmed using the PYM0L viewer (http://www.pymol.org) (Fig. 14).

For the Ae_ldhA mutant design, the structure of the skin leucine and HOB structure (Pubchem Database) was docked simulated using the triangular matching method at the enzyme active site of Ae_ldhAl, and the amino acid residues of the enzyme, (Fig. 15).

Based on the results of the docking simulation, it was assumed that Ile48 position could play an important role in the interaction with the methyl group of hyaluronic acid or with the hydroxyethyl group of HOB. It was assumed that hydrophilic (Ser, Thr, Asn) Asp, Lys). Since H0B is larger than phosonic acid, substituted amino acids are limited to amino acids having small residues in the same type.

Mutations at Ile48 sites were performed using a site directed mutagenesis kit. Table 11 below shows the primer sequences used for site directed mutagenesis of Ae-LdhA. The plasmid expressing the mutated Ae_ldhA (pET24ma_Ae-ldh0, refer to Zhang et al., "NADH-dependent lactate dehydrogenase from lei genes eutrophus H16 reduces 2-oxoadi ate to 2-hydroxyadipate" Biotechnology and Bioprocess Engineering, 19: 1048-1057 (2014)) was cloned into the pET plasmid and sequenced (Macrogen, Seoul, Korea) and transformed into E. coli BL21 (DE3). The enzyme present in the cell lysate was purified using Ni-NTA resin and the salt was removed using a 10 kDa molecular cutoff membrane. After further filtration with an Ultra-15 30K centrifugal filter (Amicon, Merck Mi 11 ipore Co., Darmstadt, Germany), it was stored at -80 ^° C.

[Table 11]

LDH1_RP cgagggcggtgcggtagt tgggcagactcgacaggccgtggctgatatag 157

LDH2_FP ctatatcagccacggcctgtcgactctgcccaactaccgcaccgccctcg 158

LDH2- RP cgagggcggtgcggtagt tgggcagagtcgacaggccgtggctgatatag 159

LDH3_FP ctatatcagccacggcctgtcgaatctgcccaactaccgcaccgccctcg 160

LDH3_RP cgagggcggtgcggtagt tgggcagat tcgacaggccgtggctgatatag 161

LDH4_FP ctatatcagccacggcctgtcggacctgcccaactaccgcaccgccctcg 162 ^'

LDH4_RP cgagggcggtgcggtagt tgggcaggtccgacaggccgtggctgatatag 163

LDH5_FP ctatatcagccacggcctgtcgaatctgcccaactaccgcaccgccctcg 164

LDH5_RP cgagggcggtgcggtagggggcagat tcgacaggccgtggctgatatag 165 The activity of the enzyme was measured by observing the degree of oxidation of NADH at 340 nm and the activity of the enzyme (1 U) was determined by measuring the activity of the enzyme required to oxidize 1 ymol of NADH to NAD Respectively. All of the mutant enzymes showed reduced activity against pyruvate and 0HB. The I48K enzyme showed a 5-fold reduction in activity against pyruvate and the other enzymes showed a 0.8-3-fold reduced activity (Fig. 16). Most of the activity against 0HB was decreased. However, in the case of I48T (LDH2), about 50% of the activity of pyruvate was decreased, but the activity of ΟΗΒί was slight but slightly increased. That is, the selectivity to 0HB over pyruvate was more than doubled. LDH2 was selected in future experiments.

Example 4: Screening of 2R-D-reductase enzyme of 2-0xo-4-hydroxy butyric acid (OHB) and preparation of mutant enzyme

4-1. Screening of OHB D-reductase enzyme

Obtaining of OHB D-reductase enzyme

In the case of L-reductase, OHB 2R-reductase enzyme was screened for D-lactate dehydrogenase. Lactobacillus listeria, L. jensenii, Oenococcus oenii, L. iantum, L. reuteri and L. casei, which are highly active against OHB, have been identified as E. coli, Pediococcus acidi lacti, Pseudomonas aeruginosa, Leuconostoc mesenteroides cremoris, The expected (D) -lactate dehydrogenase enzymes were selected (Table 12). Table 12 shows candidate enzymes for screening dehydrogenase of the OHB D-reductase enzyme.

