WO2021148063A1 - Procédé de modification d'une molécule d'acide nucléique pour faciliter son transfert dans des cellules hôtes, et la molécule d'acide nucléique modifiée - Google Patents

Procédé de modification d'une molécule d'acide nucléique pour faciliter son transfert dans des cellules hôtes, et la molécule d'acide nucléique modifiée Download PDF

Info

Publication number
WO2021148063A1
WO2021148063A1 PCT/CZ2021/050006 CZ2021050006W WO2021148063A1 WO 2021148063 A1 WO2021148063 A1 WO 2021148063A1 CZ 2021050006 W CZ2021050006 W CZ 2021050006W WO 2021148063 A1 WO2021148063 A1 WO 2021148063A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
molecule
host cell
modified
transferred
Prior art date
Application number
PCT/CZ2021/050006
Other languages
English (en)
Inventor
Jaroslav Hrabák
Martin Švec
Original Assignee
PortalGene s.r.o.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by PortalGene s.r.o. filed Critical PortalGene s.r.o.
Publication of WO2021148063A1 publication Critical patent/WO2021148063A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to the field of gene transfer.
  • the invention provides a method for modifying of a nucleic acid molecule (transgene) for its efficient transfer into prokaryotic or eukaryotic cell.
  • the nucleic acid molecule (NA) modified according to the invention represents non-replicative element comprising coding or non-coding molecule of NA. After the transfer of that modified NA into the cell, physiology of the cell can be affected.
  • the system can be used for inhibition of bacterial growth in vivo , inhibition of the genes encoding for virulence factors, inhibition of the expression of genes responsible for resistance to antibiotics or plasmid curing for plasmids encoding for resistance or virulence genes (therapeutic purpose).
  • the system can be used for regulation of gene expression or to enhance another interaction, e.g. nucleic acid-protein interactions. These properties can be used for inhibition of cancer cell proliferation, changes in production of signal molecules, antibodies or another modulation of immune cells.
  • the system can be used for genome editing (e.g., CRISPR/Cas9) as well. All the properties can be used for laboratory experiments in vitro or for therapeutic procedures in vivo. For both cell types (prokaryotic and eukaryotic) other related applications can be also developed.
  • a delivery of exogenous genetic material into a cell is one of the crucial steps in biotechnology and genetic engineering.
  • Exogenous genetic information is transferred into prokaryotic or eukaryotic cell by a process called transfection (eukaryotic cell) or horizontal gene transfer (prokaryotic cell).
  • transfection eukaryotic cell
  • prokaryotic cell horizontal gene transfer includes nucleic acid transformation (an uptake of exogenous native nucleic acid), transduction (bacteriophage-mediated transfer) or conjugation (transfer of mobile genetic elements between donor and recipient bacterial cell).
  • transformation is the most common process of introduction of foreign nucleic acid into prokaryotic cell where exogenous nucleic acid is introduced into competent cells.
  • the term “transformation” is usually avoided due to its use for the transformation of normal cell into a cancer cell.
  • the term “transformation” is used for transfer of genetic material into both types of cells (prokaryotic and eukaryotic).
  • Efficiency of nucleic acid penetration into the cell can be enhanced by chemical or physical methods. Among them, pore formation and permeabilization of the cell membrane play a crucial role. Viral particles or non-viral methods are commonly used for the transformation of eukaryotic cells and in some cases prokaryotic cells in vivo (Sung Y.K., Kim S.W. Recent advances in the development of gene delivery systems, Biomater. Res., 2019, 12; 23:8).
  • viral vectors usually defective viral particles are used. Those vectors are not able to replicate independently, therefore uncontrolled replication of introduced genetic information is avoided.
  • retroviruses In eukaryotic cells, retroviruses, adenoviruses, and herpes simplex viruses are commonly used.
  • prokaryotic cells bacteriophages are used.
  • the group of non- viral methods include physical or chemical methods. Among the physical methods, an injection of the NA using a needle with the direct transfer of the NA, biollistic method of the NA usually bound on gold nano-particles, sonoporation using ultrasound, electroporation, photoporation using a laser, magnetic poration of NA bound on magnetic nanoparticles or hydroporation have been already described.
  • nucleic acid with chemical ligand (molecule/polymer) for effective transfer across the cytoplasmic membrane.
  • chemical ligand molecule/polymer
  • efficiency of following molecules has been demonstrated: anorganic particles (e.g., silicon, gold, silver, copper, iron), biologically degradable substances (e.g., cationic lipids, peptide vectors) and polymers (polyethylenimin, polymethylmetacrylate etc.).
  • anorganic particles e.g., silicon, gold, silver, copper, iron
  • biologically degradable substances e.g., cationic lipids, peptide vectors
  • polymers polyethylenimin, polymethylmetacrylate etc.
