WO2020218489A1 - トンネル電流を使用したマイクロrna解析 - Google Patents
トンネル電流を使用したマイクロrna解析 Download PDFInfo
- Publication number
- WO2020218489A1 WO2020218489A1 PCT/JP2020/017654 JP2020017654W WO2020218489A1 WO 2020218489 A1 WO2020218489 A1 WO 2020218489A1 JP 2020017654 W JP2020017654 W JP 2020017654W WO 2020218489 A1 WO2020218489 A1 WO 2020218489A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- microrna
- tunnel current
- state
- modified state
- modification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Definitions
- the present disclosure relates to a method for identifying the base sequence and / or modified state of a microRNA using a tunneling current and its application.
- the present disclosure also relates to systems and programs for identifying microRNA nucleotide sequences and / or modified states using tunneling currents and for use in their applications.
- the present disclosure relates to methods and applications thereof for analyzing the state of interest, including identifying the base sequence and / or modified state of microRNAs using tunneling currents.
- the technology for analyzing the base sequence of polynucleotides is applied not only to academic research fields but also to fields such as medical science, drug discovery, and criminal investigation, and there is growing interest in the development of this technology. ing.
- the conventional polynucleotide (specifically, DNA) sequencer is based on an optical measurement technique of identifying a fluorescent label, and does not directly identify the nucleotide itself forming the polynucleotide. Therefore, in order to analyze the base sequence of a polynucleotide by a conventional sequencer, it is necessary to carry out PCR using the polynucleotide as a template and to add a fluorescent label to the polynucleotide extended by the PCR. Not only does this work require a large number of reagents, but it also requires a lot of time. Therefore, analysis of the nucleotide sequence of a polynucleotide by a conventional sequencer requires a great deal of money and time.
- the inventors have found that the nucleotide sequence and / or modified state of the microRNA (for example, the presence or absence of modification, the type of modification, the position of modification, etc.) can be identified using the tunnel current, and complete the present invention. It was.
- the present disclosure provides methods for identifying microRNA nucleotide sequences and / or modified states using tunneling currents, as well as systems and programs for use in this method.
- the disclosure also provides methods for analyzing the state of interest, including identifying the nucleotide sequence and / or modified state of microRNAs using tunneling currents.
- the present disclosure provides: (Item 1) A method for analyzing the modified state of microRNAs (A) A step of passing the microRNA between electrode pairs and (B) A step of detecting a tunnel current generated when the microRNA passes between the electrode pairs, and (C) A step of analyzing the modified state based on the pulse, and Including methods. (Item 2) The method according to any of the above items, wherein the modification position on the base sequence of the microRNA is identified. (Item 3) The method of any of the above items, wherein the modified position on the chemical structure of the microRNA is identified. (Item 4) The method of any of the above items, wherein the modification rate of the microRNA is identified.
- (Item 10) The method of any of the above items, comprising accumulating data for a combination of the associated modified state and the tunnel current pattern.
- (Item 11) The method of any of the above items, wherein the microRNA is present in the sample.
- (Item 12) The method of any of the above items, comprising associating the state of the subject from which the microRNA has been obtained with the modified state.
- (Item 13) A database constructed from the data accumulated by any of the above items.
- (Item 14) A method of analyzing a subject, wherein the method (X) prepares a sample from the subject so as to contain microRNAs derived from the subject.
- (YA) A step of passing the sample between the electrode pairs and (YB) A step of detecting a tunnel current generated when the sample passes between the electrode pairs, and (YC) A step of analyzing the modified state based on the tunnel current, and (Z) A method including a step of analyzing the state of the object based on the modified state.
- the microRNA was obtained by analyzing the modified state of the microRNA based on the detected pattern of the tunnel current with reference to the accumulated data of the combination of the modified state and the pattern of the tunnel current.
- (Item 16) The method of any of the above items, wherein the analysis result of the state of the object from which the sample was obtained is shown within 15 minutes from the time when the sample is subjected to the tunnel current measurement.
- (Item 17) The method of any of the above items for analyzing the condition of a subject's cancer, inflammatory bowel disease, Crohn's disease, diabetes or psychiatric disorder.
- (Item 18) The step of inputting the analysis result by the mass spectrometer of the microRNA, the step of inputting the pattern of the tunnel current acquired by the tunnel current measurement of the microRNA, and the analysis result by the mass spectrometry and the pattern of the tunnel current are associated with each other.
- a program configured to implement a method of analyzing a microRNA comprising the step of determining the modified state of the microRNA.
- the pattern of the tunnel current acquired by the tunnel current measurement of the microRNA can be obtained.
- a program configured to implement a method of analyzing microRNAs including the step of indicating the modified state of the subject microRNA from which the microRNAs have been obtained.
- a program comprising the step of analyzing the state of the subject based on the modified state.
- (Item 22) A system for determining the state of a target based on the modified state of microRNA.
- a tunnel current measuring instrument With reference to the accumulated data of the combination of the modified state of the microRNA and the pattern of the tunneling current obtained by the tunneling current measurement, the above, based on the pattern of the tunneling current obtained by the tunneling current measurement of the microRNA.
- a modification analysis / determination unit that analyzes / determines the modification state of the target microRNA that has acquired the microRNA, Including the system.
- (Item 23) A system according to any of the above items, including a state analysis / determination unit that analyzes / determines the state of the target based on the analyzed / determined modified state.
- (Item A1) A method for analyzing the modified state of microRNAs (A) A step of passing the microRNA between electrode pairs and (B) A step of detecting a tunnel current generated when the microRNA passes between the electrode pairs, and (C) A step of analyzing the modified state based on the pulse, and Including methods.
- (Item A2) The method of any of the above items, wherein the modified position on the base sequence of the microRNA is identified.
- (Item A3) The method of any of the above items, wherein the modified position on the chemical structure of the microRNA is identified.
- (Item A4) The method of any of the above items, wherein the modification comprises methylation.
- (Item A5) The method of any of the above items, wherein the base sequence of the microRNA is at least partially identified.
- (Item A6) The method of any of the above items, wherein both the nucleotide sequence and modified state of the microRNA are analyzed.
- (Item A7) The method of any of the above-mentioned items, which comprises a step of associating the modified state with the pattern of the tunnel current with reference to the analysis result by the mass spectrometer of the microRNA.
- (Item A8) The method of any of the above items, comprising accumulating data for a combination of the associated modified state and the tunnel current pattern.
- (Item A9) The method of any of the above items, wherein the microRNA is present in the sample.
- (Item A10) The method of any of the above items, comprising associating the state of the subject from which the microRNA has been obtained with the modified state.
- (Item A11) A database constructed from the data accumulated by any of the above items.
- (Item A12) A method of analyzing a subject, wherein the method (X) prepares a sample from the subject so as to contain microRNAs derived from the subject.
- (YA) A step of passing the sample between the electrode pairs and
- (YB) A step of detecting a tunnel current generated when the sample passes between the electrode pairs, and
- (YC) A step of analyzing the modified state based on the tunnel current
- (Z) A method including a step of analyzing the state of the object based on the modified state.
- the microRNA was obtained by analyzing the modified state of the microRNA based on the detected pattern of the tunnel current with reference to the accumulated data of the combination of the modified state and the pattern of the tunnel current.
- One of the methods described above to analyze the condition of the subject One of the methods described above to analyze the condition of the subject.
- the step of inputting the analysis result by the mass spectrometer of the microRNA, the step of inputting the pattern of the tunnel current acquired by the tunnel current measurement of the microRNA, and the step of inputting the analysis result by the mass spectrometry and the pattern of the tunnel current are associated with each other.
- the pattern of the tunnel current acquired by the tunnel current measurement of the microRNA can be obtained.
- a program configured to implement a method of analyzing microRNAs, including the step of indicating the modified state of the subject microRNA from which the microRNAs have been obtained.
- a program configured to implement a method of analyzing a subject on a computer, the method of obtaining a tunneling pattern by measuring the tunneling current of the microRNA of the subject and modifying the microRNA. With reference to a database containing a combination of the state and the tunnel current pattern already acquired in the tunnel current measurement, and analyzing the modified state of the target microRNA based on the acquired tunnel current pattern.
- a program comprising the step of analyzing the state of the subject based on the modified state.
- (Item A19) A system for associating the modified state of microRNA with the pattern of tunneling current obtained by tunneling current measurement.
- a mass spectrometer With a tunnel current measuring instrument, A system including an analysis / determination unit for analyzing / determining a modified state of a target microRNA by associating the mass spectrometer with the measurement result of the target microRNA by the tunnel current measurement.
- a modification analysis / determination unit that analyzes / determines the modification state of the target microRNA that has acquired the microRNA, Including the system. (Item A21) A system according to any of the above items, including a state analysis / determination unit that analyzes / determines the state of the target based on the analyzed / determined modified state.
- the base sequence and / or modification state of microRNA (for example, presence / absence of modification, type of modification, position of modification, modification rate, etc.) can be easily, quickly, and / or accurately. Can be identified. Also, according to the present disclosure, a new method of determining the state of interest based on the base sequence and / or modified state of the microRNA may be provided.
- the upper figure of (A) shows the measurement result of unmodified synthetic 200c-5p
- the lower figure of (A) shows the modified synthetic 200c-5p (7th base is methylated adenine, 13).
- the measurement result of (the second base is methylated cytosine) is shown.
- the vertical axis represents relative conductance.
- the reading results corresponding to the 7th base (left) and the 13th base (right) are extracted from the figure of (A), respectively, and the unmodified body and the modified body are compared. Shown.
- FIG. 2 An example of identifying the presence or absence of modification of microRNA obtained from a sample by tunnel current sequencing is shown. From top to bottom, the measurement results of unmodified synthetic 200c-5p, 200c-5p obtained from the sample, modified synthetic 200c-5p (7th base is methylated adenine, 13th base is methylated cytosine) The measurement result of) is shown. The analysis of the measurement result of the sample of FIG. 2 is shown. In the figure (A), the vertical axis represents relative conductance. The figure (B) is a histogram showing the reading results of the 7th base (top) and the 13th base (bottom), respectively. In the figure (B), the vertical axis represents frequency and the horizontal axis represents relative conductance.
- the vertical axis represents the detected tunnel current (pA) and the horizontal axis represents the time (seconds).
- the figure (B) is an enlarged view of the portion surrounded by the frame of the figure (A).
- the horizontal lines crossing the figure are, from the bottom, the base value of the tunnel current, the mode of the maximum current value of uracil, the mode of the maximum current value of adenine, and the mode of the maximum current value of guanine, respectively. It can be seen that the base sequence of "UGAG" was measured in the part of the pulse showing the mode regulation and the duration of about 15 milliseconds in the center.
- FIG. 1 It is a schematic diagram of the system configuration. The result of detecting the difference in the modification state of microRNA between a cancer patient and a healthy person by tunnel current measurement is shown.
- the upper panel is the measurement result of concentrated let7a-5p, and the lower panel is the measurement result of concentrated miR17-5p.
- the vertical axis represents relative conductance. For each adenine, it is shown whether there was a difference in methylation rate between pancreatic cancer patients and healthy subjects.
- the upper row shows the result of tunnel current measurement, and the lower row shows the result of Hiseq measurement.
- FIG. 6 is a graph comparing 6 types of microRNAs (ie, 12 plots for each of the wild strain (WT) and resistant strain (PS)) in the two drug resistance comparisons of FIG. 6 between the tunnel current measurement and the Hiseq measurement. ..
- the vertical axis shows the result of tunnel current measurement, and the horizontal axis shows the result of Hiseq measurement.
- RNA ribonucleic acid
- RNA means a molecule containing at least one ribonucleotide residue.
- ribonucleotide is meant a nucleotide having a hydroxyl group at the 2'position of the ⁇ -D-ribo-furanose moiety.
