WO2020023655A1 - Compositions comprising circular polyribonucleotides and uses thereof - Google Patents

Compositions comprising circular polyribonucleotides and uses thereof Download PDF

Info

Publication number
WO2020023655A1
WO2020023655A1 PCT/US2019/043272 US2019043272W WO2020023655A1 WO 2020023655 A1 WO2020023655 A1 WO 2020023655A1 US 2019043272 W US2019043272 W US 2019043272W WO 2020023655 A1 WO2020023655 A1 WO 2020023655A1
Authority
WO
WIPO (PCT)
Prior art keywords
circular polyribonucleotide
target
cell
binding
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/043272
Other languages
English (en)
French (fr)
Inventor
Avak Kahvejian
Nicholas McCartney PLUGIS
Alexandra Sophie DE BOER
Morag Helen STEWART
Catherine CIFUENTES-ROJAS
Ki Young PAEK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Flagship Pioneering Inc
Original Assignee
Flagship Pioneering Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020217005234A priority Critical patent/KR102950624B1/ko
Priority to CA3107683A priority patent/CA3107683A1/en
Priority to BR112021001343-1A priority patent/BR112021001343A2/pt
Priority to US17/262,591 priority patent/US20210292761A1/en
Priority to SG11202100750XA priority patent/SG11202100750XA/en
Priority to AU2019312269A priority patent/AU2019312269A1/en
Priority to CN201980051856.2A priority patent/CN112567038A/zh
Priority to MX2021000965A priority patent/MX2021000965A/es
Priority to EP19840286.9A priority patent/EP3827084A4/en
Application filed by Flagship Pioneering Inc filed Critical Flagship Pioneering Inc
Priority to EA202190282A priority patent/EA202190282A1/ru
Priority to JP2021504230A priority patent/JP2021531022A/ja
Publication of WO2020023655A1 publication Critical patent/WO2020023655A1/en
Priority to IL280354A priority patent/IL280354A/en
Anticipated expiration legal-status Critical
Priority to JP2024159028A priority patent/JP2024169484A/ja
Priority to AU2026201251A priority patent/AU2026201251A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/13Decoys
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/15Nucleic acids forming more than 2 strands, e.g. TFOs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/51Physical structure in polymeric form, e.g. multimers, concatemers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/532Closed or circular

Definitions

  • compositions comprising circular polyribonucleotides and methods of their use.
  • a method of binding a target in a cell comprises providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence, wherein the aptamer sequence has a secondary structure that binds the target; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the target detectable at least 5 days after delivery.
  • the target is selected from the group consisting of a nucleic acid molecule, a small molecule, a protein, a carbohydrate, and a lipid.
  • the target is a gene regulation protein.
  • the gene regulation protein is a transcription factor.
  • the nucleic acid molecule is a DNA molecule or an RNA molecule.
  • the complex modulates gene expression.
  • the complex modulates directed transcription of the DNA molecule, epigenetic remodeling of the DNA molecule, or degradation of the DNA molecule.
  • the complex modulates degradation of the target, translocation of the target, or target signal transduction.
  • the gene expression is associated with pathogenesis of a disease or condition.
  • the complex is detectable at least 7, 8, 9, or 10 days after delivery.
  • the translation incompetent circular polyribonucleotide is present at least five days after delivery. In some embodiments, the translation incompetent circular
  • the polyribonucleotide is present at least 6, 7, 8, 9, or 10 days after delivery.
  • the translation incompetent circular polyribonucleotide is an unmodified translation incompetent circular polyribonucleotide.
  • the translation incompetent circular polyribonucleotide has a quasi-double-stranded secondary structure.
  • the aptamer sequence further has a tertiary structure that binds the target.
  • the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a human cell.
  • a method of binding a transcription factor in a cell comprises providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence that binds the transcription factor; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the transcription factor and modulates gene expression.
  • a method of sequestering a transcription factor in a cell comprises providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence that binds the transcription factor; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide sequesters the transcription factor by binding the transcription factor to form a complex in the cell.
  • cell viability decreases after formation of the complex.
  • a method of sensitizing a cell to a cytotoxic agent comprises providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence that binds a transcription factor; and delivering the cytotoxic agent and the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the transcription factor in the cell; thereby sensitizing the cell to the cytotoxic agent compared to a cell lacking the translation incompetent circular
  • the sensitizing the cell to the cytotoxic agent results in decreased cell viability after the delivering of the cytotoxic agent and the translation incompetent circular polyribonucleotide.
  • the decreased cell viability is decreased by 40% or more at least two days after the delivering of the cytotoxic agent and the translation incompetent circular polyribonucleotide.
  • a method of binding a pathogenic protein in a cell comprises: providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence that binds the pathogenic protein; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the pathogenic protein for degrading the pathogenic protein.
  • a method of binding a ribonucleic acid molecule in a cell comprises: providing a translation incompetent circular polyribonucleotide comprising a sequence complementary to a sequence of the ribonucleic acid molecule; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the ribonucleic acid molecule.
  • a method of binding genomic deoxyribonucleic acid molecule in a cell comprises providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence that binds the genomic deoxyribonucleic acid molecule; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the genomic deoxyribonucleic acid molecule and modulates gene expression.
  • a method of binding a small molecule in a cell comprises providing a translation incompetent circular polyribonucleotide comprising an aptamer sequence that binds the small molecule; and delivering the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the small molecule and modulates a cellular process.
  • the small molecule is an organic compound having a molecular weight of no more than 900 daltons and modulates a cellular process.
  • the small molecule is a drug.
  • the small molecule is a fluorophore.
  • the small molecule is a metabolite.
  • a composition comprises a translation incompetent circular
  • polyribonucleotide comprising an aptamer sequence, wherein the aptamer sequence has a secondary structure that binds a target.
  • a pharmaceutical composition comprises a translation incompetent circular polyribonucleotide comprising an aptamer sequence, wherein the aptamer sequence has a secondary structure that binds the target; and a pharmaceutically acceptable carrier or excipient.
  • a cell comprises the translation incompetent circular polyribonucleotide as described herein.
  • a method of treating a subject in need thereof comprises administering the composition as described herein or the pharmaceutical composition as described herein.
  • a polynucleotide is a polynucleotide that encodes the translation incompetent circular polyribonucleotide of as described herein.
  • a method is a method of producing the translation incompetent circular polyribonucleotide as described herein.
  • a pharmaceutical composition comprises a circular polyribonucleotide comprising a binding site that binds a target, e.g., a RNA, DNA, protein, membrane of cell etc.; and a pharmaceutically acceptable carrier or excipient; wherein the target and the circular polyribonucleotide form a complex, and wherein the target is a not a microRNA.
  • a target e.g., a RNA, DNA, protein, membrane of cell etc.
  • a pharmaceutical composition comprises a circular polyribonucleotide comprising: a first binding site that binds a first target, and a second binding site that binds a second target; and a pharmaceutically acceptable carrier or excipient; wherein the first binding site is different than the second binding site, andwherein the first target and the second target are both a microRNA.
  • the binding site comprises an aptamer sequence.
  • the first binding site comprises a first aptamer sequence and the second binding site comprises a second aptamer sequence.
  • the aptamer sequence has a secondary structure that binds the target.
  • the first aptamer sequence has a secondary structure that binds the first target and the second aptamer sequence has a secondary structure that binds the second target.
  • the binding site is a first binding site and the target is a first target.
  • the circular polyribonucleotide further comprises a second binding site that binds to a second target.
  • the first target comprises a first circular polyribonucleotide (circRNA)-binding motif.
  • the second target comprises a second circular polyribonucleotide (circRNA)-binding motif.
  • the first target, the second target, and the circular polyribonucleotide form a complex.
  • the first and second targets interact with each other.
  • the complex modulates a cellular process.
  • the first and second targets are the same, and the first and second binding sites bind different binding sites on the first target and the second target. In some embodiments, the first target and the second target are different.
  • the circular polyribonucleotide further comprises one or more additional binding sites that bind a third or more targets. In some embodiments, one or more targets are the same and one or more additional binding sites bind different binding sites on the one or more targets. In some embodiments, formation of the complex modulates a cellular process. In some embodiments, the circular polyribonucleotide modulates a cellular process associated with the first or second target when contacted to the first and second targets. In some embodiments, the first and second targets interact with each other in the complex. In some embodiments, the cellular process is associated with pathogenesis of a disease or condition. In some embodiments, the cellular process is different than translation of the circular
  • the first target comprises a deoxyribonucleic acid (DNA) molecule
  • the second target comprises a protein.
  • the complex modulates directed transcription of the DNA molecule, epigenetic remodeling of the DNA molecule, or degradation of the DNA molecule.
  • the first target comprises a first protein
  • the second target comprises a second protein.
  • the complex modulates degradation of the first protein, translocation of the first protein, or signal transduction, or modulates a native protein function, inhibits or modulates formation of a complex formed by direct interaction between the first and second proteins.
  • the first target or the second target is a ubiquitin ligase.
  • the first target comprises a first ribonucleic acid (RNA) molecule
  • the second target comprises a second RNA molecule.
  • the complex modulates degradation of the first RNA molecule.
  • the first target comprises a protein
  • the second target comprises a RNA molecule.
  • the complex modulates translocation of the protein or inhibits formation of a complex formed by direct interaction between the protein and the RNA molecule.
  • the first target is a receptor
  • the second target is a substrate of the receptor.
  • the complex inhibits activation of the receptor.
  • a pharmaceutical composition comprises a circular polyribonucleotide comprising a binding site that binds a target; and a pharmaceutically acceptable carrier or excipient; wherein the circular polyribonucleotide is translation incompetent or translation defective, and wherein the target is not a microRNA.
  • a pharmaceutical composition comprises a circular polyribonucleic acid comprising a binding site that binds a target, wherein the target comprises a ribonucleic acid (RNA)-binding motif; and a
  • the binding site comprises an aptamer sequence having a secondary structure that binds the target.
  • the target comprises a DNA molecule.
  • binding of the target to the circular polyribonucleotide modulates interference of transcription of a DNA molecule.
  • the target comprises a protein.
  • binding of the target to the circular polyribonucleotide modulates interaction of the protein with other molecules.
  • the protein is a receptor, and binding of the target to the circular polyribonucleotide activates the receptor.
  • the protein is a first enzyme, wherein the circular polyribonucleotide further comprises a second binding site that binds to a second enzyme, and wherein binding of the first and second enzymes to the circular polyribonucleotide modulates enzymatic activity of the first and second enzymes.
  • the protein is a ubiquitin ligase.
  • the target comprises a messenger RNA (mRNA) molecule. In some embodiments, binding of the target to the circular polyribonucleotide modulates interference of translation of the mRNA molecule. In some embodiments, the target comprises a ribosome.
  • binding of the target to the circular polyribonucleotide modulates interference of a translation process.
  • the target comprises a circular RNA molecule.
  • binding of the target to the circular polyribonucleotide sequesters the circular RNA molecule.
  • binding of the target to the circular polyribonucleotide sequesters the microRNA molecule.
  • a pharmaceutical composition comprises a circular polyribonucleotide comprising a binding site that binds to a membrane of a cell (e.g., cell wall membrane, organelle membrane, etc.), wherein the membrane of the cell comprises a ribonucleic acid (RNA)-binding motif; and a pharmaceutically acceptable carrier or excipient.
  • the binding site comprises an aptamer sequence having a secondary structure that binds the membrane of the cell (e.g., cell wall membrane, organelle membrane, etc.).
  • the circular polyribonucleotide further comprises a second binding site that binds to a second target, wherein the second target comprises a second RNA-binding motif.
