WO2020069918A1 - Procédé d'analyse pour l'arnm de cellules individuelles irradiées de lumière - Google Patents

Procédé d'analyse pour l'arnm de cellules individuelles irradiées de lumière

Info

Publication number
WO2020069918A1
WO2020069918A1 PCT/EP2019/075683 EP2019075683W WO2020069918A1 WO 2020069918 A1 WO2020069918 A1 WO 2020069918A1 EP 2019075683 W EP2019075683 W EP 2019075683W WO 2020069918 A1 WO2020069918 A1 WO 2020069918A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
irradiated
nucleic acid
nucleic acids
Prior art date
Application number
PCT/EP2019/075683
Other languages
German (de)
English (en)
Inventor
Alexander Heisterkamp
Stefan Kalies
Dominik MÜLLER
Original Assignee
Leibniz Universität Hannover
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Leibniz Universität Hannover filed Critical Leibniz Universität Hannover
Publication of WO2020069918A1 publication Critical patent/WO2020069918A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present invention relates to a method for analyzing the nucleic acids
  • Methods are introduced into cells to generate genetically manipulated cells which encode a protein which can be activated by irradiation with light and which has the activity of a DNA recombinase and which, through the action of the recombinase, express various marker proteins from a further nucleic acid construct which are optically detectable.
  • cells which express the marker proteins for example using FACS (fluorescence-activated cell sorting)
  • FACS fluorescence-activated cell sorting
  • the method is preferably carried out without isolation or separation and separation of cells irradiated with light before the analysis of their nucleic acids.
  • the invention further relates to the nucleic acid constructs with which cells are genetically manipulated for use in the method, and the cells which use them
  • the method allows the analysis of the nucleic acids of individual cells that have been individually irradiated with light for identification, in particular of individual cells under one
  • Microscope whose position can be determined optically.
  • the method is thus suitable for analyzing the nucleic acids of individually labeled cells whose position in relation to other cells has been optically determined, e.g. each of individual cells that are adjacent in pairs or to several, e.g. in a culture dish or in a tissue.
  • WO2015 / 086818 A1 describes fusion proteins which have a homodimerizing domain, e.g. the LOV (light-oxygen-voltage scnsing) domain of the cyanobacterial phytochrome CPH1. Homodimerization, which can be triggered by light irradiation, brings the remaining components of the fusion proteins together to form a dimer, e.g. with a receptor tyrosine kinase that is activated by light irradiation.
  • LOV light-oxygen-voltage scnsing domain of the cyanobacterial phytochrome CPH1.
  • Homodimerization which can be triggered by light irradiation, brings the remaining components of the fusion proteins together to form a dimer, e.g. with a receptor tyrosine kinase that is activated by light irradiation.
  • US 2013/0345294 A1 describes a fusion protein from a LOV domain with a DNA-binding transcription factor, which is said to act as a light-inducible promoter by binding to a DNA element.
  • Macosko et al., Cell 161, 1202-1214 (2015) describe the sequencing of the mRNA of individual cells from a mixture of the cells.
  • the object of the invention is to provide an alternative method for analyzing the nucleic acids, in particular the mRNA, of individually identifiable cells.
  • the method should allow simple optical identification of specific individual cells and their subsequent analysis.
  • the invention achieves the object with the features of the claims and, in particular, provides nucleic acid constructs for labeling cells and a method for analyzing the nucleic acids, in particular the mRNA, of individual cells, which performs the steps
  • introducing a first nucleic acid construct that contains a first expression cassette that encodes a first fusion protein that a first domain of a
  • introducing a second nucleic acid construct which contains a second expression cassette which encodes a second fusion protein which has or consists of a second domain of the protein associated with irradiation with light and a second section of the DNA recombinase which is associable with the first section thereof, and
  • nucleic acid construct which, under the control of a common promoter, contains at least two sequences coding for different marker proteins, the sequences coding for the different marker proteins being flanked by pairs of recombinase recognition sequences, in at least one cell for generating at least one cell which is the first, second and third
  • the first fusion protein with the second fusion protein leads to the production of an irradiated cell, cultivation of the irradiated cell