[Table 12]

enases

(IdhD)

D- Lactobaci 1 lus ZP_03974 ATAACATATGAAAGGAATGGGAAAAC 176 ^' actate reuteri 385. 1 TAATAGGATCCTCAGTGGTGATGATGGTGATGCATTCT dehydrog TATTTCATTTCGTG

177 enases

(IdhD)

D- Leuconostoc me ZP_03913 ATAACATATGAAGATTTTTGCTTACG 178 l actate sent ero ides 173. 1

TAATAGGATCCTTAGTGGTGATGATGGTGATGATATTC

dehydrog cremoris

AACAGCAATAGCTGG

179 enases

{IdhD}

D 1 Oenococcus oen ZP_01544 ATAACATATGAAAATTTATGCTTATG 180 l actate i 962. 1 TAATAGGATCCTTAGTGGTGATGATGGTGATGGAATTT dehydrog AACGAGATTCTTGTCTC

181 enases

{IdhD}

D- Lactobaci 1 lus CAI 96942 AT CATATGACTAAMTTTTTGCTTAC 182 l actate delbruecki i. One

TAATAGGATCCTTAGTGGTGATGATGGTGATGGAAACT

dehydrog subsp.

CCAGTTAAGGTTGGC

183 enases bulgaricus

{IdhD}

Production and activity measurement of OHB D-reductase enzyme

As in the case of L-LDH, E. coli BL2KDE3) star strain was used as a host strain for the expression of the enzyme, and E. coli DH5a strain was used as a host for cloning and plasmid preservation. LB medium containing kanamycin 50 ug / mL was used for culture of recombinant strains after normal culture and cloning. PET plasmid and T7 promoter were used for gene expression and enzyme production. The Ldh gene was amplified by PCR using primer shown in Table 10 below And then Hi s-tag was attached to the C-terminal. The PCR fragment was inserted into a pET vector, cloned into E. coli strain DH5a, and sequenced into E. coli BL2KDE3 star. To facilitate the solubility of the Ldh gene, we introduced the pG-Tf2 plasmid, which expresses the chaperon.

For the production of D-LDH enzyme, recombinant BL21 (pET-Xx-LDH) strain was aerobically cultured in LB medium containing 50 Ug / mL kanamycin. The incubation temperature was 30 ^Q C, stirring speed was 100 rpm, and 250 mL medium was added to a 1 L flask. When the cell concentration reached 0.5 0D, 0.1 mM IPTG was added and an additional 10 hours of pleasure. The cells were then centrifuged, washed three times with 25 mM phosphate buffer solution (pH 7.0), suspended in binding buffer (20 mM pH 7.0 phosphate buffer solution, 0.5 M NaCl, 10 mM imidazole) . The cell lysate was centrifuged at 41: 25,000 g for 30 minutes to remove the insoluble portion, and the soluble portion was collected and used for enzyme activity analysis or additional enzyme separation.

D-LDH enzyme activity was measured in the same manner as in the case of L-LDH. pyruvate and 0HB were used as substrates. Like L-LDH, most of the enzymes had 3-10-fold higher activity on pyruvate than on 0HB (Fig. 17). The activity of D-LDH was generally 3-5 times lower than that of L-LDH. Lb-LDH and Lp-LDH showed the highest activities of 2.2 μmol / mg protein / min. For 0HB, Lb-LDH showed the highest activity of 0.8 umol / mg protein / min. The selectivity for pyruvate and 0HB was about 1: 0.2. L-LDH was selected to produce D-reductase mutant enzyme having high activity at 0HB.

Measurement of optical activity of OHB D-reductase enzyme product

To investigate whether the hydroxy group at position 2 of DHB produced by Lb-LDH is either (R) or (S), it was analyzed using optically active HPLC and colorimetric analysis kit. HPLC analysis of the 0HB product reacted with Lb-LDH showed only one peak, and retention ion ime appeared in the D-form at 11.3 minutes. In color imetr ic analysis, only D-form was obtained. Thus, the DHB obtained from the reaction with Lb-LDH was identified as optically pure D-form black as (R) -form isomer.

4-2. site-directed mutagenesis of 0HB D-reductase enzyme

The amino acid residues to be engineered were identified using the crystal structure of the Lb-LDH enzyme in the PDB databank (FIG. 18). That is, through docking with pyruvic acid, three residues of His296, Arg235, and Glu264 were present in the antagonistic activity site with pyruvate, and additionally two hydrophobic amino acid residues Val78 and TyrlOl were present around the active site. Since these hydrophobic residues are likely to interfere with the reaction with 0HB, they have been replaced with hydrophilic amino residues (Ser, Thr, Asn, Asp, Lys).

Mutation was performed using a site directed mutagenesis kit. Table 13 shows the primer sequences used for the site-directed mutagenesis of Lb-LDH. The plasmid expressing the mutated Lb-LDH was cloned into the pET plasmid and sequenced (Macrogen, Seoul, Korea) and transformed into E. coli BL21 (DE3). The enzyme present in the cell lysate was purified using Ni-NTA resin and the salt was removed using a 10 kDa molecular cutoff membrane. After further filtration with an Ultra-15 30K centrifugal filter (Am icon, Merck Millipore Co., Darmstadt, Germany), it was stored at -80 ^° C.

Table 13 below shows the primer sequences used for the site-directed mutagenesis of Lb-LDH.