  • the circular polyribonucleotide binds to the membrane of the cell and the second target.
  • the circular polyribonucleotide further comprises a second binding site that binds to a second cell target, and wherein binding of the cell target and the second cell target to the circular polyribonucleotide induces a conformational change in the cell target, thereby inducing signal transduction downstream of the cell target.
  • the circular polyribonucleotide further comprises a second binding site that binds to a second cell target, and wherein binding of the cell target and the second cell target to the circular polyribonucleotide induces a conformational change in the cell target, thereby inducing signal transduction downstream of the cell target.
  • polyribonucleotide is translation incompetent or translation defective.
  • circular polyribonucleotide further comprises at least one structural element selected from the group consisting of: a) an encryptogen; b) a splicing element; c) a regulatory sequence; d) a replication sequence; e) a quasi-double-stranded secondary structure; f) a quasi-helical structure; and g) an expression sequence.
  • the quasi-helical structure comprises at least one double-stranded RNA segment with at least one non-double-stranded segment.
  • the quasi-helical structure comprises a first sequence and a second sequence linked with a repetitive sequence.
  • the encryptogen comprises a splicing element.
  • the circular polyribonucleic acid comprises at least one modified nucleic acid.
  • the at least one modified nucleic acid is selected from the group consisting of 2’-0-methyl, 2’-0-methoxyethyl (2’-0-MOE), 2’-0-aminopropyl, 2’-deoxy, T-deoxy-2’-fluoro, 2’-0-aminopropyl (2’-0-AP), 2’-0-dimethylaminoethyl (2’-0- DMAOE), 2’-0-dimethylaminopropyl (2’-0-DMAP), T-O-dimethylaminoethyloxyethyl (2’-0- DMAEOE), 2’-0-N-methylacetamido (2’-0-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (P
  • the encryptogen comprises at least one modified nucleic acid. In some embodiments, the encryptogen comprises a protein binding site. In some embodiments, the encryptogen comprises an immunoprotein binding site. In some embodiments, the circular polyribonucleic acid has at least 2x lower immunogenicity than a counterpart lacking the encryptogen, as assessed by expression, signaling, or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-beta In some embodiments, the circular polyribonucleic acid has a size of about 20 bases to about 20 kb. In some embodiments, the circular polyribonucleic acid is synthesized through circularization of a linear polynucleotide. In some embodiments, the circular polyribonucleic acid is substantially resistant to degradation.
  • a pharmaceutical composition comprises a circular polyribonucleotide comprising a binding site that binds to a target, wherein the target comprises a ribonucleic acid (RNA)-binding motif; and a pharmaceutically acceptable carrier or excipient, wherein the circular polyribonucleotide comprises at least one modified nucleotide and a first portion that comprises at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous unmodified nucleotides.
  • RNA ribonucleic acid
  • a pharmaceutical composition comprises: a circular polyribonucleotide comprising a binding site that binds to a target, wherein the target comprises a ribonucleic acid (RNA)-binding motif; and a pharmaceutically acceptable carrier or excipient, wherein the circular polyribonucleotide comprises at least one modified nucleotide and a first portion that comprises at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides, and wherein the first portion lacks pseudouridine or 5’-methylcytidine.
  • the binding site comprises an aptamer sequence having a secondary structure that binds the target.
  • the circular polyribonucleotide comprising a binding site that binds to a target, wherein the target comprises a ribonucleic acid (RNA)-binding motif
  • RNA ribonucleic acid
  • a pharmaceutically acceptable carrier or excipient wherein the circular poly
  • polyribonucleotide has a lower immunogenicity than a corresponding unmodified circular polyribonucleotide.
  • the circular polyribonucleotide has an
  • immunogenicity that is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 fold lower than a corresponding unmodified circular polyribonucleotide, as assessed by expression or signaling or activation of at least one of the group consisting of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-beta.
  • the circular polyribonucleotide has a higher half-life than a corresponding unmodified circular polyribonucleotide. In some embodiments, the circular polyribonucleotide has a half-life that is at least about 1.2, 1.3, 1.5,
  • the half-life is measured by introducing the circular polyribonucleotide or the corresponding unmodified circular polyribonucleotide into a cell and measuring a level of the introduced circular polyribonucleotide or corresponding circular polyribonucleotide inside the cell.
  • the at least one modified nucleotide is selected from the group consisting of: N(6)methyladenosine (m6A), 5’-methylcytidine, and pseudouridine.
  • the at least one modified nucleic acid is selected from the group consisting of T - O-methyl, 2’-0-methoxyethyl (2’-0-MOE), 2’-0-aminopropyl, 2’-deoxy, T-deoxy-2’-fluoro, 2’-0-aminopropyl (2’-0-AP), 2’-0-dimethylaminoethyl (2’-0-DMA0E), 2’-0- dimethylaminopropyl (2’-0-DMAP), T-O-dimethylaminoethyloxy ethyl (2’-0-DMAE0E), 2’- O-N-methylacetamido (2’-0-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a l’,5’-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphon
  • the circular polyribonucleotide comprises a binding site that binds to a protein, DNA, RNA, or a cell target, consisting of unmodified nucleotides.
  • the circular polyribonucleotide comprises an internal ribosome entry site (IRES) consisting of unmodified nucleotides.
  • the binding site consists of unmodified nucleotides.
  • the binding site comprises an IRES consisting of unmodified nucleotides.
  • the first portion comprises a binding site that binds a protein, DNA, RNA, or a cell target.
  • the first portion comprises an IRES.
  • the circular polyribonucleotide comprises one or more expression sequences.
  • the circular polyribonucleotide comprises the one or more expression sequences and the IRES, and wherein the circular polyribonucleotide comprises a 5’-methylcytidine, a pseudouridine, or a combination thereof outside the IRES.
  • one or more expression sequences of the circular polyribonucleotide are configured to have a higher translation efficiency than a corresponding unmodified circular polyribonucleotide. In some embodiments, one or more expression sequences of the circular polyribonucleotide have a translation efficiency of that is at least about 0.7, 0.8, 0.9, 1.0, 1.1,
  • one or more expression sequences of the circular polyribonucleotide have a higher translation efficiency than a corresponding circular
  • polyribonucleotide having a first portion comprising a modified nucleotide.
  • one or more expression sequences of the circular polyribonucleotide have a higher translation efficiency than a corresponding circular polyribonucleotide having a first portion comprising more than 10% modified nucleotides.
  • one or more expression sequences of the circular polyribonucleotide have a translation efficiency that is at least about 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 fold higher than a corresponding circular
  • polyribonucleotide having a first portion comprising a modified nucleotide.
  • the translation efficiency is measured either in a cell comprising the circular polyribonucleotide or the corresponding circular polyribonucleotide, or in an in vitro translation system (e.g., rabbit reticulocyte lysate).
  • the circular polyribonucleotide is the circular polyribonucleotide of any one of the disclosed embodiments.
  • a method of treatment comprises administering the pharmaceutical composition of any one of of the previously disclosed embodiments to a subject with a disease or condition.
  • a method of producing a pharmaceutical composition comprises generating the circular polyribonucleotide of any one of the disclosed embodiments.
  • composition of any one of the embodiments is formulated in a carrier, e.g., membrane or lipid bilayer.
  • a method of making the circular polyribonucleotide of any one of disclosed embodiments comprises circularizing a linear polyribonucleotide having a nucleic acid sequence as the circular polyribonucleotide.
  • an engineered cell comprises the composition of any one of the disclosed embodiments.
  • FIG. 1 illustrates an example circular polyribonucleotide molecular scaffold.
  • FIG. 2 illustrates an example trans-ribozyme circular polyribonucleotide.
  • FIG. 3 illustrates a schematic of protein expression by a circular polyribonucleotide.
  • FIG. 4 illustrates an example circular polyribonucleotide molecular scaffold for lipids, such as membranes.
  • FIG. 5A illustrates an example circular polyribonucleotide molecular scaffold for DNA.
  • FIG. 5B illustrates an example circular polyribonucleotide molecular scaffold with a sequence specific DNA binding motif.
  • the circRNA can bind to the major groove of the DNA duplex to form parallel or antiparallel triplex structures based on the orientation of the third strand.
  • Exemplary parallel triplex structures include TATJ, CG G and CG C (DNA
  • Exemplary antiparallel triplex structures include TA A, TA U and CG G (DNA DNA RNA).
  • FIG. 5C illustrates an example circular polyribonucleotide molecular scaffold with a DNA binding motif specific to an enhancer region of the DHFR gene for interference with transcription factor binding and/or mRNA transcription.
  • FIG. 5D illustrates an example circular polyribonucleotide molecular scaffold with a DNA binding motif specific to an enhancer region of the MEG3 gene for interference with transcription factor binding and/or mRNA transcription.
  • FIG. 5E illustrates an example circular polyribonucleotide molecular scaffold with a DNA binding motif specific to an enhancer region of the EPS gene for interference with transcription factor binding and/or mRNA transcription.
  • FIG. 6 illustrates an example circular polyribonucleotide molecular scaffold for RNA.
  • FIG. 7A illustrates an example circular polyribonucleotide molecular scaffold for target RNAs to sequester and/or degrade target RNAs.
  • FIG. 7B illustrates an example circular polyribonucleotide molecular scaffold for RNAs and enzymes targeting the RNAs (e.g., decapping enzymes that induce degradation of the RNAs).
  • FIG. 7C illustrates an example circular polyribonucleotide molecular scaffold for RNA, DNA and protein (e.g., to drive target gene translation).
  • FIG. 8 illustrates an example circular polyribonucleotide molecular scaffold for protein (e.g., FUS/TDP43/ATXN2, PRPF8, GEMIN5, CUG BP1 and LIN28A).
  • protein e.g., FUS/TDP43/ATXN2, PRPF8, GEMIN5, CUG BP1 and LIN28A.
  • FIGs. 9A, 9B, and 9C show that the modified circular RNAs bind protein translation machinery in cells.
  • FIGs. 10 A, 10B, and 10C show that modified circular RNAs have reduced binding to immune proteins as assessed by activation of immune related genes (MDA5, OAS, and IFN-beta expression) as compared to unmodified circular RNAs in cells.
  • MDA5, OAS, and IFN-beta expression immune related genes
  • FIG. 11 shows that hybrid modified circular RNAs have reduced immunogenicity as compared to unmodified circular RNAs as assessed by RIG-I, MDA5, IFN-beta, and OAS expression in cells.
  • FIG. 12 demonstrates that a circular RNA aptamer exhibits increased intracellular delivery and enhanced binding to a small molecule target compared to a linear aptamer.
  • FIG. 13 illustrates binding of a circular RNA containing a protein-binding motif to a target protein.
  • FIG. 14 demonstrates a small molecule-circular RNA conjugate binds to a protein targeted by the small molecule.
  • FIG. 15 demonstrates interaction of a circular RNA-small molecule conjugate with a specific bioactive protein.
  • FIG. 16 illustrates a circRNA with two binding sites that can act as a scaffold, for example, to form a complex with an enzyme (Enz) and a target substrate (substrate), facilitating modification (M) of the target substrate by the enzyme.
  • Enz an enzyme
  • substrate substrate
  • M facilitating modification
  • FIG. 17 shows images from electrophoretic mobility shift assay (EMSA) demonstrating that RNA with scrambled binding aptamer sequences did not show binding affinity to the p50 subunit of NF-kB, while both linear and circular RNAs with the NF-kB binding aptamer sequence bound to the p50 subunit with similar affinities.
  • ESA electrophoretic mobility shift assay
  • FIG. 18 shows that treatment with circular RNA with the NF-kB binding aptamer sequence led to a decrease in cell viability of A549 cells as compared to its linear counterpart.