  • optical recognition of the expression of marker proteins of the irradiated cell optionally isolating the at least one irradiated cell
  • the optical recognition of the expression of marker proteins takes place e.g. by determining the radiation emitted by the cell, in particular the fluorescence, when irradiating excitation light.
  • Excitation light has a wavelength or a wavelength range that excites coded marker proteins for emission.
  • the excitation light is focused on the cell which has been irradiated with the light of the specific wavelength for the association of the first and second fusion proteins, in particular at a time interval after the cell has been irradiated with the light of the specific wavelength, e.g. after 1 to 24 or to 12 or to 6 hours.
  • the same cell can be irradiated again with light of the specific wavelength used to associate the first fusion protein with the second
  • Fusion protein leads, and / or another cell can be irradiated with light of the specific wavelength for the first time.
  • the method can individually mark cells, these optionally being additionally irradiated with light of the specific wavelength at at least two different times, which can be individual daughter cells of the cell which was irradiated at least once beforehand with the light of the specific wavelength.
  • a cell other than a cell that was previously irradiated with light of the specific wavelength can be individually marked by irradiation with the light of the specific wavelength.
  • the first and the second expression cassette are preferably under the control of a constitutive promoter.
  • the third expression cassette is optionally under the control of a constitutive promoter, optionally preferably a strong constitutive promoter.
  • the third expression cassette is under the control of a light-inducible promoter and the cell has a protein which binds to the light-inducible promoter when light is irradiated.
  • the first domain of the associative when irradiated with light in particular
  • dimerizing protein contained in the first fusion protein e.g.
  • the method has the advantage that individually labeled cells can be optically recognized by irradiation with light of the specific wavelength, both based on their individual expression of marker proteins as a result of the action of the recombinase, e.g. in a culture, in a tissue and / or after isolation in the FACS, and moreover the DNA and RNA of this cell can be identified and assigned to the individual optical marking of the cell on the basis of the expressed marker proteins.
  • sequence data is preferably generated by sequencing DNA and / or RNA (eg as cDNA) from cells which are marked by the radiation, in a mixture with one another and in a mixture with non-irradiated cells, the DNA and / or RNA of each cell can be distinguished during sequencing, for example by individual labeling or hybridization of each cell individually with a hybridizing oligonucleotide, each having an individual sequence as a label.
  • DNA and / or RNA eg as cDNA
  • This individual labeling of the DNA and / or RNA of each cell allows the identification of the DNA and / or RNA molecules that originate from a single cell after the sequencing. Hybridization of the individual labeling of the
  • Oligonucleotides with the DNA and / or RNA which codes for the marker proteins can be assigned to the optically recognized expression of the marker proteins, and the sequences of the DNA and / or RNA molecules, which originate from a single cell, can be examined by light microscopy or assign optically localized cell that was irradiated with the specific wavelength.
  • the nucleic acids are preferably analyzed by sequencing the DNA and / or RNA, in particular the mRNA, from a mixture of individual cells, at least one of which has been irradiated with light of the specific wavelength. This is preferably done
  • the sequencing is preferably carried out in that the nucleic acids of the cells which are contained in a mixture are each hybridized with an oligonucleotide which contains an individual sequence for labeling, the sequencing of the nucleic acids of the cells in a mixture with one another, and the subsequent assignment of the sequenced Data according to the individual sequences for labeling.
  • the cells are each individually enclosed in liquid drops which contain oligonucleotides bound to a particle, each of which has the same individual sequence for their labeling, a hybridization site for a sequencing primer and an oligo-dT section.
  • the cells are lysed individually in drops, so that the nucleic acids of a single cell hybridize with the oligonucleotide, which in each case contains the same sequence for labeling. Since the nucleic acids of an individual cell are marked by the hybridization with the individual sequence of the oligonucleotide, the nucleic acids of the cells are sequenced in a mixture with one another and then assigned to one another on the basis of the individual sequence. Accordingly, the method optionally has no step to analyze the nucleic acids for each cell separately.