- RNA includes, for example, mRNA, tRNA, rRNA, lncRNA, miRNA.
- microRNA refers to a functional nucleic acid that is encoded on the genome and undergoes a multi-step production process to eventually become a microRNA with a length of 20 to 25 bases.
- miRNAs such as sequences
- mirbase http://mirbase.org
- modification refers to the condition in which some or all of the constituent units of nucleic acids or their ends are replaced with other atomic groups, or functional groups are added. Point to.
- RNA modifications include, but are not limited to, those shown in the following table, and any modification can be used as long as it corresponds to the modification.
- modified state refers to any state of nucleic acid modification, including the presence or absence of modification, the type of modification, and the position of modification (modification position on the base sequence). , Chemical structural modification position, etc.), ratio of modified nucleic acid, modification rate at a specific modification position, etc. Since the modification also includes a modified form of the nucleic acid itself, the modified state also includes information on whether the nucleic acid itself has changed from the natural one.
- methylation refers to methylation of any position of any type of nucleotide, but typically methylation of adenine (eg, position 6; m6A, 1-position; m1A), methylation of cytosine (eg, 5-position; m5C, 3-position; m3C).
- the detected modification site can be identified by using a method known in the art. For example, m1A and m6A, and m3C and m5C can be determined by chemical modification, respectively. For example, a standard synthetic RNA can be used to determine if the behavior by chemical modification and measurement with MALDI is correct.
- nucleic acid includes modification of sugar moiety and phosphoric acid moiety in addition to modification of base moiety of nucleic acid. It is also contemplated herein that nucleic acid modifications include artificially introduced modifications as well as naturally found modifications.
- nucleic acids with modified sugar moieties include locked nucleic acids (LNA), 2'-O, 4'-C-ethylene bridged nucleic acids (2'-O, 4'-C-ethylene bridged nucleic acid, ENA).
- nucleic acid in which a phosphate moiety is modified includes a nucleic acid in which a phosphodiester bond is replaced with a phosphorothioate bond.
- the "modified position on the base sequence" of the nucleic acid refers to the position where the modified base exists in the base sequence.
- the modified position on the base sequence is the fourth. Is.
- the "chemically modified position" of a nucleic acid refers to a position in which the modification exists within the nucleotide unit of the nucleic acid.
- a nucleic acid represented by AAA (m6A) AA it is on the base sequence.
- the modification position is the fourth, and the modification position on the chemical structure is on N at the sixth position.
- the "modification rate" of nucleic acid refers to the ratio representing the number of hits having at least one modification in the specific sequence among the number of hits having the detected specific sequence. For example, if a specific sequence is AAAAA, 100 hits of GGGGGG, 70 hits of GGAAAAACC, 20 hits of GGAAA (m6A) A, and 10 hits of GGAAA (m6A) (m6A) CC, GGAAAAACC and GGAAAA (m6A) ) 100 hits, which is the sum of A and GGAAA (m6A) (m6A) CC, is the denominator, and 30 hits, which is the sum of GGAAA (m6A) A and GGAAA (m6A) (m6A) CC, including the modified sequence, is the numerator.
- the modification rate of the nucleic acid is 30%.
- the "modification rate at a modification position" of a nucleic acid refers to a specific modification position (modification position on a base sequence or a chemical structure) in a specific sequence among the number of hits having a specific sequence detected. It refers to the ratio representing the number of hits with a modification at the modification position).
- modification on the fourth base sequence of the nucleic acid having AAAAA modification on the fourth base sequence of the nucleic acid having AAAAA
- the modification rate at the position is calculated in the same manner as in the above paragraph, and the denominator is 70 + 20 + 10 hits (100 hits), and the numerator is 20 + 10 hits (30 hits), so it is 30%, and the modification position on the fifth base sequence.
- the modification rate in is calculated in the same manner as in the above paragraph, and the denominator is 70 + 20 + 10 hits (100 hits), and the numerator is 10 hits, so it is 10%.
- tunnel current refers to a current generated by electrons moving beyond an energy barrier.
- the "pattern" of the tunnel current refers to the characteristics of the tunnel current expressed by an arbitrary feature amount (for example, current value (ampere), time, etc.) of the tunnel current.
- measurement is used in the usual sense used in the art, and means to measure and obtain the existence, level, quantity, etc. of a certain object, and to measure quantitatively. In addition, it also includes qualitative measurement.
- detection is used in the usual meaning used in the art, and means to inspect and find a substance, a component, etc.
- identity is an existing substance related to a certain object. It refers to the act of searching for the attribution of a substance from the classification of, and when used in the field of chemistry, it refers to determining the identity of the target substance as a chemical substance (for example, determining the chemical structure).
- Quantitative means determining the amount of a substance of interest present.
- the "quantity" of an analyte in a sample generally refers to an absolute value that reflects the mass of the analyte that can be detected in the volume of the sample. However, the quantity also contemplates a relative quantity compared to another analyte quantity. For example, the amount of analyte in the sample may be greater than the control or normal level of the analyte normally present in the sample.
- the term "subject” refers to a subject to be analyzed, diagnosed or detected in the present disclosure (for example, food, microorganisms, organisms such as humans, cells taken from organisms, blood, serum, etc.). In the case of the subject of the test, it is also called a subject, a subject, or the like.
- biomarker is an index for evaluating the state or action of a certain object. Unless otherwise stated herein, a “biomarker” may be referred to as a “marker.”
- the detection agent or detection means of the present disclosure may be a complex or a complex molecule in which another substance (for example, a label or the like) is bound to a detectable portion (for example, an antibody or the like).
- a detectable portion for example, an antibody or the like.
- complex or “complex molecule” means any construct that includes two or more moieties.
- one portion is a polypeptide
- the other portion may be a polypeptide or other substance (eg, substrate, sugar, lipid, nucleic acid, other hydrocarbon, etc.). You may.
- two or more portions constituting the complex may be bonded by a covalent bond or other bonds (for example, hydrogen bond, ionic bond, hydrophobic interaction, van der Waals force, etc.).
- the "complex” includes a molecule formed by linking a plurality of molecules such as a polypeptide, a polynucleotide, a lipid, a sugar, and a small molecule.
- the term "means” means a tool that can be an arbitrary tool for achieving a certain purpose (for example, detection, diagnosis, treatment), and in particular, in the present specification, “means for selective recognition (detection)". "" Means a means by which an object can be recognized (detected) differently from another.
- MS mass spectrometry
- MS mass spectrometry
- MS refers to a method of filtering, detecting, and measuring ions based on this mass-to-charge ratio, i.e. "m / z”.
- MS techniques generally include (1) ionizing the compound to form a charged compound: and (2) detecting the molecular weight of the charged compound and calculating the mass-to-charge ratio.
- the compound can be ionized and detected by appropriate means.
- a "mass spectrometer” generally includes an ionizer, a mass spectrometer and an ion detector.
- one or more molecules of interest are ionized and the ions are then introduced into a mass spectrometer where the ions are mass (“m”) and charge (“m”) and charge (“m”) due to the combination of magnetic and electric fields.
- the ions are mass (“m”) and charge (“m”) and charge (“m”) due to the combination of magnetic and electric fields.
- m mass
- m charge
- m charge
- m charge
- m charge
- m charge
- selective ion monitoring which selectively detects only the target ions, or selecting one of the ion species purified by the first mass spectrometer as a precursor ion
- SRM Selective reaction monitoring
- the signal-to-noise ratio is improved by increasing selectivity and reducing noise.
- the term “resolution” broadly refers to the ability to measure or identify an object with a device or the like, and is specifically used herein as “resolution (FWHM)" ("m / m /”. (Also known in the art as ⁇ m50%) refers to the observed mass-to-charge ratio divided by the width of the mass peak at 50% of the maximum height (half full width, “FWHM”). In the present specification, the term “resolution” may refer to this specific resolution (FWHM). The higher the resolution, the better the qualitative and quantitative.
- label refers to an entity (eg, substance, energy, electromagnetic wave, etc.) for identifying a target molecule or substance from others.
- labeling methods include RI (radioisotope) method, stable isotope labeling method, fluorescence method, biotin method, optical method using Raman scattering, chemiluminescence method and the like.
- the markers of the present disclosure or a plurality of factors or means for capturing the markers are labeled by an optical method utilizing Raman scattering
- the markers are labeled with substances having different Raman scattering.
- such a label can be used to modify an object of interest so that it can be detected by the detection means used.
- modifications are known in the art and those skilled in the art can appropriately implement such methods depending on the label and the subject of interest.
- diagnosis refers to identifying various parameters related to a condition (eg, disease, disorder) in a subject and determining the current state or future of such condition.
- condition eg, disease, disorder
- the condition within the body can be examined and such information can be used to determine the condition in the subject, the procedure or method for administration or prevention, and the like.
- Various parameters can be selected.
- diagnosis in a narrow sense means diagnosing the current state, but broadly includes “early diagnosis”, “predictive diagnosis”, “pre-diagnosis” and the like.
- the diagnostic method of the present disclosure is industrially useful because it can be used from the body and can be carried out without the hands of medical personnel such as doctors.
- predictive diagnosis, pre-diagnosis or diagnosis may be referred to as "support” in order to clarify that it can be carried out without the hands of medical personnel such as doctors.
- the technique of the present disclosure can be applied to such a diagnostic technique.
- treatment refers to a condition (eg, a disease or disorder) that, in the event of such condition, prevents exacerbation of such condition, preferably maintains the status quo, more preferably. It refers to alleviation, more preferably withdrawal, and includes the ability to exert a symptom-improving effect or a preventive effect on a patient's condition or one or more symptoms associated with the condition. Diagnosis in advance and appropriate treatment is called “companion treatment”, and the diagnostic agent for that purpose is sometimes called “companion diagnostic agent”. The ability to identify RNA modifications using the techniques of the present disclosure may be useful in such companion therapy or companion diagnostics as it can be associated with a particular condition.
- prognosis means predicting the possibility of death or progression due to a disease or disorder such as cancer.
- Prognostic factors are variables related to the natural history of a disease or disorder, and these affect the recurrence rate of patients who have once developed the disease or disorder.
- Clinical indicators associated with worse prognosis include, for example, any cellular indicator used in the present disclosure.
- Prognostic factors are often used to classify patients into subgroups with different pathologies. If RNA modifications can be identified using the techniques of the present disclosure, they can be useful as techniques for providing prognostic factors because they can be associated with specific disease states.
- the "detector also referred to as a detector or detector) means any device capable of detecting or inspecting a target object in a broad sense.
- the term “diagnostic agent” refers to any drug capable of diagnosing a desired condition (for example, medical condition such as cancer or aging, as well as other conditions, species classification, etc.). ..
- kits are a unit in which parts to be provided (for example, a test drug, a diagnostic drug, a therapeutic drug, a reagent, a label, a manual, etc.) are usually divided into two or more sections. To say.
- the form of this kit is preferred when the purpose is to provide a composition that should not be mixed and provided for stability and the like, but is preferably mixed and used immediately before use.
- kits are preferably instructions that describe how the parts provided (eg, test agents, diagnostic agents, therapeutic agents, reagents, labels, etc.) are used or should be treated. Alternatively, it is advantageous to have instructions.
- kit When the kit is used as a reagent kit in the present specification, the kit describes how to use a test agent, a diagnostic agent, a therapeutic agent, a reagent, a label, and the like. Instructions and the like are included.
- a “kit” can also be referred to as a "system.”
- program is used in the usual sense used in the art, and describes the processes to be performed by a computer in order, and is treated as a "thing" under the Japanese Patent Law. It is sometimes referred to as a "program product” for the purpose of clarifying that it is perceptible or patentable. All computers operate according to the program. In modern computers, programs are represented as data, stored in recording media or storage devices, or provided from the cloud.