  • Binding of the NA with positively charged polysaccharides, or short peptides is commonly used for transformation of prokaryotes (Sung Y.K., Kim S.W. Recent advances in the development of gene delivery systems, Biomater. Res., 2019, 23:8; Ferrer-Miralles N., Vazquez E., Villaverde A. Membrane- active peptides for non-viral gene therapy: Making the safest easier. Trends Biotechnol. 2008, 26(5): 267-275).
  • Short nucleic acid molecules or their analogs can be also transferred by essential nutrients, e.g., cobalamin or iron (Rownicky M., Wojciechowska M., Wierzba A.J., Czamecki J., Bartosik D., Gryko D., Trylska J. Vitamin B 12 as a carrier of peptide nucleic acid (PNA) into bacterial cells. Scientific Reports., 2017, 7(1): 7644; Giedyk M., Jackowska A., Rownicky M., Kolanowska M., Trylska J., Gryko D. Vitamin B12 transports modified RNA into E. coli and S. Typhimurium cells. Chemical Communications. 2018, 55(6): 763-766.).
  • a desired nucleic acid molecule i.e. the molecule which has to be transferred (also transformed, delivered or introduced) into a host cell is modified by attaching a hairpin structure to one end and by covalent attaching of a transport molecule to the other end of the molecule.
  • the transport molecule is selected based on its ability to penetrate through biological barriers and non-immunogenic potential.
  • the linking of the hairpin structure to one end (to both 5’ and 3’ termini) of the NA molecule and binding of the transport molecule to the opposite end (either to 5’ or 3’ terminus of the NA strand) increase a stability of the resulting construct.
  • the rest free 3’ or 5‘ terminus can be also modified to prevent hydrolysis of the NA by common nucleases in order to use the system in vivo.
  • Nucleic acid to be transferred into a host cell the transport molecule and the hairpin structure represent key components of the modified NA molecule, i.e. molecule of the NA modified for efficient transfer into a host (i.e. recipient) cell.
  • the advantage of the modified nucleic acid molecule of the invention is its non-replicative character, i.e. the nucleic acid will not be integrated into the genome of transformed cell and thus it will not be transmitted into next generations. Therefore, the method provides sufficient safety with minimized risk of unpredictable changes of the genome.
  • Efficiency of the transformation can be regulated by the concentration of modified nucleic acid molecules in the recipient compartment or by choosing transport molecules specific for selected cell(s).
  • Transformation method according to the invention can be used for inhibition of the growth of prokaryotic cells in vivo , suppression of virulence by inhibition of responsible virulence genes, inhibition of expression of genes responsible for antibiotic resistance, or plasmid curing of plasmids carrying virulence or antibiotic resistant genes.
  • the system can be used for regulation of gene expression or to enhance another interaction, e.g. nucleic acid-protein interactions. That effect can be used for inhibition of cancer cell proliferation, changes in production of signal proteins, immunoglobulins etc.
  • other related applications can be also developed by the persons skilled in the art.
  • the presented invention provides highly effective tool for genetic engineering.
  • the cells can be transformed by NA molecule.
  • the NA molecule to be transferred into the cell is also called scattertransgene“.
  • the present invention relates especially to a method for nucleic acid modification that is to be transferred into a cell for its expression, transcription, translation or interaction with RNA, DNA or proteins.
  • Nucleic acid here is defined as deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and nucleic acid modifications including RNA-DNA hybrids, PNA (peptide nucleic acid), LNA (locked nucleic acid), morpholino- or other hybrids, analogs, their derivatives and combinations.
  • Nucleic acid mentioned in this description can be composed of native nucleotides or it can comprise other bases or nucleotides (synthetic or modified) that can be paired with native nucleotides or chemically related or other non-natural base/nucleotide.
  • Double-stranded NA also includes partially double- stranded NA, i.e. the fragment consisting of two strands allowing to hybridize together only in part of their length. If the application requires transfer of single- stranded NA (e.g., different RNA types, as mRNA), the molecule is easily converted into double stranded or partially double stranded nucleic acid by commonly known procedures.
  • the method of the present invention comprises the steps of transgene modification with binding of a hairpin structure to one end and binding of a transport molecule to the other end (either to the 5‘ or 3’ terminus) of transgene molecule, which allows enhanced transfer of the modified NA molecule into a cell.
  • the free 3‘ or 5‘ terminus can be also modified (e.g. by 2'-0-methoxyethyl, phosphorothioate bound, amino modified nucleotide, inverted nucleotide etc.).
  • the hairpin structure provides stability of the whole modified NA molecule against nucleases and ensures a linearization of the nucleic acid during its transfer into a cell.
  • Linearized nucleic acid allows more efficient penetration across cytoplasmic membrane or cell wall comparing to double- stranded NA and thus increases an efficiency of the transfer of the nucleic acid.