  • Sequence data obtained which each contain the same individual sequence and are assigned to the same individual sequence, are analyzed for whether they contain a coding sequence which corresponds to the optically recognized expression of marker proteins, and are then assigned to the location of the irradiated cell for which the appropriate expression of marker proteins was optically recognized. This is because the appropriate expression of marker proteins is that which corresponds to the coding sequence of the
  • the domains of the protein dimerizing when irradiated with light is e.g. the
  • the sections of the DNA recombinase are e.g. selected from combinations of N-terminal Cre (SEQ ID NO: 1:
  • the recombinase recognition sequences are recognition sequences for the DNA recombinase, to which the DNA recombinase can attack and which can invert or delete the intermediate sequences, which, for example, each encode different marker proteins.
  • the sequences coding for the different marker proteins are flanked at one of their ends directly by a recombinase recognition sequence of a pair and the other recombinase recognition sequence of the pair is arranged opposite and at a distance from the coding sequence, for example in each case in 3 'adjacent to the common promoter or on the 3 ' End of the third nucleic acid construct, for example for each pair of recombinase recognition sequences.
  • the third nucleic acid construct preferably contains at least 3, more preferably at least 4 or more sequences, each of which encodes different marker proteins.
  • each of the different ones Sequences encoding marker proteins have a polyadenylation signal (polyA) at their 3 'end.
  • polyA polyadenylation signal
  • Marker proteins fluorescent proteins e.g. green fluorescent protein (GFP), red fluorescent protein (RFP) and derivatives thereof.
  • the action of the DNA recombinase randomly rearranges the third expression cassette so that different arrangements of the sequences coding for different marker proteins, preferably with a polyadenylation signal arranged in 3 ', result in different cells downstream of the common promoter.
  • the expression of this arrangement of the sequences coding for the different marker proteins, randomly transformed by the DNA recombinase, results in a random individual pattern of marker proteins for irradiated cells.
  • the nucleic acid constructs can be introduced into cells by transfection, transduction, electroporation, injection or another method.
  • the cells can be introduced into cells by transfection, transduction, electroporation, injection or another method.
  • the cells can be introduced into cells by transfection, transduction, electroporation, injection or another method.
  • the cells can be introduced into cells by transfection, transduction, electroporation, injection or another method.
  • the cells can be introduced into cells by transfection, transduction, electroporation, injection or another method.
  • the cells can be introduced into cells by transfection, transduction, electroporation, injection or another method.
  • prokaryotic or eukaryotic cells preferably animal or plant cells, preferably excluding human embryonic cells and human germ cells.
  • the at least one cell which contains the first, second and third nucleic acid construct can be the directly genetically manipulated cell produced directly by introducing the nucleic acid constructs into a cell, or, preferably, a cell produced by
  • Cultivation emerged from an immediately genetically manipulated cell.
  • cells which are produced by cultivation and which have emerged from an immediately genetically manipulated cell and which contain the first, second and third nucleic acid construct are also referred to as a cell which contains the first, second and third nucleic acid construct.
  • Locating cells containing the nucleic acid constructs can e.g.
  • the cells are preferably irradiated under microscopic control with light of a wavelength at which the first and second domains of the protein dimerizing when irradiated with light, preferably at least two cells are irradiated with the wavelength in succession or simultaneously.
  • the cells are optionally irradiated individually, or exactly one cell is irradiated. While the microscopic control is preferably an image of the irradiated or
  • irradiated cells recorded, optionally at least one further image, which comprises the same cells, at a time interval.
  • the time interval is preferably long enough to allow expression of the marker proteins, and the at least one further image takes place under the irradiation of light with excitation wavelengths for the marker proteins if they are fluorescent proteins.