- the "recording medium” is a recording medium in which a program for executing the method described in the present specification is stored, and the recording medium can record the program and can be read by a computer, and as a result, the read program is read. Anything may be used as long as it can be executed and implemented by another device such as a computer.
- it may be an external storage device such as a ROM, an HDD, a magnetic disk, or a flash memory such as a USB memory that can be stored inside, but the present invention is not limited thereto.
- system refers to a configuration for executing the method or program of the present disclosure, and originally means a system or organization for accomplishing an object, and a plurality of elements are systematically configured. , Which influences each other and is configured so that multiple various devices communicate with each other as needed.
- the whole of hardware, software, OS, network, etc. refers to the composition.
- drug As used herein, “drug”, “drug” or “factor” (both of which correspond to agents in English) are used interchangeably as long as they can achieve their intended purpose. It may be a substance or other element (eg, energy such as light, radioactivity, heat, electricity, etc.) (eg, "inhibitor” can be said to be an agent that "inhibits” what is intended. ). Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (including, for example, cDNA, DNA such as genomic DNA, RNA such as mRNA), poly.
- cDNA DNA such as genomic DNA
- RNA RNA such as mRNA
- Factors specific to a polynucleotide typically include polynucleotides that are complementary to the sequence of the polynucleotide with certain sequence homology (eg, 70% or more sequence identity). Examples include, but are not limited to, polypeptides such as transcription factors that bind to the promoter region.
- Factors specific to a polypeptide typically include an antibody or derivative thereof or an analog thereof (eg, a single chain antibody) specifically directed to the polypeptide, and the polypeptide is a receptor.
- the polypeptide is a receptor.
- a specific ligand or receptor in the case of a ligand, a substrate thereof when the polypeptide thereof is an enzyme, and the like can be mentioned, but the present invention is not limited thereto.
- Electrode pair As used herein, the term “electrode pair” is used in the usual sense as used in the art and generally refers to a pair of electrodes.
- measurement is performed on the target by detecting the tunnel current generated when the target such as microRNA passes between the electrode pairs.
- the distance between the electrode pairs can be important for proper tunneling current generation. If the distance between the electrode pairs is too long than the molecular diameter of each nucleotide that makes up the microRNA, it will be difficult for tunnel current to flow between the electrode pairs, or two or more microRNAs will be between the electrode pairs at the same time. It can get in. On the other hand, if the distance between the electrode pairs is too short than the molecular diameter of each nucleotide constituting the microRNA, the microRNA cannot enter between the electrode pairs.
- the distance between the electrode pairs is preferably slightly shorter, equal to, or slightly longer than the molecular diameter of the nucleotides that make up the microRNA.
- the distance between the electrode pairs is 0.5 to 2 times as long as the molecular diameter of the nucleotide, preferably 1 to 1.5 times as long, and 1 to 1.2 times as long. More preferably, it is twice as long.
- the distance between the electrode pairs is set to, for example, 0.5 nm to 2 nm and 1 nm to 1 with respect to the molecular diameter. It can be set to 5.5 nm or 1 nm to 1.2 nm.
- the distance between the electrode pairs can be kept constant during the measurement, i.e., the distance between the electrode pairs can be controlled so that it does not change during the measurement.
- the rate of change in the distance between the electrode pairs during the measurement can be 5% or less, 2% or less, 1% or less, 0.1% or less, 0.01% or less, 0.001% or less. Keeping the distance between the electrode pairs constant can improve the accuracy of identifying the base sequence and / or modified state of the microRNA.
- the electrode pair used in the present disclosure can be produced by any suitable method.
- the electrode pair can be produced by using a known nanofabricated mechanically-controllable break junctions.
- This nano-processed mechanical fracture joining method is an excellent method capable of controlling the distance between electrodes with excellent mechanical stability with a resolution of picometer or less.
- any conductive material can be used as the material for each electrode of the electrode pair, and for example, a metal (for example, gold) can be used.
- An exemplary specific procedure for making an electrode pair is shown, for example, in the Examples.
- the nanogap electrode produced by mechanically breaking a fine metal wire produced by microfabrication by the feedback method using a piezo actuator and the nanogap electrode produced by microfabrication on a substrate have a constant distance between electrodes even in a solution. Can be easy to hold in.
- Tunnel currents can be measured by passing microRNAs between electrode pairs.
- microRNAs can be passed between electrode pairs by allowing a fluid containing the microRNAs to flow through a device with electrode pairs.
- a medium for dispersing microRNA can be used, and in one embodiment, a medium that does not generate a tunnel current is used, and examples thereof include, but are not limited to, ultrapure water.
- the concentration of microRNA in the fluid may be 0.0001-100 ⁇ M ( ⁇ mol / L), eg, at least 0.0001 ⁇ M, at least 0.0002 ⁇ M, at least 0.0005 ⁇ M, at least 0.
- microRNA in the sample Even if the concentration of microRNA in the sample is unknown, once the microRNA is measured by some method to obtain information on the approximate content and concentration, it is concentrated or diluted to a concentration suitable for measurement with a tunnel current. Can be measured again. If the fluid contains at least one molecule of microRNA, the nucleotide sequence and / or modified state can be analyzed.
- the applied voltage can be, for example, 0.1V to 1V, for example, 0.25V to 0.75V, but is not particularly limited.
- the method of applying a voltage between the electrode pairs is not particularly limited, and for example, a known power supply device may be connected to the electrode pairs and a voltage (for example, a bias voltage) may be applied between the electrode pairs.
- the microRNA of interest may be physically, chemically or biologically pretreated prior to measurement.
- Pretreatment can, for example, improve sensitivity, accuracy and / or accuracy in measuring the microRNA of interest, further differentiate modified states, improve quantification in intersample comparisons, control the direction of movement in solution.
- the direction of the microRNA that invades the electrode pair (for example, preferentially invades from 3') and other effects can be obtained.
- the agent used for pretreatment can be designed to introduce a group into the amine moiety, terminal phosphate group or hydroxyl group on the base of the microRNA.
- the specific method for passing the microRNA between the electrode pairs is not particularly limited, but for example, the microRNA is moved by thermal diffusion (that is, Brownian motion) or AC voltage, and the movement causes the microRNA to pass between the electrode pairs. It is possible to pass it.
- the microRNA can be transferred by thermal diffusion and passed between the electrode pairs by the transfer so that the microRNA can be present between the electrode pairs for an extended period of time. More information on microRNAs can be obtained as it becomes possible.
- the temperature at which the microRNA is thermally diffused is not particularly limited and can be set as appropriate. For example, temperatures such as 5 ° C. to 70 ° C. and 20 ° C. to 50 ° C. can be used.
- the present disclosure does not require electrodes with pores formed by proteins, so even if microRNAs are thermally diffused at high temperatures, the electrodes will not lose their function. Further, if the microRNA is thermally diffused at a high temperature, it is possible to prevent the microRNA from intermolecularly and intramolecularly interacting (for example, hydrogen bond), preventing the formation of complementary strand pairs, and microRNA. The base sequence and / or modified state of is more accurately identified.
- the first nucleotide may be a nucleotide at the 5'end of the polynucleotide, a nucleotide at the 3'end of the polynucleotide, or between the 5'end and the 3'end. It may be a nucleotide that is present.
- the second nucleotide may be a nucleotide adjacent to the first nucleotide, or may be a nucleotide not adjacent to the first nucleotide.
- the position of the second nucleotide may be 5'terminal to the first nucleotide or 3'terminal.
- tunneling currents due to multiple nucleotides of microRNA are generated between the electrode pairs.
- the tunneling current generated between the electrode pairs disappears.
- the tunnel current generated between the electrode pairs can be measured using a known ammeter. Further, a current amplifier may be used to amplify the signal of the tunnel current. By using a current amplifier, it is possible to amplify a weak tunnel current value, so that the tunnel current can be measured with high sensitivity. Any current amplifier can be used, and examples thereof include a commercially available variable high-speed current amplifier (manufactured by Femto, catalog number: DHPCA-100).
- the tunnel current can be affected by the distance between the electrodes, the concentration of microRNA in the solution, the shape of the electrodes, the voltage between the electrode pairs, and the like. Therefore, when comparing and referring to the results of different measurement conditions, the data (for example, the feature amount of the tunnel current) can be adjusted appropriately.
- the same nucleotide can produce tunneling currents with different characteristics (eg, different peak heights). For example, peaks of different heights may appear due to the change in distance between the electrode and the nucleotide due to the movement of the nucleotide. That is, as the distance between the nucleotide and the electrode becomes shorter, the tunnel current is likely to be generated, so that the current value of the tunnel current increases and a higher peak appears. Therefore, in one embodiment, a wide range of features (eg, a range of peak heights) and / or a combination of different types of features are used to identify the sequence and / or modified state of the microRNA. obtain.
- any feature of the measured tunnel current (eg, peak height, peak width, peak frequency, peak shape and combination thereof) can be used to identify the base sequence and / or modified state of the microRNA. it can.
- a pattern of tunneling currents can be represented by these features or combinations of features.
- the tunneling current itself generated as the microRNA passes between the electrode pairs can be used for identification.
- the pulse of tunneling current generated as the microRNA passes between the electrode pairs can be used for identification.
- the current value of the tunnel current may be used, or the conductance of the tunnel current may be used instead of the current value.
- Conductance can be calculated by dividing the current value of the tunneling current by the voltage applied to the electrode pair. By using conductance, a unified reference profile can be obtained even if the voltage value applied between the electrode pairs varies from measurement to measurement. When the voltage value applied between the electrode pairs is constant for each measurement, the current value of the tunnel current and the conductance can be treated equally.
- a plurality of pulses can be detected for one base in the passing microRNA molecule, but one pulse may or may not be detected.
- the number of pulses detected for an individual base in a microRNA molecule is not particularly limited, but the greater the number, the more accurate and / or highly accurate the base type and / or modified state can be identified. The longer the measurement time, the more pulses can be detected.
- the average measurement time per nucleotide is, for example, about 5 ms, about 10 ms, about 20 ms, about 50 ms, about 100 ms, about 200 ms, about 500 ms. It can be seconds, about 1000 milliseconds, about 2000 milliseconds, about 5000 milliseconds, or about 10000 milliseconds.
- the tunnel current pulse can be detected by measuring the tunnel current flowing between the electrode pairs and determining whether or not the current value of the tunnel current exceeds the base level over time. Any time frame containing the current value of the tunnel current above the base level can be detected as a pulse, but for example, identify when the tunnel current exceeds the base level and when it returns to the base level again. Thus, the signal between these two time points can be detected as a pulse of tunneling current due to nucleotides.
- One pulse may be associated with one or more nucleotides, or one or more pulses may be associated with one nucleotide.
- FIGS. 2 show an example of a pulse of tunnel current.
- any feature of each pulse or pulse combination can be extracted and used for identification from the graph showing the measured tunnel current value and the tunnel current measurement time.
- the magnitude of the current, the frequency of pulses per hour, the duration of the pulse, the shape of the pulse, and the like can be used, but are not limited thereto.
- the maximum current value (Ip) and / or pulse duration (tp) of the pulse can be used for identification.
- a tunneling current may begin to occur in the second nucleotide before the current value returns to the basal level. Yes (for example, FIG. 6 (C)).
- the first and second nucleotides are likely to be contiguous nucleotides in the molecule. Since the current value does not return to the basal level, it can be counted as one pulse for multiple nucleotides, but it may be counted as multiple pulses depending on the characteristics of the pulse (eg, current value and pulse duration).