  • FIG. 19 shows co-treatment with linear RNA and doxorubicin (dox) decreased cell viability at day 2 and co-treatment with the circular aptamer and dox resulted in more cell death at both days 1 and 2 in the dox-resistant A549 lung cancer cell line.
  • dox doxorubicin
  • FIG. 20 is a schematic showing an exemplary circular RNA that is delivered into cells and tags a target BRD4 protein in the cells for degradation by ubiquitin system.
  • FIG. 21 shows Western blot images and quantitative chart demonstrating that circular RNA containing thalidomide and JQ1 small molecules was able to degrade BRD4 in cells.
  • FIG. 22 shows aptamer fluorescence when bound to TO-l biotin at different time points after delivery of the circular RNA (endless aptamer) or the linear RNA (linear aptamer) to HeLa cell cultures.
  • the fluorescent images (top) show aptamer fluorescence when bound to TO-l biotin at 6 hours, Day 1, and Day 10 after delivery of the the circular RNA (endless aptamer) or the linear RNA (linear aptamer).
  • the graphs (bottom) show the percentage of fluorescent cells in the HeLa cell cultures at 6 hours, Day 1, Day 3, Day 5, Day 7, Day 10, and Day 12 after delivery of the the circular RNA (endless aptamer), the linear RNA (linear aptamer), or the TO-l biotin only (control).
  • FIG. 23 shows HuR bound circular RNAs with a HuR RNA binding aptamer motif and the streptavidin pull-down yielded RNAs with the RNA binding aptamer motifs compared to a circular RNA with no binding aptamer motifs, a circular RNA with a HuR RNA binding aptamer motif, and a circular RNA with an RNA binding aptamer motif.
  • FIG. 23 shows HuR bound circular RNAs with a HuR RNA binding aptamer motif and the streptavidin pull-down yielded RNAs with the RNA binding aptamer motifs compared to a circular RNA with no binding aptamer motifs, a circular RNA with a HuR RNA binding aptamer motif, and a circular RNA with an RNA binding aptamer motif.
  • RNA 24 shows HuR bound circular RNAs with the HuR DNA binding aptamer motif and the streptavidin pull-down yielded RNAs with the DNA binding aptamer motifs compared to a circular RNA with no binding apatmer motifs, a circular RNA with a HuR DNA binding aptamer motif, and a circular RNA with DNA.
  • FIG. 25 shows lower secreted protein expression from circular RNA without a HuR binding motif compared to a circular RNA with IX HuR binding motif, 2X HuR binding motifs, and 3X HuR binding motifs.
  • This invention relates generally to pharmaceutical compositions and preparations of circular polyribonucleotides and uses thereof.
  • the term“circRNA” or“circular RNA” or“circular polyribonucleotide” refers to a polyribonucleotide that forms a circular structure through covalent or non-covalent bonds.
  • the term“encryptogen” refers to a nucleic acid sequence of the circular polyribonucleotide that aids in reducing, evading, and/or avoiding detection by an immune cell and/or reduces induction of an immune response against the circular polyribonucleotide.
  • the term“expression sequence” refers to a nucleic acid sequence that encodes a product, e.g., a peptide or polypeptide, or a regulatory nucleic acid.
  • immunoprotein binding site refers to a nucleotide sequence that binds to an immunoprotein and aids in masking the circular polyribonucleotide as non- endogenous.
  • modified ribonucleotide refers to a nucleotide with at least one modification to the sugar, the nucleobase, or the internucleoside linkage.
  • the phrase“quasi-helical structure” refers to a higher order structure of the circular polyribonucleotide, wherein at least a portion of the circular polyribonucleotide folds into a helical structure.
  • the phrase“quasi-double-stranded secondary structure” refers to a higher order structure of the circular polyribonucleotide, wherein at least a portion of the circular polyribonucleotide creates a double strand.
  • regulatory sequence refers to a nucleic acid sequence that modifies an expression product.
  • repetitive nucleotide sequence refers to a repetitive nucleic acid sequence within a stretch of DNA or throughout a genome.
  • the repetitive nucleotide sequence includes poly CA or poly TG sequences.
  • the repetitive nucleotide sequence includes repeated sequences in the Alu family of introns.
  • replication element refers to a sequence and/or motifs useful for replication or that initiate transcription of the circular polyribonucleotide.
  • selective translation sequence refers to a nucleic acid sequence that selectively initiates or activates translation of an expression sequence in the circular polyribonucleotide.
  • the term“selective degradation sequence” refers to a nucleic acid sequence that initiates translation of an expression sequence in the circular polyribonucleotide.
  • stagger sequence refers to a nucleotide sequence that induces ribosomal pausing during translation.
  • the stagger sequence is a non- conserved sequence of amino-acids with a strong alpha-helical propensity followed by the consensus sequence -D(V/I)ExNPG P, where x is any amino acid.
  • the term“substantially resistant” refers to one that has at least 50%
  • the term“complex” refers to an association between at least two moieties (e.g., chemical or biochemical) that have an affinity for one another.
  • at least two moieties are a target (e.g., a protein) and a circular RNA molecule.
  • Polypeptide and“protein” are used interchangeably and refer to a polymer of two or more amino acids joined by a covalent bond (e.g., an amide bond).
  • Polypeptides as described herein can include full length proteins (e.g., fully processed proteins) as well as shorter amino acid sequences (e.g., fragments of naturally-occurring proteins or synthetic polypeptide fragments).
  • Polypeptides can include naturally occurring amino acids (e.g., one of the twenty amino acids commonly found in peptides synthesized in nature, and known by the one letter abbreviations A, R, N, C, D, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y and V) and non-naturally occurring amino acids (e.g., amino acids which is not one of the twenty amino acids commonly found in peptides synthesized in nature, including synthetic amino acids, amino acid analogs, and amino acid mimetics).
  • naturally occurring amino acids e.g., one of the twenty amino acids commonly found in peptides synthesized in nature, and known by the one letter abbreviations A, R, N, C, D, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y and V
  • non-naturally occurring amino acids e.g., amino acids which is not one of the twenty amino acids commonly found in peptide
  • binding site refers to a region of the circular
  • a binding site can comprise an aptamer sequence.
  • binding moiety refers to a region of a target that can be bound by a binding site, for example, a region, domain, fragment, epitope, or portion of a nucleic acid (e.g., RNA, DNA, RNA-DNA hybrid), chemical compound, small molecule (e.g., drug), aptamer, polypeptide, protein, lipid, carbohydrate, antibody, virus, virus particle, membrane, multi-component complex, organelle, cell, other cellular moieties, any fragment thereof, and any combination thereof.
  • a nucleic acid e.g., RNA, DNA, RNA-DNA hybrid
  • small molecule e.g., drug
  • aptamer sequence refers to a non-naturally occurring or synthetic oligonucleotide that specifically binds to a target molecule.
  • an aptamer is from 20 to 250 nucleotides.
  • an aptamer binds to its target through secondary structure rather than sequence homology.
  • small molecule refers to an organic compound that has a molecular weight of no more than 900 daltons.
  • a small molecule is capable of modulating a cellular process or is a fluorophore.
  • conjugation moiety refers to a modified nucleotide comprising a functional group for use in a method of conjugation.
  • the term“linear counterpart” refers to a polyribonucleotide having the same nucleotide sequence and nucleic acid modifications as a circular polyribonucleotide and having two free ends (i.e., the uncircularized version of the circularized polyribonucleotide).
  • the linear counterpart further comprises a 5’ cap.
  • the linear counterpart further comprises a poly adenosine tail.
  • the linear counterpart further comprises a 3’ UTR.
  • the linear counterpart further comprises a 5’ UTR.
  • Circular polyribonucleotides (circRNA) described herein are polyribonucleotides that form a continuous structure through covalent or non-covalent bonds.
  • the present invention described herein includes compositions comprising synthetic circRNA and methods of their use. Due to the circular structure, circRNA can have improved stability, increased half-life, reduced immunogenicity, and/or improved functionality (e.g., of a function described herein) compared to a corresponding linear RNA.
  • the circular RNA is detectable for at least 5 days after delivery of the circular RNA to a cell. In some embodiments, the circular RNA is detectable for at 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after delivery of the circular RNA to the cell.
  • the circular RNA can be detected using any technique known in the art.
  • circRNA binds one or more targets.
  • a circRNA is a circular aptamer.
  • a circRNA comprises one or more binding sites that bind to one or more targets.
  • the circ RNA comprises an aptamer sequence.
  • circRNA binds both a DNA target and a protein target and e.g., mediates transcription.
  • circRNA brings together a protein complex and e.g., mediates post-translational modifications or signal transduction.
  • circRNA binds two or more different targets, such as proteins, and e.g., shuttles these proteins to the cytoplasm, or mediates degradation of one or more of the targets.
  • circRNA binds at least one of DNA, RNA, and proteins and thereby regulates cellular processes (e.g., alter protein expression, modulate gene expression, modulate cell signaling, etc.).
  • synthetic circRNA includes binding sites for interaction with a target or at least one moiety, e.g., a binding moiety, of DNA, RNA or proteins of choice to thereby compete in binding with the endogenous counterpart.
  • the circular RNA forms a complex that regulates the cellular process (e.g., alter protein expression, modulate gene expression, modulate cell signaling, etc.).
  • the circular RNA sensitizes a cell to a cytotoxic agent (e.g., a
  • the chemotherapeutic agent by binding to a target (e.g., a transcription factor), which results in reduce cell viability.
  • a target e.g., a transcription factor
  • sensitizing the cell to the cytoxic agent results in decreased cell viability after the delivery of the cytotoxic agent and the circular RNA.
  • the decreased cell viability is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or any percentage therein.
  • the complex is detectable for at least 5 days after delivery of the circular RNA to cell. In some embodiments, the complex is detectable for at 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days after delivery of the circular RNA to the cell.
  • synthetic circRNA binds and/or sequesters miRNAs. In another embodiment, synthetic circRNA binds and/or sequesters proteins. In another embodiment, synthetic circRNA binds and/or sequesters mRNA. In another embodiment, synthetic circRNA binds and/or sequesters ribosomes. In another embodiment, synthetic circRNA binds and/or sequesters circRNA. In another embodiment, synthetic circRNA binds and/or sequesters long- noncoding RNA (lncRNA) or any other non-coding RNA, e.g., miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, long-noncoding RNA, shRNA. Besides binding and/or sequestration sites, the circRNA may include a degradation element, which will result in degradation of the bound and/or sequestered RNA and/or protein.
  • lncRNA long- noncoding RNA
  • the circRNA may include a degradation element, which will result in
  • a circRNA comprises a lncRNA or a sequence of a lncRNA, e.g., a circRNA comprises a sequence of a naturally occurring, non-circular lncRNA or a fragment thereof.
  • a lncRNA or a sequence of a lncRNA is circularized, with or without a spacer sequence, to form a synthetic circRNA.
  • a circRNA has ribozyme activity.
  • a circRNA can be used to act as a ribozyme and cleave pathogenic or endogenous RNA, DNA, small molecules or protein.
  • a circRNA has enzymatic activity.
  • synthetic circRNA is able to specifically recognize and cleave RNA (e.g., viral RNA).
  • circRNA is able to specifically recognize and cleave proteins.
  • circRNA is able to specifically recognize and degrade small molecules.
  • a circRNA is an immolating or self-cleaving or cleavable circRNA.
  • a circRNA can be used to deliver RNA, e.g., miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, long-noncoding RNA, shRNA.