[Table 13]

Pr imers nucleotide sequence SEQ ID NO:

LDH6_FP cat cactaagatgagcctgcgtaactccggtgt tgacaacatcgacatggct 184

LDH6_RP tagccatgtcgatgttgtcaacaccggagt tacgcaggctcatcttagtgatg 185

LDH7_FP cat cactaagatgagcctgcgtaacaacggtgt tgacaacatcgacatggcta 186

LDH7_RP tagccatgtcgatgttgtcaacaccgttgt tacgcaggctcatcttagtgatg 187

LDH8_FP cat cactaagatgagcctgcgtaacaccggtgt tgacaacatcgacatggcta 188 LDH8_RP tagccatgtcgatgttgtcaacaccggtgttacgcaggctcatcttagtgatg 189

LDH9_FP catcactaagatgagcctgcgtaacgacggtgttgacaacatcgacatggcta 190

LDH9- RP tagccatgtcgatgttgtcaacaccgtcgttacgcaggctcatcttagtgatg 191

LDH10_FP catcactaagatgagcctgcgtaacaagggtgttgacaacatcgacatggcta 192

LDH10- RP tagccatgtcgatgttgtcaacacccttgttacgcaggctcatcttagtgatg 193 Enzymatic activity was measured by measuring the degree of oxidation of NADH at 340 nm. The specific activity (1 U) of the enzyme was determined by the amount of enzyme required to oxidize 1 n of NADH to NAD + Respectively. All of the mutant enzymes showed reduced activity against pyruvate and 0HB. Of these, V78D (LDH-9) showed almost four-fold reduced activity against pyruvate. The most excellent enzyme was V78T (LDH-8), with about 45% activity reduced for pyruvate while about 10% increased for HOB (FIG. 19). In future experiments, V78T (LDH-8) was selected as the OHB D-reductase enzyme.

Example 5: Preparation of strains for producing DHB (2,4-dihydroxybutyric acid)

For optimal production of DHB, transaminase and OHB reductase should be optimally expressed. In addition, the increase of TA activity should increase the expression of pyridoxal-5-phosphate (PLP) which is a cofactor of TA antagonist as well as the expression of TA enzyme itself, that is, the biosynthesis of vitamin B6. Furthermore, the extracellular delivery rate of DHB should be increased. For this, DHB production strains were prepared by further modifying strains prepared for homoserine production in Example 1 above.

5-1. Increased Vitamin B6 production

In the case of Escherichia coli, PLP is biosynthesized through a DXP-dependent pathway. In this case, it is known that the rate of PLP biosynthesis is regulated by proteins encoded by epd, dxs, pdxJ gene, etc. (Fig. In order to improve the rate of PLP biosynthesis, the promoters of these three genes were replaced with synthetic promoter 5 (Table 5) and pop-in pop-out method was used. The primers used are shown in Table 14 below. Table 14 shows the primer sequences used to increase expression of epd, dxs ^' , and pdxJ genes to increase vitamin B6 biosynthesis. As a result, three strains with enhanced PLP biosynthesis were obtained (Table

[Table 14]

Primer nucleotide sequence SEQ ID NO: us- atctaagcggccgcggaattatgcaattcgtggtac 194

Psp5

epd-FP

us- aaaaaatttatttgctttcgcatctttttgtacctataagtgtggaatgaccgtacgcgtagcgataa 195

Psp5-ATG

epd-RP

Psp5- gccagtttagtatcgacc 196 epd-FP

Psp5- acaaaagcatgatcctgttgaagatgcg 197 epd-RP

DS- catttatcgctacgcgtacggtcattccacacttataggtacaaaaagatgcgaaagcaaataaattt 198

Psp5-TTTTc

epd-FP

DS- tagtaatctagaggagttggcatctctctgcgatttc 199

Psp5-EPd-RP

us- atctaagcggccgctcgacatttcattgtcgttgag 200

Psp5- dxs-FP

us- caaaaaatttatttgctttcgcatct ttttgtacctataagtgtggaatgagttttgatattgccaaa 201

Psp5- tac

dxs-RP

Psp5- gtaaagcttaccggaaagcagctgt 202 dsx-FP

Psp5- agcaactcgaagcctgcgttaag 203

[Table 15]

The EcW13 strain was deposited on June 22, 2018 with the deposit number KCCM12281P deposited at the Korean Microorganism Conservation Center in Seodaemun-gu, Seoul, Korea. The EcW20 strain was deposited with the Korean Center for Microorganism Preservation on June 22, 2018, I received the number KCCM12282P.