- the maximum current value of each pulse can be obtained by subtracting the basis level from the current value of the highest peak of each pulse for the tunnel current measurement result of a certain nucleotide. Then, the mode can be calculated by performing statistical analysis on each of the obtained maximum current values. In order to obtain the mode value, for example, a histogram showing the relationship between the value of the maximum current value and the number of pulses having the value is generated. Then, the generated histogram is fitted to a predetermined function. Then, the mode can be calculated by obtaining the peak value of the fitted function. Examples of the function used for fitting include a Gaussian function and a Poisson function.
- this mode can be a value unique to each nucleotide, for example, under the same measurement conditions and / or the same environment, this mode can be used as an index for identifying the nucleotides constituting the polynucleotide. Can be used.
- the mode of the maximum current value has a distribution
- the mode may be used as the mode of one point or as the distribution of the mode. For example, comparing the mode distribution of the maximum current value of the first nucleotide with the mode value distribution of the maximum current value or the maximum current value of the second nucleotide, the first nucleotide and the second nucleotide are compared. Similarities with nucleotides (eg, the probability of being the same nucleotide, the possibility of having a relationship between modified and unmodified nucleotides) may be determined.
- the base sequence and / or modification information of the microRNA is identified based on the measurement result of the tunnel current of the target microRNA. In one embodiment, both the nucleotide sequence and modification information of the microRNA are identified. In one embodiment, the modified position on the base sequence of the microRNA is identified. In one embodiment, the location of the chemical structural modification of the microRNA is identified. In one embodiment, the modification rate of the microRNA is identified. In one embodiment, the rate of modification of the microRNA at a particular modification position is identified. In one embodiment, information on the modification of the microRNA nucleotide itself is identified.
- the type of modification identified can be arbitrary, and according to the present disclosure, any type of microRNA can be identified by a pattern of tunneling currents. In one embodiment, for example, microRNA methylation is identified.
- any suitable reference information other than the measurement result of the tunnel current of the target microRNA may be referred to. It is not necessary to identify all the nucleotides contained in the measured microRNA, for example, it may be sufficient to identify a particular nucleotide sequence and / or modified state at a particular location.
- the identification result may be output together with a specific base sequence and / or the probability of being in a modified state.
- time-series signal data of conductance values are acquired and assembled for each microRNA sequence to create a histogram of conductance values to identify the type of microRNA. And / or the signal can be associated with a nucleotide at a particular position.
- each of the one or more nucleotides contained in the measured microRNA may be identified.
- the partial structure in the measured microRNA may be identified.
- the entire measured microRNA molecule may be identified. For example, the tunneling currents of the entire microRNA molecule can be compared to identify whether the two measurements are from the same microRNA molecule.
- the reference information for identifying each nucleotide is by measuring the tunneling currents of the various modified and unmodified nucleotides to obtain pulse characteristics (eg, maximum current values). Will be created.
- the modified nucleotide and the unmodified nucleotide may be measured as a mononucleotide, or those incorporated in the polynucleotide (for example, a polynucleotide having the same structure other than the desired modified or unmodified nucleotide) are measured. May be good.
- such reference information may be obtained by measuring the synthesized microRNA, or such reference information may be obtained by measuring the concentrated microRNA using a specific modification-specific antibody. You may get it.
- the reference information for identifying each nucleotide may be made from calculated values based on the structure of modified and / or unmodified nucleotides, or may be made by combining the calculated and measured values. Good. For example, such calculated values can be obtained by calculating the highest molecular orbital energy (HOMO) occupied based on density functional theory, based on the structure of modified and / or unmodified nucleotides.
- HOMO highest molecular orbital energy
- the conductance values of nucleotides and modified nucleotides are measured in the monomer data, and the range of conductance values of the nucleotides and modified nucleotides in the nucleic acid sequence is set in consideration of the peak position and shape of the histogram. May be good. For example, based on the adenine and methylated adenine conductance values (0.7 and 0.8, respectively) in the monomer data, the adenine and methylated adenine conductance values in the nucleic acid sequence were set to 0.60 to 0, respectively. It may be set in the range of 8 and 0.75 to 0.90.
- the nucleotide For each signal corresponding to the position of the target nucleotide, it can be determined whether or not the nucleotide is modified by using the probability density such as the Gaussian function as an index. In one embodiment, based on this determination result, the number of adenine and the number of methylated adenine are counted, and the methylation rate (amount) is calculated as the number of methylated adenine / (the number of adenine + the number of methylated adenine). Can be calculated.
- the difference in methylation rate between the measurement results of microRNAs obtained from the target sample and the control sample is a specific value, for example, about 1-10000%, about 1%, about 2%, about 3%, about.
- the sample of interest can be identified as having the medical or biological condition of interest.
- the same or similar sample as measured by tunnel current is used as reference information to identify the sequence and / or modified state of the microRNA contained in the sample. be able to. Since the measured microRNA can be recovered without being decomposed in the tunnel current measurement, the recovered microRNA can be used for other analytical means.
- a mixed sample from the same sample may be subjected to tunneling current measurement and another sample from the same sample may be used for other analytical means.
- the result of the tunnel current measurement and the result of the mass spectrometric measurement may be combined.
- Mass spectrometric measurements can identify the nucleotide sequence and / or modified state (eg, position and presence or absence) of the microRNA contained in the sample at high throughput. Even if the type of modification (for example, monomethylation of adenine) is known by mass spectrometric measurement, the difference in the modification position in the chemical structure can be difficult to detect as the difference in the mass number, and the modification in the chemical structure. The location is usually identified in combination with other information, such as derivatization of the sample by chemical treatment. On the other hand, in tunnel current measurement, the difference in the modified position in the chemical structure can be detected as the difference in the tunnel current.
- the combination of tunneling and mass spectrometry can complement each other's information and provide high throughput of reference information for identifying microRNA nucleotide sequences and / or modified states based on tunneling current measurements. It may be possible to collect at. For example, if a mass spectrometric measurement reveals that a base at a position on the microRNA is replaced by a modified base (having a specific mass difference), the tunneling current measurement result at that base position is associated with the modification information. be able to.
- this modification information (for example, information on the modification position on the chemical structure) can be supported, for example, by collating with known information of synthetic microRNA.
- the mass spectrometer that can be used includes a magnetic field type, an electric field type, a quadrupole type, a time-of-flight type (TOF), and the like. Mass spectrometry can be combined with any ionization method.
- the ionization methods that can be used in the present disclosure include, for example, electron ionization method (EI), chemical ionization method (CI), fast atom bombardment (FAB), matrix-assisted laser desorption ionization method (MALDI), and electrospray ionization. Law (ESI), but is not limited to these.
- ESI can be combined with liquid chromatography, supercritical chromatography, etc., and it is possible to measure while separating a plurality of types of RNA by chromatography.
- columns that can be used for chromatography include hydrophilic interaction chromatography (HILIC) columns, reverse phase (RP) chromatography columns, and the like.
- the sample is premixed as a matrix with a substance (coating agent) that is easily ionized by laser light, placed at a spot (anchor position) on the target plate, and ionized by irradiating this with laser light.
- the modified state of RNA eg, with or without modification, location of modification, modification
- the modified state of RNA based on measurements of unfragmented ions (parent ions) and / or fragmented ions (daughter ions). Number of qualifications, reliability of modification, etc.
- the modified state of RNA eg, stable isotope-labeled nucleic acid, unmodified nucleic acid, the other nucleic acid of the pair that formed the complementary double strand, etc.
- the data of mass spectrometry can be processed by any software and converted into an RNA-modified state.
- examples of such software include, but are not limited to, the DNA methylation analysis system MassARRAY® EpiTYPER (Sequenom).
- the modified state (for example, the modified position on the chemical structure) can be identified only by the tunnel current sequence measurement thereafter.
- the sequence and its modification information can be specified at once by combining a specific nucleic acid sequence and a modified state.
- Any suitable method can be selected to support the type of modification, eg, radiation emitted from radioactive atoms contained in the moieties that make up the modification (eg, the methyl moiety) may be identified.
- the binding of a molecule that specifically binds to the modification eg, a modification-specific antibody
- the reactants may be measured (eg, measurement of the reactant light, detection of the reaction-produced biotin derivative by streptavidin, etc.).
- the identification of the base sequence and / modification information of the microRNA based on the measurement result of the tunnel current is shown by, for example, the following specific examples, but none of these examples is limited. .. •
- a nucleotide at a position where certain modifications are expected to occur may be weighted so that it is more likely to be identified as a modified nucleotide.
- a microRNA candidate having an identified base sequence can be selected, and a base having low reliability can be identified from a more limited choice.
- nucleotide that cannot be identified with high accuracy is present as a result of interpreting the result of tunnel current measurement based on the existing reference information, it may be treated as a modified nucleotide that is not included in the existing reference information.
- the modification rate at a specific modification position the presence or absence of the specific modification at the modification position does not have to be counted as a hit with or without modification when the specific threshold value is not reached.
- reference information for identifying the base sequence and / or modification information of a part or all of the measured microRNA can be accumulated.
- any modification, deletion and / or addition can be made to the accumulated reference information.
- the disclosure provides a database constructed from accumulated reference information for identifying measured microRNA nucleotide sequences and / or modification information based on tunnel current measurement results.
- the disclosure provides a method of analyzing the condition of a subject based on the nucleotide sequence and / or modification information of the microRNA. In another aspect, the disclosure provides a method comprising associating a microRNA nucleotide sequence and / or modification information with a state of interest. In these methods, the nucleotide sequence and / or modification information of the microRNA can be identified by any of the methods described above based on the tunneling current measurement results.
- the microRNA is present in the sample.
- the sample is derived from a subject, where the subject is a mammal (eg, human, chimpanzee, monkey, mouse, rat, rabbit, dog, horse, pig, cat, etc.), microorganism (eg, human, chimpanzee, monkey, mouse, rat, rabbit, dog, horse, pig, cat, etc.).
- pathogens for example, pathogens, microorganisms used for fermentation, bacteria such as Escherichia coli, parasites, fungi, viruses (for example, RNA viruses such as coronavirus), edible organisms (birds, fish, reptiles, fungi, plants, etc.), appreciation ⁇ Examples include, but are not limited to, pet organisms and environmental indicator organisms.
- the sample is derived from a subject that is or may be in a particular state.
- specific conditions include, but are not limited to, disease, age, gender, race, ancestry, medical history, treatment history, smoking status, drinking status, occupation, living environment information, and the like.
- the sample is an organ, tissue, cell (eg, circulating tumor cells (CTC)), blood (eg, plasma, serum, etc.), mucosal epidermis (eg, oral cavity, nasal cavity, etc.) obtained from the subject. (In the ear cavity, vagina, etc.), skin epidermis, biosecretory fluid (eg, plasma, runny nose, sweat, tears, urine, bile, etc.), feces, epidermal microorganisms or parts thereof.
- the sample is a cultured cell (eg, a cell-based organoid obtained from a subject, a particular cell line, etc.).
- the sample is a food or portion thereof, or a microorganism on the food.
- the microRNA may or may not be purified in advance to measure the microRNA.
- a "purified" substance or biological factor eg, a microRNA or protein such as a genetic marker
- a purified biological factor is one in which at least some of the factors naturally associated with the biological factor have been removed. Say something. Therefore, the purity of the biological factor in the purified biological factor is usually higher (ie, enriched) than in the state in which the biological factor is normally present.
- the term "purified” as used herein is preferably at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and most preferably at least 98% by weight. It means that the same type of biological factor is present.
- the material used in the present disclosure is preferably a "purified" material.
- isolated means that at least one of the naturally occurring microRNAs is removed, for example, when a specific microRNA is extracted from the total microRNA. It can be said. Therefore, the microRNAs used herein can be isolated.
- all types of microRNAs may be purified from other components without distinction.
- microRNAs having the sequence of interest may be purified from other components.
- microRNAs with modifications may be purified from other components.