  • synthetic circRNA is made up of microRNAs separated by (1) self-cleavable elements (e.g., hammerhead, splicing element), (2) cleavage recruitment sites (e.g., ADAR), (3) a degradable linker (e.g., glycerol), (4) a chemical linker, and/or (5) a spacer sequence.
  • synthetic circRNA is made up of siRNAs separated by (1) self-cleavable elements (e.g., hammerhead, splicing element), (2) cleavage recruitment sites (e.g., ADAR), (3) a degradable linker (e.g., glycerol), (4), chemical linker, and/or (5) a spacer sequence.
  • a circRNA is a transcriptionally/replication competent circRNA. This circRNA can encode any type of RNA.
  • a synthetic circRNA has an anti-sense miRNA and a transcriptional element.
  • linear functional miRNAs are generated from a circRNA.
  • a circRNA is a translation incompetent circular polyribonucleotide.
  • a circRNA has one or more of the above attributes in combination with a translating element.
  • a circRNA comprises at least one modified nucleotide. In some embodiments, a circRNA comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% modified nucleotides. In some embodiments, a circRNA comprises substantially all (e.g., greater than 80%, 85%, 90%, 95%, 97%, 98%, or 99%, or about 100%) modified nucleotides. In some embodiments, a circRNA comprises modified nucleotides and a portion of unmodified contiguous nucleotides, which can be referred to as a hybrid modified circRNA.
  • a portion of unmodified contiguous nucleotides can be an unmodified binding site configured to bind a protein, DNA, RNA, or a cell target in a hybrid modified circRNA.
  • a portion of unmodified contiguous nucleotides can be an unmodified IRES in a hybrid modified circRNA.
  • a circRNA lacks modified nucleotides, which can be referred to as an unmodified circRNA.
  • a circRNA can comprise at least one binding site for a target, e.g., for a binding moiety of a target.
  • a circRNA can comprise at least one aptamer sequence that binds to a target.
  • the circRNA comprises one or more binding sites for one or more targets.
  • Targets include, but are not limited to, nucleic acids (e.g., RNAs, DNAs, RNA-DNA hybrids), small molecules (e.g., drugs, fluorophores, metabolites), aptamers, polypeptides, proteins, lipids, carbohydrates, antibodies, viruses, virus particles, membranes, multi-component complexes, organelles, cells, other cellular moieties, any fragments thereof, and any combination thereof.
  • a target is a single-stranded RNA, a double-stranded RNA, a single- stranded DNA, a double-stranded DNA, a DNA or RNA comprising one or more double stranded regions and one or more single stranded regions, an RNA-DNA hybrid, a small molecule, an aptamer, a polypeptide, a protein, a lipid, a carbohydrate, an antibody, an antibody fragment, a mixture of antibodies, a virus particle, a membrane, a multi-component complex, a cell, a cellular moiety, any fragment thereof, or any combination thereof.
  • a target is a polypeptide, a protein, or any fragment thereof.
  • a target can be a purified polypeptide, an isolated polypeptide, a fusion tagged polypeptide, a polypeptide attached to or spanning the membrane of a cell or a virus or virion, a cytoplasmic protein, an intracellular protein, an extracellular protein, a kinase, a tyrosine kinase, a serine/threonine kinase, a phosphatase, an aromatase, a phosphodiesterase, a cyclase, a helicase, a protease, an oxidoreductase, a reductase, a transferase, a hydrolase, a lyase, an isomerase, a glycosylase, a extracellular matrix protein, a ligase, a ubiquitin ligas
  • a target is a heterologous polypeptide.
  • a target is a protein overexpressed in a cell using molecular techniques, such as transfection.
  • a target is a recombinant polypeptide.
  • a target is in a sample produced from bacterial (e.g., E. coli), yeast, mammalian, or insect cells (e.g., proteins overexpressed by the organisms).
  • a target is a polypeptide with a mutation, insertion, deletion, or polymorphism.
  • a target is a polypeptide naturally expressed by a cell (e.g., a healthy cell or a cell associated with a disease or condition).
  • a target is an antigen, such as a polypeptide used to immunize an organism or to generate an immune response in an organism, such as for antibody production.
  • a target is an antibody.
  • An antibody can specifically bind to a particular spatial and polar organization of another molecule.
  • An antibody can be monoclonal, polyclonal, or a recombinant antibody, and can be prepared by techniques that are well known in the art such as immunization of a host and collection of sera (polyclonal) or by preparing continuous hybrid cell lines and collecting the secreted protein (monoclonal), or by cloning and expressing nucleotide sequences, or mutagenized versions thereof, coding at least for the amino acid sequences required for specific binding of natural antibodies.
  • a naturally occurring antibody can be a protein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain can be comprised of a heavy chain variable region (V H ) and a heavy chain constant region.
  • the heavy chain constant region can comprise three domains, CHI, CH2, and CH 3 ⁇
  • Each light chain can comprise a light chain variable region (V L ) and a light chain constant region.
  • the light chain constant region can comprise one domain, C L .
  • the V H and V L regions can be further subdivided into regions of hypervariability, termed complementary determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementary determining regions
  • Each V H and V L can be composed of three CDRs and four FRs arranged from amino-terminus to carboxy -terminus in the following order: FRi, CDRi, FR 2 , CDR 2 , FR 3 , CDR 3 , and FR4.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Cl q) of the classical complement system.
  • the antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., lgGi, lgG 2 , lgG 3 , lgG 4 , lgAi and lgA 2 ), subclass or modified version thereof.
  • Antibodies may include a complete immunoglobulin or fragments thereof.
  • An antibody fragment can refer to one or more fragments of an antibody that retain the ability to specifically bind to a binding moiety, such as an antigen.
  • aggregates, polymers, and conjugates of immunoglobulins or their fragments are also included so long as binding affinity for a particular molecule is maintained.
  • antibody fragments include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; an Fd fragment consisting of the V H and CHI domains; an Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a single domain antibody (dAb) fragment (Ward et al, (1989) Nature 341 :544-46), which consists of a V H domain; and an isolated CDR and a single chain Fragment (scFv) in which the V L and V H regions pair to form monovalent molecules (known as single chain Fv (scFv); See, e.g., Bird et al, (1988) Science 242:423-26; and Huston et al, (1988) PNAS 85:5879-83).
  • antibody fragments include Fab, F(ab
  • an antibody can be a polyvalent antibody, for example, bivalent, trivalent, tetravalent, pentavalent, hexavalanet, heptavalent, or octavalent antibodies.
  • An antibody can be a multi-specific antibody.
  • bispecific, trispecific, tetraspecific, pentaspecific, hexaspecific, heptaspecific, or octaspecific antibodies can be generated, e.g., by recombinantly joining a combination of any two or more antigen binding agents (e.g., Fab, F(ab) 2 , scFv, Fv, IgG).
  • Multi-specific antibodies can be used to bring two or more targets into close proximitiy, e.g., degradation machinery and a target substrate to degrade, or a ubiquitin ligase and a substrate to ubiquitinate.
  • Antibodies can be human, humanized, chimeric, isolated, dog, cat, donkey, sheep, any plant, animal, or mammal.
  • a target is a polymeric form of ribonucleotides and/or
  • deoxyribonucleotides such as DNA or RNA (e.g., mRNA).
  • DNA includes double-stranded DNA found in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes.
  • a polynucleotide target is single-stranded, double stranded, small interfering RNA (siRNA), messenger RNA (mRNA), transfer RNA (tRNA), a chromosome, a gene, a noncoding genomic sequence, genomic DNA (e.g., fragmented genomic DNA), a purified polynucleotide, an isolated polynucleotide, a hybridized polynucleotide, a transcription factor binding site, mitochondrial DNA, ribosomal RNA, a eukaryotic polynucleotide, a prokaryotic polynucleotide, a synthesized polynucleotide, a ligated polynucleotide, a recombinant polynucleotide, a polynucleotide containing a nucleic acid analogue, a methylated polynucleotide, a demethylated polynucleotide,
  • siRNA
  • a target is a recombinant polynucleotide.
  • a target is a heterologous polynucleotide.
  • a target is a polynucleotide produced from bacterial (e.g., E. coli ), yeast, mammalian, or insect cells (e.g., polynucleotides heterologous to the organisms).
  • a target is a bacterial (e.g., E. coli ), yeast, mammalian, or insect cells (e.g., polynucleotides heterologous to the organisms).
  • a target is a polynucleotide produced from bacterial (e.g., E. coli ), yeast, mammalian, or insect cells (e.g., polynucleotides heterologous to the organisms).
  • a target is a bacterial (e.g., E. coli ), yeast, mammalian, or insect cells (e.g., poly
  • polynucleotide with a mutation, insertion, deletion, or polymorphism is a polynucleotide with a mutation, insertion, deletion, or polymorphism.
  • a target is an aptamer.
  • An aptamer is an isolated nucleic acid molecule that binds with high specificity and affinity to a binding moiety or target molecule, such as a protein.
  • An aptamer is a three dimensional structure held in certain conformation(s) that provides chemical contacts to specifically bind its given target.
  • aptamers are nucleic acid based molecules, there is a fundamental difference between aptamers and other nucleic acid molecules such as genes and mRNA. In the latter, the nucleic acid structure encodes information through its linear base sequence and thus this sequence is of importance to the function of information storage.
  • aptamer function which is based upon the specific binding of a target molecule, is not entirely dependent on a conserved linear base sequence (a non-coding sequence), but rather a particular secondary/tertiary/quatemary structure. Any coding potential that an aptamer may possess is fortuitous and is not thought to play a role in the binding of an aptamer to its cognate target.
  • Aptamers are differentiated from naturally occurring nucleic acid sequences that bind to certain proteins. These latter sequences are naturally occurring sequences embedded within the genome of the organism that bind to a specialized sub-group of proteins that are involved in the transcription, translation, and transportation of naturally occurring nucleic acids (e.g., nucleic acid-binding proteins).
  • Aptamers on the other hand non-naturally occurring nucleic acid molecules. While aptamers can be identified that bind nucleic acid-binding proteins, in most cases such aptamers have little or no sequence identity to the sequences recognized by the nucleic acid-binding proteins in nature. More importantly, aptamers can bind virtually any protein (not just nucleic acid-binding proteins) as well as almost any partner of interest including small molecules, carbohydrates, peptides, etc. For most partners, even proteins, a naturally occurring nucleic acid sequence to which it binds does not exist.
  • aptamers are capable of specifically binding to selected partners and modulating the partner’s activity or binding interactions, e.g., through binding, aptamers may block their partner’s ability to function.
  • the functional property of specific binding to a partner is an inherent property an aptamer.
  • An aptamer can be 6-35 kDa.
  • An aptamer can be from 20 to 250 nucleotides.
  • An aptamer can bind its partner with micromolar to sub-nanomolar affinity, and may discriminate against closely related targets (e.g., aptamers may selectively bind related proteins from the same gene family). In some cases, an aptamer only binds one molecule. In some cases, an aptamer binds family members of a molecule of interest. An aptamer, in some cases, binds to multiple different molecules. Aptamers are capable of using commonly seen intermolecular interactions such as hydrogen bonding, electrostatic complementarities, hydrophobic contacts, and steric exclusion to bind with a specific partner.
  • Aptamers have a number of desirable characteristics for use as therapeutics and diagnostics including high specificity and affinity, low immunogenicity, biological efficacy, and excellent pharmacokinetic properties.
  • An aptamer can comprise a molecular stem and loop structure formed from the hybridization of complementary
  • An aptamer can be a linear ribonucleic acid (e.g., linear aptamer) comprising an aptamer sequence or a circular polyribonucleic acid comprising an aptamer sequence (e.g., a circular aptamer).
  • a target is a small molecule.