5-2. Regulation of Expression of DHB Membrane Transfer Protein

To increase the extracellular delivery rate of DHB, the transferred protein candidates were first screened. The known organic acid membrane transfer proteins, especially lactic acid and low molecular weight carboxylic acid transfer protein, were used as query to select importer and exporter. Table 16 lists selected proteins as candidates for the 2,4-DHB exporter, and Table 17 lists the proteins selected as candidates for the 2,4-DHB importer.

[Table 16]

Protein Names Gene

MFS type transporter YhjX

Probable formate transporter focA

Lactate premease lldp

Inner membrane metabolite transporter yhjE

C4-dicarboxylate transporter dcuA

C4-dicarboxylate transporter dcuB C4-dicarboxylate transporter dcuC

[Table 17]

The expression level of the two most potent exporters, ldp, (fcuA), was elevated using a synthetic promoter. The overexpression of membrane protein interfered with cell growth, so SP5, a mid-level synthetic promoter, was used. In addition, three membrane proteins, kgtP, dsdx, and actP, which are expected to be the most likely importer, were removed: ^Λ 1 "soluble primer sequences in transporter engineering are shown in Table 18.

[Table 18]

Primer sequence SEQ ID NO:

(Overexpression)

us- atctaagcggccgcgattggaatgcccatcgcac 212

Psp4- lldp-FP

US- ttgacaat taat cat ccggctcgtaattt atgtggaatgaat etc tggcaacaaaactacg 213 Psp4- lldp-RP Psp5- ccatctgaccaatctcaaagctgt 214 lldp-FP

Psp5- t tgtgaacaaagcacctggtcgcg 215 lldp-RP

DS- ccacat aaat t acgagccggat at a tgt caattggt agggccaat tcttgtg 216

Psp4- lldp-FP

DS- tagtaatct agagaaagaagt cgaaaaaaacgaaat c 217

Psp4-1LLDP-RP

us- atctaagcggccgcgttgatgattgcatagataacc 218

Psp4-ducA-FP

us-ttgacaattaatcatccggctcgtaatttatgtggaatgcaggttgctggcggtctggactatctg 219

Psp4-gttc

ducA - RP

Psp4- ccatctgaccaatctcaaagctgt 220 ducA-FP

Psp4- t tgtgaacaaagcacctggtcgcg 221 ducA-RP

DS- t ccacat aaattacgagccggatgattaattgtcaatgttttttaacaagttgatattagattg 222 Psp4- ducA-FP

DS- tagtaatct agagaaagaagt cgaaaaaaacgaaat c 223 Psp4- ducA-RP Pr imers sequence

(remove)

us- atctaagcggccgcggtatccagcgacgat t t tagcg

224 dsdx-FP

US- gtacgtctctt tgcgct tacatatctcacctt cccctg

225 dsdx-RP

G-dsdx gcgtgtaaagtcacctaatgc

226 -FP

G-dsdx gggcatcagcagacatatg

227 -RP

DS- caggggaaggt gagat atgt aagcgcaaagagacgt ac

228 dsdx-FP

DS- tagtaatctagacgctcataatgccgattgataac

229 dsdx-RP

us- atctaagcggccgcggagctgatccgcgagcatac

230 kgtP-FP

us- acggcaggagacataatggcatgtagtgacgggtcagttgccagac

kgtP-231 RP

G- kgtP tggcgtctggatctggaaaacg.

232 -FP

G- kgtP tgtgtaagcgcagcgatgc

233 -RP

DS- gtctggcaactgacccgtcactacatgccat tatgtctcctgccgt

kgtP - 234 FP

DS-ta agt aatct agagaagc tgt t t t ggcggatga

235 kgtP-RP

US 1 atctaagcggccgcct tatct t tat taaggtaaac

236 actP-FP us- agtcctgcatgaggtacaagcatcatgtaatctctccccttccccggtcgtctg actP - 237 RP

G- actP ctgtgggat t tcgatagtat

238 -FP

G- actP agcaacctgggcgatacctcgac

239-RP

DSC agacgaccggggaaggggagagat t aca t ga t gc 11 gt ac c t c at gcaggac t 240 actP - FP

DS-tagtaatct agaaagc tgct t aagagaagcag 241 actP-RP DHB-producing host strain E. coli transformed with transporter and PLP biosynthetic pathway was finally obtained as shown in Table 19 below.

[Table 19].

Example 6: Production and fermentation of optically pure S-form or L-form 2, 4-dihydroxybutyric acid (S-black R-DHB) 6-1. Genetically recombinant plasmids for production of DHB

A plasmid (pET-LDHA2 or pET-LDHD3) expressing PET-TA4-1 and LDH was used to construct a recombinant plasmid expressing TA4-1 enzyme and OHB reductase enzyme simultaneously. Each gene fragment was amplified by PCR and ligated to Ndel and EcoRI site of pBAD plasmid. Two new plasmids were obtained: pBAD_TA4-l_LDHA2 (hereinafter referred to as pDHB-L) plasmid for L-form DHB and pBAD_TA4-1_LDHD3 (hereinafter referred to as pDHB-D) plasmid for D-form DHB. In these two plasmids, TA4-1 and 0HB reductase genes were simultaneously cloned under the promoter induced by Arabinose to be transcribed polycistronic (Fig. 21).