- microRNAs with methylation modifications may be purified from other components.
- the desired microRNA may be purified by purifying the nucleic acid molecule after allowing a DNA-degrading enzyme to act on it.
- the plurality of types of microRNAs may be purified separately, in parallel, or in a mixed state.
- 1,2,3,3,4,5,10,15,20,25,30,35,40,45,50,75,100,150,200,300,400,500, 750, 1000, 1500, 2000, 2500 or 3000 RNAs may be purified in parallel (eg, using a carrier-bound sequence-specific RNA capture molecule).
- nucleic acid molecules that are at least partially complementary to the sequence of interest may be used to purify the microRNA having the sequence of interest, wherein said complementation.
- Nucleic acid molecule may contain any moiety for purification.
- a carrier which may be magnetic, if desired
- a pair of molecules that bind to each other such as biotin and streptavidin, binds to each other.
- Examples include, but are not limited to, a moiety for binding a pair of molecules (for example, an alkyne moiety in click chemistry), an antibody recognition moiety, and the like.
- binding molecules may be used to purify the microRNA of interest.
- binding molecules eg, antibodies
- binding molecules eg, antibodies
- RNA modification eg, methylation
- a binding molecule specific for a particular sequence eg, an antibody
- the modification in the modified microRNA is an artificially introduced modification.
- artificially introduced modifications include, but are not limited to, modifications introduced by chemical synthesis, when the drug is treated with an organism (including a virus) and the drug is RNA in the organism. Also includes modifications resulting from binding to.
- treatment of an organism with a drug that directly chemically interacts with nucleic acids in the body can result in modified RNA into which a moiety derived from this drug has been introduced.
- a nucleic acid (type, position, etc.) in which such an artificial modification is likely to be introduced can be easily identified, and such an artificial modification is introduced.
- Nucleic acids with high potential can be usefully used as indicators or biomarkers for drug research and development.
- the desired microRNA may be purified by purifying an organelle (eg, an exosome).
- an organelle eg, an exosome
- intracellular organelles e.g, exosomes
- the microRNA of interest may be purified by using a molecule (eg, an antibody) that binds to a molecule present in an organelle (eg, an anti-CD63 antibody to produce an exosome. Purify).
- microRNA nucleotide sequence and / or modification information is used to analyze the medical or biological condition of the subject.
- the medical or biological condition of the subject may be, for example, disease, aging, immune status (eg, intestinal immunity, systemic immunity, etc.), cell differentiation status, responsiveness to a drug or treatment, target microorganism (eg, intestinal).
- target microorganism eg, intestinal
- the state of bacteria, epidermis but is not limited to these.
- Diseases that can be analyzed in this disclosure include, for example, neurological diseases, pollution diseases, pediatric surgical diseases, fungal diseases, specific diseases, infectious diseases, cancer (malignant tumors), digestive diseases (including inflammatory bowel diseases).
- Neurodegenerative diseases allergic diseases, parasite diseases, animal infections, urinary tract tumors, various syndromes, respiratory diseases, mammary gland tumors, personality disorders, skin diseases, sexually transmitted diseases, dental diseases, mental diseases, kidneys Urinary diseases, eye diseases, food poisoning, red spot disease intermediate host, hepatitis, cardiovascular disease, playful diseases, collagen diseases, symptoms, common veterinary diseases, paraphilia, immune diseases (including intestinal immunity), congenital diseases, developmental disorders, Eczema, congenital heart disease, area-specific disease name, fear, viral infection, male reproductive disease, animal disease, fish disease, proliferative disease, polyp, periodontal disease, mammary gland disease, genetic disease, blood disease, metabolic endocrine Diseases, gynecological diseases, diseases that cause fever and rash, soft tumors, plant diseases, etc.
- Diseases that can be analyzed particularly preferably in the present disclosure include, for example, cancer, inflammatory bowel disease, Alzheimer's or angiopathic dementia, borderline psychiatric disease, dilated cardiomyopathy, hypertrophic cardiomyopathy, heart failure (hidden). (Including mild ones), heart disease (eg, those that induce sudden death due to arrhythmia, including fatal ones), but not limited to these, these diseases cause specific cell metabolism. It can affect the modified state of RNA through.
- the state of the target microorganism is a state that can be a public hygiene incident, for example, a state of resistance to heat treatment and disinfectants (for example, a state of spore formation such as hepatitis E virus parasitizing incompletely cooked food).
- a virus for example, hepatitis RNA virus, papilloma DNA virus, corona virus
- the present disclosure includes pancreatic cancer (eg, early pancreatic cancer), liver cancer, gallbladder cancer, biliary tract cancer, stomach cancer, colon cancer, bladder cancer, kidney cancer, breast cancer, lung cancer, brain tumor, and skin. It is highly significant from a medical point of view because it can also target cancer such as pancreatic cancer.
- the obtained microRNA base sequence and / or modification information is used to analyze the stage of cancer (eg, pancreatic cancer).
- a target organism eg, anticancer drug, molecular target drug, antibody drug, biologic (eg, nucleic acid, protein), antibiotic, etc.) or treatment.
- drug eg, anticancer drug, molecular target drug, antibody drug, biologic (eg, nucleic acid, protein), antibiotic, etc.
- drug resistance can be analyzed, and it can be applied to, for example, responsiveness of anticancer agents, selection of appropriate therapeutic agents, analysis of antibiotic resistance, and the like.
- the analysis of the present disclosure can also be used to analyze the course and prognosis of surgery or radiation procedures such as heavy ion beam (eg, Carbon / HIMAC) or X-ray procedures.
- a drug for treating the above-mentioned condition when examining the responsiveness to a plurality of drugs, a drug for treating the above-mentioned condition can be indicated from among the plurality of drugs.
- the analysis can be based on a comparison of the nucleotide sequences and / or modification information (eg, methylation) of the microRNAs of the present disclosure in the subject before and after administration of the drug or the treatment.
- the subject of biological or medical status analysis is of age, gender, race, family information, medical history, treatment history, smoking status, drinking status, occupational information, living environment. At least one selected from the group consisting of information, disease marker information, nucleic acid information (including nucleic acid information of bacteria in the subject), metabolite information, protein information, gut flora information, epidermal bacterial information and any combination thereof.
- the analysis can be performed with further consideration of the two pieces of information.
- the nucleic acid information that can be used in the method of the present disclosure include genomic information, epigenome information, transcriptome expression level information, RIP sequencing information, microRNA expression level information, and any combination thereof. it can.
- the RIP sequencing information that can be used individually may include RIP sequencing information of drug resistance pump P-glycoprotein, RIP sequencing information of feces, RIP sequencing information of Escherichia coli in feces, and the like.
- the state of the subject is analyzed further based on the nucleotide sequence and / or modified state of the microRNA in the resistant strain to the drug or treatment, or the combination of the resistant strain and the cell line from which the resistant strain was derived.
- agents or treatments include, for example, Ronsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, histone demethylase inhibitors, or heavy ion beams (eg, Carbon / HIMAC) or X. Treatment with lines can be mentioned, but is not limited to them.
- microRNAs to be analyzed in the present disclosure can be increased or decreased depending on the purpose of analysis, for example, at least 5, at least 10, at least 20, at least 30, at least 50, at least 100.
- the nucleotide sequences and / or modified states of at least 200, at least 300, at least 500, at least 1000, at least 1500, and at least 2000 microRNAs can be analyzed. Alternatively, all available microRNAs may be targeted. In one embodiment, multiple modification information on microRNAs containing the same sequence can be analyzed. In another embodiment, the condition of the subject can be analyzed based further on the structural information of the microRNA.
- a family having a YTH domain such as a methylating enzyme (eg, Mettl3, Mettl14, Wtap), a demethylating enzyme (eg, FTO, AlkBH5) and a methylation recognizing enzyme (eg, YTHDF1, YTHDF2, YTHDF3).
- a methylating enzyme eg, Mettl3, Mettl14, Wtap
- a demethylating enzyme eg, FTO, AlkBH5
- a methylation recognizing enzyme eg, YTHDF1, YTHDF2, YTHDF3
- the base sequence and / or modified state of the microRNA in an organism in which at least one of the molecules has been knocked down, and / or methylases (eg, Mettl3, Mettl14, Wtap), demethylases (eg, FTO, etc.).
- a step of calculating the probability of a state based on a plurality of modification information may be performed.
- any statistical method can be carried out, for example, principal component analysis or the like can be carried out.
- an anticancer agent eg, Ronsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drug or histone demethylase inhibitor
- TAS102 Ronsurf
- gemcitabine gemcitabine
- CDDP 5-FU
- cetuximab nucleic acid drug or histone demethylase inhibitor
- new mechanisms of action of various drugs can be elucidated to create medium-molecular-weight compounds that can be applied in further therapeutic strategies, for example, planning a strategy for overcoming intractable advanced cancer. Can be used for.
- the mechanism of action can be further elucidated by analyzing the microRNA by the method of the present disclosure. That is, the method of the present disclosure can be used to analyze microRNAs specific to drugs such as anticancer drugs, and companion diagnostics can be designed using these microRNAs.
- companion diagnostics can be performed using miRNAs in peripheral blood obtained by minimally invasive liquid biopsy.
- drugs eg, Ronsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs or histone demethylase inhibitors
- TAS102 e.g., Ronsurf
- gemcitabine e.g., gemcitabine
- CDDP e.g., 5-FU
- cetuximab e.g., azathionine
- nucleic acid drugs or histone demethylase inhibitors eg., asedoxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxifen, doxif
- cancer stem cells or Cancer Initiating Cell (CIC).
- CIC Cancer Initiating Cell
- the analysis of the present disclosure can also be applied when the modified RNA itself is the target molecule of the drug. That is, the analytical technique of the present disclosure can be used to screen for novel agents by detecting modified or unmodified RNA.
- the application of microRNA nucleotide sequences and / or modified states (eg, methylation) to the screening of such novel agents has not been previously known, and the present disclosure presents agents with new mechanisms of action. It can be provided.
- the analysis of the present disclosure can also be applied when the modified RNA itself is a component molecule of the drug.
- the analytical technique of the present disclosure by detecting an RNA modification or non-modification, it is possible to analyze whether an external factor such as an RNA modification of interest or an enzyme responsible for the modification is available as a drug. It is possible to screen for new drugs.
- nucleic acids for example, base substitution and / or modification information of nucleic acids (DNA, RNA, etc.) are combined and analyzed. It is understood that can be done.
- base substitution and / or modification information of nucleic acids DNA, RNA, etc.
- Sijia Huang et al., Front Genet. 2017; 8:84 Yehudit Hasin et al., Genome Biol. 2017; 18:83 and other omics other than RNA modification (epitranscriptome).
- Information on other nucleic acids can be analyzed by, for example, mass spectrometry.
- RIP-seq is applied to RNA
- DIP-seq is applied to DNA
- BrdU is used for FDNA. It can be analyzed by performing FDIP-seq.
- the analytical techniques of the present disclosure can elucidate new mechanisms based on clinical evidence.
- drug discovery target research can be performed in the present disclosure.
- drug discovery of low- or medium-molecular-weight compounds targeting interactions between multiple molecular complexes and targets can be performed, library screening, and phenotype screening using organoids or individual animals.
- the technique for analyzing the base sequence and / or modified state of the microRNA of the present disclosure can be utilized in performing the above.
- the present disclosure can be used in drug discovery corresponding to tumor diversity.
- the nucleotide sequence and / or modified state of the microRNA of the present disclosure for example, methylation information of the microRNA
- single molecule measurement of modified DNA incorporating ChIP-seq and FTD and further, the stroma of the tumor tissue. It can be applied in combination with CAF (Cancer Associated Fibroblasts) and single cell analysis of lymphocytes (C1).