  • a small molecule can be a macrocyclic molecule, an inhibitor, a drug, or chemical compound.
  • a small molecule contains no more than five hydrogen bond donors.
  • a small molecule contains no more than ten hydrogen bond acceptors.
  • a small molecule has a molecular weight of 500 Daltons or less.
  • a small molecule has a molecular weight of from about 180 to 500 Daltons.
  • a small molecule contains an octanol-water partition coefficient lop P of no more than five.
  • a small molecule has a partition coefficient log P of from -0.4 to 5.6. In some embodiments, a small molecule has a molar refractivity of from 40 to 130. In some embodiments, a small molecule contains from about 20 to about 70 atoms. In some
  • a small molecule has a polar surface area of 140 Angstroms 2 or less.
  • a target is a cell.
  • a target is an intact cell, a cell treated with a compound (e.g., a drug), a fixed cell, a lysed cell, or any combination thereof.
  • a target is a single cell.
  • a target is a plurality of cells.
  • circRNA comprises a binding site to a single target or a plurality of (e.g., two or more) targets.
  • the single circRNA comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different binding sites for a single target.
  • the single circRNA comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the same binding sites for a single target.
  • the single circRNA comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different binding sites for one or more different targets.
  • two or more targets are in a sample, such as a mixture or library of targets, and the sample comprises circRNA comprising two or more binding sites that bind to the two or more targets.
  • a single target or a plurality of (e.g., two or more) targets have a plurality of binding moieties.
  • the single target may have 2, 3, 4, 5, 6, 7, 8, 9, 10, or more binding moieties.
  • two or more targets are in a sample, such as a mixture or library of targets, and the sample comprises two or more binding moieties.
  • a single target or a plurality of targets comprise a plurality of different binding moieties.
  • a plurality may include at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30,
  • a target can comprise a plurality of binding moieties comprising at least 2 different binding moieties.
  • a binding moiety can comprise a plurality of binding moieties comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60,
  • 70, 80, 90 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000,
  • a circRNA comprises one binding site.
  • a binding site can comprise an aptamer sequence.
  • a circRNA comprises at least two binding sites.
  • a circRNA can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more binding sites.
  • circRNA described herein is a molecular scaffold that binds one or more targets, or one or more binding moieties of one or more targets.
  • Each target may be, but is not limited to, a different or the same nucleic acids (e.g., RNAs, DNAs, RNA-DNA hybrids), small molecules (e.g., drugs), aptamers, polypeptides, proteins, lipids, carbohydrates, antibodies, viruses, virus particles, membranes, multi-component complexes, cells, cellular moieties, any fragments thereof, and any combination thereof.
  • nucleic acids e.g., RNAs, DNAs, RNA-DNA hybrids
  • small molecules e.g., drugs
  • aptamers e.g., polypeptides, proteins, lipids, carbohydrates, antibodies, viruses, virus particles, membranes, multi-component complexes, cells, cellular moieties, any fragments thereof, and any combination thereof.
  • the one or more binding sites binds to the same target. In some embodiments, the one or more binding sites bind to one or more binding moieties of the same target. In some embodiments, the one or more binding sites bind to one or more different targets. In some embodiments, the one or more binding sites bind to one or more binding moieties of different targets. In some embodiments, a circRNA acts as a scaffold for one or more binding one or more targets. In some embodiments, a circRNA acts as a scaffold for one or more binding moieties of one or more targets. In some embodiments, a circRNA modulates cellular processes by specifically binding to one or more one or more targets.
  • a circRNA modulates cellular processes by specifically binding to one or more binding moieties of one or more targets. In some embodiments, a circRNA modulates cellular processes by specifically binding to one or more targets. In some embodiments, a circRNA described herein includes binding sites for one or more specific targets of interest. In some embodiments, circRNA includes multiple binding sites or a combination of binding sites for each target of interest. In some embodiments, circRNA includes multiple binding sites or a combination of binding sites for each binding moiety of interest. For example, a circRNA can include one or more binding sites for a polypeptide target. In some embodiments, a circRNA includes one or more binding sites for a polynucleotide target, such as a DNA or RNA, an mRNA target, an rRNA target, a tRNA target, or a genomic DNA target.
  • a polynucleotide target such as a DNA or RNA, an mRNA target, an rRNA target, a tRNA target,
  • a circRNA comprises a binding site for a single-stranded DNA. In some instances, a circRNA comprises a binding site for double-stranded DNA. In some instances, a circRNA comprises a binding site for an antibody. In some instances, a circRNA comprises a binding site for a virus particle. In some instances, a circRNA comprises a binding site for a small molecule. In some instances, a circRNA comprises a binding site that binds in or on a cell. In some instances, a circRNA comprises a binding site for a RNA-DNA hybrid. In some instances, a circRNA comprises a binding site for a methylated polynucleotide.
  • a circRNA comprises a binding site for an unmethylated polynucleotide. In some instances, a circRNA comprises a binding site for an aptamer. In some instances, a circRNA comprises a binding site for a polypeptide. In some instances, a circRNA comprises a binding site for a polypeptide, a protein, a protein fragment, a tagged protein, an antibody, an antibody fragment, a small molecule, a virus particle (e.g., a virus particle comprising a transmembrane protein), or a cell. In some instances, a circRNA comprises a binding site for a binding moiety on a single-stranded DNA.
  • a circRNA comprises a binding site for a binding moiety on a double-stranded DNA. In some instances, a circRNA comprises a binding site for a binding moiety on an antibody. In some instances, a circRNA comprises a binding site for a binding moiety on a virus particle. In some instances, a circRNA comprises a binding site for a binding moiety on a small molecule. In some instances, a circRNA comprises a binding site for a binding moiety in or on a cell. In some instances, a circRNA comprises a binding site for a binding moiety on a RNA-DNA hybrid.
  • a circRNA comprises a binding site for a binding moiety on a methylated polynucleotide. In some instances, a circRNA comprises a binding site for a binding moiety on an unmethylated polynucleotide. In some instances, a circRNA comprises a binding site for a binding moiety on an aptamer. In some instances, a circRNA comprises a binding site for a binding moiety on a polypeptide.
  • a circRNA comprises a binding site for a binding moiety on a polypeptide, a protein, a protein fragment, a tagged protein, an antibody, an antibody fragment, a small molecule, a virus particle (e.g., a virus particle comprising a transmembrane protein), or a cell.
  • a virus particle e.g., a virus particle comprising a transmembrane protein
  • a binding site binds to a portion of a target comprising at least two amide bonds. In some instances, a binding site does not bind to a portion of a target comprising a phosphodiester linkage. In some instances, a portion of the target is not DNA or RNA. In some instances, a binding moiety comprises at least two amide bonds. In some instances, a binding moiety does not comprise a phosphodiester linkage. In some instances, a binding moiety is not DNA or RNA.
  • the circRNAs provided herein can include one or more binding sites for binding moieties on a complex.
  • the circRNAs provided herein can include one or more binding sites for targets to form a complex.
  • the circRNAs provided herein can act as a scaffold to form a complex between a circRNA and a target.
  • a circRNA forms a complex with a single target.
  • a circRNA forms a complex with two targets.
  • a circRNA forms a complex with three targets.
  • a circRNA forms a complex with four targets.
  • a circRNA forms a complex with five or more targets.
  • a circRNA forms a complex with a complex of two or more targets. In some embodiments, a circRNA forms a complex with a complex of three or more targets. In some embodiments, two or more circRNAs form a complex with a single target. In some embodiments, two or more circRNAs form a complex with two or more targets. In some embodiments, a first circRNA forms a complex with a first binding moiety of a first target and a second different binding moiety of a second target. In some embodiments, a first circRNA forms a complex with a first binding moiety of a first target and a second circRNA forms a complex with a second binding moiety of a second target.
  • a circRNA can include a binding site for one or more antibody- polypeptide complexes, polypeptide-polypeptide complexes, polypeptide-DNA complexes, polypeptide-RNA complexes, polypeptide-aptamer complexes, virus particle-antibody complexes, virus particle-polypeptide complexes, virus particle-DNA complexes, virus particle- RNA complexes, virus particle-aptamer complexes, cell-antibody complexes, cell-polypeptide complexes, cell-DNA complexes, cell-RNA complexes, cell-aptamer complexes, small molecule-polypeptide complexes, small molecule-DNA complexes, small molecule-aptamer complexes, small molecule-cell complexes, small molecule-virus particle complexes, and combinations thereof.
  • a circRNA can include a binding site for one or more binding moieties on one or more antibody-polypeptide complexes, polypeptide-polypeptide complexes, polypeptide-DNA complexes, polypeptide-RNA complexes, polypeptide-aptamer complexes, virus particle-antibody complexes, virus particle-polypeptide complexes, virus particle-DNA complexes, virus particle-RNA complexes, virus particle-aptamer complexes, cell-antibody complexes, cell-polypeptide complexes, cell-DNA complexes, cell-RNA complexes, cell- aptamer complexes, small molecule-polypeptide complexes, small molecule-DNA complexes, small molecule-aptamer complexes, small molecule-cell complexes, small molecule-virus particle complexes, and combinations thereof.
  • a binding site binds to a polypeptide, protein, or fragment thereof. In some embodiments, a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a polypeptide, protein, or fragment thereof of a target. For example, a binding site binds to a domain, a fragment, an epitope, a region, or a portion of an isolated polypeptide, a polypeptide of a cell, a purified polypeptide, or a recombinant polypeptide. For example, a binding site binds to a domain, a fragment, an epitope, a region, or a portion of an antibody or fragment thereof.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a transcription factor.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a receptor.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a transmembrane receptor.
  • Binding sites may bind to a domain, a fragment, an epitope, a region, or a portion of isolated, purified, and/or recombinant polypeptides.
  • Binding sites can bind to a domain, a fragment, an epitope, a region, or a portion of a mixture of analytes (e.g., a lysate).
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of from a plurality of cells or from a lysate of a single cell.
  • a binding site can bind to a binding moiety of a target.
  • a binding moiety is on a polypeptide, protein, or fragment thereof.
  • a binding moiety comprises a domain, a fragment, an epitope, a region, or a portion of a polypeptide, protein, or fragment thereof.
  • a binding moiety comprises a domain, a fragment, an epitope, a region, or a portion of an isolated polypeptide, a polypeptide of a cell, a purified polypeptide, or a recombinant polypeptide.
  • a binding moiety comprises a domain, a fragment, an epitope, a region, or a portion of an antibody or fragment thereof.
  • a binding moiety comprises a domain, a fragment, an epitope, a region, or a portion of a transcription factor.
  • a binding moiety comprises a domain, a fragment, an epitope, a region, or a portion of a receptor.
  • a binding moiety comprises a domain, a fragment, an epitope, a region, or a portion of a transmembrane receptor.
  • Binding moieties may be on or comprise a domain, a fragment, an epitope, a region, or a portion of isolated, purified, and/or recombinant polypeptides.
  • Binding moieties include binding moieties on or a domain, a fragment, an epitope, a region, or a portion of a mixture of analytes (e.g., a lysate).
  • binding moieties are on or comprise a domain, a fragment, an epitope, a region, or a portion of from a plurality of cells or from a lysate of a single cell.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a chemical compound (e.g., small molecule).
  • a binding binds to a domain, a fragment, an epitope, a region, or a portion of a drug.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a compound.
  • a binding moiety binds to a domain, a fragment, an epitope, a region, or a portion of an organic compound.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a small molecule with a molecular weight of 900 Daltons or less. In some instances, a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a small molecule with a molecular weight of 500 Daltons or more.
