WO2020193610A1 - Procédé et produits de production de molécules d'arn - Google Patents

Procédé et produits de production de molécules d'arn Download PDF

Info

Publication number
WO2020193610A1
WO2020193610A1 PCT/EP2020/058310 EP2020058310W WO2020193610A1 WO 2020193610 A1 WO2020193610 A1 WO 2020193610A1 EP 2020058310 W EP2020058310 W EP 2020058310W WO 2020193610 A1 WO2020193610 A1 WO 2020193610A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
molecule
dna
sequence
cleavage
Prior art date
Application number
PCT/EP2020/058310
Other languages
English (en)
Inventor
Hannes FEYRER
Katja PETZOLD
Lorenzo BARONTI
Original Assignee
Feyrer Hannes
Petzold Katja
Baronti Lorenzo
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Feyrer Hannes, Petzold Katja, Baronti Lorenzo filed Critical Feyrer Hannes
Publication of WO2020193610A1 publication Critical patent/WO2020193610A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Definitions

  • the present invention relates to a method for producing RNA molecules.
  • the invention provides a method that utilises chimeric oligonucleotides to guide site-specific enzymatic (RNase H) cleavage of RNA transcripts (produced by run-off in vitro transcription) comprising plurality of tandem repeats of the RNA molecule to be produced, to generate a plurality of copies of the RNA molecule.
  • RNase H site-specific enzymatic
  • the method can be worked on a large scale and in a single reaction vessel to facilitate large yields of the desired RNA molecule.
  • the invention also provides a reaction mixture for producing the RNA molecules and a kit for use in the method of the invention.
  • RNA molecules obtained by the method and a library comprising a plurality of RNA molecules obtained by the method are also provided. Uses of the RNA molecules obtained by the method, e.g. in therapy, and pharmaceutical compositions comprising the RNA molecules are also contemplated.
  • RNA molecules are used widely in research and are increasingly being used in therapy.
  • synthetic RNA molecules predominate in basic research and drug development and these molecules commonly are conjugated with extensive and various modifications.
  • modifications make them completely different from cellular RNAs transcribed from the genome that usually consist of unmodified ribonucleotides or just contain a few posttranscriptional modifications.
  • the structure and characteristics of synthetic RNA molecules or mimics is not necessarily compatible with many of their proposed utilities in RNA research and drug development.
  • RNA production is solid-phase synthesis. While this is at least possible for small molecules, e.g. oligonucleotides, it is expensive and requires labour intensive post-synthesis treatment, such as purification. Moreover, practical issues attributable to remaining impurities in so- called pure RNA molecules can still be observed. For instance, residual reagents from solid-phase synthesis can lead to immune responses in patients meaning that many synthesised RNA molecules cannot be used in their proposed therapeutic utilities. For instance, RNA molecules have been proposed for use in therapy by interacting or interfering with miRNA/siRNA pathways. However, in these pathways the RNA molecules are completely enveloped by the acting proteins and
  • RNA polymerase such as the T7 RNA polymerase
  • T7 RNA polymerase performs well in vitro its utility is hampered due to its tendency to produce heterogeneous transcript lengths.
  • alternative length products cannot be tolerated, thereby limiting the utility of current enzymatic production methods.
  • the purity and yield of enzymatically-produced transcripts are sequence-dependent.
  • RNA molecules In view of the issues with current methods for the production of RNA molecules, there is a desire for alternative methods of producing RNA molecules, particularly cost-efficient methods capable of producing homogeneous molecules with greater accuracy and on a large scale.
  • RNA molecules suitable for use as therapeutic RNA drugs e.g.
  • RNA molecules can readily be used for large-scale production of RNA molecules and is significantly cheaper than solid-phase synthesis, even for short molecules, such as those used in RNA inference applications, e.g. siRNAs or microRNAs consisting of 20-25 nucleotides. Furthermore, the method avoids problems associated with residual reagents associated with RNA molecules produced by solid-phase synthesis.
  • the method first involves the design and preparation of a DNA template comprising a promoter sequence for an RNA polymerase (e.g. T7 RNA polymerase) and a sequence encoding a plurality of tandem repeats of the desired RNA molecule, which is under the control of the promoter sequence (i.e. operably linked to the promoter sequence).
  • the DNA template is used to synthesise RNA transcripts using the DNA template and an RNA polymerase that recognises the promoter sequence, such that each of the RNA transcripts contains a plurality of tandem repeats of the desired RNA molecule.
  • Chimeric oligonucleotide splints (comprising a mixture of conventional deoxyribonucleotides and 2’-0-methyl ribonucleotides) that are complementary to portions of the RNA transcripts are hybridized to the RNA transcripts to produce duplexes (RNA:splint duplexes).
  • the duplexes are formed at the junctions between the tandem repeats of the desired RNA molecule to create site-specific cleavage domains in the partially double stranded RNA transcripts.
  • RNA molecules guide RNase H to cleave the RNA transcripts at the ends of the tandem repeats of the desired RNA molecule, thereby releasing a plurality of copies of the desired RNA molecule from each transcript.
  • the RNA molecules can be isolated from the uncleaved chimeric oligonucleotides, e.g. using HPLC purification, whereby the RNA molecules may be used in various utilities and the chimeric oligonucleotides may be re-used in the method.
  • a schematic of this representative example is shown in Figure 1.
  • the invention can be seen to provide the use of (i) a DNA molecule comprising a promoter sequence for an RNA polymerase and a sequence encoding a plurality of tandem repeats of an RNA molecule under the control of the promoter sequence; and (ii) DNA oligonucleotides comprising 2’-0- methylated ribonucleotides, wherein the DNA oligonucleotides guide enzymatic cleavage (RNase H cleavage) of RNA transcripts produced from the DNA molecule at the ends of the tandem repeats of the RNA molecule, in the production of a plurality of copies of the RNA molecule.
  • RNase H cleavage enzymatic cleavage
  • the invention provides a method for producing a plurality of copies of an RNA molecule, said method comprising:
  • RNA transcripts produced in (b) hybridizing the RNA transcripts produced in (b) to DNA oligonucleotides comprising 2’-0-methylated ribonucleotides to produce partially double stranded RNA: DNA duplexes, wherein the DNA oligonucleotides guide enzymatic cleavage of the RNA transcripts at the ends of the tandem repeats of the RNA molecule to be produced; and
  • RNA molecule refers to a polymer of“conventional” ribonucleotides, i.e. ribonucleotides found in nature: ATP, GTP, CTP and UTP.
  • a “desired RNA molecule” or“RNA molecule to be produced” refers to an RNA molecule produced by the method of the invention.
  • the present invention may be used to produce RNA molecules of any desired length.
  • the methods may be used to produce RNA molecules that far exceed the length of RNA molecules that can be accurately produced using solid- phase synthesis methods.
  • an RNA molecule produced by the method of the invention may be between about 10 up to about 10000 nucleotides in length.
  • the method may be viewed as the production of RNA molecules that are oligonucleotides (oligoribonucleotides).
  • the method may be viewed as the production of RNA molecules that are
  • polyribonucleotides polynucleotides
  • the boundary between the size of an“oligonucleotide” and“polynucleotide” is not well-defined in the art.
  • a sequence of more than 400 nucleotides may be termed a
  • oligonucleotide and polynucleotide are used interchangeably herein to refer to nucleotide sequences (RNA molecules) within the size range specified above.
  • RNA molecules nucleotide sequences
  • polynucleotide it will typically refer to RNA molecules containing more than 400 nucleotides.
  • the RNA molecule may be from about 10 to about 750 nucleotides in length, including from about 10 to about 500 nucleotides in length, e.g., from about 10 to about 450 nucleotides in length, such as from about 12 to about 400 nucleotides in length, from about 12 to about 300 nucleotides in length, from about 12 to about 250 nucleotides in length, from about 15 to about 200 nucleotides in length, from about 15 to about 150 nucleotides in length, from about 18 to about 100 nucleotides in length, from about 18 to about 75 nucleotides in length, from about 20 to about 70 nucleotides in length, from about 20 to about 60 nucleotides in length, and so on. In some embodiments, the RNA molecule contains about 10-400, 11-390, 12-380, 13-370, 14-360 or 15-350 nucleotides.
  • the method finds utility in the production of RNA molecules for use in RNA interference applications, e.g. siRNAs and microRNAs.
  • the RNA molecule may contain about 20-50 nucleotides, such as at least about 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
  • the invention may find utility in the effective production of longer RNA molecules, e.g. comprising about 30 or more nucleotides, such as about 35, 40, 45, 50, 60, 70, 80, 90, 100 or more nucleotides.
  • the RNA molecules produced by the invention may contain about 30-1000, 40-900, 50-800, 60-700, 70- 600, 80-500, 90-450 or 100-400 nucleotides.
  • the RNA molecules (e.g. polynucleotides) produced by the invention may contain about 400- 10000, 500-9000, 600-8000, 700-7000, 800-6000, 900-5000 or 1000-4000 nucleotides, e.g. comprising about 500, 1000, 1500, 2000, 2500, 3000, 3500 or more nucleotides.
  • the method of the invention can also be used to produce RNA molecules of any desired sequence.
  • the method of the invention overcomes problems associated with the need to optimise in vitro transcription conditions for a particular sequence.
  • the method utilises a DNA template encoding a plurality of tandem repeats of the desired RNA molecule, even templates that are poorly transcribed, i.e. transcribed at low rates or yields, will provide sufficient copies of the RNA molecule to yield a useful amount of RNA molecules when the transcripts are cleaved.
  • the scale of the reaction can be adjusted to increase the yield of the reaction to obtain useful amounts of the desired RNA molecule without the need to optimise the in vitro transcription reaction.
  • the ability to conduct the method of the invention in a single reaction vessel further assists to maximise the yield of the desired RNA molecule as products are not lost in intermediate purification steps.
  • the length and sequence of the desired RNA molecule produced by the method of the invention is dependent on being able to design an oligonucleotide splint suitable to guide the site-specific cleavage of the RNA transcripts to yield the desired RNA molecule, i.e. without cleaving the RNA transcripts within the RNA molecule.
  • the desired RNA molecule does not contain internal cleavage sites, i.e. sites that are complementary to the oligonucleotide splints used in the hybridizing and cleavage steps.
  • the combined sequence consisting of the 3’ end of the desired RNA molecule e.g. the terminal 4-10 nucleotides, e.g. about 4,
  • RNA molecule directly adjacent to the 5’ end of the desired RNA molecule (e.g. the terminal 4-10 nucleotides, e.g. about 4, 5, 6, 7 or 8 nucleotides) is not repeated elsewhere in the desired RNA molecule.
  • it may be possible to modify or mutate the sequence of the RNA molecule e.g. by modifying or mutating the DNA template encoding the RNA molecule to generate a sequence that has the functional properties of the desired RNA molecule but does not contain internal sequences that would be cleaved in the cleavage step.
  • RNA molecule encodes a protein or peptide
  • a codon may be changed to remove an internal cleavage site whilst maintaining the amino acid encoded by the codon due to codon degeneracy.
  • a codon may be changed to remove an internal cleavage site such that the encoded protein contains a conservative amino acid substitution that does not substantially alter the function of the protein.