  • the method has the advantage that cells containing the nucleic acid constructs can be irradiated individually, e.g. under microscopic control, cells can be irradiated individually by means of a laser, the nucleic acids of which are subsequently analyzed.
  • the individual pattern of marker proteins generated by the irradiation in cells which have been irradiated with the dimerization from the releasing wavelength permits optical identification and isolation or isolation of the irradiated cells from a mixture with cells which have not been irradiated, the mixture being preferred additionally contains cells that have also been irradiated.
  • the nucleic acids can be analyzed by sequencing, optionally after isolating mRNA, e.g. by contacting with nucleic acid molecules which have an oligo-dT section which has a poly-A tail of eukaryotic mRNA
  • RNA can hybridize, and isolating the hybridized RNA.
  • the recombinase recognition sequences can be arranged in opposite or rectified orientation.
  • Cre wild type
  • a light inducible promoter generally consisting of one, two or more
  • genetic elements can exist, for example the PpsbAII :: DHex promoter region, (Sequence: gccctctgtttacccatggaaaaaacgacaattacaagaaagtaaacttatgtcatctataagcttcgtgtatattaacttc ctggaccaaagctttacacaaaactctcattaatatctctattagataatgatacatacatattacatcatcata
  • the nucleic acid constructs can be individual DNA molecules or two, three or all four of the nucleic acid constructs can be contained in a common DNA molecule.
  • a preferred DNA recombinase is Cre, e.g. formed from the sections CreN and CreC.
  • Recombinase recognition sequences for Cre can contain rectified or oppositely arranged pairs of the following recognition sequences, which flank the sequences which each encode a marker protein:
  • loxP wild type
  • FIG. 1 shows a first nucleic acid construct
  • FIG. 2 shows a second nucleic acid construct
  • Figure 3 shows the dimerization of a first fusion protein with a second
  • Figure 4 shows a third nucleic acid construct.
  • Figure 1 shows a plasmid that a first nucleic acid construct with a first
  • FIG. 2 shows a plasmid which constructs a second nucleic acid construct with a second one
  • Chicken actin gene (chicken ß-actin promoter), which has the CMV enhancer signal in 5 '(CMV enhancer), a second fusion protein (SEQ ID NO: 5:
  • FIG. 3 shows schematically the dimerization of the CIBN domain of the first fusion protein CIBN-CreC triggered by irradiation of a cell which contains the expression cassettes with the CRY2 domain of the second fusion protein CRY2-CreN, whereby the CreC and CreN sections of the Cre recombinase brought together to form a dimer and form an active DNA recombinase.
  • FIG. 4 shows a third nucleic acid construct in which various fluorescent proteins are encoded as marker proteins, on the coding sequences of which a polyadenylation signal (poly (A) signal) is arranged at the C-terminal, and that of pairs of
  • Recombinase recognition sequences are flanked. There is one each
  • CMV enhancer CMV promoter
  • CMV promoter CMV promoter
  • Kusabira orange the adjacent coding sequence
  • Recombinase recognition sequences are formed, which are recognized by the DNA recombinase Cre or used by this, but only within a pair.
  • the pairs of recombinase recognition sequences of this example are 1oc2272 / 1oc2272, loxP / loxP and NoxN / loxN.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Procédé d'analyse des acides nucléiques, en particulier de l'ARNm de cellules qui ont été irradiées de lumière individuellement. Dans le procédé, des constructions d'acide nucléique sont introduites dans des cellules, pour générer des cellules manipulées génétiquement, qui codent une protéine pouvant être activée par irradiation, ayant l'activité d'une recombinase d'ADN et qui exprime à partir d'une autre construction d'acide nucléique par l'effet de la recombinase différentes protéines marqueurs qui peuvent être détectées optiquement. Les protéines marqueurs permettent d'identifier et de localiser optiquement, en particulier par microscope optique, des cellules qui expriment les protéines marqueurs, p. ex. par FACS, et les acides nucléiques des cellules individuelles, en particulier leur ARNm, peuvent être analysés, p. ex. par séquençage ou hybridation. Le procédé est exécuté de préférence sans l'isolement ni la séparation de cellules irradiées de lumière avant l'analyse de leurs acides nucléiques.
PCT/EP2019/075683 2018-10-01 2019-09-24 Procédé d'analyse pour l'arnm de cellules individuelles irradiées de lumière WO2020069918A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102018216872.5 2018-10-01
DE102018216872.5A DE102018216872A1 (de) 2018-10-01 2018-10-01 Analyseverfahren für mRNA einzeln lichtbestrahlter Zellen