  • NA molecule which is to be transferred into the host cell modified by the method of the invention, forms modified NA molecule which is modified for efficient penetration into a host cell.
  • any efficient transport molecule can be used, e.g., cobalamin (vitamin B12), iron, silver or gold nanoparticles, short transport peptides, polymers, siderophores, etc. as known in state of the art.
  • Transport molecule is covalently bound to one end of nucleic acid which is to be transferred into a host cell as described above.
  • the hairpin structure is crucial for a penetration of the linearized single- stranded nucleic acid into the cell. In absence of the hairpin structure, only one NA strand penetrates into the cytoplasm in most types of the cells. The single strand structure, however, does not allow transcription of the nucleic acid. Such a structure is also efficiently degraded by cytoplasmic nucleases.
  • Another advantage of the hairpin structure is a stability of the transgene against ribonucleases/deoxyribonucleases in extracellular space as well as in the cytoplasm.
  • the hairpin structure comprises two parts, a stem and a loop. The stem is formed by two inversely complementary regions (inverted repeats) at the ends of linear molecule.
  • the loop is formed by the region between the inverted repeats.
  • the loop of the hairpin can be of variable length, from 3 nucleotides (bases) to 25 nucleotides (bases). It is generally known that the loop longer than 25 bases looses the stability against physical-chemical effects. Thu, in preferred embodiments, the stem contains 2 to 10 base pairs and the loop 3 to 25 bases.
  • the loop can be formed by repeated adenine (A) or various stable sequences, e.g., TTCG, TACG, TTTG, GCTT, or other sequences showing stability.
  • the opposite end of the transgene can be further modified either at 5 ‘ or 3
  • One of the 5‘ or 3‘ termini is modified by the transport molecule as mentioned above.
  • the other terminus (3‘ or 5‘) can be simultaneously modified in another way to prevent hydrolysis by exonuclease. That modification can be carried out by the method mentioned above or by another phosphate modification. Modification of that terminus, however, is not mandatory.
  • the whole transgene can be fully complementary or can contain non-complementary sequences. It is also possible to use RNA or nucleic acid analogs mentioned above. In that case, the transport molecule is bound to the linear molecule that is attached to the hairpin structure (containing stem and loop structure) as described above.
  • Effectivity of denaturation of double- stranded nucleic acid i.e. denaturation of the bonds between complementary nucleotides of the hairpin structure and linked nucleic acid
  • effects of denaturation of double- stranded nucleic acid i.e. denaturation of the bonds between complementary nucleotides of the hairpin structure and linked nucleic acid
  • Helicase can be bound on the structure responsible for the transport of the transgene (in vitro).
  • the helicase can be also activated near the target cell allowing denaturation, i.e. linearization, just before the entry into a cell. This procedure can further enhance the penetration of the NA into the cell in comparison with currently known methods.
  • transgene For enhancement of the stability against environmental effects (physical and chemical) or against endonucleases, it is possible to protect the transgene by suitable proteins, e.g. SspC (small acid-soluble spore protein C). Those proteins can be prepared by recombination from spore-forming bacteria, e.g., Bacillus subtilis. Another example can be protein Dsup (damage- suppressor protein) that protect NA against radiation and Dps (DNA Protection During Starvation Protein) protecting NA against oxidation.
  • SspC small acid-soluble spore protein C
  • Those proteins can be prepared by recombination from spore-forming bacteria, e.g., Bacillus subtilis.
  • Another example can be protein Dsup (damage- suppressor protein) that protect NA against radiation and Dps (DNA Protection During Starvation Protein) protecting NA against oxidation.
  • Nucleic acid which is transferred into the cell according to the invention can be used for changing physiology of the cell. For that reason, several mechanisms are proposed, e.g., regulation of gene expression using complementary sequence, transcription of mRNA which can be both coding and non-coding. Coding RNA can be used for translation of the peptide/protein with specific function in the cell. Non-coding RNA can be designed for activation of RISC complex (RNA-induced silencing complex) which degrades mRNA of the gene to be silenced. Another approach is an introduction of specific molecule which is fragmented into small RNA molecules by Dicer endonuclease. In another embodiment, the nucleic acid can be used for specific interaction with intracellular molecules, e.g., peptides/proteins. Apart from coding sequences and promoter, other short sequences can be introduced into the NA which is to be transferred. Those sequences can be responsible for expression regulation or for better affinity of DNA-dependent RNA polymerase.
  • RISC complex RNA-induced sile
  • the transport molecule is taken into cytoplasm followed by internalization of nucleic acid.