  • the portion the small molecule that the binding site binds to may be obtained, for example, from a library of naturally occurring or synthetic molecules, including a library of compounds produced through combinatorial means, i.e. a compound diversity combinatorial library. Combinatorial libraries, as well as methods for their production and screening, are known in the art and described in: US
  • a binding site can bind to a binding moiety of a small molecule.
  • a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a small molecule.
  • a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a drug.
  • a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a compound.
  • a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of an organic compound. In some instances, a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a small molecule with a molecular weight of 900 Daltons or less. In some instances, a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a small molecule with a molecular weight of 500 Daltons or more. Binding moieties may be obtained, for example, from a library of naturally occurring or synthetic molecules, including a library of compounds produced through combinatorial means, i.e.
  • Combinatorial libraries as well as methods for their production and screening, are known in the art and described in: US 5,741,713; 5,734,018; 5,731,423; 5,721,099; 5,708,153; 5,698,673; 5,688,997; 5,688,696; 5,684,711; 5,641,862; 5,639,603; 5,593,853; 5,574,656; 5,571,698; 5,565,324;
  • a binding site can bind to a domain, a fragment, an epitope, a region, or a portion of a member of a specific binding pair (e.g., a ligand).
  • a binding site can bind to a domain, a fragment, an epitope, a region, or a portion of monovalent (monoepitopic) or polyvalent
  • a binding site can bind to an antigenic or haptenic portion of a target.
  • a binding site can bind to a domain, a fragment, an epitope, a region, or a portion of a single molecule or a plurality of molecules that share at least one common epitope or determinant site.
  • a binding site can bind to a domain, a fragment, an epitope, a region, or a portion of a part of a cell (e.g., a bacteria cell, a plant cell, or an animal cell).
  • a binding site can bind to a target that is in a natural environment (e.g., tissue), a cultured cell, or a microorganism (e.g., a bacterium, fungus, protozoan, or virus), or a lysed cell.
  • a binding site can bind to a portion of a target that is modified (e.g., chemically), to provide one or more additional binding sites such as, but not limited to, a dye (e.g., a fluorescent dye), a polypeptide modifying moiety such as a phosphate group, a carbohydrate group, and the like, or a polynucleotide modifying moiety such as a methyl group.
  • a binding site can bind to a binding moiety of a member of a specific binding pair.
  • a binding moiety can be on or comprise a domain, a fragment, an epitope, a region, or a portion of a member of a specific binding pair (e.g., a ligand).
  • a binding moiety can be on or comprise a domain, a fragment, an epitope, a region, or a portion of monovalent (monoepitopic) or polyvalent (polyepitopic).
  • a binding moiety can be antigenic or haptenic.
  • a binding moiety can be on or comprise a domain, a fragment, an epitope, a region, or a portion of a single molecule or a plurality of molecules that share at least one common epitope or determinant site.
  • a binding moiety can be on or comprise a domain, a fragment, an epitope, a region, or a portion of a part of a cell (e.g., a bacteria cell, a plant cell, or an animal cell).
  • a binding moiety can be either in a natural environment (e.g., tissue), a cultured cell, or a microorganism (e.g., a bacterium, fungus, protozoan, or virus), or a lysed cell.
  • a binding moiety can be modified (e.g., chemically), to provide one or more additional binding sites such as, but not limited to, a dye (e.g., a fluorescent dye), a polypeptide modifying moiety such as a phosphate group, a carbohydrate group, and the like, or a polynucleotide modifying moiety such as a methyl group.
  • a dye e.g., a fluorescent dye
  • polypeptide modifying moiety such as a phosphate group, a carbohydrate group, and the like
  • a polynucleotide modifying moiety such as a methyl group.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a molecule found in a sample from a host.
  • a binding site can bind to a binding moeity of a molecule found in a sample from a host.
  • a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a molecule found in a sample from a host.
  • a sample from a host includes a body fluid (e.g., urine, blood, plasma, serum, saliva, semen, stool, sputum, cerebral spinal fluid, tears, mucus, and the like).
  • a sample can be examined directly or may be pretreated to render a binding moiety more readily detectible.
  • Samples include a quantity of a substance from a living thing or formerly living things.
  • a sample can be natural, recombinant, synthetic, or not naturally occurring.
  • a binding site can bind to any of the above that is expressed from a cell naturally or recombinantly, in a cell lysate or cell culture medium, an in vitro translated sample, or an immunoprecipitation from a sample (e.g., a cell lysate).
  • a binding moiety can be any of the above that is expressed from a cell naturally or recombinantly, in a cell lysate or cell culture medium, an in vitro translated sample, or an immunoprecipitation from a sample (e.g., a cell lysate).
  • a binding site binds to a target expressed in a cell-free system or in vitro.
  • a binding site binds to a target in a cell extract.
  • a binding site binds to a target in a cell extract with a DNA template, and reagents for transcription and translation.
  • a binding site can bind to a binding moiety of a a target expressed in a cell-free system or in vitro.
  • a binding moiety of a target is expressed in a cell-free system or in vitro.
  • a binding moiety of a target is in a cell extract.
  • a binding moiety of a target is in a cell extract with a DNA template, and reagents for transcription and translation.
  • exemplary sources of cell extracts that can be used include wheat germ, Escherichia coli , rabbit reticulocyte, hyperthermophiles, hybridomas, Xenopus oocytes, insect cells, and mammalian cells (e.g., human cells).
  • Exemplary cell-free methods that can be used to express target polypeptides (e.g., to produce target polypeptides on an array) include Protein in situ arrays (PISA), Multiple spotting technique (MIST), Self-assembled mRNA translation, Nucleic acid programmable protein array (NAPPA), nanowell NAPPA, DNA array to protein array (DAP A), membrane-free DAP A, nanowell copying and mIR-microintaglio printing, and pMAC-protein microarray copying ( See Kilb et al., Eng. Life Sci. 2014, 14, 352- 364).
  • PISA Protein in situ arrays
  • MIST Multiple spotting technique
  • NAPPA Nucleic acid programmable protein array
  • DAP A DNA array to protein array
  • membrane-free DAP A membrane-free DAP A
  • nanowell copying and mIR-microintaglio printing See Kilb et al., Eng. Life Sci. 2014, 14, 352- 364
  • a binding site binds to a target that is synthesized in situ (e.g, on a solid substrate of an array) from a DNA template.
  • a binding site can bind to binding moiety of a target that is synthesized in situ.
  • a binding moiety of a target is synthesized in situ (e.g, on a solid substrate of an array) from a DNA template.
  • a plurality of binding moieties is synthesized in situ from a plurality of corresponding DNA templates in parallel or in a single reaction.
  • Exemplary methods for in situ target polypeptide expression include those described in Stevens, Structure 8(9): R177-R185 (2000); Katzen et al., Trends Biotechnol. 23(3): 150-6. (2005); H e et al., Curr. Opin. Biotechnol. l9(l):4— 9. (2008);
  • a binding site binds to a nucleic acid target comprising a span of at least 6 nucleotides, for example, least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 nucleotides. In some instances, a binding site binds to a protein target comprising a contiguous stretch of nucleotides. In some instances, a binding site binds to a protein target comprising a non contiguous stretch of nucleotides. In some instances, a binding site binds to a nucleic acid target comprising a site of a mutation or functional mutation, including a deletion, addition, swap, or truncation of the nucleotides in a nucleic acid sequence.
  • a binding site can bind to a binding moiety of a nucleic acid target.
  • a binding moiety of a nucleic acid target comprises a span of at least 6 nucleotides, for example, least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 nucleotides.
  • a binding moiety of a protein target comprises a contiguous stretch of nucleotides.
  • a binding moiety of a protein target comprises a non-contiguous stretch of nucleotides.
  • a binding moiety of a nucleic acid target comprises a site of a mutation or functional mutation, including a deletion, addition, swap, or truncation of the nucleotides in a nucleic acid sequence.
  • a binding site binds to a protein target comprising a span of at least 6 amino acids, for example, least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 amino acids. In some instances, a binding site binds to a protein target comprising a contiguous stretch of amino acids. In some instances, a binding site binds to a protein target comprising a non-contiguous stretch of amino acids. In some instances, a binding site binds to a protein target comprising a site of a mutation or functional mutation, including a deletion, addition, swap, or truncation of the amino acids in a polypeptide sequence. A binding site can bind to a binding moiety of a protein target.
  • a binding moiety of a protein target comprises a span of at least 6 amino acids, for example, least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 amino acids.
  • a binding moiety of a protein target comprises a contiguous stretch of amino acids.
  • a binding moiety of a protein target comprises a non-contiguous stretch of amino acids.
  • a binding moiety of a protein target comprises a site of a mutation or functional mutation, including a deletion, addition, swap, or truncation of the amino acids in a polypeptide sequence.
  • a binding site binds to a domain, a fragment, an epitope, a region, or a portion of a membrane bound protein.
  • a binding site can bind to a binding moiety of a membrane bound protein.
  • a binding moiety is on or comprises a domain, a fragment, an epitope, a region, or a portion of a membrane bound protein.
  • Exemplary membrane bound proteins include, but are not limited to, GPCRs (e.g., adrenergic receptors, angiotensin receptors, cholecystokinin receptors, muscarinic acetylcholine receptors, neurotensin receptors, galanin receptors, dopamine receptors, opioid receptors, erotonin receptors, somatostatin receptors, etc.), ion channels (e.g., nicotinic acetylcholine receptors, sodium channels, potassium channels, etc.), non-excitable and excitable channels, receptor tyrosine kinases, receptor serine/threonine kinases, receptor guanylate cyclases, growth factor and hormone receptors (e.g., epidermal growth factor (EGF) receptor), and others.
  • GPCRs e.g., adrenergic receptors, angiotensin receptors, cholecystokinin receptors
  • the binding site can bind to a domain, a fragment, an epitope, a region, or a portion of a mutant or modified variants of membrane-bound proteins.
  • the binding site can bind to a binding moiety of a mutant or modified variant of membrane-bound protein.
  • the binding moiety may also be on or comprise a domain, a fragment, an epitope, a region, or a portion of a mutant or modified variants of membrane-bound proteins.
  • some single or multiple point mutations of GPCRs retain function and are involved in disease (See, e.g., Stadel et al, (1997) Trends in Pharmacological Review 18:430-37).
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of a ubiquitin ligase.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of a ubiquitin adaptor, proteasome adaptor, or proteasome protein.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of a protein involved in endocytosis, phagocytosis, a lysosomal pathway, an autophagic pathway, macroautophagy, microautophagy, chaperone-mediated autophagy, the multi vesicular body pathway, or a combination thereof.
  • the binding site binds to a binding moiety.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of a ubiquitin ligase.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of a ubiquitin adaptor, proteasome adaptor, or proteasome protein.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of a protein involved in endocytosis, phagocytosis, a lysosomal pathway, an autophagic pathway, macroautophagy, microautophagy, chaperone-mediated autophagy, the multivesicular body pathway, or a combination thereof.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of a protein associated with a disease or condition.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of a proto-oncogene.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of an oncogene.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of a tumor suppressor gene.
  • a binding site binds to, for example, a domain, a fragment, an epitope, a region, or a portion of an inflammatory gene (e.g., a cytokine).
  • a binding site can bind to a binding moiety.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of a protein associated with a disease or condition.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of a proto- oncogene.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of an oncogene.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of a tumor suppressor gene.
  • a binding moiety can comprise, for example, a domain, a fragment, an epitope, a region, or a portion of an
  • inflammatory gene e.g., a cytokine
  • FIG. 1 shows an example of a circular polyribonucleotide with a sequence-specific RNA-binding motif, sequence-specific DNA-binding motif, and protein-specific binding motif.