  • the method of the invention may be used to produce RNA molecules encoding a protein, peptide, tRNA, rRNA, viral RNA, small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), small interfering RNA (siRNA), piwi-interacting RNA (piRNA), ribozymal RNA, antisense RNA, CRISPR/Cas9 guide RNA or non-coding RNA.
  • the RNA molecule is a miRNA.
  • the RNA encodes a protein or peptide.
  • the protein or peptide is a therapeutic protein or peptide.
  • the DNA molecule of the invention comprises: (i) a promoter sequence for an RNA polymerase; and (ii) a sequence encoding a plurality of tandem repeats of the RNA molecule to be produced (the desired RNA molecule) which is under the control of the promoter sequence of (i).
  • the DNA molecule for use in the method of the invention may be viewed as, and must be suitable for use as, a“DNA template” for in vitro transcription by an RNA polymerase, i.e. an RNA transcription template.
  • a“DNA template” for in vitro transcription by an RNA polymerase
  • RNA transcription template i.e. an RNA transcription template
  • the promoter sequence of (i) and encoding sequence of (ii) must be arranged such that contacting the DNA molecule with an RNA polymerase that recognises the promoter sequence under conditions suitable for transcription results in the template dependent production of an RNA molecule (“transcript”) comprising a plurality of tandem repeats of the RNA molecule to be produced.
  • the promoter sequence and encoding sequence may be viewed as being “operably linked”, which term refers to the association or arrangement of sequences in a nucleic acid molecule such that the function of one sequence (i.e. the encoding sequence) is regulated by the other (i.e. the promoter sequence).
  • the promoter sequence promotes or induces RNA polymerase directed transcription of the encoding sequence of the DNA template.
  • the DNA template may comprise an“optimal initiation site” located at the 3’ end of the promoter sequence (or alternatively viewed at the 5’ end of the encoding sequence).
  • RNA polymerases such as T7 RNA polymerase
  • T7 RNA polymerase may be less efficient at initiating transcription using the 5’ end of the sequence encoding the desired RNA molecule.
  • Such optimal initiate sites are known in the art.
  • T7 RNA polymerase is particularly effective at initiating transcription when the encoding sequence starts with a poly-dG sequence, e.g. GGG.
  • the DNA molecule comprises a poly-dG sequence, such as GGG, at the start of the encoding sequence (at the 5’ end of the encoding sequence).
  • the optimal initiate site is GGGAGA (SEQ ID NO: 1).
  • the tandem repeats encoded by the DNA template may be bordered on one or both sides by“spacer” sequences.
  • a spacer sequence may be included between the optimal initiation site and the first tandem repeat to facilitate the removal of the optimal initiation site following cleavage of the RNA transcripts.
  • a spacer sequence may be included at 3’ end of the tandem repeats to avoid the production of heterogeneous RNA molecules from the final tandem repeat.
  • Spacer sequences may be of any suitable length and sequence.
  • the spacer sequences result in cleavage products that are a different size to the desired RNA molecules such that they can be readily separated from the RNA molecules in downstream purification steps.
  • the spacer sequences comprise at least about 4 nucleotides, e.g. 4-100, 5-90, 6-80, 7- 70, 8-60, 9-50 or 10-40 nucleotides.
  • RNAscription refers to the DNA template dependent production (synthesis) of an RNA molecule using an RNA polymerase enzyme to a polymerise ribonucleotides thereby synthesising an RNA molecule that is complementary to the DNA strand used to template the polymerisation.
  • a“transcript” is an RNA molecule produced from a DNA templated RNA polymerase reaction.
  • in vitro transcription refers to a transcription reaction that occurs in solution outside a cell, e.g. in a reaction vessel.
  • the DNA molecule used in the method of the invention may be in any suitable form to function efficiently as a template for an in vitro transcription reaction.
  • the RNA polymerase must bind with high affinity to the promoter sequence in the DNA molecule (template).
  • RNA polymerase enzymes bind more efficiently to double stranded promoter sequences.
  • the T7 RNA polymerase has been shown to bind to double stranded DNA comprising its promoter sequence (T AAT ACG ACT CACT ATA, SEQ ID NO: 2) with an K d of about 3.4-20nM.
  • the DNA molecule used in the method of the invention is at least partially double stranded, wherein at least the promoter sequence is double stranded.
  • the DNA molecule is fully double stranded.
  • high affinity refers to RNA polymerases that bind to their respective promoter sequence with a K d of about 5x1 O 7 M or less, such about 1x10 7 , 5x1 O 8 , 4x1 O 8 , 3x1 O 8 , 2x1 O 8 or 1x10 8 M or less.
  • the DNA molecule (template) provided in step (a) of the present method may be produced by any suitable means and a variety of means are well-known in the art e.g. assembly PCR, solid-phase synthesis. Accordingly, the method of the present invention may comprise additional steps of producing the DNA molecule (template) before step (a) of providing the DNA molecule.
  • the means used to produce the DNA molecule may depend on the length of the molecule, e.g. the number of tandem repeats encoding the desired RNA molecule and the length of each repeat (i.e. the length of the RNA molecule to be produced). For instance, if the DNA molecule contains a relatively small number of repeats (e.g. 10 or less, such as about 9, 8, 7, 6, 5 or 4) of an oligonucleotide sequence (e.g. comprising about 30 or fewer nucleotides, such as about 10-30, 11- 29, 12-28, 13-27, 14-26, 15-25 nucleotides), it may be cost-effective to produce the DNA molecule using solid-phase synthesis, i.e.
  • a relatively small number of repeats e.g. 10 or less, such as about 9, 8, 7, 6, 5 or 4
  • an oligonucleotide sequence e.g. comprising about 30 or fewer nucleotides, such as about 10-30, 11- 29, 12-28, 13-
  • the DNA molecule contains 200 or fewer nucleotides. However, if the DNA molecule contains a large number of repeats (e.g. 11 or more repeats, such as about 12, 13, 14, 15, 20, 25, 30 or more repeats) and/or each repeat is large (e.g. about 30 nucleotides or more, e.g. about 40, 50, 60, 70, 80, 90, 100 nucleotides or more), it may be more cost-effective to use other means of producing the DNA molecule, e.g. assembly PCR.
  • a large number of repeats e.g. 11 or more repeats, such as about 12, 13, 14, 15, 20, 25, 30 or more repeats
  • each repeat is large (e.g. about 30 nucleotides or more, e.g. about 40, 50, 60, 70, 80, 90, 100 nucleotides or more)
  • it may be more cost-effective to use other means of producing the DNA molecule e.g. assembly PCR.
  • DNA molecule Once the DNA molecule is produced, it may be necessary or advantageous to make the molecule double stranded and/or to increase the number of copies of the molecule (i.e. amplify the molecule) to produce sufficient template for the in vitro transcription reaction.
  • Suitable means for producing and amplifying double stranded DNA molecules are well-known in the art, e.g. PCR, and any such means may be used in the invention.
  • PCR amplification can introduce errors into the amplified molecules, which may impact on the accuracy of the RNA molecule produced in the method of the invention.
  • the PCR utilises a high fidelity DNA polymerase, such as Pfu DNA polymerase or Pwo DNA polymerase. Numerous high fidelity DNA polymerases are known in the art and may be used in the invention.
  • DNA molecule template
  • E.coli E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.g., E.coli.
  • Suitable plasmid sequences are well known in the art. This allows the sequence of the DNA molecule (template) to be checked (e.g. by sequencing) and for any errors in the sequence to be corrected, e.g. via iterations of sequencing and mutagenesis using any suitable methods.
  • the insertion of the DNA molecule (template) into a plasmid also facilitates the generation of a significant number of copies of the DNA molecule.
  • a single bacterial colony containing a plasmid comprising the sequence-verified DNA molecule (template) may be grown to amplify the plasmid, which may be subsequently purified from the bacteria using any suitable means known in the art.
  • the DNA molecule may be excised from the plasmid, e.g. using cleavage enzymes.
  • the excised linear DNA molecule may be purified, e.g. using PAGE and gel extraction, or other suitable methods, to provide the DNA molecule of step (a).
  • the DNA molecule in the plasmid is bordered by cleavage domains or sites (e.g. restriction endonuclease recognition sites) to enable the excision of the DNA molecule.
  • the plasmid containing the DNA molecule may be linearized, e.g. using a restriction enzyme.
  • the linearized plasmid may be used directly in the in vitro transcription reaction, i.e. the DNA molecule provided in step (a) may be a linearized plasmid.
  • the DNA molecule provided in step (a) of the method is a linear DNA molecule.
  • RNA transcripts produced in the in vitro transcription reaction of step (b) do not contain additional sequences at the 3’ end.
  • cleave the plasmid directly adjacent to the end of the final repeat of the sequence encoding the desired RNA molecule such that the RNA transcripts produced in the in vitro transcription reaction of step (b) do not contain additional sequences at the 3’ end.
  • the cleavage site or cleavage domain may be downstream of the encoding sequence.
  • the distance between the cleavage site and the end of the encoding sequence may depend on the length of the desired RNA molecule and a suitable distance can be determined by the skilled person. In this respect, the distance must result in an RNA molecule that may readily be separated from the desired RNA molecule upon cleavage of the RNA transcripts in step (d).
  • cleavage may occur within 20 nucleotides or less of the 3’ end of the encoding sequence, e.g.
  • the cleavage site upstream of the DNA molecule in the plasmid i.e. upstream (5’ of) the RNA polymerase promoter sequence
  • the DNA molecule may be a circular molecule.
  • the plasmid in which the DNA molecule is inserted may be used directly in the RNA transcription reaction.
  • the purified linear DNA molecule excised from the plasmid could be re-circularised using a suitable ligase enzyme, such as T4 ligase, to form a circular DNA molecule to be provided in step (a) of the present method.
  • a suitable ligase enzyme such as T4 ligase
  • the process of transfecting the DNA molecule (template) containing plasmid into bacteria also allows a bacterial glycerol stock to be produced.
  • Bacteria comprising the DNA molecule (template) plasmid can be prepared in glycerol, frozen and stored stably for long periods of time.
  • step (a) of the present method comprises:
  • step (ii) comprises transfecting said DNA plasmid into bacteria and growing the bacteria and optionally isolating the plasmid.
  • step (iii) further comprises a step of isolating the excised DNA molecule.
  • the DNA molecule comprises a 5’ end region and a 3’ end region each comprising a cleavage domain and wherein step (iii) comprises cleaving the cleavage domains in the end regions with a cleavage enzyme.
  • the method may comprise a further step of (iv) circularising the excised DNA molecule obtained in step (iii).
  • Any suitable cleavage enzyme as defined herein may be used to excise the DNA molecule (template) from the plasmid.
  • the cleavage enzyme may be selected to ensure that it does not cleave within the DNA molecule, i.e. within the promoter sequence, optimal initiation sequence (if present) and encoding sequence.
  • the promoter sequence in the DNA molecule (template) provided in step (a) may be selected based on the RNA polymerase used in the method. Any suitable RNA polymerase and cognate promoter sequence may be used in the method.
  • the promoter sequence is a promoter sequence suitable for use with any one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase or E.coli RNA polymerase.
  • the promoter sequence is suitable for use with T7 RNA polymerase.
  • the promoter sequence comprises a nucleotide sequence as set forth in SEQ ID NO: 2.
  • DNA molecule comprises a nucleotide sequence as set forth in SEQ ID NO: 2 and a nucleotide sequence as set forth in SEQ ID NO: 1.