Publications (1)

Publication Number Publication Date
WO2020069918A1 true WO2020069918A1 (fr) 2020-04-09

Family

ID=68233953

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/075683 WO2020069918A1 (fr) 2018-10-01 2019-09-24 Procédé d'analyse pour l'arnm de cellules individuelles irradiées de lumière

Country Status (2)

Country Link
DE (1) DE102018216872A1 (fr)
WO (1) WO2020069918A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130345294A1 (en) 2011-02-28 2013-12-26 East China University Of Science And Technology Light-Switchable Gene Expression System
WO2015086818A1 (fr) 2013-12-13 2015-06-18 Ist Austria (Institute Of Science And Technology Austria) Récepteurs optiquement activés

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1445320A1 (fr) * 2003-02-05 2004-08-11 ARTEMIS Pharmaceuticals GmbH Gene targeting automatique à l aide de marqueurs détectables non toxiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130345294A1 (en) 2011-02-28 2013-12-26 East China University Of Science And Technology Light-Switchable Gene Expression System
WO2015086818A1 (fr) 2013-12-13 2015-06-18 Ist Austria (Institute Of Science And Technology Austria) Récepteurs optiquement activés

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ALBERSPEEBLES, BIOTECHNOLOGY PROGRESS, vol. 33, 2017, pages 45 - 53
EVAN Z. MACOSKO ET AL: "Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets", CELL, vol. 161, no. 5, 1 May 2015 (2015-05-01), AMSTERDAM, NL, pages 1202 - 1214, XP055586617, ISSN: 0092-8674, DOI: 10.1016/j.cell.2015.05.002 *
FUUN KAWANO ET AL: "A photoactivatable Cre-loxP recombination system for optogenetic genome engineering", NATURE CHEMICAL BIOLOGY, vol. 12, no. 12, 1 December 2016 (2016-12-01), Basingstoke, pages 1059 - 1064, XP055506281, ISSN: 1552-4450, DOI: 10.1038/nchembio.2205 *
LAUREN R. POLSTEIN ET AL: "An Engineered Optogenetic Switch for Spatiotemporal Control of Gene Expression, Cell Differentiation, and Tissue Morphogenesis - Supplemental information", ACS SYNTHETIC BIOLOGY, vol. 6, no. 11, 17 November 2017 (2017-11-17), Washington, DC,USA, pages 2003 - 2013, XP055649083, ISSN: 2161-5063, DOI: 10.1021/acssynbio.7b00147 *
LAUREN R. POLSTEIN ET AL: "An Engineered Optogenetic Switch for Spatiotemporal Control of Gene Expression, Cell Differentiation, and Tissue Morphogenesis", ACS SYNTHETIC BIOLOGY, vol. 6, no. 11, 6 September 2017 (2017-09-06), Washington, DC,USA, pages 2003 - 2013, XP055648242, ISSN: 2161-5063, DOI: 10.1021/acssynbio.7b00147 *
MACOSKO ET AL., CELL, vol. 161, 2015, pages 1202 - 1214
STEVAN C. ALBERS ET AL: "Evaluating Light-Induced Promoters for the Control of Heterologous Gene Expression in Synechocystis sp . PCC 6803", BIOTECHNOLOGY PROGRESS, vol. 33, no. 1, 17 November 2016 (2016-11-17), pages 45 - 53, XP055648142, ISSN: 8756-7938, DOI: 10.1002/btpr.2396 *

Also Published As

Publication number Publication date
DE102018216872A1 (de) 2020-04-02

Similar Documents

Publication Publication Date Title
DE4344726C2 (de) Verfahren zum Nachweis von nicht balanciertem genetischen Material einer Spezies oder zum Nachweis der Genexpression in Zellen einer Spezies
DE69726306T2 (de) Renilla luciferase und green fluorescent protein fusionsgene
EP0835325B1 (fr) Methode d'analyse in vitro pour mettre en evidence des effets embryotoxiques/teratogenes induits par des substances chimiques
EP0438512A1 (fr) Procede pour l'analyse de polymorphismes longitudinaux dans des regions d'adn
EP3615680B1 (fr) Procédé et dispositif permettant d'obtenir une lignée cellulaire ayant une certaine expression d'une protéine cible souhaitée
WO2020069918A1 (fr) Procédé d'analyse pour l'arnm de cellules individuelles irradiées de lumière
DE69936867T2 (de) Dns sequenz, verfahren für dessen nachweis und herstellung und benutzung
DE69935539T2 (de) Untersuchungsverfahren für Protein-Protein-Interaktion
WO2012025110A1 (fr) Procédé d'obtention de lignées cellulaires hautement sécrétrices
DE69834422T2 (de) Klonierungsverfahren durch multiple verdauung
EP0698122A1 (fr) Agent de diagnostic complexe de l'expression genetique et son procede d'application en diagnostic medical et pour isoler des genes
DE19753182A1 (de) Topologisch fixierte matrixgebundene Nukleinsäure
DE10242359A1 (de) Verfahren zur Amplifikation genetischer Informationen
DE102007051578B3 (de) Verfahren zur parallelen Amplifikation von wenigstens zwei verschiedenen Nukleinsäureabschnitten
WO2012049154A1 (fr) Détermination de la qualité de cellules souches
DE19735221C1 (de) Beeinflussung der Bindung von p53 an Zielgene
DE19851413C2 (de) Verfahren zur Auswahl von Mutanten von tTA oder rtTA
WO2016074942A1 (fr) Production de vecteurs d'expression de recombinaison
DE19715683C2 (de) Neue Reportervektoren für One-Hybrid und Two-Hybrid Systeme
DE102021005748A1 (de) Replikasekettenreaktion (RCR) und ihre Verwendung in der Diagnose und Behandlung von viralen Erkrankungen
WO1996008571A1 (fr) Identification de substances susceptibles d'endommager l'adn au moyen de lignees de cellules dotees d'une capacite de surexpression de la poly(adp-ribose)-polymerase
DE102004048334A1 (de) Verbessertes elektrophoretisches Trennverfahren für die Analyse der Genexpression
이병훈 Imaging mRNA in live neurons and animals
DE102020103965A1 (de) Verfahren zum Nachweis einzelner Zelltypen
DE102015004998A1 (de) Verfahren zur ldentifizierung von unerwünschten Off-Target-Effekten in RNA-lnterferenz Analysen

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19786721

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19786721

Country of ref document: EP

Kind code of ref document: A1