- CAF Cancer Associated Fibroblasts
- C1 single cell analysis of lymphocytes
- the disclosure traces a drug to (1) broadening the indications to others, (2) showing non-inferiority to other preceding drugs and dating back to 2nd line therapy (3). It can be applied to elucidate a new mechanism of action and to verify the possibility of being linked to a therapeutic drug.
- the expression information of serum exosome miRNA is prepared as a liquid biopsy of a patient such as a cancer patient, and the expression information of serum exosome miRNA of the treated patient to be analyzed and the micro of the present disclosure are prepared.
- the base sequence and / or modified state of RNA can be analyzed. Therefore, for example, in the case of colorectal cancer, for example, using a database of 1000 cases (The Cancer Genome Atlas-Cancer Genome; TCCA), expression information and bases of miRNA in serum exosomes of patients with advanced colorectal cancer. Sequences and / or modified states can be analyzed.
- tissue homeostasis can be grasped by the base sequence and / or modified state of microRNA, and clinical application can be performed using this.
- the target is a transcription factor, that is, a key inducing factor that (in many cases, exactly) controls the expression of the target gene. It can also be a point. In this case, the number can be narrowed down by carefully selecting independent transcription factors.
- c-myc which acts as an oncogene
- miRNA also referred to as “microR”, “microRNA” or “miR”
- miRNA is used, but in this case, it is characterized by a many-to-many correspondence.
- one of the important points is that one microR acts on a plurality of cells and shares a common target among microRNAs as different molecules.
- there is an important set that induces an event not just one molecule. Rather, it can be said that it is a feature of the analysis provided by the present disclosure that it is a limited set and that it can be expressed with a weight value that can express the hierarchy in the set.
- the diagnosis of cancer is assumed based on the base sequence and / or modified state of the microRNA, but the diagnosis is not limited thereto, and drug resistance (not only an anticancer drug but also a molecular target drug, an antibody) is assumed.
- drug resistance not only an anticancer drug but also a molecular target drug, an antibody
- Pharmaceuticals, biologics such as nucleic acids, and more broadly, antibiotics derived from microorganisms), species population classification, inflammatory bowel disease, Escherichia coli, food classification (origin, age, taste, quality, expiration date, taste) Etc. can also be assumed.
- the nucleotide sequence and / or modified state of the microRNA can be used to select the jiuqu.
- the distribution of IC50s is very different, with 5-FU working well for those that work, but not for all. It has been found to be ineffective and can also be found in the epitranscriptome. For example, when looking at microRNAs, it is possible to draw a detailed classification line by looking at the epitranscriptome rather than looking at the expression, which makes a big difference in principal component analysis (PCA). I know.
- PCA principal component analysis
- RNA methylation is known to be associated with circadian rhythms (Sanchez et al., Nature. 2010 Nov 4; 468 (7320): 112-6 and Jean-Michel et al., Cell Vol. 155, Issue 4, pp. 793-806 7 November 2013 etc.).
- the nucleotide sequence and / or modified state of the microRNA can be used to analyze sleep activity associated with time difference (such as jet lag). For example, based on such an analysis, is it recommended to determine if a subject's sleep activity may be affected by time difference and related personnel or medical management, pilot or flight attendant management, taking melatonin? Some kind of stratification can be carried out.
- the nucleotide sequence and / or modified state of the microRNA can be used to analyze jet lag in space flight.
- the nucleotide sequence and / or modified state of the microRNA can be used to analyze whether the subject sleeps adequately. Lack of hidden sleep is a problem, but in many cases it is unaware of the person. Therefore, to correct this, the base sequence and / or modified state of the microRNA can be used. In one embodiment, it is matched with sleep life therapy. In one embodiment, the nucleotide sequence and / or modified state of the microRNA can be used for the health care of the coach driver. In one embodiment, the nucleotide sequence and / or modified state of the microRNA can be used for welfare management. In one embodiment, the nucleotide sequence and / or modified state of microRNAs can be used for the health care of night shift workers (steel, nuclear, hospitals, medical personnel, guards, building management companies, etc.). it can.
- night shift workers steel, nuclear, hospitals, medical personnel, guards, building management companies, etc.
- the microRNA nucleotide sequence and / or modified state of a blood sample can be used to analyze the age of the subject for use in criminal investigations.
- the nucleotide sequence and / or modified state of the microRNA can be used to analyze the presence or absence of doping.
- the acquired microRNA nucleotide sequence and / or modified state can be used to search for new biomarkers.
- the base sequence and / or modified state of the microRNA obtained in a subject in a certain state is compared with the base sequence and / or modified state of the microRNA obtained in a subject not in that state.
- An RNA or group of RNAs in which a difference (eg, statistically significant difference) in the base sequence and / or modified state of the microRNA is observed can be used as a biomarker for predicting the state.
- the nucleotide sequence and / or modified state of the microRNA obtained in the drug and / or treated subject is the base of the microRNA obtained in the drug and / or untreated subject.
- the nucleotide sequence and / or modified state of the microRNA obtained in a resistant strain resistant to a drug and / or treatment is transferred to the microRNA obtained in the wild strain from which the resistant strain was derived.
- resistant strains can be produced, for example, by maintaining and culturing wild strains in the presence of drugs and / or treatments, and in one aspect, the present disclosure provides methods for producing such resistant strains. provide.
- resistant strains to drugs and / or treatment can be evaluated whether it is resistant strains based on IC 50 for drug and / or treatment.
- the disclosure is resistant to trifluridine (FTD), 5-fluorouracil (5-FU), gemcitabine, cisplatin, cetuximab, Carbon / HIMAC (heavy particle beam), and X-rays, respectively.
- FTD trifluridine
- 5-fluorouracil 5-fluorouracil
- gemcitabine gemcitabine
- cisplatin cetuximab
- Carbon / HIMAC carbon / HIMAC
- the nucleotide sequence and / or modified state of the obtained microRNA can be used to evaluate a new drug.
- the microRNA base sequence and / or modified state obtained in a subject treated with one drug is combined with the microRNA base sequence and / or modified state obtained in a subject treated with another drug. By comparison, classification can be made between drugs based on the RNA that fluctuates with each drug treatment.
- the nucleotide sequence and / or modified state of the obtained microRNA can be used to classify species.
- a subject for example, a mammal such as a human being, a food, etc.
- the microorganism was obtained can be analyzed.
- the nucleotide sequence and / or modified state of the obtained microRNA can be used to analyze food quality.
- Food quality includes, for example, origin, age, elapsed time after processing, freshness, post-processing degeneration, taste, active oxygen state, microbial contamination (Escherichia coli, Salmonella, botulinum, virus, parasite, etc.), fermentation state (fermentation Examples include, but are not limited to, chemical factors (eg, pesticides, additives, etc.), physical factors (eg, foreign substances, radiation, etc.), fatty acid status or maturity.
- food quality can be analyzed using the nucleotide sequence and / or modified state of microRNAs obtained for food quality control by public authorities such as government agencies.
- the quality of food can be analyzed using the nucleotide sequence and / or modified state of the microRNAs obtained to provide an indicator for consumers to determine the quality of the product (taste, Objectively express what was expressed by the smell).
- RNA modification for example, methylation
- DNA and RNA information on continuous base sequences is lost (shortly fragmented) with degradation, but methylation expresses its quality as long as there is a target site. Since it is expressed as a methylation rate, it is unique in that it is possible to monitor "how the original predisposition decays over time and how it remains". Not only is protein between the two, but in this case the target is not defined, so it has limitations as a tracking tool and tracer, so it can be said that it has an exceptionally excellent effect unlike DNA, RNA, and protein. ..
- RNA-modified state in addition to the base sequence and / or modified state of the microRNA obtained from the subject, other information, such as the base sequence and / or modified state of the microRNA obtained from the subject at another time point (eg, , Before and after treatment), information about the subject, protein motif information related to modification, information about the base sequence and / or modification state of microRNA obtained from other subjects, substances that bind to RNA (proteins, lipids, etc.)
- the state of the subject can be analyzed using information about the complex of and RNA (and, if necessary, a state associated with the RNA-modified state).
- Information about the subject includes, for example, age, gender, race, family information, medical history, treatment history, smoking status, drinking status, occupational information, living environment information, disease marker information, nucleic acid information.
- Examples include (including nucleic acid information of microorganisms in the subject), biotransformer information, protein information, intestinal bacterial information, epidermal bacterial information, and the like.
- Nucleic acid information includes, for example, genome information, genome modification information, transcriptome information (including expression level and sequence information), RIP sequencing information, and microRNA information (including expression level and sequence information). ..
- Examples of the RIP sequencing information that can be used individually include RIP sequencing information of drug resistance pump P-glycoprotein, RIP sequencing information of feces, RIP sequencing information of Escherichia coli in feces, and the like.
- Additional modification-related protein motif information may include recognition motif information for the enzyme that adds the modification, recognition motif information for the enzyme that removes the modification, and recognition motif information for the protein that binds to the modification.
- recognition motif information for the enzyme that adds the modification e.g, Mettl3, Mettl14, Wtap
- demethylating enzymes e.g, FTO, AlkBH5
- methylation recognizing enzymes e.g, YTHDF1, YTHDF2, YTHDF3
- Motif information such as (molecule) can be mentioned.
- RNA modification information in a subject in a certain state includes, for example, RNA modification information in a subject in a certain state, RNA modification information in a genetically engineered organism for expression of proteins associated with the modification, drugs and / Or RNA modification information in resistant strains resistant to treatment, RNA modification information in drugs and / or treated subjects, information on RNA-binding substances (proteins, lipids, etc.) and RNA complexes (necessary)
- the condition is further related to the RNA modification state), but is not limited thereto.
- the state of a subject is analyzed based further on the nucleotide sequence and / or modified state of the microRNA in the resistant strain to the drug or treatment, or the combination of the resistant strain and the cell line from which the resistant strain was derived.
- agents or treatments include, for example, Ronsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, histone demethylase inhibitors, or heavy ion beams (eg, Carbon / HIMAC) or X. Treatment with lines can be mentioned, but is not limited to them.
- the disclosure refers to data on the combination of accumulated microRNA nucleotide sequences and / or modified states and tunnel current patterns, and microRNAs based on the detected tunnel current patterns.
- a method for analyzing the state of a subject from which microRNA has been obtained by analyzing the base sequence and / or modified state of can be obtained by measuring a sample derived from the subject.
- the analysis is measured in a short period of time after the sample is obtained (eg, within 1 day, within 10 hours, within 5 hours, within 2 hours, within 1 hour, within 30 minutes, within 15 minutes, etc.). Is an on-site analysis to perform.
- the results of the on-site analysis are short-lived (eg, within 1 day, within 10 hours, within 5 hours, within 2 hours, within 1 hour, within 30 minutes, 15 minutes) from the acquisition of the sample. (Within, etc.) is output.
- the sample is delivered to the location of the instrument and / or analyzer where the analysis is performed.
- the sample may be obtained by the subject himself / herself.
- the obtained sample is frozen and delivered.
- the results of the analysis may be communicated to the service source or may be available by accessing a site on the Internet.
- a sample eg, blood, excised organ, feces, etc.
- a subject for example, a patient or a subject at risk such as a disease.
- the sample is processed to purify the microRNA of interest, and the nucleotide sequence and / or modified state of the microRNA of interest is identified.
- the state of the subject eg, the likelihood of developing and recurring cancer, the likelihood of developing resistance to a particular drug treatment, etc.
- the microRNA base sequence and / or modified state is obtained, it may be used for analysis of the state of another subject, for analysis of the state of the same subject at another time point, or in a database. It may be accumulated.
- a sample obtained from the subject for example, tissue or organ of a laboratory animal, clinical practice
- samples, cultured cells, etc. are processed to purify the microRNA of interest, and the nucleotide sequence and / or modified state of the microRNA of interest is identified.