  • the promoter sequence of SEQ ID NO: 2 is operably linked to the optimal initiation sequence of SEQ ID NO: 1 , which is further operably linked to the sequence encoding a plurality of tandem repeats of the desired RNA molecule.
  • the DNA molecule (template) comprises a sequence encoding a plurality of tandem repeats of the RNA molecule to be produced (the desired RNA molecule).
  • the term“tandem repeat” refers to repeated sequences within a DNA molecule in which the repeated sequences are directly adjacent to each other, i.e. there are no intervening nucleotides between the end of one repeat and the start of the next repeat.
  • the term“plurality” means two or more, e.g. at least 2, 3, 4,
  • the DNA molecule may contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 or more tandem repeats of the sequence encoding the RNA molecule, such as 2-100, 3-90, 4-80, 5- 70, 6-60, 7-50, 8-40, 9-30 or 10-25 tandem repeats of the sequence encoding the RNA molecule.
  • the DNA molecule contains at least 4, 5, 6,
  • the cleavage reaction in step (d) will result in the release of a plurality of copies of the desired RNA molecule, e.g. 10 3 , 10 4 , 10 s , 10 6 , 10 7 , 10 s , 10 9 , 10 10 or more copies of the desired RNA molecule.
  • the method of the invention may be used to produce more than one desired RNA molecule, i.e. the DNA molecule (template) may comprise a sequence encoding tandem repeats of more than one desired RNA molecule, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNA molecules, i.e. RNA molecules with different sequences.
  • the DNA molecule template
  • the DNA molecule may comprise a sequence encoding tandem repeats of more than one desired RNA molecule, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNA molecules, i.e. RNA molecules with different sequences.
  • the encoding sequence may contain tandem repeats of different RNA molecules in any order.
  • encoding sequences for different RNA molecules may be directly adjacent to each other such that the plurality of tandem repeats refers to the repetition of the sequence encoding all of the RNA molecules, e.g. for RNA molecules A and B the plurality of tandem repeats may be sequence ABABAB.
  • the plurality of tandem repeats may be sequence ABCABCABC.
  • the DNA molecule may encode more than one plurality of tandem repeats, e.g. AAAAABBBBB,
  • the DNA molecule may be designed (e.g. the order of the plurality of tandem repeats) to avoid or minimise interactions between the repeated sequences in the RNA transcripts that may interfere with their production or cleavage.
  • the present invention may be used to generate a plurality of copies of RNA molecules in controlled stoichiometry in a single reaction based on the number of copies of each RNA molecule encoded by the DNA molecule.
  • This may be particularly useful for the production of double stranded RNA molecules, e.g. for use in RNA interference applications, such as siRNAs.
  • the DNA molecule encodes more than one plurality of tandem repeats of RNA molecules
  • the RNA molecules do not need to be produced in equal amounts.
  • a 1 :2:3 ratio of RNA molecules A, B and C could be achieved using a DNA molecule with an encoding sequence AAAABBBBBBBBCCCCCCCCCCCC.
  • each type of RNA molecule may be produced separately in a method of the invention and subsequently mixed in the appropriate ratio to produce the double strand RNA molecule or RNA structure.
  • the method involves a step of mixing RNA molecules obtained by the method, e.g. to produce double stranded RNA molecules.
  • the products of the mixture form a further embodiment of the invention.
  • DNA molecule encodes a plurality of RNA molecules
  • DNA oligonucleotides i.e. DNA oligonucleotides with different sequences
  • RNA molecules their encoding sequences or DNA oligonucleotide sequences comprising one or more different nucleotides.
  • different oligonucleotide sequences may differ by one or more, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, nucleotides, e.g. 20, 30, 40, 50, 60, 70, 80, 90 or more nucleotides. The differences may be in the length and/or composition of the sequences. Alternatively viewed, the different sequences (e.g. RNA molecules) have less than 100% sequence identity each other, such as less than 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 70%, 60%, 50% sequence identity to each other.
  • Different oligonucleotides may comprise the same nucleotide sequences but differ in the position of the 2’-0-methyl-NTPs within the oligonucleotide.
  • RNA polymerase Any RNA polymerase may be used in the in vitro transcription reaction of the invention (step (b)).
  • Suitable RNA polymerase enzymes include T7 RNA
  • RNA polymerase includes not only naturally occurring enzymes but also all such modified derivatives, including also derivatives of naturally occurring RNA polymerase enzymes.
  • the RNA polymerase used in the method of the invention must be suitable for use with the promoter sequence in the DNA molecule (template).
  • RNA polymerase enzymes for use in the invention may be selected from the group consisting of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, E.coli RNA polymerase and derivatives, e.g. sequence-modified derivatives, or mutants thereof.
  • T7 RNA polymerase T7 RNA polymerase
  • T3 RNA polymerase T3 RNA polymerase
  • SP6 RNA polymerase RNA polymerase
  • E.coli RNA polymerase E.coli RNA polymerase
  • derivatives e.g. sequence-modified derivatives, or mutants thereof.
  • the RNA polymerase enzyme used in the invention is T7 RNA polymerase or a derivative, e.g. sequence-modified derivatives, or mutant thereof.
  • Sequence-modified derivatives or mutants of RNA polymerase enzymes include mutants that retain at least some of the functional activity, e.g. RNA polymerase activity, of the wild-type sequence. Mutations may affect the activity profile of the enzymes, e.g. enhance or reduce the rate of polymerisation, under different reaction conditions, e.g. temperature, template concentration, etc.
  • Conditions suitable for in vitro transcription include any conditions that result in the template dependent production of RNA molecules (“transcripts”).
  • a typical in vitro transcription reaction mixture includes the DNA molecule (template) described above, an RNA polymerase (e.g. at a concentration of about 0.1-1.0mg/ml_, such as about 0.3 mg/ml_), nucleotides (ribonucleotides, ATP, GTP, CTP and UTP, e.g. at a concentration of about 1-5mM, e.g. about 3mM) and other components required for a RNA polymerase reaction as described below.
  • the desired polymerase activity may be provided by one or more distinct polymerase enzymes.
  • the temperature of the reaction will depend on the RNA polymerase used, but typically may be in the range of 20-50°C, such as about 25-40°C, preferably about 37°C.
  • the reaction may be incubated at a suitable temperature for a time sufficient to produce a useful amount of RNA transcripts, e.g. at least about 1 hour, such as at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14
  • the in vitro transcription reaction mixture may further include an aqueous buffer medium that includes a source of divalent cations and a buffering agent.
  • a source of divalent cations may be used, such magnesium, manganese, zinc and the like, where the cation will typically be magnesium.
  • Any convenient source of magnesium cations may be employed, including MgCh, Mg-acetate, and the like.
  • the amount of Mg 2+ present in the buffer may range from 0.5 to 40 mM, but will preferably range from about 5 to 15 mM, and will ideally be at about 10 mM.
  • buffering agents or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS and the like, where the amount of buffering agent will typically range from about 5 to 200 mM, usually from about 10 to 150 mM, and more usually from about 80 to 100 mM, where in certain preferred embodiments the buffering agent will be present in an amount sufficient to provide a pH ranging from about 6.0 to 9.5, typically about pH 8.0.
  • Other agents which may be present in the buffer medium include a source of monovalent cations (e.g. sodium or potassium ions, e.g. provided in the form of NaCI or KCI), redox reagents, such as
  • dithiothreitol agents to improve polymerase activity or initiation, such as UMP,
  • GMP inorganic pyrophophatase and spermidine
  • crowding agents such as DMSO, PEG or BSA, and the like.
  • the DNA oligonucleotides used in the methods of the invention guide or template the cleavage of the RNA transcripts produced in step (b) and enable the release of the plurality of copies of the desired RNA molecule.
  • the DNA molecules guide RNase H cleavage of the RNA transcripts produced in step (b).
  • RNase H is present in, and may be isolated from, various organisms. It is characterised by its ability to hydrolyze only RNA: DNA hybrids (duplexes), wherein cleavage occurs in the RNA strand to yield a 3’-hydroxyl and 5’-phosphate at the hydrolysis site.
  • RNase H enzyme used in the method of the invention must be able to cleave the RNA strand opposite the 5’ end of the hybridised DNA oligonucleotide and this property is used to direct the site-specific cleavage of RNA molecules using RNase H. This is a property of E.coli RNase H.
  • RNase H can be used to cleave RNA molecules at specific sites using chimeric oligonucleotides comprising DNA nucleotides and 2’-0- methylated ribonucleotides. 2’-0-methylated oligoribonucleotides form stable duplexes with complementary RNA molecules but as RNase H does not recognise RNA duplexes as a substrate, the enzyme does not cleave such duplexes.
  • the DNA oligonucleotides for use in the method of the invention comprise a mixture of“conventional” deoxyribonucleotides (dNTPs) and 2’-0- methylated ribonucleotides (2’-0-methyl-NTPs). Accordingly, the DNA
  • oligonucleotides may be viewed as chimeric guide or splint oligonucleotides that hybridize to the RNA transcripts produced by the in vitro transcription reaction of step (b) to form cleavage domains in the RNA transcripts (RNA:DNA or RNA:splint duplexes) and enable the site-specific cleavage of the RNA transcripts by RNase H.
  • the term DNA oligonucleotides is used herein on the basis that the molecules must contain a consecutive sequence of dNTPs and therefore comprise a DNA oligonucleotide. However, the term DNA oligonucleotide may be used
  • oligonucleotide splint “oligonucleotide guide”,“oligonucleotide cleavage guide” or“chimeric splint”.
  • the design of the DNA oligonucleotides for use in the method of the invention will depend on the sequence of the desired RNA molecule. Any suitable design may be used as along as it is sufficient to enable specific cleavage of the RNA transcripts at the ends of the tandem repeats of the RNA molecule to be produced, i.e. the DNA oligonucleotides must hybridize (be complementary to) the regions of the RNA transcripts comprising the ends of tandem repeats such that cleavage occurs between the last nucleotide in one repeat and the first nucleotide in the adjacent repeat.
  • the DNA oligonucleotides may be of any suitable length to hybridize to the RNA transcripts produced in the in vitro transcription reaction of step (b).
  • the DNA oligonucleotides may comprise at least 8 nucleotides (i.e. made up of dNTPs and 2’-0-methyl-NTPs), such as about 9, 10, 11 , 12, 13, 14, 15, 16,
  • the DNA is 17, 18, 19, 20 or more nucleotides.
  • the DNA is 17, 18, 19, 20 or more nucleotides.
  • oligonucleotides may comprise about 20, 25, 30, 35, 40 or more nucleotides.
  • the DNA oligonucleotides may comprise any number, combination or design of dNTPs and 2’-0-methyl-NTPs that is sufficient to hybridize to the RNA transcripts and guide site-specific cleavage of the RNA transcripts to release the RNA molecules as defined above.
  • the DNA oligonucleotides may comprise a sequence of dNTPs bordered on one or both sides by 2’-0-methyl- NTPs.
  • the DNA oligonucleotides may comprise a sequence of 2’-0-methyl-NTPs bordered on one or both sides by dNTPs.
  • the 2’-0-methyl-NTPs are present at the 5’ end of the dNTP sequence.
  • the 2’-0-methyl-NTPs are bordered by dNTPs only on one side, it is preferred that the dNTPs are present at the 3’ end of the 2’-0-methyl-NTP sequence.
  • each sequence of dNTPs may comprise 3 or more consecutive nucleotides, such as 3, 4, 5, 6, 7, 8, 9, 10 or more consecutive nucleotides.
  • each sequence of 2’-0-methyl-NTPs may comprise 3 or more consecutive nucleotides, such as 3, 4, 5, 6, 7, 8, 9, 10 or more consecutive nucleotides.