  • circRNA can include other binding motifs for binding other intracellular molecules. Non-limiting examples of circRNA applications are listed in TABLE 1.
  • the circular polyribonucleotide comprises one or more RNA binding sites. In some embodiments, the circular polyribonucleotide includes RNA binding sites that modify expression of an endogenous gene and/or an exogenous gene. In some
  • the RNA binding site modulates expression of a host gene.
  • the RNA binding site can include a sequence that hybridizes to an endogenous gene (e.g., a sequence for a miRNA, siRNA, mRNA, lncRNA, RNA, DNA, an antisense RNA, gRNA as described herein), a sequence that hybridizes to an exogenous nucleic acid such as a viral DNA or RNA, a sequence that hybridizes to an RNA, a sequence that interferes with gene transcription, a sequence that interferes with RNA translation, a sequence that stabilizes RNA or destabilizes RNA such as through targeting for degradation, or a sequence that modulates a DNA- or RNA-binding factor.
  • an endogenous gene e.g., a sequence for a miRNA, siRNA, mRNA, lncRNA, RNA, DNA, an antisense RNA, gRNA as described herein
  • an exogenous nucleic acid such as a viral DNA
  • the circular polyribonucleotide comprises an aptamer sequence that binds to an RNA.
  • the aptamer sequence can bind to an endogenous gene (e.g., a sequence for a miRNA, siRNA, mRNA, lncRNA, RNA, DNA, an antisense RNA, gRNA as described herein), to an exogenous nucleic acid such as a viral DNA or RNA, to an RNA, to a sequence that interferes with gene transcription, to a sequence that interferes with RNA translation, to a sequence that stabilizes RNA or destabilizes RNA such as through targeting for degradation, or to a sequence that modulates a DNA- or RNA-binding factor.
  • an endogenous gene e.g., a sequence for a miRNA, siRNA, mRNA, lncRNA, RNA, DNA, an antisense RNA, gRNA as described herein
  • an exogenous nucleic acid such as a viral DNA or RNA
  • the secondary structure of the aptamer sequence can bind to the RNA.
  • the circular RNA can form a complex with the RNA by binding of the aptamer sequence to the RNA.
  • the RNA binding site can be one of a tRNA, lncRNA, lincRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA binding site.
  • RNA binding sites are well-known to persons of ordinary skill in the art.
  • RNA binding sites can inhibit gene expression through the biological process of RNA interference (RNAi).
  • the circular polyribonucleotides comprises an RNAi molecule with RNA or RNA-like structures typically having 15-50 base pairs (such as aboutl8-25 base pairs) and having a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell.
  • RNAi molecules include, but are not limited to: short interfering RNA (siRNA), double- strand RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), meroduplexes, and dicer substrates.
  • the RNA binding site comprises an siRNA or an shRNA.
  • siRNA and shRNA resemble intermediates in the processing pathway of the endogenous miRNA genes.
  • siRNA can function as miRNA and vice versa.
  • MicroRNA like siRNA, can use RISC to downregulate target genes, but unlike siRNA, most animal miRNA do not cleave the mRNA. Instead, miRNA reduce protein output through translational suppression or poly A removal and mRNA degradation.
  • Known miRNA binding sites are within mRNA 3’- UTRs; miRNA seem to target sites with near-perfect complementarity to nucleotides 2-8 from the miRNA’ s 5’ end. This region is known as the seed region. Because siRNA and miRNA are interchangeable, exogenous siRNA can downregulate mRNA with seed complementarity to the siRNA. Multiple target sites within a 3’-UTR can give stronger downregulation.
  • MicroRNA are short noncoding RNA that bind to the 3’-UTR of nucleic acid molecules and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.
  • the circular polyribonucleotide can comprise one or more miRNA target sequences, miRNA sequences, or miRNA seeds. Such sequences can correspond to any miRNA.
  • a miRNA sequence comprises a“seed” region, i.e., a sequence in the region of positions 2-8 of the mature miRNA, which sequence has Watson-Crick complementarity to the miRNA target sequence.
  • a miRNA seed can comprise positions 2-8 or 2-7 of the mature miRNA.
  • a miRNA seed can comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to miRNA position 1.
  • a miRNA seed can comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), wherein the seed- complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to miRNA at position 1.
  • A adenine
  • the bases of the miRNA seed can be substantially complementary with the target sequence.
  • the circular polyribonucleotide can evade or be detected by the host’s immune system, have modulated degradation, or modulated translation. This process can reduce the hazard of off target effects upon circular polyribonucleotide delivery.
  • the circular polyribonucleotide can include an miRNA sequence identical to about 5 to about 25 contiguous nucleotides of a target gene.
  • the miRNA sequence targets a mRNA and commences with the dinucleotide AA, comprises a GC-content of about 30%-70%, about 30%-60%, about 40%-60%, or about 45%-55%, and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the mammal in which it is to be introduced, for example, as determined by standard BLAST search.
  • miRNA binding sites can be engineered out of (i.e., removed from) the circular polyribonucleotide to modulate protein expression in specific tissues. Regulation of expression in multiple tissues can be accomplished through introduction or removal or one or several miRNA binding sites.
  • tissues where miRNA are known to regulate mRNA, and thereby protein expression include, but are not limited to, liver (miR-l22), muscle (miR-l33, miR-206, miR- 208), endothelial cells (miR-l7-92, miR-l26), myeloid cells (miR-l42-3p, miR-l42-5p, miR-l6, miR-2l, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-l49), kidney (miR-l92, miR-l94, miR-204), and lung epithelial cells (let-7, miR-l33, miR-l26).
  • liver miR-l22
  • muscle miR-l33, miR-206, miR- 208
  • endothelial cells miR-l7-92, miR-l26
  • myeloid cells miR-l42-3p, mi
  • MiRNA can also regulate complex biological processes, such as angiogenesis (miR-l32).
  • binding sites for miRNA that are involved in such processes can be removed or introduced, in order to tailor the expression from the circular polyribonucleotide to biologically relevant cell types or to the context of relevant biological processes.
  • the miRNA binding site includes, e.g., miR-7.
  • the circular polyribonucleotide described herein can be engineered for more targeted expression in specific cell types or only under specific biological conditions.
  • the circular polyribonucleotide can be designed for optimal protein expression in a tissue or in the context of a biological condition.
  • miRNA seed sites can be incorporated into the circular polyribonucleotide to modulate expression in certain cells which results in a biological improvement.
  • An example of this is incorporation of miR-l42 sites.
  • Incorporation of miR-l42 sites into the circular polyribonucleotide described herein can modulate expression in hematopoietic cells, but also reduce or abolish immune responses to a protein encoded in the circular polyribonucleotide.
  • the circular polyribonucleotide comprises at least one miRNA, e.g., 2, 3, 4, 5, 6, or more. In some embodiments, the circular polyribonucleotide comprises an miRNA having at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% nucleotide sequence identity to any one of the nucleotide sequences or a sequence that is complementary to a target sequence.
  • RNAi molecules can be readily designed and produced by technologies known in the art.
  • computational tools can be used to determine effective and specific sequence motifs.
  • a circular polyribonucleotide comprises a long non-coding RNA.
  • Long non-coding RNA include non-protein coding transcripts longer than
  • lncRNA 100 nucleotides. The longer length distinguishes lncRNA from small regulatory RNA, such as miRNA, siRNA, and other short RNA. In general, the majority (-78%) of lncRNA are characterized as tissue-specific. Divergent lncRNA that are transcribed in the opposite direction to nearby protein-coding genes (comprise a significant proportion -20% of total lncRNA in mammalian genomes) can regulate the transcription of the nearby gene.
  • the length of the RNA binding site may be between about 5 to 30 nucleotides, between about 10 to 30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides.
  • the degree of identity of the RNA binding site to a target of interest can be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.
  • the circular polyribonucleotide includes one or more large intergenic non-coding RNA (lincRNA) binding sites.
  • LincRNA make up most of the long non coding RNA.
  • LincRNA are non-coding transcripts and, in some embodiments, are more than about 200 nucleotides long.
  • lincRNA have an exon-intron-exon structure, similar to protein-coding genes, but do not encompass open-reading frames and do not code for proteins. LincRNA expression can be strikingly tissue-specific compared to coding genes.
  • LincRNA are typically co-expressed with their neighboring genes to a similar extent to that of pairs of neighboring protein-coding genes.
  • polyribonucleotide comprises a circularized lincRNA.
  • the circular polyribonucleotides disclosed herein include one or more lincRNA, for example, FIRRE, LINC00969, PVT1, LINC01608, JPX, LINC01572, LINC00355, Clorfl32, C3orf35, RP11-734, LINC01608, CC-499B15.5, CASC15, LINC00937, and RP11-191.
  • lincRNA for example, FIRRE, LINC00969, PVT1, LINC01608, JPX, LINC01572, LINC00355, Clorfl32, C3orf35, RP11-734, LINC01608, CC-499B15.5, CASC15, LINC00937, and RP11-191.
  • LincRNA and lncRNA molecules can be readily designed and produced by technologies known in the art.
  • computational tools can be used to determine effective and specific sequence motifs.
  • the RNA binding site can comprise a sequence that is substantially complementary, or fully complementary, to all or a fragment of an endogenous gene or gene product (e.g., mRNA).
  • the complementary sequence can complement sequences at the boundary between introns and exons to prevent the maturation of newly-generated nuclear RNA transcripts of specific genes into mRNA for transcription.
  • the complementary sequence may be specific to genes by hybridizing with the mRNA for that gene and prevent its translation.
  • the RNA binding site can comprise a sequence that is antisense or substantially antisense to all or a fragment of an endogenous gene or gene product, such as DNA, RNA, or a derivative or hybrid thereof.
  • the circular polyribonucleotide comprises a RNA binding site that has an RNA or RNA-like structure typically between about 5-5000 base pairs (depending on the specific RNA structure, e.g., miRNA 5-30 bps, lncRNA 200-500 bps) and has a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell.
  • the circular polyribonucleotide comprises a DNA binding site, such as a sequence for a guide RNA (gRNA).
  • gRNA guide RNA
  • polyribonucleotide comprises a guide RNA or a complement to a gRNA sequence.
  • Guide RNA sequences can have a length of between 17 - 24 nucleotides (e.g., 19, 20, or 21 nucleotides) and complementary to the targeted nucleic acid sequence.
  • Custom gRNA generators and algorithms can be used in the design of effective guide RNA.
  • Gene editing can be achieved using a chimeric“single guide RNA” (“sgRNA”), an engineered (synthetic) single RNA molecule that mimics a naturally occurring crRNA-tracrRNA complex and contains both a tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing).
  • sgRNA chimeric“single guide RNA”
  • Chemically modified sgRNA can be effective in genome editing.
  • the gRNA can recognize specific DNA sequences (e.g., sequences adjacent to or within a promoter, enhancer, silencer, or repressor of a gene).
  • the gRNA is part of a CRISPR system for gene editing.
  • the circular polyribonucleotide can be designed to include one or multiple guide RNA sequences corresponding to a desired target DNA sequence.
  • the gRNA sequences may include at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides for interaction with Cas9 or other exonuclease to cleave DNA, e.g., Cpfl interacts with at least about 16 nucleotides of gRNA sequence for detectable DNA cleavage.
  • the circular polyribonucleotide comprises an aptamer sequence that can bind to DNA.
  • the secondary structure of the aptamer sequence can bind to DNA.
  • the circular polyribonucleotide forms a complex with the DNA by binding of the aptamer sequence to the DNA.
  • the circular polyribonucleotide includes sequences that bind a major groove of in duplex DNA.