- the base sequence and / or modified state of the microRNA identified in this way is confirmed by other analysis in the same subject state (for example, cancer state, drug resistance acquired state, drug effected state). Etc.) and information can be accumulated.
- a drug that can be appropriately applied to the state of the subject can be determined.
- the present disclosure includes a step of inputting the analysis result of the microRNA by a mass spectrometer, a step of inputting a pattern of the tunnel current acquired by the tunnel current measurement of the microRNA, and an analysis by the mass spectrometry.
- a program configured to implement a method comprising associating a result with a pattern of tunnel currents to determine the modified state of the microRNA.
- the present disclosure is a program configured to implement a method of analyzing a subject into a computer, the method of tunneling current patterns by measuring the tunneling of the microRNA of the subject.
- the target micro is based on the acquired tunneling current pattern with reference to a database containing the steps to be acquired, the modified state of the microRNA, and the tunneling current pattern already acquired in the tunneling current measurement.
- a program comprising the step of analyzing the modified state of RNA and the step of analyzing the state of the subject based on the modified state.
- the method further comprises the step of indicating the state of the subject based on the modified state of the microRNA of the subject.
- the disclosure provides a program that allows a computer to implement a method of analyzing a state of interest based on the nucleotide sequence and / or modified state of a microRNA, and a recording medium that stores the program.
- the methods performed by this program are: (a) the step of comparing the base sequence and / or modified state of at least one microRNA in the subject with the reference base sequence and / or modified state of the microRNA; and (b). ) Includes a step of determining the state of the subject based on the output result of the comparison step.
- the reference modification information includes the base sequence and / or modification state of the microRNA in a subject different from the subject.
- the reference modification information includes the base sequence and / or modified state of the microRNA in the subject obtained at a time different from the base sequence and / or modified state.
- the disclosure provides a system for associating microRNA nucleotide sequences and / or modified states with patterns of tunneling currents obtained by tunneling current measurements.
- the system analyzes and determines the base sequence and / or modified state of the target microRNA by associating the mass spectrometer, the tunnel current measuring device, and the measurement result of the target microRNA by the mass spectrometer and the tunnel current measurement. Includes analysis / judgment unit.
- the disclosure provides a system for analyzing the state of a subject based on the nucleotide sequence and / or modification information of a microRNA.
- the system refers to the tunnel current meter and the accumulated data of the combination of the microRNA nucleotide sequence and / or modification information and the tunnel current pattern obtained by the tunnel current measurement to tunnel the microRNA. It includes an analysis / determination unit that analyzes / determines the base sequence and / or modified state of the target microRNA from which the microRNA has been acquired based on the pattern of the tunnel current acquired by the current measurement.
- the system further includes a state analysis / determination unit that analyzes / determines the state of interest based on the analyzed / determined base sequence and / or modified state.
- the measuring unit may have any structure as long as it has a function and arrangement that provides a base sequence and / or a modified state of microRNA. It may be provided as the same or different structure from the calculation unit and the analysis unit.
- the measuring unit includes a tunneling current measuring instrument.
- the measuring unit includes a mass spectrometer (eg, MALDI-MS).
- the calculation unit identifies the base sequence and / or modified state of the microRNA based on the measurement data.
- the analysis unit analyzes the state of the target based on the obtained microRNA information. In one embodiment, the analysis may be further performed with reference to the additional information described above.
- the system 1000 of the present disclosure includes an external storage device 1005 such as a RAM 1003, a ROM, an SSD or HDD, a magnetic disk, a flash memory such as a USB memory, and an input / output interface (I) via a system bus 1020 in a CPU 1001 built in a computer system. / F) 1025 is connected and configured.
- An input device 1009 such as a keyboard or mouse, an output device 1007 such as a display, and a communication device 1011 such as a modem are connected to the input / output I / F 1025, respectively.
- the external storage device 1005 includes an information database storage unit 1030 and a program storage unit 1040. Each is a constant storage area secured in the external storage device 1005.
- this storage device is obtained by inputting various commands (commands) via the input device 1009, or by receiving commands via the communication I / F, the communication device 1011 or the like.
- the software program installed in 1005 is called by the CPU 1001 on the RAM 1003, expanded, and executed, so that the function of the present disclosure is performed in cooperation with the OS (operating system).
- OS operating system
- microRNA samples were measured (eg, mass analysis and / or tunnel current measurements) to obtain microRNA data
- the microRNA data obtained from this measurement or with it.
- Equivalent information is input via the input device 1009, or is input via the communication I / F, the communication device 1011 or the like, or the database storage unit. It may be stored in 1030.
- the step of performing measurement of the microRNA sample (for example, mass analysis and / or tunnel current measurement) to obtain microRNA data and analyzing the microRNA data is a program stored in the program storage unit 1040, or a program.
- a software program installed in the external storage device 1005 by inputting various commands (commands) via the input device 1009 or by receiving a command via a communication I / F, a communication device 1011 or the like. Can be done by.
- the software for performing such analysis any software known in the art can be used.
- the analyzed data may be output through the output device 1007 or stored in an external storage device 1005 such as the information database storage unit 1030.
- the above calculation result may be stored in the database storage unit 1030 in association with various information such as another nucleic acid information obtained from the same sample and known information such as biological information. Such associations may be made as-is or as network links with data available through the network (Internet, intranet, etc.).
- the computer program stored in the program storage unit 1040 is a processing system described above, for example, data provision, extraction of feature quantities of tunnel current measurement data, identification of base sequence and / or modified state, comparison with reference data,
- a computer is configured as a system for performing classification, clustering, and other processing. Each of these functions is an independent computer program, its module, a routine, or the like, and is executed by the CPU 1001 to configure the computer as each system or device.
- the disclosure is a composition for purifying a microRNA to determine the condition of a subject based on the microRNA, an agent for capturing at least one microRNA in the subject.
- Compositions are provided that include (eg, reagents, scavengers, etc.).
- the agent for capture comprises a nucleic acid that is at least partially complementary to the microRNA of interest.
- the agent for capture comprises an agent for capturing modified RNA (eg, a modification-specific antibody).
- the agent for capture comprises a modified RNA-specific molecule of interest.
- the means for capture comprises a portion for purification (eg, a carrier that may be magnetic, one of a interconnectable pair (eg, biotin and streptavidin)).
- the means for capture comprises a linker linked to a moiety for purification.
- kits In one embodiment, the disclosure is a kit for determining the condition of a subject based on microRNAs, a composition for purifying the microRNA of interest, and for obtaining a sample from the subject.
- a kit is provided that includes at least one of the devices and instructions for using the kit.
- the kit comprises means for purifying RNA from a sample.
- the kit includes a device for obtaining a sample from a subject.
- a kit that includes a device for obtaining a sample from a subject includes instructions that describe the destination of the sample.
- the kit comprises means for cryopreserving the sample taken.
- the kit includes blood, mucosal epidermis (eg, in the oral cavity, nasal cavity, ear cavity, vagina, etc.), skin epidermis, biosecretory fluid (eg, saliva, runny nose, sweat, tears, urine, etc.) from the subject. Includes devices for obtaining (such as bile), feces, and epidermal microorganisms.
- reagents described in the examples were used, but equivalent products from other manufacturers (Sigma-Aldrich, Wako Junyaku, Nacalai, R & D Systems, USCN Life Science INC, etc.) can be used instead.
- Example 1 Preparation of electrode pair An electrode pair was formed by using a nano-processed mechanical break bonding method (MCBJ) (Tsutsui, M., Shoji, K., Taniguchi, M., Kawai, T., Formation). and self-breaking mechanism of stable atom-sized junctions. Nano Lett. 8, 345-349 (2007)). The method of manufacturing the electrode pair will be briefly described below.
- MBJ nano-processed mechanical break bonding method
- Nanoscale gold bonding is performed using an electron beam drawing device (JEOL Ltd., catalog number: JSM6500F) using standard electron beam lithography and lift-off technology, and polyimide (Industrial Summit Technology, catalog number: Pyre-).
- the pattern was formed on a flexible metal substrate (phosphorus bronze substrate) coated with Ml).
- the polyimide under this junction was removed by etching based on the reactive ion etching method using a reactive ion etching apparatus (manufactured by SAMCO, catalog number: 10NR). Then, by bending the metal substrate, a nanoscale gold bridge having a structure bent at three points was produced. Such bending of the substrate was performed using a piezo actuator (manufactured by CEDRAT, catalog number: APA150M). By precisely manipulating the bending of the substrate, the distance between the electrode pairs can be controlled with a resolution equal to or less than the picometer.
- the electrode pair (gold electrode) was formed by pulling the bridge and breaking a part of the bridge. Specifically, using a data acquisition board (manufactured by National Instruments, catalog number: NI PCIe-6321), the resistance feedback method (M.Tsutsui, K.Shoji, M.Taniguchi, T.Kawai, Nano Lett.8) , 345 (2008), and M. Tsutsui, M. Taniguchi, T. Kawai, Appl. Phys. Lett. 93, 163 115 (2008)) under programmed junction stretching speeds of 10 k ⁇ . A DC bias voltage (Vb) of 0.1 V was applied to the bridge using a series of resistors to pull the bridge and break it. Then, the bridge was further pulled, and the size of the gap (distance between electrodes) generated by the fracture was set to be the length of the target nucleotide molecule (about 1 nm).
- Vb DC bias voltage
- the electrode pair prepared in this way was observed under a microscope.
- Example 2 Measurement of tunnel current of synthetic microRNA The following microRNAs were synthesized. miR-200c-5p 5'-CGUCUUACCCAGCAGUGUUUGG-3' (SEQ ID NO: 1) miR-200c-5p 5'-CGUCUUACCCAGCAGUGUUUGG-3'(# 7, mA; # 13, mC) (SEQ ID NO: 1)
- Each of these synthetic microRNAs was added to Milli-Q so that the final concentration was 0.10 ⁇ M to prepare a measurement solution.
- the electrode pair was immersed in a measurement solution, a voltage of 0.4 V was applied between the electrode pairs, and the tunnel current generated between the electrode pairs was measured.
- the synthetic microRNA existing between the electrodes is performing Brownian motion (the temperature of the measurement solution was about 25 ° C.).
- the tunnel current is a logarithmic amplifier at 10 kHz under a DC bias voltage of 0.4 V (manufactured by Daiwa Giken Co., Ltd. according to the design described in Rev. Sci. Instrument. 68 (10), 3816).
- PXI 4071 digital multimeter National Instruments
- Example 3 Mass spectrometric measurement of synthetic microRNA Mass spectrometric measurement is performed on the synthetic microRNA prepared in Example 2.
- Acetonitrile: 0.1% TFA aqueous solution 1: 1 solution was added with 3-HPA (3-hydroxypicolinic acid) at 10 mg / mL, and this solution and 10 mg / mL DHC (diammonium citrate) were added.
- 1 ⁇ L of a mixed solution obtained by mixing an aqueous solution at a ratio of 1: 1 is applied to a target plate (Target Plate MTP Anchor Chip 384 (600 micrometer), Bruker DHC) as a matrix (coating agent) for MALDI and dried.
- target plate Target Plate MTP Anchor Chip 384 (600 micrometer), Bruker DHC
- RNA aqueous solution A 1 ⁇ L purified RNA aqueous solution is layered on this same position and dried. After confirming complete drying, mass spectrometry is performed with a MALDI type mass spectrometer (ultrafle Xtreme-TOF / TOF mass spectrometer, manufactured by Bruker Dalotnics).