  • the nucleic acid is transferred as a single stranded NA molecule followed by hybridization of complementary regions and forming of the double stranded NA that can be transcripted (if the transgene is DNA with an open reading frame preceded by promoter and optionally enhancer) or it can directly hybridize with the target molecule (DNA, mRNA, protein etc.).
  • the nucleic acid can penetrate through cytoplasm without denaturation (denaturation of hydrogen bonds).
  • the transgene is coding RNA, i.e., mRNA
  • the molecule can be directly used for translation of peptide/protein.
  • a dimer upon entry into a cell complementary RNA is found and a dimer is formed. The dimer is then degraded by the RISC system (RNA-induced silencing complex).
  • Modified NA molecule according to the invention i.e. NA molecule modified by the procedures described above, can be introduced into eukaryotic as well as prokaryotic cells (e.g., HeLa, CHO, BGM, Escherichia coli, Klebsiella pneumoniae, Salmonella enterica, Streptococcus pneumoniae, Staphylococcus aureus).
  • prokaryotic cells e.g., HeLa, CHO, BGM, Escherichia coli, Klebsiella pneumoniae, Salmonella enterica, Streptococcus pneumoniae, Staphylococcus aureus.
  • any kind of transgene can be transferred representing coding or non-coding molecule. Genes encoding for peptides/proteins can be expressed in the cell and can modify several processes in the cell. Transgene can also represent antisense RNA, i.e., RNA which is not translated into the peptide/protein and works as transcription inhibitor in the RISC system.
  • the advantage of the modified NA molecule of the invention is its non-replicative nature, i.e. the inability of the molecule to pass into progeny cells and thus unpredicted changes of genetic information are avoided.
  • effects on prokaryotic cells can be toxic effect on the cell, inhibition of expression of genes encoding for virulence, antibiotic resistance, can be responsible for plasmid curing by the toxin/antitoxin system or inhibition of replicative system.
  • the transgene can regulate expression of selected genes or other interactions, e.g., nucleic acid/protein interactions. That effect can be used for inhibition of cancer cell proliferation, changes in signalling pathways, immunoglobulins or another modulation of immune system. Another possibility is the transport of CRISPR/Cas9 system into the cell.
  • Other applications aiming to the pathological effects of the microorganisms or pathological processes in the cells will be appreciated by the persons skilled in the art.
  • the invention is focused especially on the method of modification of nucleic acid molecule for enhancing its transfer into the host cells comprising the steps, where nucleic acid molecule which is to be transferred into host cell and which is double stranded or partially double stranded molecule, or can be converted to double stranded or partially double stranded form, is provided with a hairpin structure which is attached at one end and a transport molecule which is attached at the other end to the 5’ or 3’ terminus.
  • the molecule which is to be transferred into a host cell represents DNA or RNA, RNA-DNA hybrids, peptide nucleic acid, locked nucleic acid, morpholino- or other hybrids, analogs, their derivatives and combinations of mentioned molecules with the same function as natural nucleic acids.
  • the hairpin structure is formed by the stem and the loop.
  • the stem contains 2 to 10 base pairs and the loop contains 3 to 25 bases.
  • the transport molecule can be cobalamin (vitamin B12), iron nanoparticle, silver nanoparticle, gold nanoparticle, short transport peptide, polymer, siderophor, polymer, polysaccharide or other molecule enhancing the penetration of nucleic acid into the cell.
  • a spacer can be inserted between the nucleic acid molecule (transgene) and the transport molecule,.
  • the spacer can be double-stranded, single-stranded or other molecule.
  • free 3’ or 5’ terminus of the NA molecule can be modified by modified 2’-0-methoxyethyl, phosphothioate bond, amino group modified nucleotide, inverted nucleotide or another structure in order to prevent nuclease cleavage.
  • the host cell can be both prokaryotic and eukaryotic cell.
  • the present invention is related to modified nucleic acid molecule, i.e. molecule of nucleic acid which is modified for efficient transfer into a host cell, which comprises nucleic acid which is to be transferred into a host cell and which is in double-stranded or partially double- stranded form or can be converted into double-stranded or partially double-stranded form, a hairpin structure attached at one end and a transport molecule attached at the other end at 5’ or 3’ terminus.
  • the molecule of nucleic acid to be transferred into a host cell is DNA or RNA, RNA-DNA hybrid, peptide nucleic acid, locked nucleic acid, morpholino- or other hybrids, analog, their derivatives and combinations with the same function as natural nucleic acids.
  • the hairpin structure in the modified NA molecule is formed by a stem and a loop.
  • the stem contains 2 to 10 base pairs and the loop 3 to 25 bases.
  • the transport molecule in the modified NA molecule can be cobalamin (vitamin B12), iron nanoparticle, silver nanoparticle, gold nanoparticle, short transport peptide, siderophor, polymer, polysaccharide or other molecule enhancing the penetration of nucleic acid into a cell.