  • the DNA oligonucleotides for use in the method of the invention comprise a sequence of 3 or more consecutive dNTPs bordered on both sides by sequences of 3 or more consecutive 2’-0-methyl-NTPs.
  • dUTP conventional deoxyribonucleotides
  • dUTP conventional deoxyribonucleotides
  • NTPs refers to NTP analogues where a methyl group is added to the 2' hydroxyl of the ribose moiety of a nucleoside, producing a methoxy group.
  • nucleotide refers generally to a dNTP or NTP or an analogue thereof.
  • the step of hybridizing the RNA transcripts produced in the in vitro transcription reaction of step (b) to the DNA oligonucleotides may be performed under any suitable conditions, which may differ depending on the size and/or composition of the RNA transcripts and/or DNA oligonucleotides.
  • the step of hybridizing comprises contacting the RNA transcripts with the DNA oligonucleotides, heating the mixture and subsequently cooling the mixture such that the RNA transcripts and DNA oligonucleotides form duplexes (RNA: DNA duplexes) at sites of complementarity, i.e.
  • RNA duplex DNA duplex wherein only the regions at which the oligonucleotides hybridise are double stranded.
  • Suitable conditions for hybridizing nucleic acid molecules are well-known in the art.
  • the mixture of RNA transcripts and DNA oligonucleotides is heated to a temperature suitable to denature any secondary structures present in the transcripts, such as about 85 °C or more, e.g. 85-100°C, such as about 95°C, and allowed to cool to a temperature to allow the
  • oligonucleotides to anneal to the RNA transcripts and that is suitable for the cleavage reaction to occur e.g. 40°C or less, such as about 20-37°C. It will be evident that the RNA transcripts may be heated before the addition of the DNA oligonucleotides.
  • RNA transcripts any suitable means for heating the RNA transcripts may be used, e.g. water bath, heat block etc. However, it is preferred that the RNA transcripts (the solution containing the RNA transcripts) is heated rapidly. Whilst conventional laboratory means of heating, such as a heat block, is suitable for small volumes, e.g. of 1ml_ or less, the heat transfer is too slow for large volumes, e.g. of 5ml_ or more, which can result in RNA transcript degradation. The inventors have found that for large volumes of RNA transcripts (i.e. for large scale production of the RNA molecules) rapid heating may be achieved using microwaves and, surprisingly, this does not have a deleterious effect on the RNA transcripts (e.g. degradation).
  • the step of hybridizing may comprise heating the RNA transcripts with microwaves, e.g. using a conventional microwave oven.
  • the power and duration of microwaves will dependent on the volume of solution in which the RNA transcripts are present.
  • the solution should be rapidly heated to the required temperature. For instance, for a volume of 20 ml_, the microwaves used should be sufficient to heat the solution to the required temperature in about 30 seconds or less.
  • Representative conditions for a 20 ml_ sample are a first heating step at 450W for 10 seconds followed by a second heating step at 450W for 5 seconds.
  • rapid heating may be defined as heating to the required temperature with 90 seconds, preferably within 80, 70 or 60 seconds.
  • Microwaves of a power of between about 300-1500W, such as about 450-1000W may be used in the invention.
  • the rapid heating comprises heating the reaction mixture (solution) to the required temperature as defined above in about 5 minutes or less, e.g. about 4 or 3 minutes or less.
  • rapid heating include heating the reaction mixture (solution) to the required temperature as defined above in about 180 seconds or less, e.g. 170, 160, 150, 140, 130, 120 seconds or less.
  • cooling of the solution may be achieved by any suitable means and will dependent on the volume of the solution, the nature of the reaction vessel etc.
  • the solution may be left at room temperature until it reaches the required temperature for the cleavage reaction.
  • the solution may be cooled at a first temperature, e.g. 37°C for 15 minutes, followed by a second lower temperature, e.g. room temperature for 15 minutes.
  • the amount or concentration of DNA oligonucleotides used in the cleavage reaction will depend on the amount or concentration of RNA transcripts formed by the transcription step and/or the length of each RNA molecule repeat. The skilled person readily could determine the amount or concentration of DNA
  • the DNA oligonucleotides may be added to a concentration of about 50-500 mM, such as about 75-300 pM, e.g. about 90-120 pM.
  • the DNA oligonucleotides are not cleaved by the RNase H enzyme and thus may be separated from cleaved RNA molecules and re used. Re-cycling of the DNA oligonucleotides reduces costs are represents a further advantage of the invention.
  • hybridisation or “hybridises” as used herein refers to the formation of a duplex between nucleotide molecules comprising sequences which are sufficiently complementary to form duplexes via Watson-Crick base pairing.
  • nucleotide sequences are “complementary” to one another when those molecules share base pair organization homology. "Complementary" nucleotide sequences will combine with specificity to form a stable duplex under appropriate hybridization conditions. For instance, two sequences of the same length may be viewed as complementary when the first sequence can bind to the second sequence in an anti-parallel sense wherein the sequence at the 3'-end of each strand binds to the sequence at the 5'-end of the other strand and each A, T(U), G and C of one sequence is then aligned with a T(U), A, C and G, respectively, of the other sequence.
  • the ends of the strands may not be complementary, e.g. there may be an overhang at one or both ends of the longer sequence.
  • two sequences need not have perfect homology to be "complementary" under the invention.
  • two sequences are sufficiently complementary when at least about 90% (preferably at least about 95%) of the nucleotides share base pair organization over a defined length of the molecule.
  • the DNA oligonucleotides are fully complementary to the sequences in the RNA transcripts with which they hybridize.
  • bordered refers to domains (e.g. cleavage domains) or sequences that are directly or indirectly adjacent to other domains or sequence.
  • the cleavage domains used to excise the DNA molecule (template) may be positioned at either end of the DNA sequence (template), i.e. the cleavage domains are upstream and downstream (at the 5’ and 3’ ends) of the DNA sequence (template).
  • the cleavage site of the cleavage domains e.g.
  • the DNA template and cleavage domain sequence may overlap, i.e. the end of the DNA template may form part of the cleavage domain, i.e. the cleavage domains may form the ends or part of the ends of the DNA template.
  • the cleavage domain and the DNA template may overlap one or more, e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more, nucleotides.
  • bordered refers to sequences of dNTPs that are directly adjacent to sequences of 2’-0-methyl-NTPs.
  • RNA DNA duplexes formed in step (c) may be achieved using any conditions suitable to enable RNase H site-specific cleavage of the RNA strand to release the RNA molecules.
  • RNA transcripts Suitable conditions to cleave the RNA transcripts will be dependent on the RNase H used to achieve cleavage.
  • RNase H may be obtained from any suitable source and the cleavage step may follow the manufacturer’s instructions for the particular RNase H enzyme.
  • the RNase H enzyme is a naturally-occurring enzyme (i.e. isolated from its natural source, e.g. animal or bacteria), a recombinant enzyme (e.g. expressed in an, and obtained from, a recombinant organism producing the enzyme, e.g. from a microbial, e.g. bacterial, expression system) or a derivative, e.g. sequence-modified derivatives, or mutant thereof.
  • any enzyme or combination of enzymes in the enzyme commission number 3.1.26.4 may be used in the present invention.
  • the RNase H is an E.coli RNase H.
  • the RNase H is selected from the following group, which refers to the UniProtKB/Swiss-Prot accession numbers: POA7Y4/RNH_ECOLI;
  • B7N876/RNH_ECOLU B6HZS7/RNH_ECOSE
  • B1 LHM3, RNH_ECOSM functional variants and derivatives thereof or a combination thereof.
  • the RNase H is POA7Y4/RNH_ECOLI or a functional variant or derivative thereof.
  • the source of the RNase H for use in the present invention is not particularly important and both natural and recombinant enzymes are contemplated for use in the methods described herein.
  • a solution comprising an RNase H may contain a mixture of enzymes each contributing to the RNA cleavage activity of the solution.
  • the RNase H is a mixture of enzymes, e.g. a mixture of any two or more of the enzymes described above.
  • the mixture may comprise one of the enzymes defined above and one or more other undefined RNase H.
  • a mixture of RNase H enzymes comprises one of the enzymes defined above as a substantial part of the mixture, i.e.
  • RNA cleavage activity of the mixture contributing to at least about 30%, e.g. at least about 40%, 50%, 60%, or 70% of the RNA cleavage activity of the mixture.
  • the RNase H may specifically bind to the RNA: DNA duplexes and selectively (e.g. specifically) cleave the RNA (opposite the 5’ end of the dNTP sequence in the oligonucleotide splint as defined above) in a Tris-HCI buffer (e.g. about 20mM). Cleavage may occur in a pH range of about 7.0- 9.0, e.g. about 8.0 such as about pH 7.8, over a range of temperatures, e.g. about 20-40 °C, e.g. about 37 °C, for a period of about 1-10 hours, e.g. about 3-6 hours.
  • a Tris-HCI buffer e.g. about 20mM
  • the reaction mix may contain other reagents, such as monovalent and divalent cations (e.g. in the form of KCI and MgCh, respectively) and DTT.
  • RNase H enzyme may be used at a concentration of about 50-200 Units/mL, e.g. about 100 Units/mL.
  • One unit may be defined as the amount of enzyme that will hydrolyze 1 nmol of the RNA in [ 3 H]-labelled poly(rA) * poly(dT), to acid-soluble ribonucleotides in a total reaction volume of 50 pi in 20 minutes at 37°C.
  • the skilled person would readily be able to determine other suitable conditions.
  • the method comprises a step of inactivating the RNase H enzyme.
  • cleavage includes any means of breaking a covalent bond.
  • cleavage involves cleavage of a covalent bond in a nucleotide chain (i.e. strand cleavage or strand scission), for example by cleavage of a phosphodiester bond.
  • cleavage domain typically refers to a domain within the plasmid comprising the DNA molecule (template) that can be cleaved specifically to linearize the plasmid to produce the DNA molecule (template) or excise the DNA molecule (template) from the plasmid.
  • the term“cleavage domain” may be used to describe the RNA:DNA duplex formed by hybridizing the DNA oligonucleotides to the RNA transcripts insofar as the DNA oligonucleotides function to create a cleavage domain that may be site-specifi cally cleaved by RNase H.
  • the DNA oligonucleotides may be viewed as forming RNase H cleavage domains in the RNA transcripts.
  • a cleavage domain may comprise a sequence (a cleavage recognition site) that is recognised by one or more enzymes capable of cleaving a nucleic acid molecule, i.e. capable of breaking the phosphodiester linkage between two or more nucleotides.
  • a cleavage domain may comprise a restriction endonuclease (restriction enzyme) recognition sequence. Restriction enzymes cut double-stranded or single stranded DNA at specific recognition nucleotide sequences known as restriction sites and suitable enzymes are well-known in the art.
  • rare-cutting restriction enzymes i.e. enzymes with a long recognition site (at least 8 base pairs in length)
  • template e.g. to avoid the inclusion of a cleavage recognition site within the DNA template.
  • a cleavage domain may comprise a sequence that is recognised by a type II restriction endonuclease, more preferably a type I Is restriction endonuclease. Any suitable cleavage domain and cleavage enzyme may be used in the invention to linearize or excise the DNA molecule (template).
  • the cleavage domains that border the DNA molecule (template) in a plasmid may be the same or different from each other.
  • the cleavage domains that border the DNA molecule (template) are the same such that a single cleavage step is sufficient to excise the DNA molecule (template).