6-2. DHB production

DHB production pathway plasmids pDHB-L and pDHB-D were respectively introduced into the homoserine producing strains developed in Example 1 for DHB production. A homozygous homozygous mutant strain, EcW20 (see Table 19), was used to replace the 10 gene deletions pts, Aeda, MacI, AthrB, AmetA, MysA, AadhE, ApfJB, MdhA and two promoter substitutions (APacs: -PSP8), and the plasmid pUCPK-P rd »e for overexpression of the metL gene. Furthermore, this strain has been further supplemented with PLP and enhanced production pathway key enzyme expression for production, elimination of importer membrane protein, and enhancement of expression membrane protein expression. The strains into which the DHB production pathway plasmid pDHB-L or pDHB-D was introduced into the EcW20 strain were named EcW20 (pDHB-L) and EcW20 (pDHB_D), respectively.

First, the production of L-DHB was investigated through the EcW20 (pDHB-L) strain in which pDHBL was introduced. The EcW20 (pDHB-L) strain was cultivated under aerobic conditions with stirring at 200 rpm in a 250 mL flask with a volume of 50 mL of medium. TPM2 medium glucose as a carbon source (yeast extract, 2 g; MgS0 4 7_H 2 0, 2 g; KH 2 P0 4, 2 g; (NH 4) 2 S0 4, 10 g; L-methionine, 0.2 g; L L-isoleucine, 0.05 g, trace metal solution, 10 ml) was used. The concentration of glucose was 10 g / L, Kanamycin and ampicillin were 50 mg / L . Arabinose was added at different concentrations in the range of 0 - 1 g / L after 3 hours of incubation.

As shown in Fig. 22, the EcW20 strain having no DHB production plasmid produced no DHB at all. In the case of the EcW20 strain having a DHB production plasmid, the amount of DHB produced varied depending on the amount of arabinose added. That is, when arabinose was not added, a small amount of 0.005 g / L was obtained, whereas when it was added at a concentration of 0.5 g / L, the highest amount of 0.33 g / L was obtained. When 1 g / L of arabinose was added, cell growth and glucose consumption decreased and DHB production decreased to 0. 19 g / L. This is considered to be a side effect of overexpression of DHB production pathway enzyme. All DHB produced were in L-form.

D-DHB production was investigated in the same way through the EcW20 (pDHB-D) strain in which pDHBD was introduced. As with L-DHB, we have a DHB production plasmid _. The non-EcW20 strain produced no DHB at all. In the case of the Ec 20 (pDHB-D) strain, the amount of DHB produced varied depending on the amount of arabinose added. That is, a small amount of 0.005 g / L was obtained when arabinose was not added, whereas 0.20 g / L was obtained when 0.5 g / L was added. When 1 g / L of arabinose was added, cell growth, glucose consumption, and DHB production were reduced to 0.17 g / L. This was considered to be a side effect due to overexpression of DHB production pathway enzyme. The DHB produced was all D-form. Overall, lower amounts of D-DHB were produced than L-DHB. This is because the activity of the LdhD enzyme used in the production of the recombinant strain is lower than that of the LdM activity. (Fig. 22)

Bioreactor experiments were performed using EcW20 (pDHB-L) and EcW20 (pDHB_D) strains (Fig. 24A). The medium volume was 3 L, and the initial medium volume was 1 L. The same TPM2 medium as in the flask experiment was used and glucose was added at an appropriate level during fermentation. In order to maintain aerobic conditions, air was injected at a speed of 1 wm and the agitation speed was appropriately adjusted between 500 - 900 rpm. Arabinose was added at a concentration of 0.5 g / ml after 6 hours of incubation. Cells grew up to 18 hours from the beginning. DHB production started from 9 hours and lasted up to 48 hours after cultivation. In FIGS. 24A and 24B, the solid line of the black circles indicates the cell concentration, the white circles indicate the product DHB, and the inverted triangles indicate the glucose concentration.

As a result, there was a difference in cell growth, product production, final concentration and the like for DHB and L-DHB. In the case of L-DHB, the final cell concentration was 10 g / L and the final L-DHB concentration was 20 g / L. In contrast, the final cell concentration of D-DHB was 8 g / L and the final L-DHB concentration was 14 g / L.