- Example 4 Measurement of microRNA obtained from a sample A DNA complementary to 200c-5p (captured 200c-5p) having the following sequence was synthesized. Capture 200c-5p CCAAACACTGCTGGGTAAGACG (SEQ ID NO: 2)
- Biotin was introduced into the phosphate moiety at the 5'end of capture 200c-5p. Magnetic beads (Dynabeads M270 Streptoavidin, Thermo Fisher Scientific) covalently bound to streptavidin on the surface are mixed with the above biotinylated capture oligonucleotide DNA to generate avidin-biotin bond to generate the capture oligo DNA. Fixed on magnetic beads.
- Example preparation 200c-5p was concentrated from the sample using the streptavidin-bound beads to which the capture 200c-5p was bound. Concentrated 200c-5p was added to Milli-Q so that the final concentration was 0.10 ⁇ M to prepare a measurement solution. The tunnel current was measured in the same manner as in Example 2. Results are shown in FIGS. 2 and 3 as compared to the synthetic microRNAs prepared in Example 2.
- Example 5 Identification of microRNAs having different structural modification positions MicroRNAs having different structural modification positions are subjected to tunnel current measurement and modification is analyzed.
- Example 6 Search for biomarkers by combining tunnel current measurement and mass spectrometric measurement Samples are prepared from cancer patient-derived serum and healthy human serum, and tunnel current measurement is performed to analyze microRNA modifications. Search for microRNAs that are significantly more modified in cancer patients than in healthy individuals.
- Example 7 Determination of disease based on tunnel current measurement results DNA complementary to let7a-5p or miR17-5p (capture let7a-5p and capture miR17-5p) having the following sequences was synthesized. Capture 17-5p CTACCTGCACTGTAAGCACTTTG (SEQ ID NO: 3) Capture let7a-5p AACTATACAACCTACTACCTCA (SEQ ID NO: 4)
- Body fluids were collected from human pancreatic cancer patients (stage I to stage IV pancreatic cancer) and healthy subjects.
- let7a-5p and miR17-5p were concentrated with streptavidin-bound beads using capture let7a-5p and capture miR17-5p as in Example 4.
- the probability density of the Gaussian function or the like is used as an index for adenine and methylated adenine. It was determined which was the case. Based on this determination result, the number of adenine and the number of methylated adenine were counted, and the methylation rate (amount) was calculated as the number of methylated adenine / (the number of adenine + the number of methylated adenine).
- tunnel current measurements are performed on samples obtained from subjects with inflammatory bowel disease, Crohn's disease, diabetes, and psychiatric disorders, and microRNA modifications are analyzed to determine the disease.
- Samples are prepared from sera derived from cancer patients and sera of healthy individuals, tunnel current is measured, and microRNA modifications are analyzed to determine the disease.
- Example 8 Quantitative analysis by tunnel current measurement Quantitative analysis of microRNA by tunnel current measurement was performed. Colorectal cancer cell lines (DLD1) and 5-fluorouracil (5-FU) or trifluridine (FTD) resistant strains were used as samples.
- DLD1 Colorectal cancer cell lines
- 5-FU 5-fluorouracil
- FTD trifluridine
- the resistant strain was prepared as follows.
- the cancer cell line DLD-1 obtained from the cell bank was maintained and cultured for 6 months or longer in the presence of trifluridine or 5-fluorouracil (Aldrich-Sigma) (about 10 mg / mL).
- the maintenance culture was subcultured about twice a week in DMEM medium supplemented with 10% serum on a plastic dish at 37 ° C. to maintain a 60-80% confident state.
- IC 50 300 ⁇ mol / L was obtained, and the establishment of a resistant strain was confirmed.
- the present disclosure provides methods for identifying microRNA nucleotide sequences and / or modified states using tunneling currents, as well as systems and programs for use in this method.
- the state of interest eg, medical state
- -SEQ ID NO: 1 Natural human 200c-5p sequence CGUCUUACCCAGCAGUGUUUGG ⁇
- SEQ ID NO: 2 Capture 200c-5p CCAAACACTGCTGGGTAAGACG ⁇
- SEQ ID NO: 3 Capture 17-5p CTACCTGCACTGTAAGCACTTTG ⁇
- SEQ ID NO: 4 Capture let7a-5p AACTATACAACCTACTACCTCA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
- Investigating Or Analyzing Materials By The Use Of Electric Means (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Electrochemistry (AREA)
- General Physics & Mathematics (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2021516247A JP7418024B2 (ja) | 2019-04-26 | 2020-04-24 | トンネル電流を使用したマイクロrna解析 |
| US17/605,917 US20230194472A1 (en) | 2019-04-26 | 2020-04-24 | Microrna analysis using tunneling current |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2019-085805 | 2019-04-26 | ||
| JP2019085805 | 2019-04-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020218489A1 true WO2020218489A1 (ja) | 2020-10-29 |
Family
ID=72942125
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2020/017654 Ceased WO2020218489A1 (ja) | 2019-04-26 | 2020-04-24 | トンネル電流を使用したマイクロrna解析 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20230194472A1 (https=) |
| JP (1) | JP7418024B2 (https=) |
| WO (1) | WO2020218489A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20230101083A1 (en) * | 2021-09-30 | 2023-03-30 | Microsoft Technology Licensing, Llc | Anti-counterfeit tags using base ratios of polynucleotides |
| WO2024247764A1 (ja) * | 2023-05-30 | 2024-12-05 | 国立大学法人東京大学 | シグナルベース法による分子の修飾分析 |
| US12530651B2 (en) | 2021-10-26 | 2026-01-20 | Microsoft Technology Licensing, Llc | Synthetic molecular tags for supply chain tracking |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20250022560A1 (en) * | 2023-07-10 | 2025-01-16 | Ayble Health, Inc. | Individualized management system for treating disease, including gi diseases, and methods of use thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013147208A1 (ja) * | 2012-03-29 | 2013-10-03 | 国立大学法人大阪大学 | ポリヌクレオチドの塩基配列を決定する方法、および、ポリヌクレオチドの塩基配列を決定する装置 |
| JP2017227657A (ja) * | 2011-07-27 | 2017-12-28 | ザ ボード オブ トラスティーズ オブ ザ ユニヴァーシティー オブ イリノイ | 生体分子を特徴付けるためのナノ細孔センサー |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2522746B1 (en) * | 2006-03-02 | 2014-11-12 | The Ohio State University Research Foundation | MicroRNA expression profile associated with pancreatic cancer |
| KR101354480B1 (ko) * | 2012-05-14 | 2014-01-27 | 한국과학기술연구원 | 나노채널과 결합된 나노포어를 이용한 입자 검출 장치 및 방법 |
| DE102013215666B4 (de) * | 2013-08-08 | 2024-06-13 | Siemens Healthineers Ag | Verfahren zum Sequenzieren von Biopolymeren |
| EP3464622B1 (en) * | 2016-05-31 | 2021-04-28 | F. Hoffmann-La Roche AG | Methods and systems for nucleic acid sequencing by tunneling recognition |
-
2020
- 2020-04-24 WO PCT/JP2020/017654 patent/WO2020218489A1/ja not_active Ceased
- 2020-04-24 US US17/605,917 patent/US20230194472A1/en active Pending
- 2020-04-24 JP JP2021516247A patent/JP7418024B2/ja active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2017227657A (ja) * | 2011-07-27 | 2017-12-28 | ザ ボード オブ トラスティーズ オブ ザ ユニヴァーシティー オブ イリノイ | 生体分子を特徴付けるためのナノ細孔センサー |
| WO2013147208A1 (ja) * | 2012-03-29 | 2013-10-03 | 国立大学法人大阪大学 | ポリヌクレオチドの塩基配列を決定する方法、および、ポリヌクレオチドの塩基配列を決定する装置 |
Non-Patent Citations (2)
| Title |
|---|
| TANIGUCHI, MASATERU ET AL., PROGRESS AND PERSPECTIVE OF, vol. 54, no. 6, 2016, pages 396 - 402 * |
| TANIGUCHI, MASATERU ET AL.: "Big Data Produced by Single-Molecule Electrical Sequencing of DNA", PROCEEDINGS OF THE 30TH ANNUAL CONFERENCE OF THE JAPANESE SOCIETY FOR ARTIFICIAL INTELLIGENCE, 2016 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20230101083A1 (en) * | 2021-09-30 | 2023-03-30 | Microsoft Technology Licensing, Llc | Anti-counterfeit tags using base ratios of polynucleotides |
| US12391986B2 (en) * | 2021-09-30 | 2025-08-19 | Microsoft Technology Licensing, Llc | Anti-counterfeit tags using base ratios of polynucleotides |
| US12530651B2 (en) | 2021-10-26 | 2026-01-20 | Microsoft Technology Licensing, Llc | Synthetic molecular tags for supply chain tracking |
| WO2024247764A1 (ja) * | 2023-05-30 | 2024-12-05 | 国立大学法人東京大学 | シグナルベース法による分子の修飾分析 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP7418024B2 (ja) | 2024-01-19 |
| JPWO2020218489A1 (https=) | 2020-10-29 |
| US20230194472A1 (en) | 2023-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7125782B2 (ja) | Rna修飾を利用した分析・診断法 | |
| Drexler et al. | A prognostic neural epigenetic signature in high-grade glioma | |
| JP7418024B2 (ja) | トンネル電流を使用したマイクロrna解析 | |
| Lin et al. | Chemical analysis of single cells | |
| AU2012275556B2 (en) | MicroRNA biomarkers indicative of Alzheimer's Disease | |
| US12135300B2 (en) | Single cell analysis using secondary ion mass spectrometry | |
| Luo et al. | Plasma exosomal miR-450b-5p as a possible biomarker and therapeutic target for transient ischaemic attacks in rats | |
| MacDonald et al. | Laser capture microdissection–targeted mass spectrometry: a method for multiplexed protein quantification within individual layers of the cerebral cortex | |
| Zhang et al. | High glucose causes distinct expression patterns of primary human skin cells by RNA sequencing | |
| US20190259469A1 (en) | Method for Evaluating Genotoxicity of Substance | |
| Zhao et al. | Sequencing-free analysis of multiple methylations on gene-specific mRNAs | |
| US20140220160A1 (en) | Method for detecting, quantifying and mapping damage and/or repair of dna strands | |
| Zhong et al. | Single‐cell sequencing combined with transcriptomics and in vivo and in vitro analysis reveals the landscape of ferroptosis in myocardial ischemia–reperfusion injury | |
| Donovan et al. | Peptide-centric analyses of human plasma enable increased resolution of biological insights into non-small cell lung cancer relative to protein-centric analysis | |
| Yoshioka et al. | Fluorescence laser microdissection reveals a distinct pattern of gene activation in the mouse hippocampal region | |
| KR101529633B1 (ko) | 은 나노클러스터 형성을 이용한 테오필린의 검출방법 | |
| EP3426801B1 (en) | Algorithm and an in vitro method based on rna editing to select particular effect induced by active compounds | |
| Li et al. | Discrimination of common isomerides of methyl nucleosides by collision‐induced dissociation tandem mass spectrometry | |
| WO2024245463A1 (zh) | 基于谷氨酰胺代谢模式的癌症风险评估方法及其应用 | |
| JP6085352B2 (ja) | ヘキサナール曝露特異的メチル化マーカー遺伝子およびそれを用いた確認方法 | |
| JP2022049709A (ja) | Rna修飾を利用したがんの転移/原発性に関連する状態の分析・診断法 | |
| Wang et al. | TransMetaSegmentation (TMS): a transcriptome-based segmentation method for spatial metabolomic data | |
| Huang et al. | Models for evaluation of biological age based on multi-omics | |
| JP2016123338A (ja) | マイクロrnaにおけるメチル化修飾部位を計測する方法 | |
| WO2024020572A1 (en) | Methods and compositions for the treatment of ptsd |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20795561 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2021516247 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20795561 Country of ref document: EP Kind code of ref document: A1 |