  • the step of excising the DNA molecule (template) comprises contacting the plasmid containing the DNA molecule (template) with a single cleavage enzyme under conditions suitable to cleave the cleavage domains in the plasmid.
  • a cleavage enzyme e.g. a restriction endonuclease
  • a cleavage enzyme may specifically bind to its cleavage recognition site and selectively (e.g. specifically) cleave the nucleic acid in a variety of buffers, such as phosphate buffered saline (PBS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), HEPES buffered saline (HBS), and Tris buffered saline (TBS), both with and without EDTA.
  • PBS phosphate buffered saline
  • HEPES HEPES buffered saline
  • TBS Tris buffered saline
  • Cleavage may occur in a pH range of about 3.0-10.0, e.g. 4.0-9.0, 5.0-8.0, over a wide range of temperatures, e.g. 0-70 °C.
  • the skilled person would readily
  • release is used in the present context to refer to cleaving the RNA transcripts produced in the in vitro transcription reaction at the RNA:DNA duplexes formed in step (c) so as to detach, disconnect or separate the tandem repeats of the RNA molecule. It is desirable that the release of a given RNA molecule will involve cleavage at both ends of the RNA molecule, i.e. in both RNA:DNA duplexes bordering the RNA molecule.
  • RNA oligonucleotides may not hybridise to every complementary sequence in the RNA transcripts, which may reduce the efficiency of the cleavage step.
  • the step of cleaving the RNA strand of the RNA:DNA duplexes results in cleavage of the RNA strand in at least about 50% of the RNA: DNA duplexes in the RNA transcripts, e.g. at least about 60%, 70% or 80%.
  • the step of cleaving the RNA strand of partially double stranded RNA:DNA duplexes results in cleavage of the RNA strand in at least about 90% of the RNA: DNA duplexes in the RNA transcripts, e.g. 95% or more.
  • the step of cleaving the RNA strand of partially double stranded RNA: DNA duplexes results in the release of at least about 50% of the RNA molecules contained in the RNA transcripts, e.g. at least about 60%, 70% or 80%. In some embodiments, the step of cleaving the RNA strand of partially double stranded RNA:DNA duplexes results in the release of at least about 90% of RNA molecules contained in the RNA transcripts, e.g. 95% or more.
  • RNA molecules Once the RNA molecules have been released, it may be desirable to isolate, separate or purify the RNA molecules from the cleavage reaction mixture (e.g. reaction components, such as RNase H and DNA oligonucleotides and/or degradation products, such as the 5’ ends of the transcripts which may contain an optimal initiation site and/or spacer sequence, uncleaved RNA transcripts, etc.) and for use in other applications.
  • reaction components such as RNase H and DNA oligonucleotides and/or degradation products, such as the 5’ ends of the transcripts which may contain an optimal initiation site and/or spacer sequence, uncleaved RNA transcripts, etc.
  • the method of the present invention further comprises a step of isolating, separating or purifying the RNA molecules.
  • This isolation, separation or purification may be done by any suitable method known in the art.
  • the isolated or purified RNA molecules form a further embodiment of the invention.
  • the RNA molecules are preferably substantially free of any contaminating components derived from the materials or components used in the isolation procedure or in their preparation (e.g. reaction components and/or degradation products as described above).
  • the RNA molecules are purified to a degree of purity of more than about 50 or 60 %, e.g. more than about 70, 80 or 90%, such as more than about 95 or 99% purity as assessed w/w (dry weight). Such purity levels may include degradation products of the RNA molecules.
  • RNA molecules which have lower purity, e.g. contain less than about 50% of the RNA molecules of interest, e.g. less than about 40 or 30%.
  • the invention may result in a mixture or plurality (e.g. a library) of copies of RNA molecules.
  • it may be desirable to further separate the RNA molecules e.g. by size, to obtain specific RNA molecules (i.e. to isolate specific RNA molecules) or to generate sub-groups or sub-libraries of RNA molecules.
  • Any suitable means for separating the mixtures of RNA molecules to isolate the specific RNA molecules or sub-groups or sub libraries of RNA molecules may be employed.
  • the method comprises a further step of separating RNA molecules from a mixture (e.g. library) of RNA molecules obtained by the method described above, to isolate copies of a specific RNA molecule or a sub-group of RNA molecules.
  • a mixture e.g. library
  • the products of the cleavage reaction may be separated by size using gel electrophoresis using an agarose gel or a polyacrylamide gel.
  • the desired RNA molecules can then be isolated from the gel and purified further, if necessary, according to methods known in the art.
  • Other methods for purifying, isolating or separating the RNA molecules of the invention utilise chromatography (e.g. HPLC, FPLC, size-exclusion, ion-exchange, affinity, hydrophobic interaction, reverse-phase), organic extraction or capillary electrophoresis.
  • the step of isolating the plurality of copies of the RNA molecule comprises HPLC purification, particularly ion-exchange HPLC.
  • HPLC fractions containing the plurality of copies of the RNA molecule are pooled and optionally concentrated.
  • Any suitable conditions for HPLC may be used to isolate the RNA molecules and exemplary conditions are set out in the Examples. However, the conditions may depend on the RNA molecules to be isolated and/or the molecules and/or reagents from which the RNA molecules are to be separated. As described above and shown in the Examples, the inventors have surprisingly determined that the method of the invention may be used effectively on a large scale to produce large amounts of RNA, e.g.
  • the invention may be viewed as providing a large scale method for producing a plurality of copies of an RNA molecule.
  • the term“large scale” refers reaction volumes of about 5ml_ or more, such as about 10, 12, 15, 20, 25, 30, 40 or 50 ml_ or more, e.g. about 75 or 100ml_ or more.
  • the reaction volume of the reaction mixture(s) used the method of the invention is at least about 5ml_, such as about 10, 12, 15, 20, 25, 30, 40 or 50 ml_ or more, e.g. about 75 or 100ml_ or more.
  • the determination that microwaves can be used to rapidly heat the completed in vitro transcription reaction mixture without degrading the RNA transcripts in step (c) of the method facilitates the use of such large volumes.
  • the method of the invention results in, i.e. produces, the desired RNA molecules at a concentration of at least about 0.10 mg/ml_, e.g. at least about 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45 or 0.50 mg/ml_. In some embodiments, the method of the invention produces the desired RNA molecules at a concentration of about 0.60, 0.70, 0.80, 0.90, 1.00 mg/ml_ or more.
  • the inventors have also determined that the efficiency of the method can be improved by performing all of the reactions in a single reaction vessel, a so-called “one-pot” reaction.
  • the DNA oligonucleotides may be added to the reaction mixture which is subjected to conditions to facilitate hybridization of the DNA
  • the DNA oligonucleotides may be added to the reaction mixture after it is heated.
  • the RNase H enzyme may then be added to the reaction mixture under suitable conditions (e.g. once the reaction mixture has cooled to a temperature that will not denature the RNase H but at which the enzyme is active) to cleave the RNA transcripts and release the RNA molecules.
  • the reagents from previous reactions are not removed. Accordingly, the RNase H enzyme used in step (d) must be compatible with (i.e. functional in) the reagents (e.g. buffer) used in the previous steps, e.g. the in vitro transcription step, and/or the reaction mixture from the previous steps may be adjusted to conditions suitable for the next step, e.g. by adjusting the pH, addition of salts etc.
  • the reagents e.g. buffer
  • the reaction mixture from the previous steps may be adjusted to conditions suitable for the next step, e.g. by adjusting the pH, addition of salts etc.
  • the step of providing the DNA molecule (template) may comprise a step of cleaving a plasmid containing the DNA molecule (template).
  • the in vitro transcription reagents used in step (b) must be compatible with (i.e. functional in) the reagents (e.g. buffer) used in the previous steps, e.g. the cleavage step, and/or the reaction mixture from the previous step may be adjusted to conditions suitable for the next step, e.g. by adjusting the pH, addition of salts, buffers etc.
  • the RNase H enzyme may show some reduced activity in cleaving the RNA strand of the RNA:DNA duplexes relative to the activity of the RNase H enzyme on the RNA: DNA duplexes in conditions that are optimum for the enzyme, e.g. in the buffer, salt and
  • the RNase H enzyme may be considered to be compatible or functional if it has at least 50%, e.g. at least 60, 70, 80, 85, 90, 95, 96, 97, 98, 99 or 100%, activity relative to the activity of the RNase H enzyme in conditions that are optimum for the enzyme.
  • the RNA polymerase enzyme may show some reduced activity in transcription of the DNA template relative to the activity of the RNA polymerase enzyme on the same DNA template in conditions that are optimum for the enzyme, e.g. in the buffer, salt and temperature conditions recommended by the enzyme
  • the polymerase enzyme may be considered to be compatible or functional if it has at least 50%, e.g. at least 60, 70, 80, 85, 90, 95, 96, 97, 98, 99 or 100%, activity relative to the activity of the RNA polymerase enzyme in conditions that are optimum for the enzyme.
  • RNase H is compatible with the reagents used in a T7 polymerase in vitro transcription reaction.
  • the RNA polymerase is T7 RNA polymerase and the RNase H is E.coli RNase H.
  • step (b) may be performed simultaneously or sequentially.
  • DNA duplexes may be performed simultaneously, e.g. the reagents for the cleavage reaction may be provided during the hybridization step, e.g. during the cooling step.
  • steps (c) and (d) may be performed simultaneously or sequentially.
  • reaction mixture comprising:
  • DNA oligonucleotides comprising 2’-0-methylated ribonucleotides, wherein the DNA oligonucleotides guide enzymatic cleavage of RNA transcripts produced from the DNA molecule at the ends of the tandem repeats of the RNA;
  • the reaction mixture also contains reagents needed to perform the methods of the invention, e.g. NTPs, buffers, ions, etc. as described above.
  • the reaction mixture may further comprise a cleavage enzyme (and associated buffers etc.), e.g. to linearize or excise the DNA molecule from a plasmid containing said DNA molecule.
  • the method of the invention may also be performed in batches, e.g. each step is performed in a separate reaction vessel or at least two steps are performed in separate reaction vessels. Batch reactions may be particularly useful where the reagents used in one step are not compatible with the reagents in a subsequent step, e.g. the RNase H enzyme is not functional in the conditions used in the in vitro transcription step.
  • the method may comprise additional purification steps between the steps of the method described above, e.g. to switch buffers etc. Suitable methods for such purification steps are known in the art, e.g. dialysis, and any such method may be employed in the method of the invention.
  • RNA molecules produced by the method of the invention may be desirable to modify their properties (e.g. improve their stability or half-life) or increase their utility, e.g. for use as a label or in therapy.
  • the RNA molecules produced by the invention may be conjugated to another molecule or component by a chemical linker or spacer.
  • the method provides a further step of conjugating or linking the RNA molecules to another molecule or component.
  • conjugation in the context of the present invention with respect to linking or joining a molecule or component to an RNA molecule refers to joining said molecule or component to the RNA molecule via a covalent bond.
  • the conjugation may occur via a click chemistry reaction.