Example 7: Production and fermentation of 2-hydroxy gamma butyrolactone (HGBL) producing strains

7-1 Production of recombinant plasmids and recombinant strains for production hall of HGBL

To convert DHB to HGBL, l act onase enzyme is required. Paraoxonase was used as a lactonease enzyme, which requires calcium and is active against several substrates. Since this enzyme reaction is optimal in the acidic range, it is necessary to express it in the cell membrane or peripolar space. Since this enzyme is derived from an animal, appropriate mutation is necessary for microbial expression. In this study, the ponl gene mutant (G3C9) was used and the s ignal sequence was attached at the N-terminus to be expressed in the periplank c space. First, the ponl (G3C9) gene was synthesized and then cloned into a pACYC-Duet plasmid having a low copy number of s-f Jl (SEQ ID NO: 16). PCR amplification (FP, tagacacatatggct aaactgacagcg; RP, tacat act cagat t acagct cacagt aaagagc 111 g) A tac promoter was used for the expression of ponl (G3C9) (Fig. 18). This plasmid was named pACYC_Ponl.

The obtained Ponl pl asmi d was introduced into the strains for producing the two strains, L-DHB and D-DHB, respectively. In this case, it is not preferable to increase the extracellular transport rate of DHB. Therefore, EcW16 was used as a host cell (Table 19), and plasmids for producing DHB in homoserine were used for pDHB-L and pDHB- D was used (Fig. 21). These strains were named EcW16 (pHGBL-L) and EcW16 (pHGBL-D), respectively. 7-2 Production of HGBL for Biological Control

Two - stage cultivation was performed for HGBL production. First, DHB was produced in one culture and then HGBL was produced by lowering pH in the second stage. After obtaining a single strain from agar medium, starter culture was performed using LB medium. The seed culture was performed using TPM2 medium as described above. This culture was carried out in TPM2 medium inoculated with seed culture cells in the exponential growth phase.

In the case of L-DHB, about 16 g / L of DHB was produced during one 48-hour incubation. The cell concentration and glucose consumption rate were also decreased compared to fermentation for L-DHB production. the lack of engineering of transporters, the introduction of plasmids for the expression of ponl, and the production of additional proteins, especially ponl membrane proteins.

In the case of D-DHB, about 9 g / L of DHB was produced during the first 48-hour incubation. Cell concentration and glucose uptake rate were also decreased compared to fermentation for D-DHB production. The introduction of plasmids for ponl expression and the production of additional proteins, particularly ponl membrane proteins, were presumed to be responsible for this. In addition, L-DHB was obtained at a higher concentration than D-DHB because the activity of 2-oxo-reductase was significantly higher than that of D-form as described above.

The pH of the medium was lowered to 6.2 using a hydrochloric acid solution to convert the produced DHB to HGBL, and the culture was continued. As a result, about 5 g / L of lactone was obtained by further culturing for about 24 hours in case of L-HGBL. Most of the DHB remained unconverted to HGBL (Fig. 26A).

The gain D-HGBL was subjected to the same experiments ^(Fig. 26b) that is conducted after 48 hours incubation the first stage for 24 hours in a two-stage incubation pH 6.2. Unlike the case of L-HGBL, only a very low concentration of 0.3 g / L was obtained. The reason is that the used ponl enzyme is active only in DHB of L-form.

Through chemical reaction, we converted 2, 4-dihydroxybutyric acid to lactone. In this case, the culture medium having the single-stage culture shown in FIGS. 23 and 24 was centrifuged to remove cells, and a hydrochloric acid solution was added to the culture to lower the pH to 1.0. And 10 hours of political opposition. In this case, L-DHB and D- About 50% of all DHB were converted to lactone. As a result, about 9 g / L of L-HGBL and about 6 g / L of D-HGBL were obtained. Therefore, it was found that esterification reaction of DHB was more efficient than using ponl enzyme by using acid catalyst chemical reaction in both D-form and L-form.

¾ ^: n

Deposits by original deposit

:.Number. H ^

50. Health ¾ _t Thunder

Note. : 44919. The whole nation ^Λ

Deposits by original deposits Φ

0 -1 room, 10 billet,

50, Nice,

: Lieutenant Governor, Excitement, Republic of Korea

I. Microorganisms ≤ Name: В «'' Zap: Serve | Tongjin Jungchung: International Tachibanggye ^ ^ Tachan ^ Tak:

EcW20 KCOI12282P

Π ::, Scientificity ¾ Taxonomy Location 1 ί ^: , Respectively _.

f ^" J Scientific 44 m, receipt and entrustment

Deposits of Depositary Institutions ¾ above 1 ¾Λ | I have 20 years of life _. 6¾ 22 ¾

^^

^ The filing body

Jim Jim: Chung Shim Yuryobo Center

Address Rate ^ S & D 4 4 ^'

^■ 45 ^"