  • modified NA molecule comprises a helicase attached to it. In another embodiment it comprises at least one protein selected from Ssp and Dsup attached to the NA molecule.
  • the invention relates to a method of the transfer of nucleic acid molecule into a host cell where nucleic acid molecule to be transferred is modified by the method described above and then the modified nucleic acid molecule is contacted with the cell into which the nucleic acid molecule is to be transferred.
  • FIG1 Schematic representation on nucleic acid molecule (transgene) which is to be transferred into a host cell with attached transport molecule (TM), a hairpin structure and free terminus (M) modified by amino group.
  • transgene which is to be transferred into a host cell with attached transport molecule (TM), a hairpin structure and free terminus (M) modified by amino group.
  • FIG 2 Combination of modified nucleic acid molecule (transgene with attached transport molecule and a hairpin structure) with helicase for enhancing the transfer into the cell by linearization of the nucleic acid molecule.
  • Transgene is represented by double-stranded DNA containing open-reading frame preceded by regulatory sequence and the promoter, possibly with an enhancer.
  • Transgene can contain multiple cloning sites. A spacer can be inserted between promoter/enhancer and the transport molecule.
  • FIG 3 Molecule of nucleic acid which is to be transferred into a host cell with attached transport molecule (TM), hairpin structure and the proteins for the protection of nucleic acid against physical, chemical, physical-chemical, or biological effects of ribonucleases/deoxyribonucleases.
  • TM transport molecule
  • FIG 4 Examples of modified NA molecule according to the invention comprising expression system of the double-stranded NA, a transport molecule (TM) and a hairpin structure.
  • Expression system contains open reading frame, a sequence responsible for controlling the expression, a promoter and, optionally, an enhancer. It also contains a spacer between the promoter/enhancer and the transport molecule. Expression system can be oriented in either ways in the modified NA molecule.
  • oligonucleotide 02 5 ‘-GTGGTTGGTAATCCATGCCG-3 ‘ (oligonucleotide 02). Oligonucleotide 1 was modified by amino group (C6 amino-modifier) at the 5‘ terminus, oligonucleotide 2 was modified by phosphate at 5’ terminus. PCR product of the size of 1170 bp was purified (PCR reaction mixture and free oligonucleotides removed) and visualized by gel electrophoresis. After that, ligation of hairpin structure was carried out by using DNA ligase. The hairpin structure had the following sequence:
  • Vitamin B12 (cobalamin) was diluted in IN hydrochloric acid and incubated at 37 °C for 4 hrs. By this way, partial hydrolysis of vitamin B12 occurred with formation of carboxyl groups. Neutralization was achieved by 0.1N sodium hydroxide to a pH of 7.5. Modified Vitamin B12 with carboxyl groups was purified by phenol extraction method, followed by removing phenol by chloroform and ether. Neutralized solution was mixed with water-saturated phenol in ratio of 1:1. The mixture was vortexed and centrifuged to separate the phases. Water phase was admixed with acetone/ether (1:3) solution in the ratio of 1:1. The water phase was then washed twice by the same solution and lyophilized. In another experiment, purification was performed by Amberlite XAD.
  • transgene delivery into E. coli cells was determined by reverse- transcriptase real-time PCR with SYBR green with oligonucleotides ATCTGACAACAGGCATGACG (oligonucleotide RT1) and GCGCGGCGATGAGGTAT (oligonucleotide RT2). Possible DNA contamination was excluded by standard PCR with the oligonucleotides RT1 a RT2 as primers with negative results. Hence, the expression of the gene W ⁇ 2 KPC -2 was demonstrated.
  • PCR product of the size of 1170 bp was purified (PCR reaction mixture and free oligonucleotides removed) and visualized by gel electrophoresis. After that, ligation of the hairpin structure was carried out using DNA ligase.
  • the hairpin structure had the following sequence:
  • transgene delivered into E. coli cells was verified by reverse-transcriptase real-time PCR with SYBR green with oligonucleotides ATCTGACAACAGGCATGACG (oligonucleotide RT1) and GCGCGGCGATGAGGTAT (oligonucleotide RT2). Possible DNA contamination was excluded by standard PCR with the oligonucleotides RT1 a RT2 as primers with negative results. Thus, the expression of the gene bla ⁇ c was demonstrated.
  • beta-lactamase gene of the KPC-2 type Transfer of beta-lactamase gene of the KPC-2 type with hairpin structure and gold nanoparticle transport molecule into Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa
  • PCR product of the size of 1170 bp was purified (PCR reaction mixture and free oligonucleotides removed) and visualized by gel electrophoresis. After that, ligation of hairpin structure was carried out using DNA ligase.
  • the hairpin structure had the following sequence:
  • DNA encoding bradykinin together with a strong promoter of insertion sequence ISEcpl (sequence Nr. CP046445.1, GenBank) was synthesized by commercially available service as a structure of the following oligonucleotides: 03 : 5 ‘ - GC AGT CT A A ATT CTTC GTG A A AT AGT G ATTTTTG A AGCT A AT A A A A AC AC ACGTGGAATTTAGGTTTCATTCTGGCGACGTCCGTATTTGCCTTTCGGAAGCATAA AATCGGACGCGTTGTGGCTCGCTTCAGGTAAAATATTGACTATTCATGTTGTTGTT ATTTCGTCTCTTCCAGAATAAGGAATCCC-3 ‘ ,
  • oligonucleotide 03 5 ‘-CAACAACATGAATAGTCAATATTTTACCTGAAGCGAGCCACAACGCGTCC GATTTTATGCTTCCGAAAGGCAAATACGGACGTCGCCAGAATGAAACCTAAATTC CACGTGTGTTTTTTATTAGCTTCAAAAATCACTATTTCACGAAGAATTTAGACTGC -3‘.
  • the 5’ terminus of the oligonucleotide 03 was modified by amino group (C6 amino- modifier), 5’ termini of the oligonucleotides 04 and 05 were modified by a phosphate.
  • 10 m ⁇ of each oligonucleotide at concentration 0.1 mmol/1 in water was ligated by T4 DNA ligase and incubated at 8 °C for 12 hrs.
  • Vitamin B12 was used as a transport molecule.
  • Vitamin B12 (cobalamin) was diluted in IN hydrochloric acid and incubated at 37 °C for 4 hrs. By this way, partial hydrolysis of vitamin B12 occurred with formation of carboxyl groups. Neutralization was achieved by 0.1N sodium hydroxide to a pH of 7.5.
  • Modified Vitamin B12 with carboxyl groups was purified by phenol extraction method, followeded by removing phenol by chloroform and ether. Neutralized solution was mixed with water- saturated phenol in ration 1:1. A mixture was vortexed and centrifuged to separate the phases. Water phase was admixed with acetone/ether (1:3) solution in the ratio 1:1. The water phase was then washed twice by the same solution and lyophilized. In another experiment, purification was performed by Amberlite XAD.
  • oligonucleotide RT4 Possible DNA contamination was excluded by standard PCR with the oligonucleotides RT3 a RT4 as primers with negative results. Thus, the expression of the bradykinin gene was demonstrated.
  • GFP Green Fluorescent Protein
  • Plasmid pcDNA3-EGFP (plasmid #13031, Addgene) encoding for EGFP (Enhanced Green Fluorescent Protein) with CMV promoter was used for amplification of target sequence.
  • DNA molecule was amplified using oligonucleotides 5‘-CTTGTGTGTTGGAGGTCGCT-3‘ (oligonucleotide 06) and 5 ‘-AACAACAGATGGCTGGCAAC-3 ‘ (oligonucleotide 07).
  • Oligonucleotide 06 was modified by amino group (C6 amino-modifier) at 5’ terminus
  • oligonucleotide 07 was modified by a phosphate at 5’ terminus.
  • PCR product was purified (PCR reaction mixture and free oligonucleotides removed) and visualized by gel electrophoresis. After that, ligation of the hairpin structure was carried out.
  • the hairpin structure has the following sequence:
  • Vitamin B12 was diluted in IN hydrochloric acid and incubated at 37 °C for 4 hrs. By this way, partial hydrolysis of vitamin B12 occurred with formation of carboxyl groups. Neutralization was achieved by 0.1N sodium hydroxide to a pH of 7.5. Modified Vitamin B12 with carboxyl groups was purified by phenol extraction method, followed by removing phenol by chloroform and ether. Neutralized solution was mixed with water- saturated phenol in ratio of 1:1. The mixture was vortexed and centrifuged to separate the phases. The water phase was admixed with acetone/ether (1:3) solution in the ratio of 1:1. The water phase was then washed twice by the same solution and lyophilized. In another experiment, purification was performed by Amberlite XAD.
  • transgene delivery into BGM cells was verified by reverse-transcriptase real-time PCR with SYBR green with oligonucleotides 5‘-CACAAGTTCAGCGTGTCCG- 3‘ (oligonucleotide RT5) and 5 ‘-TTCAGCTCGATGCGGTTCAC- 3‘ (oligonucleotide RT6). Possible DNA contamination was excluded by standard PCR with the oligonucleotides RT3 a RT4 as primers with negative results. Thus, the expression of the gene EGFP was demonstrated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un procédé de modification d'une molécule d'acide nucléique souhaitée pour son administration efficace à une cellule procaryote ou eucaryote. La molécule d'acide nucléique (NA) modifiée selon l'invention est un élément non réplicatif comprenant une molécule codante ou une molécule NA non codante. Le procédé de modification de la molécule NA comprend la liaison d'une structure en épingle à cheveux à une extrémité de la molécule NA et d'une molécule de transport à l'autre extrémité de la molécule NA. L'invention concerne en outre une molécule NA modifiée, comprenant une molécule NA à transférer à une cellule hôte, une molécule de transport et une structure en épingle à cheveux. La présente invention concerne également un procédé d'administration d'une molécule d'acide nucléique souhaitée à une cellule hôte, la molécule NA souhaitée étant modifiée par le procédé de l'invention et la molécule NA modifiée étant mise en contact avec la cellule dans laquelle l'acide nucléique souhaité doit être transféré. La présente invention concerne des moyens simples, économiquement avantageux et hautement efficaces pour le domaine de l'ingénierie génétique.
PCT/CZ2021/050006 2020-01-20 2021-01-18 Procédé de modification d'une molécule d'acide nucléique pour faciliter son transfert dans des cellules hôtes, et la molécule d'acide nucléique modifiée WO2021148063A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CZPV2020-30 2020-01-20
CZ202030A CZ202030A3 (cs) 2020-01-20 2020-01-20 Způsob úpravy molekuly nukleové kyseliny pro usnadění jejího přenosu do hostitelských buněk a upravená molekula nukleové kyseliny