  • click chemistry generally refers to reactions that are modular, wide in scope, give high yields, generate only inoffensive by-products, such as those that can be removed by non-chromatographic methods, and are stereospecific (but not necessarily enantioselective). See, e.g., Angew. Chem. Int. Ed., 2001 , 40(11):2004-2021 , which is entirely incorporated herein by reference.
  • click chemistry can describe pairs of functional groups that can selectively react with each other in mild, aqueous conditions. Accordingly, click chemistry groups are suitable for the conjugation of functional groups to the RNA molecules of the present method.
  • Common click chemistry reactions include azide- alkyne cycloadditions, alkyne-nitrone cycloadditions, alkene-tetrazine reactions and alkene-tetrazole reactions.
  • a specific example of click chemistry reaction can be the Huisgen 1 ,3- dipolar cycloaddition of an azide and an alkyne, i.e., Copper-catalysed reaction of an azide with an alkyne to form a 5-membered heteroatom ring called 1 ,2,3-triazole.
  • the reaction can also be known as a Cu(l)-Catalyzed Azide-Alkyne Cycloaddition (CuAAC), a Cu(l) click chemistry or a Cu+ click chemistry.
  • Catalyst for the click chemistry can be Cu(l) salts, or Cu(l) salts made in situ by reducing Cu(ll) reagent to Cu(l) reagent with a reducing reagent (Pharm Res. 2008, 25(10): 2216-2230).
  • Known Cu(ll) reagents for the click chemistry can include, but are not limited to, Cu(ll)D(TBTA) complex and Cu(ll) (THPTA) complex.
  • TBTA which is tris-[(1- benzyl-1 H-1 ,2,3-triazol-4-yl)methyl]amine, also known as tris- (benzyltriazolylmethyl)amine, can be a stabilizing ligand for Cu(l) salts.
  • THPTA which is tris-(hydroxypropyltriazolylmethyl)amine
  • THPTA can be another example of stabilizing agent for Cu(l).
  • Other conditions can also be accomplished to construct the 1 ,2,3-triazole ring from an azide and an alkyne using copper-free click chemistry, such as by the Strain-promoted Azide-Alkyne Click chemistry reaction (SPAAC, see, e.g., Chem. Commun., 2011 , 47:6257-6259 and Nature, 2015, 519(7544):486-90), each of which is entirely incorporated herein by reference.
  • SPAAC Strain-promoted Azide-Alkyne Click chemistry reaction
  • RNA molecules produced by the present method may be conjugated to RNA molecules produced by the present method.
  • the molecule or component may be a nucleic acid molecule, protein (e.g. an antibody or antigen-binding fragment thereof), peptide, small-molecule organic compound (e.g. biotin), fluorophore, metal-ligand complex, polysaccharide, nanoparticle, nanotube, polymer, cell, organelle, vesicle, virus, virus-like particle or any combination of these.
  • the cell may be a prokaryotic or eukaryotic cell.
  • the RNA molecules may be conjugated or linked to a compound or molecule which has a therapeutic or prophylactic effect, e.g. an antibiotic, antiviral, vaccine, antitumour agent, e.g. a radioactive compound or isotope, cytokine, toxin, oligonucleotide, nucleic acid encoding gene or nucleic acid vaccine.
  • a therapeutic or prophylactic effect e.g. an antibiotic, antiviral, vaccine, antitumour agent, e.g. a radioactive compound or isotope, cytokine, toxin, oligonucleotide, nucleic acid encoding gene or nucleic acid vaccine.
  • the RNA molecules may be conjugated or linked to a label, e.g. a radiolabel, a fluorescent label, luminescent label, a chromophore label as well as to substances and enzymes which generate a detectable substrate, e.g. horse radish peroxidase, luciferase or alkaline
  • a label e.g. a radiolabel, a fluorescent label, luminescent label, a chromophore label
  • substances and enzymes which generate a detectable substrate e.g. horse radish peroxidase, luciferase or alkaline
  • Labels for magnetic resonance imaging, positron emission tomography probes and boron 10 for neutron capture therapy may also be conjugated to the RNA molecules described herein.
  • the molecule or component may be selected from the group consisting of: a fluorophore, a sterol, a polyether, a metal complex, a thiol containing molecule, a molecule containing a group providing increased nuclease resistance and a molecule containing a group capable of participating in a click chemistry reaction.
  • RNA molecules or component conjugated to the RNA molecules may interact with other molecules and such interactions may be covalent or non-covalent interactions.
  • a peptide conjugated to the RNA molecules may interact with its cognate binding partner, such as an antibody, non- covalently.
  • a molecule containing a group capable of participating in a click chemistry reaction may by conjugated to another molecule or component as defined above via reaction with a reactive group of said molecule or component to form a covalent complex.
  • the RNA molecules and other component may be joined together either directly through a bond or indirectly through a linking group. Where linking groups are employed, such groups may be chosen to provide for covalent attachment of the RNA molecules and other component through the linking group.
  • Linking groups of interest may vary widely depending on the nature of the other component. The linking group, when present, is in many embodiments biologically inert.
  • linking groups are known to those of skill in the art and find use in the invention.
  • the linking group is generally at least about 50 daltons, usually at least about 100 daltons and may be as large as 1000 daltons or larger, for example up to 1000000 daltons if the linking group contains a spacer, but generally will not exceed about 500 daltons and usually will not exceed about 300 daltons.
  • linkers will comprise a spacer group terminated at either end with a reactive functionality capable of covalently bonding to the RNA molecules and other molecule or component.
  • Spacer groups of interest may include aliphatic and unsaturated
  • Spacer groups may also be comprised of ligands that bind to metals such that the presence of a metal ion coordinates two or more ligands to form a complex.
  • Specific spacer elements include: 1 ,4-diaminohexane, xylylenediamine, terephthalic acid, 3,6- dioxaoctanedioic acid, ethylenediamine-N,N-diacetic acid, 1 ,T-ethylenebis(5-oxo-3- pyrrolidinecarboxylic acid), 4,4'-ethylenedipiperidine, oligoethylene glycol and polyethylene glycol.
  • Potential reactive functionalities include nucleophilic functional groups (amines, alcohols, thiols, hydrazides), electrophilic functional groups (aldehydes, esters, vinyl ketones, epoxides, isocyanates, maleimides), functional groups capable of cycloaddition reactions, forming disulfide bonds, or binding to metals.
  • Specific examples include primary and secondary amines, hydroxamic acids, N-hydroxysuccinimidyl esters, N-hydroxysuccinimidyl carbonates, oxycarbonylimidazoles, nitrophenylesters, trifluoroethyl esters, glycidyl ethers, vinylsulfones, and maleimides.
  • RNA molecule conjugates include heterofunctional compounds, such as azidobenzoyl hydrazide, N-[4-(p-azidosalicylamino)butyl]-3'-[2'-pyridyldithio]propionamid), bis- sulfosuccinimidyl suberate, dimethyladipimidate, disuccinimidyltartrate, N- maleimidobutyryloxysuccinimide ester, N-hydroxy sulfosuccinimidyl-4- azidobenzoate, N-succinimidyl [4-azidophenyl]-1 ,3'-dithiopropionate, N-succinimidyl [4-iodoacetyl]aminobenzoate, glutaraldehyde, and succinimidyl-4-[N- maleimidomethyl]cyclohexane-1-carboxy
  • RNA molecules of the invention may be conjugated to a solid substrate (i.e. a solid phase or solid support) and it will be evident that this may be achieved in any convenient way.
  • a solid substrate i.e. a solid phase or solid support
  • the manner or means of immobilisation and the solid support may be selected, according to choice, from any number of immobilisation means and solid supports as are widely known in the art and described in the literature.
  • the RNA molecules may be directly bound to the support, for example via a domain or moiety of the RNA molecules (e.g. chemically cross-linked).
  • the RNA molecules may be bound indirectly by means of a linker group, or by an
  • the RNA molecules may be covalently or non-covalently linked to the solid support.
  • the linkage may be a reversible (e.g. cleavable) or irreversible linkage.
  • the linkage may be cleaved enzymatically, chemically, or with light, e.g. the linkage may be a light-sensitive linkage.
  • a RNA molecule may be provided with means for immobilisation (e.g. an affinity binding partner, e.g. biotin or a hapten, capable of binding to its binding partner, i.e. a cognate binding partner, e.g. streptavidin or an antibody) provided on the support.
  • an affinity binding partner e.g. biotin or a hapten
  • a cognate binding partner e.g. streptavidin or an antibody
  • the interaction between the RNA molecule and the solid support must be robust enough to allow for washing steps, i.e. the interaction between the RNA molecules and solid support is not disrupted (significantly disrupted) by the washing steps. For instance, it is preferred that with each washing step, less than 5%, preferably less than 4, 3, 2, 1 , 0.5 or 0.1 % of the RNA molecules is removed or eluted from the solid phase.
  • the solid support may be any of the well-known supports or matrices which are currently widely used or proposed for use with nucleic acids. These may take the form of particles (e.g. beads which may be magnetic, para-magnetic or non-magnetic), sheets, gels, filters, membranes, fibres, capillaries, slides, arrays or microtitre strips, tubes, plates or wells etc.
  • particles e.g. beads which may be magnetic, para-magnetic or non-magnetic
  • the support may be made of glass, silica, latex or a polymeric material, e.g. a polysaccharide polymer material, such as agarose (e.g. sepharose). Suitable are materials presenting a high surface area for binding of the RNA molecules of the invention.
  • Such supports may have an irregular surface and may be for example porous or particulate, e.g. particles, fibres, webs, sinters or sieves. Particulate materials, e.g. beads are useful due to their greater binding capacity, particularly polymeric beads.
  • a particulate solid support used according to the invention will comprise spherical beads.
  • the size of the beads is not critical, but they may for example be of the order of diameter of at least about 1 pm and preferably at least about 2 pm, 5 pm, 10 pm or 20 pm and have a maximum diameter of preferably not more than about 500 pm, and e.g. not more than about 100 pm.
  • Monodisperse particles that is those which are substantially uniform in size (e.g. size having a diameter standard deviation of less than 5%) have the advantage that they provide very uniform reproducibility of reaction.
  • Representative monodisperse polymer particles may be produced by the technique described in US-A-4336173.
  • magnetic beads are advantageous.
  • the term "magnetic” as used herein means that the support is capable of having a magnetic moment imparted to it when placed in a magnetic field, and thus is displaceable under the action of that field.
  • a support comprising magnetic particles may readily be removed by magnetic aggregation, which provides a quick, simple and efficient way of separating the particles following the interactions or reactions with the RNA molecules.
  • a pharmaceutical composition comprising an RNA molecule obtained using the method of the invention, together with a pharmacologically (or pharmaceutically) acceptable excipient.
  • the method may comprise a further step of formulating an RNA molecule obtained using the method of the invention with a pharmacologically (or pharmaceutically) acceptable excipient to produce a pharmaceutical composition.
  • the excipient may include any excipients known in the art, for example any carrier or diluent or any other ingredient or agent such as buffer, antioxidant, chelator, binder, coating, disintegrant, filler, flavour, colour, glidant, lubricant, preservative, sorbent and/or sweetener etc.
  • any carrier or diluent or any other ingredient or agent such as buffer, antioxidant, chelator, binder, coating, disintegrant, filler, flavour, colour, glidant, lubricant, preservative, sorbent and/or sweetener etc.
  • the excipient may be selected from, for example, lactic acid, dextrose, sodium metabisulfate, benzyl alcohol, polyethylene glycol, propylene glycol, microcrystalline cellulose, lactose, starch, chitosan, pregelatinized starch, calcium carbonate, calcium sulfate, dextrates, dextrin, dextrose, dibasic calcium phosphate dihydrate, tribasic calcium phosphate, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, powdered cellulose, sodium chloride, sorbitol and/or talc.