June 22, 2018 1

Claims

Claims: What is claimed is: 1. A process for preparing optically pure 2, 4-dihydroxybutyrate or 2-hydroxy-gamma-butyrolactone (2-hydroxygal Dihydroxy-butyrate or 2- (4-hydroxybutyrate), comprising the step of performing at least one selected from the following (1) to (4) Method for producing hydroxy-gamma-butyrolactone-producing microorganism variants:

(1) deletion of one or more genes selected from the group consisting of ptsG, eda, adhE, pflB, lysA, thrBC, metA, LacI, IdhA and genes, or one selected from the group consisting of acs, ppc, Overexpressing the above genes, or both,

(3) and ducA, and

(4) deletion of one or more genes selected from the group consisting of kgtP, dsdx, and acP genes.

[Claim 2]

The microorganism producing the 2,4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone according to claim 1, wherein the microorganism produces E. coli 0. coin, yeast, and Corynebacter ium.

[Claim 3]

The method according to claim 1, wherein the step of mutating the microorganism comprises the steps of (1) and (2) to (4).

[Claim 4]

2. The method according to claim 1, wherein the step of mutating the microorganism includes all steps (1) to (4).

[Claim 5] The method according to any one of claims 1 to 4, wherein said step (1) deletes all of the ptsG, eda, adhE, pflB, lysA, thrB, metA, Lad, ldhA and iclR genes, And overexpressing all of the metL gene.

[Claim 6]

The method of any one of claims 1 to 4, wherein said step (2) comprises overexpressing all of the epd, dxs, and pdx genes.

7.

5. The method according to any one of claims 1 to 4, wherein step (3) comprises overexpressing all of the lpd and ducA genes.

8.

5. The method according to any one of claims 1 to 4, wherein said step (4) comprises deleting all of the kgtP, dsdx, and ac genes.

[Claim 9]

2. The method according to claim 1,

Further comprising the step of promoting the conversion of 4-hydroxy-2-oxo-butyrate from homoserine.

Claim 10

In step 19, the step of promoting the conversion of 4-hydroxy-2-oxo-butyrate from the homoserine is a step of treating the transaminase to remove the alpha-position amine group of homoserine The method comprising the steps of:

'

Claim 11

11. The method of claim 10, wherein the transaminase is an enzyme that uses pyruvate as an amino acceptor.

Claim 12

The transaminase according to claim 11, wherein the transaminase comprises an enzyme consisting of the amino acid sequence of SEQ ID NO: 12, an enzyme consisting of the amino acid sequence of SEQ ID NO: 13, an enzyme consisting of the amino acid sequence of SEQ ID NO: 14, &Lt; RTI ID = 0.0 > and / or < / RTI > How, one.

[Claim 13]

9. The method for producing a microorganism variant according to claim 9,

Further comprising the step of promoting conversion of 4-hydroxy-2-oxo-butylate to 2,4-dihydroxy-butyrate.

14.

14. The process of claim 13, wherein the 2,4-dihydroxy-butyrate is selected from the group consisting of (2S) -2,4-dihydroxy-butyrate and (2R) Selected one or more.

15.

14. The method of claim 13, wherein the step of promoting the conversion is L-hydroxy-2-oxo-reductase or D-4-hydroxy- Wherein the method comprises using D-hydroxy-2-oxo-reductase.

Claim 16

16. The method according to claim 15, wherein the L-4-hydroxy-2-oxo-reductase comprises an enzyme consisting of the amino acid sequence of SEQ ID NO: 16, an enzyme consisting of the amino acid sequence of SEQ ID NO: 17 and an amino acid sequence of SEQ ID NO: &Lt; RTI ID = 0.0 > enzymes. &Lt; / RTI >

17.

15. The method according to claim 15, wherein the D-4-hydroxy-2-oxo-reductase comprises an enzyme consisting of the amino acid sequence of SEQ ID NO: 19, an enzyme consisting of the amino acid sequence of SEQ ID NO: 20 and an amino acid sequence of SEQ ID NO: Wherein the enzyme comprises one or more enzymes selected from the group consisting of enzymes that have been made.

Claim 18

14. The method of claim 13, wherein the method further comprises the step of promoting lactonization to 2,4-dihydroxy-butyrate to promote the production of 2-hydroxy-gamma-butyrolactone. .

Claim 19

19. The method of claim 18, wherein the facilitation of the lactonization comprises contacting the amino acid sequence of SEQ ID NO: Lt; RTI ID = 0.0 > lactonase, < / RTI >

[20]

19. The composition of claim 18, wherein the 2-hydroxy-gamma-butyrolactone is (2S) -2-hydroxy gamma butyrolactone and (2R) -2- hydroxy gamma butyrolactone

Wherein said at least one selected from the group consisting of.