Publications (1)

Publication Number Publication Date
WO2021148063A1 true WO2021148063A1 (fr) 2021-07-29

Family

ID=74858165

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CZ2021/050006 WO2021148063A1 (fr) 2020-01-20 2021-01-18 Procédé de modification d'une molécule d'acide nucléique pour faciliter son transfert dans des cellules hôtes, et la molécule d'acide nucléique modifiée

Country Status (2)

Country Link
CZ (1) CZ202030A3 (fr)
WO (1) WO2021148063A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019246544A2 (fr) * 2018-06-22 2019-12-26 Asklepios Biopharmaceutical, Inc. Vecteurs pour l'administration de gènes qui persistent dans les cellules

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE9803099D0 (sv) * 1998-09-13 1998-09-13 Karolinska Innovations Ab Nucleic acid transfer
US8372966B2 (en) * 2003-12-19 2013-02-12 University Of Cincinnati Oligonucleotide decoys and methods of use

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019246544A2 (fr) * 2018-06-22 2019-12-26 Asklepios Biopharmaceutical, Inc. Vecteurs pour l'administration de gènes qui persistent dans les cellules

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
BROUDE N E: "Stem-loop oligonucleotides: a robust tool for molecular biology and biotechnology", TRENDS IN BIOTECHNOLOGY, ELSEVIER PUBLICATIONS, CAMBRIDGE, GB, vol. 20, no. 6, 1 June 2002 (2002-06-01), pages 249 - 256, XP004352763, ISSN: 0167-7799, DOI: 10.1016/S0167-7799(02)01942-X *
EISENHUT PETER ET AL: "Systematic use of synthetic 5'-UTR RNA structures to tune protein translation improves yield and quality of complex proteins in mammalian cell factories", NUCLEIC ACIDS RESEARCH, vol. 48, no. 20, 18 November 2020 (2020-11-18), pages e119 - e119, XP055799343, ISSN: 0305-1048, Retrieved from the Internet <URL:https://academic.oup.com/nar/article-pdf/48/20/e119/34367161/gkaa847.pdf> DOI: 10.1093/nar/gkaa847 *
HAMANN ANDREW ET AL: "Nucleic acid delivery to mesenchymal stem cells: a review of nonviral methods and applications", JOURNAL OF BIOLOGICAL ENGINEERING, vol. 13, no. 1, 18 January 2019 (2019-01-18), XP055799532, Retrieved from the Internet <URL:https://link.springer.com/content/pdf/10.1186/s13036-019-0140-0.pdf> DOI: 10.1186/s13036-019-0140-0 *
J. R. BABENDURE ET AL: "Control of mammalian translation by mRNA structure near caps", RNA, vol. 12, no. 5, 1 January 2006 (2006-01-01), US, pages 851 - 861, XP055470459, ISSN: 1355-8382, DOI: 10.1261/rna.2309906 *
JING ZHENG ET AL: "Rationally designed molecular beacons for bioanalytical and biomedical applications", CHEMICAL SOCIETY REVIEWS, vol. 44, no. 10, 1 January 2015 (2015-01-01), UK, pages 3036 - 3055, XP055455375, ISSN: 0306-0012, DOI: 10.1039/C5CS00020C *
KLEIN ARNAUD F. ET AL: "Peptide-conjugated oligonucleotides evoke long-lasting myotonic dystrophy correction in patient-derived cells and mice", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 129, no. 11, 1 November 2019 (2019-11-01), GB, pages 4739 - 4744, XP055799058, ISSN: 0021-9738, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6819114/pdf/jci-129-128205.pdf> DOI: 10.1172/JCI128205 *
LEPPEK KATHRIN ET AL: "Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them", NATURE REVIEWS. MOLECULAR CELL BIOLOGY,, vol. 19, no. 3, 1 March 2018 (2018-03-01), pages 158 - 174, XP002793469, ISSN: 1471-0080, DOI: 10.1038/NRM.2017.103 *
REN KEWEI ET AL: "A DNA dual lock-and-key strategy for cell-subtype-specific siRNA delivery", NATURE COMMUNICATIONS, vol. 7, no. 1, 24 November 2016 (2016-11-24), XP055799611, Retrieved from the Internet <URL:https://www.nature.com/articles/ncomms13580.pdf> DOI: 10.1038/ncomms13580 *
ROBERTS THOMAS C ET AL: "Advances in oligonucleotide drug delivery", NATURE REVIEWS DRUG DISCOVERY, NATURE PUBLISHING GROUP, GB, vol. 19, no. 10, 11 August 2020 (2020-08-11), pages 673 - 694, XP037256878, ISSN: 1474-1776, [retrieved on 20200811], DOI: 10.1038/S41573-020-0075-7 *
RÓWNICKI MARCIN ET AL: "Vitamin B12 as a carrier of peptide nucleic acid (PNA) into bacterial cells", SCIENTIFIC REPORTS, vol. 7, no. 1, 9 August 2017 (2017-08-09), XP055799778, Retrieved from the Internet <URL:https://www.nature.com/articles/s41598-017-08032-8.pdf> DOI: 10.1038/s41598-017-08032-8 *
SEUNG SOO OH ET AL: "Synthetic Aptamer-Polymer Hybrid Constructs for Programmed Drug Delivery into Specific Target Cells", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 136, no. 42, 7 October 2014 (2014-10-07), US, pages 15010 - 15015, XP055709020, ISSN: 0002-7863, DOI: 10.1021/ja5079464 *
SUBHAN MD ABDUS ET AL: "Efficient nanocarriers of siRNA therapeutics for cancer treatment", TRANSLATIONAL RESEARCH, vol. 214, 1 December 2019 (2019-12-01), NL, pages 62 - 91, XP055799586, ISSN: 1931-5244, DOI: 10.1016/j.trsl.2019.07.006 *
TAN XIAOHONG ET AL: "Closing the Loop: Constraining TAT Peptide by [gamma]PNA Hairpin for Enhanced Cellular Delivery of Biomolecules", BIOCONJUGATE CHEMISTRY, vol. 29, no. 9, 19 September 2018 (2018-09-19), pages 2892 - 2898, XP055799614, ISSN: 1043-1802, Retrieved from the Internet <URL:https://pubs.acs.org/doi/pdf/10.1021/acs.bioconjchem.8b00495> DOI: 10.1021/acs.bioconjchem.8b00495 *
TRYLSKA SEE JOANNA: "Showcasing research from Professor Dorota Gryko's laboratory from the Institute of Organic Chemistry Polish Academy of Sciences and Professor Joanna Trylska's laboratory from the", 19 November 2018 (2018-11-19), pages 719 - 872, XP055799942, Retrieved from the Internet <URL:https://pubs.rsc.org/en/content/articlepdf/2019/cc/c8cc05064c> [retrieved on 20210429] *
YAO XIAO ET AL: "Engineering Nanoparticles for Targeted Delivery of Nucleic Acid Therapeutics in Tumor", MOLECULAR THERAPY- METHODS & CLINICAL DEVELOPMENT, vol. 12, 1 March 2019 (2019-03-01), GB, pages 1 - 18, XP055675441, ISSN: 2329-0501, DOI: 10.1016/j.omtm.2018.09.002 *