  • the pharmaceutical composition may be provided in any form known in the art, for example as a tablet, capsule, coated tablet, liquid, suspension, tab, sachet, implant, inhalant, powder, pellet, emulsion, lyophilisate, effervescent, spray, salve, emulsion, balm, plaster or any mixtures thereof. It may be provided e.g. as a gastric fluid-resistant preparation and/or in sustained action form. It may be a form suitable for oral, parenteral, topical, rectal, genital, subcutaneous, transurethral,
  • transdermal, intranasal, intraperitoneal, intramuscular and/or intravenous administration and/or for administration by inhalation are preferred.
  • the invention provides an RNA molecule obtained by the method of the invention.
  • the RNA molecules obtained by the method of the invention may be conjugated to another molecule or component and/or immobilized on a solid substrate.
  • the invention provides RNA molecules obtained by the method of the invention (including conjugates thereof) or a pharmaceutical composition comprising the RNA molecules for use in therapy.
  • the invention provides the use of RNA molecules obtained by the method of the invention (including conjugates thereof) in the manufacture or preparation of a medicament (e.g. pharmaceutical composition) for use in therapy.
  • the invention provides a method of treating a subject in need of therapy comprising administering to the subject an effective amount of RNA molecules obtained by the method of the invention (including conjugates thereof) or a pharmaceutical composition comprising the RNA molecules.
  • the present invention provides a kit, particularly a kit for use in a method for producing a plurality of copies of an RNA molecule as described herein, the kit comprising: (i) a DNA molecule comprising a promoter sequence for an RNA
  • DNA oligonucleotides comprising 2’-0-methylated ribonucleotides, wherein the DNA oligonucleotides guide enzymatic cleavage of RNA transcripts produced from the DNA molecule at the ends of the tandem repeats of the RNA molecule, and optionally
  • DNA molecule RNA polymerase, DNA oligonucleotides and RNase H are as described above.
  • the kit may further comprise a cleavage enzyme, e.g. a restriction endonuclease, as defined herein.
  • a cleavage enzyme e.g. a restriction endonuclease, as defined herein.
  • RNA molecules produced by the method of the invention may be pooled to generate a mixture or library of RNA molecules.
  • the present invention provides a library comprising a plurality of RNA molecules obtained by the method of the invention.
  • the RNA molecules produced by the method of the invention may be used to produce their encoded protein or peptide, e.g. in an in vitro translation system.
  • the method further comprises a step of translating the RNA molecules and optionally isolating the translation product, e.g. protein or peptide.
  • the RNA molecules of the invention may be transfected into cells, e.g. prokaryotic or eukaryotic cells.
  • cells e.g. prokaryotic or eukaryotic cells.
  • the method further comprises a step of transfecting or transferring the RNA molecules into cells.
  • the transfected cells form a further embodiment of the invention.
  • Figure 1 shows a schematic of the method of the invention in which a chimeric oligonucleotide splint guides the RNase H site-specific cleavage of an RNA transcript comprising a plurality of (e.g. 26) tandem repeats of a desired RNA molecule to yield a plurality of copies of the desired RNA molecule.
  • Figure 2 shows a photograph of a 20% denaturing PAGE showing the production of miR-34a binding site in the HNF4a mRNA (22nt). The numbers on the left show the sizes of the sequences based on a size ladder (not shown).
  • Lane 1 shows the product of an in vitro transcription reaction from a linearized plasmid encoding 26 repeats following a T7 promoter. 1ml reaction scale, 0.1 pi loaded.
  • Lane 2 shows the RNase H cleavage reaction of sample from lane 1. 0.1 mI loaded. Lane 3: shows the product of an in vitro transcription reaction from conventional template (single repeat following a T7 promoter sequence). 1ml reaction scale,
  • Figure 3 shows a photograph of a PAGE stained with ethidium bromide to visualise the nucleic acid.
  • The“Reference” lane shows a size ladder.
  • the “Transcription” lane shows the product of an in vitro transcription reaction from a linearized plasmid containing a DNA template encoding 26 repeats of miR-34-5p following a T7 promoter (SEQ ID NO: 6).
  • The“Cleavage (incomplete)” lane shows the product of the oligonucleotide splint guided RNase H cleavage reaction.
  • the “HLPC purified” lane shows the miR-34-5p product following ion-exchange HPLC purification.
  • Figure 4 shows photographs of PAGE gels stained with a nucleic acid stain (GelRed) to visualise the nucleic acids.
  • Lane 1 shows a size ladder (sizes of some bands marked on the left); Lane 2 shows the circular plasmid containing the DLL1-2 DNA template; Lane 3 shows the linearized plasmid containing the DLL1-2 DNA template; Lanes 4 and 6 show the different amounts of the product of a small scale in vitro transcription reaction using the linearized plasmid; Lanes 5 and 7 show different amount of the product of a large scale in vitro transcription reaction using the linearized plasmid; and (B) Lane 1 shows a reference RNA molecule of 22 nucleotides; Lane 2 shows the product of a small scale cleavage reaction (1 pL RNase H for 24 hours) performed on the large scale in vitro transcription reaction shown in Lanes 5 and 7 of A; Lanes 3 and 4 show the product of a large scale cleavage reaction (1 mL RNase H for 24 hours) performed on the
  • Figure 5 shows a photograph of PAGE gels stained with a nucleic acid stain (SYBR Gold) to visualise the nucleic acids.
  • the numbers across the top refer to constructs 1-6 described in Example 3.
  • the numbers on the left show the sizes of the sequences based on a size ladder (not shown).
  • All lanes marked“A” show the in vitro transcription products from the linearised plasmid from the respective construct.
  • All lanes marked“B” are the cleavage reaction from the in vitro transcription product of A.
  • the arrows indicate the target band for the RNA sequence.
  • RNA 1 is 20nt
  • RNAs 2-5 are 22nt
  • RNA 6 is 75nt.
  • miR- 34a is a tumor suppressor gene, which is down-regulated in the K-562 cells and chronic myeloid leukemia (CML) patients due to aberrant DNA hypermethylation.
  • CML chronic myeloid leukemia
  • the plasmids were linearized by cleaving the plasmid with BamHI according to the manufacturer’s instructions and linearized plasmid was used as the DNA template in 10ml_ transcription reactions using T7 polymerase as described below.
  • RNA obtained from the templates comprising multiple repeats of the encoding sequences were subjected to cleavage with RNase H as described below.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of miR- 34a-3p consisted of the sequence mAmUmUmGAGGGmCmAmGmU (SEQ ID NO: 7), wherein each letter preceded by an“m” represents a 2’-0-methyl-NTP. The other letters represent dNTPs.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of miR-34a-5p consisted of the sequence
  • Figure 2 shows a picture of denaturing PAGE comparing the amount of miR- 34a binding site in the HNF4a mRNA obtained from the transcription and
  • Table 1 demonstrates that the method of the invention consistently results in a significant increase in the amount of target RNA molecules produced relative to conventional“run-off” transcription, which uses only one copy of the target molecule in the DNA template.
  • Dithiothreitol 5mM GMP, 3mM NTPs, T7 RNA polymerase 0.3mg/ml, inorganic pyrophophatase (IPPase) 0.1 mg/ml and DNA template in varying concentrations.
  • Linearized plasmid was used at 2ng/pl. The plasmid linearization reaction was used directly as the input for transcription reaction without prior purification.
  • the cleavage reaction was checked for completion on a 20% denaturing PAGE of 20x20cm (8M urea, 1X TBE buffer, 14W, 2h, Biorad, Protean II) or a similar setup. Reactions took typically between 3 and 6h for completion. In case of incomplete cleavage reactions, microwave annealing was repeated and more RNase H was added. The reaction was stopped by adding excess of EDTA
  • the cleavage reactions were concentrated and washed with water using Amicon stirred cells with 1 or 3 kDa cut-off before injection into HPLC.
  • the completed cleavage reaction for mi-R34-5p described in Example 1 was concentrated and washed with water using Amicon stirred cells with 1 or 3 kDa cut-off before injection into HPLC.
  • Running buffers were A: 20mM NaAc, 20mM NaCICL, 10% ACN, pH 6.5; and B: 20mM NaAc, 600mM NaCICL,
  • Figure 3 shows that HPLC purification results in a highly pure product.
  • Example 3 - RNA molecule production is independent of template sequence and production
  • DNA templates were designed for a variety of desired RNA molecules as shown below. Moreover, the templates were used in the in vitro transcription reactions in the form linearized plasmids as described in Example 1 or solid-phase synthesised DNA. All templates were able to generate RNA transcripts that could be cleaved with RNase H using the oligonucleotide splints set out below, to generate high yields of the desired RNA molecules. These results demonstrate that the method is independent of template sequence and the method used to produce it.
  • Figure 4 shows the product of the DLL1-2 template described below.
  • Figure 5 shows the products of constructs 1-6 described below.
  • a ntisense-miR-34a
  • AACCAGCUAAGACACUGCCAGG (SEQ ID NO: 9) was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of antisense- miR-34a consisted of the sequence
  • CCGGCCGCCUGCGGCACUGCCU SEQ ID NO: 11 was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of DLL1-2 consisted of the sequence
  • Synthetic double strand DNA encoding 6 repeats of the RNA sequence GGCCACUAUGUGUUGUUACUGCCA (SEQ ID NO: 13) was produced by solid- phase synthesis and used directly in the in vitro transcription reaction.
  • the antisense strand sequence of the template DNA is provided in SEQ ID NO: 14.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of CD44 consisted of the sequence mGmGmCmCTGGCmAmGmUmA (SEQ ID NO: 15).
  • Synthetic single strand DNA encoding 2 repeats of the HNF4a RNA sequence was produced by solid-phase synthesis and used directly in the in vitro transcription reaction with a T7 promoter oligonucleotide to provide a double stranded promoter sequence.
  • the antisense strand sequence of the template DNA is provided in SEQ ID NO: 16.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of HNF4a consisted of the sequence
  • GGGCCACAUCCCACUGCCA (SEQ ID NO: 18) was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of SEQ ID NO: 18 consisted of the sequence
  • UGGCAGUGUCUUAGCUGGUUGU (SEQ ID NO: 20) was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of SEQ ID NO: 20 consisted of the sequence
  • CAAUCAGCAAGUAUACUGCCCU (SEQ ID NO: 22) was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of SEQ ID NO: 22 consisted of the sequence
  • CCGGCCGCCUGCGGCACUGCCU (SEQ ID NO: 11) was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of SEQ ID NO: 11 consisted of the sequence
  • AACCAGCUAAGACACUGCCAGG (SEQ ID NO: 9) was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of SEQ ID NO: 9 consisted of the sequence
  • a DNA template encoding 5 repeats of the RNA sequence set forth in SEQ ID NO: 24 was cloned into pUC19 as described in Example 1.
  • the oligonucleotide splint used to cleave the transcripts comprising repeats of SEQ ID NO: 24 consisted of the sequence mGmAmCmGCGACmUmUmGmU (SEQ ID NO: 25).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un procédé de production de molécules d'ARN qui utilise des oligonucléotides chimériques pour guider le clivage enzymatique spécifique à un site (RNase H) de transcrits d'ARN (produits par transcription in vitro ) comprenant une pluralité de répétitions en tandem de la molécule d'ARN à produire, pour générer une pluralité de copies de la molécule d'ARN.
PCT/EP2020/058310 2019-03-25 2020-03-25 Procédé et produits de production de molécules d'arn WO2020193610A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1904081.5 2019-03-25
GBGB1904081.5A GB201904081D0 (en) 2019-03-25 2019-03-25 Method and products for producing RNA molecules