21,

2, 4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone is introduced into the genome of a microorganism producing the mutation of any one of (1) to (4) 4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone-producing microorganism variant:

(1) one or more deletions selected from the group consisting of ptsG, eda, adhE, pflB, lysA, thrBC, metA, Lad, ldhA, and / c / Overexpressing the above genes, or both;

(2) epd, dxs, and over-expression of one ^'or more genes selected from the group consisting of pdxj gene,

(3) overexpression of one or more genes of J d and ducA,

(4) deletes one or more genes selected from the group consisting of kgtP, dsdx, and aci ³ genes.

[22]

In the genome of microorganisms that produce 2, 4-dihydroxy-butyrate or 2-hydroxy-gamma-butyrolactone,

ptsG, eda, adhE, pflB, lysA, thrBC, metA, Lac I, ldhA, iclR, kgtP, dsd,

acs, ppc, metL, epd, dxs, pdxj, microbial mutants overexpressing the c / ucA gene.

23. The method of claim 22,

22. The microorganism variant according to claim 21, wherein the microorganism variant is a strain of KCCM12281P.

24.

22. The microorganism variant according to claim 21, wherein the microorganism variant is a strain of KCCM12282P.

[25]

25. The microorganism variant according to any one of claims 21 to 24, wherein the microbial mutant further comprises at least one gene selected from the following (1) to (4) or a recombinant vector comprising the same:

(1) a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13, and a gene encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14 and SEQ ID NO: 15, or one or more transaminase mutant enzyme encoding genes selected from the group consisting of SEQ ID NO:

26. The method of claim 26,

22. The composition of claim 21, wherein the microbial variant is selected from the group consisting of homoserine, 4-hydroxy-2-oxobutyrate, 2,4-dihydroxy-butyrate, and 2-hydroxy-gamma-butyrolactone Microbial variants, which produce more than one.

[27]

(2-hydroxygalactopyranoside) or 2-hydroxygalactopyranoside, which comprises culturing the microorganism variant according to any one of claims 21 to 24 and 26, 2, 4-dihydroxy butanoic acid acid.

28. The method of claim 28,

28. The production method according to claim 27, wherein the microorganism variant further comprises at least one gene selected from the following (1) to (3) or a recombinant vector comprising the same:

(1) a gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 13, a gene encoding the enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and an enzyme consisting of the amino acid sequence of SEQ ID NO: Natri mutational enzyme coding gene,

Claim 29

28. The production method according to claim 27, wherein said culturing is carried out in a culture medium containing yeast extract and ammonium salt as a nitrogen source.

[30]

28. The method according to claim 27, wherein after the step of culturing, at least one amino acid selected from the group consisting of a sugar and methionine, lysine, threonine, and isoleucine is added, &Lt; / RTI >

[Claim 31]

The method according to claim 30, wherein, in the fermentation step, (2S) -2,4-dihydroxybutyrate or (2R) -2,4-dihydroxybutyrate, which is a pure optical isomer, (2S) -2-hydroxy-gamma-butyrolactone or (2R) -2-hydroxy-gamma-butyrolactone by chemically lowering the pH to 1.0 to 3.0. , Production method.

[Claim 32]

(2-hydroxy gamma butyrol actone) or 2,4-dihydroxybutyrate (2-hydroxybutyrate), which comprises a microorganism variant or a culture thereof according to any one of claims 21 to 24 and 26, , 4-dihydroxy butanoic acid).

[Claim 33]

The production composition according to claim 32, wherein said microbial mutant further comprises at least one gene selected from the following (1) to (3) or a recombinant vector comprising said gene:

(1) a gene consisting of a nucleotide sequence encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 13, a gene consisting of a nucleotide sequence encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: 14, and a nucleotide sequence encoding an enzyme consisting of the amino acid sequence of SEQ ID NO: A gene encoding a transaminase mutant enzyme encoding gene selected from the group consisting of a gene consisting of a nucleotide sequence,

34. The method of claim 34,

A transaminase comprising the amino acid sequence of SEQ ID NO:

Mutation enzyme.

[35]

A transaminase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 14.

36. The method of claim 36,

A transaminase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 15.

[37]

17. An L-hydroxy-2-oxo-lyudatease mutant enzyme comprising the amino acid sequence of SEQ ID NO:

38.

18. An L-hydroxy-2-oxo-lyudatease mutant enzyme comprising the amino acid sequence of SEQ ID NO: 18.

39. The method of claim 30,

A D-hydroxy-2-oxo-reductase mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 20.

[40]

A D-hydroxy-2-oxo-lyudatease mutant enzyme consisting of the amino acid sequence of SEQ ID NO: 21.

41. The method of claim 41,

A lactonase mutant enzyme comprising the amino acid sequence of SEQ ID NO: 22.