Also Published As

Publication number Publication date
CZ308738B6 (cs) 2021-04-14
CZ202030A3 (cs) 2021-04-14

Similar Documents

Publication Publication Date Title
AU2016359629B2 (en) Tracking and manipulating cellular RNA via nuclear delivery of CRISPR/Cas9
EP3178935B1 (fr) Édition du génome à l&#39;aide de rgen dérivés du système campylobacter jejuni crispr/cas
US20200347387A1 (en) Compositions and methods for target nucleic acid modification
US20240093207A1 (en) Non-toxic cas9 enzyme and application thereof
EP2307575B1 (fr) Produit d&#39;amplification par cercle roulant non traité
WO2023098485A1 (fr) Nouveau système d&#39;édition génomique fondé sur la nucléase c2c9 et son application
US20220372455A1 (en) Crispr type v-u1 system from mycobacterium mucogenicum and uses thereof
US20230357790A1 (en) Self-targeting expression vector
WO2021148063A1 (fr) Procédé de modification d&#39;une molécule d&#39;acide nucléique pour faciliter son transfert dans des cellules hôtes, et la molécule d&#39;acide nucléique modifiée
US20220333129A1 (en) A nucleic acid delivery vector comprising a circular single stranded polynucleotide
US20230147779A1 (en) Polymer with cationic and hydrophobic side chains
WO2020193610A1 (fr) Procédé et produits de production de molécules d&#39;arn
WO2023206872A1 (fr) Nucléase optimisée par génie génétique, arn guide, système d&#39;édition et utilisation
KR20240107373A (ko) C2c9 뉴클레아제 기반의 신규 게놈 편집 시스템 및 이의 응용
Nielsen Therapeutic Potential of DNA Gene Targeting using Peptide Nucleic Acid (PNA)
WO2022104381A1 (fr) Système crispri/a minimal pour régulation de génome ciblé
WO2022253903A1 (fr) Nucléases de casω guidées par arn et leurs utilisations dans le diagnostic et la thérapie
KR20230016751A (ko) 염기 편집기 및 이의 용도
CN114410680A (zh) Dph6基因在制备具有毒素抗性细胞系中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21709879

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21709879

Country of ref document: EP

Kind code of ref document: A1