Publications (1)

Publication Number Publication Date
WO2020193610A1 true WO2020193610A1 (fr) 2020-10-01

Family

ID=66105298

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2020/058310 WO2020193610A1 (fr) 2019-03-25 2020-03-25 Procédé et produits de production de molécules d'arn

Country Status (2)

Country Link
GB (1) GB201904081D0 (fr)
WO (1) WO2020193610A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024022253A1 (fr) * 2022-07-29 2024-02-01 重庆精准生物技术有限公司 Système de préparation d'arnm linéarisé, son utilisation et procédé de préparation pour la préparation d'arnm à l'aide de celui-ci

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4336173A (en) 1978-02-21 1982-06-22 Sintef Process for preparing an aqueous emulsion or dispersion of a partly water-soluble material, and optionally further conversion of the prepared dispersion or emulsion to a polymer dispersion when the partly water-soluble material is a polymerizable monomer
WO2004058989A2 (fr) * 2002-12-23 2004-07-15 Epicentre Technologies Transcription dependante de la cible
WO2014134029A1 (fr) * 2013-02-26 2014-09-04 Massachusetts Institute Of Technology Particules d'acide nucléique, procédés et leur utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4336173A (en) 1978-02-21 1982-06-22 Sintef Process for preparing an aqueous emulsion or dispersion of a partly water-soluble material, and optionally further conversion of the prepared dispersion or emulsion to a polymer dispersion when the partly water-soluble material is a polymerizable monomer
WO2004058989A2 (fr) * 2002-12-23 2004-07-15 Epicentre Technologies Transcription dependante de la cible
WO2014134029A1 (fr) * 2013-02-26 2014-09-04 Massachusetts Institute Of Technology Particules d'acide nucléique, procédés et leur utilisation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ANGEW. CHEM. INT. ED., vol. 40, no. 11, 2001, pages 2004 - 2021
CHEM. COMMUN., vol. 47, 2011, pages 6257 - 6259
J LAPHAM ET AL: "RNase H cleavage for processing of in vitro transcribed RNA for NMR studies and RNA ligation", RNA, vol. 2, no. 3, 1 March 1996 (1996-03-01), US, pages 289 - 296, XP055352700, ISSN: 1355-8382 *
NATURE, vol. 519, no. 7544, 2015, pages 486 - 90
PHARM RES., vol. 25, no. 10, 2008, pages 2216 - 2230

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024022253A1 (fr) * 2022-07-29 2024-02-01 重庆精准生物技术有限公司 Système de préparation d'arnm linéarisé, son utilisation et procédé de préparation pour la préparation d'arnm à l'aide de celui-ci

Also Published As

Publication number Publication date
GB201904081D0 (en) 2019-05-08

Similar Documents

Publication Publication Date Title
US20230123754A1 (en) RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
CN107532210B (zh) Dna合成的方法
AU2005314431B2 (en) Cell free biosynthesis of high-quality nucleic acid and uses thereof
US9012183B2 (en) Use of template switching for DNA synthesis
EP3481838B1 (fr) Nouveaux procédés de production d'oligonucléotides
KR20170084334A (ko) 화학적 변형을 갖는 가이드 rna
JP7065970B2 (ja) オリゴヌクレオチドの産生のための新規プロセス
JP2023504264A (ja) 合成ガイドｒｎａ、組成物、方法、およびそれらの使用
EP3227476A1 (fr) Procédés et kits pour des applications théranostiques
WO2023081311A1 (fr) Procédés de purification de l'adn pour la synthèse génique
US20230357790A1 (en) Self-targeting expression vector
WO2020193610A1 (fr) Procédé et produits de production de molécules d'arn
US20230079822A1 (en) Method and products for producing single stranded dna polynucleotides
WO2007018744A2 (fr) Biosynthese sans cellule d'acide nucleique
CN117070514B (zh) 非天然rna的制备方法及产品
WO2023222114A1 (fr) Procédés de production d'arn circulaire
CN115975974A (zh) 适合体外合成rna的t7-rna聚合酶突变体及其应用
EP4365303A1 (fr) Purification de produits d'adn linéaire
WO2021148063A1 (fr) Procédé de modification d'une molécule d'acide nucléique pour faciliter son transfert dans des cellules hôtes, et la molécule d'acide nucléique modifiée

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20712378

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20712378

Country of ref document: EP

Kind code of ref document: A1