  • the specificity and stability of a triplex structure created by the circular polyribonucleotide and duplex DNA is afforded via Hoogsteen hydrogen bonds, which are different from those formed in classical Watson-Crick base pairing in duplex DNA.
  • the circular polyribonucleotide binds to the purine-rich strand of a target duplex through the major groove.
  • triplex formation occurs in two motifs, distinguished by the orientation of the circular polyribonucleotide with respect to the purine-rich strand of the target duplex.
  • polypyrimidine sequence stretches in a circular polyribonucleotides bind to the polypurine sequence stretches of a duplex DNA via Hoogsteen hydrogen bonding in a parallel fashion (i.e., in the same 5’ to 3’, orientation as the purine-rich strand of the duplex), whereas the polypurine stretches (R) bind in an antiparallel fashion to the purine strand of the duplex via reverse-Hoogsteen hydrogen bonds.
  • a purine motif comprises triplets of G:G-C, A:A-T, or T:A-T; whereas in the parallel, a pyrimidine motif comprises canonical triples of C+:G-C or T:A-T triplets (where C+ represents a protonated cytosine on the N3 position).
  • Antiparallel GA and GT sequences in a circular polyribonucleotide may form stable triplexes at neutral pH, while parallel CT sequences in a circular polyribonucleotide may bind at acidic pH. N3 on cytosine in the circular polyribonucleotide may be protonated.
  • Substitution of C with 5-methyl-C may permit binding of CT sequences in the circular polyribonucleotide at physiological pH as 5-methyl-C has a higher pK than does cytosine.
  • contiguous homopurine-homopyrimidine sequence stretches of at least 10 base pairs aid circular polyribonucleotide binding to duplex DNA, since shorter triplexes may be unstable under physiological conditions, and interruptions in sequences can destabilize the triplex structure.
  • the DNA duplex target for triplex formation includes consecutive purine bases in one strand.
  • a target for triplex formation comprises a homopurine sequence in one strand of the DNA duplex and a homopyrimidine sequence in the complementary strand.
  • a triplex comprising a circular polyribonucleotide is a stable structure.
  • a triplex comprising a circular polyribonucleotide exhibits an increased half-life, e.g., increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or greater, e.g., persistence for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days,
  • the circular polyribonucleotide includes one or more protein binding sites.
  • a protein binding site comprises an aptamer sequence.
  • the circular polyribonucleotide includes a protein binding site to reduce an immune response from the host as compared to the response triggered by a reference compound, e.g., a circular polyribonucleotide lacking the protein binding site, e.g., linear RNA.
  • circular polyribonucleotides disclosed herein include one or more protein binding sites to bind a protein, e.g., a ribosome.
  • a protein e.g., a ribosome.
  • the circular polyribonucleotide can evade or have reduced detection by the host’s immune system, have modulated degradation, or modulated translation.
  • the circular polyribonucleotide comprises at least one
  • the immunoprotein binding site is a nucleotide sequence that binds to an immunoprotein and aids in masking the circular polyribonucleotide as non-endogenous.
  • RNA binding to the capped 5’ end of an RNA From the 5’ end, the ribosome migrates to an initiation codon, whereupon the first peptide bond is formed.
  • internal initiation (i.e., cap-independent) or translation of the circular polyribonucleotide does not require a free end or a capped end. Rather, a ribosome binds to a non-capped internal site, whereby the ribosome begins polypeptide elongation at an initiation codon.
  • the circular polyribonucleotide includes one or more RNA sequences comprising a ribosome binding site, e.g., an initiation codon.
  • circular polyribonucleotides disclosed herein comprise a protein binding sequence that binds to a protein.
  • the protein binding sequence targets or localizes a circular polyribonucleotide to a specific target.
  • the protein binding sequence specifically binds an arginine-rich region of a protein.
  • circular polyribonucleotides disclosed herein include one or more protein binding sites that each bind a target protein, e.g., acting as a scaffold to bring two or more proteins in close proximity.
  • circular polynucleotides disclosed herein comprise two protein binding sites that each bind a target protein, thereby bringing the target proteins into close proximity.
  • circular polynucleotides disclosed herein comprise three protein binding sites that each bind a target protein, thereby bringing the three target proteins into close proximity.
  • circular polynucleotides disclosed herein comprise four protein binding sites that each bind a target protein, thereby bringing the four target proteins into close proximity.
  • polynucleotides disclosed herein comprise five or more protein binding sites that each bind a target protein, thereby bringing five or more target proteins into close proximity.
  • the target proteins are the same.
  • the target proteins are different.
  • bringing target proteins into close proximity promotes formation of a protein complex.
  • a circular polyribonucleotide of the disclosure can act as a scaffold to promote the formation of a complex comprising one, two, three, four, five, six, seven, eight, nine, or ten target proteins, or more.
  • bringing two or more target proteins into close proximity promotes interaction of the two or more target proteins.
  • bringing two or more target proteins into close proximity modulates, promotes, or inhibits of an enzymatic rection. In some embodiments, bringing two or more target proteins into close proximity modulates, promotes, or inhibits a signal transduction pathway.
  • the protein binding site includes, but is not limited to, a binding site to the protein, such as ACIN1, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, EIF4G2, ELAVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMR1, FUS, FXR1, FXR2, GNL3, GTF2F1, HNRNPA1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPL, HNRNPM, HNRNPU, HNRNPUL1, IGF2BP1, IGF2BP2, IGF2BP3, ILF3, KHDRBS1, LARP
  • a protein binding site is a nucleic acid sequence that binds to a protein, e.g., a sequence that can bind a transcription factor, enhancer, repressor, polymerase, nuclease, histone, or any other protein that binds DNA.
  • a protein binding site is an aptamer sequence that binds to a protein.
  • the secondary structure of the aptamer sequence binds the protein.
  • the circular RNA forms a complex with the protein by binding of the aptamer sequence to the protein.
  • a circular RNA is conjugated to a small molecule or a part thereof, wherein the small molecule or part thereof binds to a target such as a protein.
  • a small molecule can be conjugated to a circular RNA via a modified nucleotide, e.g., by click chemistry.
  • small molecules that can bind to proteins include, but are not limited to 4-hydroxytamoxifen (4-OHT), AC220, Afatinib , an aminopyrazole analog, an AR antagonist, BI-7273, Bosutinib, Ceritinib, Chloroalkane, Dasatinib, Foretinib, Gefitinib, a HIF- la-derived (R)-hydroxyproline, HJB97, a hydroxyproline-based ligand, IACS-7e, Ibrutinib, an ibrutinib derivative, JQ1, Lapatinib, an LCL161 derivative, Lenalidomide, a nutlin small molecule, OTX015, a PDE4 inhibitor, Pomalidomide, a ripk2 inhibitor, RN486, Sirt2 inhibitor 3b, SNS- 032, Steel factor, a TBK1 inhibitor, Thalidomide, a thalidomide derivative, a Thia
  • a circular RNA is conjugated to more than one small molecule, for instance, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more small molecules.
  • a circular RNA is conjugated to more than one different small molecules, for instance, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different small molecules.
  • the more than one small molecule conjugated to the circular RNA are configured to recruit their respective target proteins into proximity, which can lead to interaction between the target proteins, and/or other molecular and cellular changes.
  • a circular RNA can be conjugated to both JQ1 and thalidomide, or derivative thereof, which can thus recruit a target protein of JQ1, e.g., BET family proteins, and a target protein of thalidomide, e.g., E3 ligase.
  • the circular RNA conjugated with JQ1 and thalidomide recruits a BET family protein via JQ1, or derivative thereof, tags the BET family protein with ubiquitin by E3 ligase that is recruited through thalidomide or derivative thereof, and thus leads to degradation of the tagged BET family protein.
  • the circular polyribonucleotide comprises one or more binding sites to a non-RNA or non-DNA target.
  • the binding site can be one of a small molecule, an aptamer, a lipid, a carbohydrate, a virus particle, a membrane, a multi- component complex, a cell, a cellular moiety, or any fragment thereof binding site.
  • the circular polyribonucleotide comprises one or more binding sites to a lipid.
  • the circular polyribonucleotide comprises one or more binding sites to a carbohydrate.
  • the circular polyribonucleotide comprises one or more binding sites to a carbohydrate.
  • the circular polyribonucleotide comprises one or more binding sites to a membrane. In some embodiments, the circular polyribonucleotide comprises one or more binding sites to a multi-component complex, e.g., ribosome, nucleosome, transcription machinery, etc.
  • a multi-component complex e.g., ribosome, nucleosome, transcription machinery, etc.
  • the circular polyribonucleotide comprises an aptamer sequence.
  • the aptamer sequence can bind to any target as described herein (e.g., a nucleic acid molecule, a small molecule, a protein, a carbohydrate, a lipid, etc.).
  • the aptamer sequence has a secondary structure that can bind the target.
  • the aptamer sequence has a tertiary structure that can bind the target.
  • the aptamer sequence has a quaternary structure that can bind the target.
  • the circular polyribonucleotide can bind to the target via the aptamer sequence to form a complex.
  • the complex is detectable for at least 5 days. In some embodiments, the complex is detectable for at least 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days.
  • circRNA described herein sequesters a target, e.g., DNA, RNA, proteins, and other cellular components to regulate cellular processes. CircRNA with binding sites for a target of interest can compete with binding of the target with an endogenous binding partner.
  • circRNA described herein sequesters miRNA.
  • circRNA described herein sequesters mRNA.
  • circRNA described herein sequesters proteins.
  • circRNA described herein sequesters non-coding RNA, lncRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA.
  • circRNA described herein includes a degradation element that degrades a sequestered target, e.g., DNA, RNA, protein, or other cellular componentbound to the circRNA.
  • a sequestered target e.g., DNA, RNA, protein, or other cellular componentbound to the circRNA.
  • any of the methods of using circRNA described herein can be in combination with a translating element.
  • CircRNA described herein that contain a translating element can translate RNA into proteins.
  • FIG. 3 illustrates a schematic of protein expression facilitated by a circRNA containing a sequence-specific RNA-binding motif, sequence-specific DNA-binding motif, protein-specific binding motif (Protein 1), and regulatory RNA motif (RNA 1).
  • the regulatory RNA motif can initiate RNA transcription and protein expression.
  • a circRNA as disclosed herein can comprise an encryptogen.
  • the encryptogen comprises untranslated regions (UTRs).
  • UTRs of a gene can be transcribed but not translated.
  • a UTR can be included upstream of the translation initiation sequence of an expression sequence described herein.
  • a UTR can be included downstream of an expression sequence described herein.
  • one UTR for first expression sequence is the same as or continuous with or overlapping with another UTR for a second expression sequence.
  • the intron is a human intron. In some embodiments, the intron is a full length human intron, e.g., ZKSCAN1.
  • the encryptogen enhances stability.
  • the regulatory features of a UTR can be included in the encryptogen to enhance the stability of the circular polyribonucleotide.
  • the circular polyribonucleotide comprises a UTR with one or more stretches of adenosines and uridines embedded within.
  • AU-rich signatures can increase turnover rates of the expression product.
  • UTR AU-rich elements can be useful to modulate the stability or immunogenicity of the circular polyribonucleotide.
  • AREs UTR AU-rich elements
  • one or more copies of an ARE can be introduced to destabilize the circular polyribonucleotide and the copies of an ARE can decrease translation and/or decrease production of an expression product.
  • AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.
  • a ETTR from any gene can be incorporated into the respective flanking regions of the circular polyribonucleotide.
  • multiple wild-type ETTRs of any known gene can be utilized.
  • artificial UTRs that are not variants of wild type genes can be used. These UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence a 5’- or 3’- UTR can be inverted, shortened, lengthened, or made chimeric with one or more other 5’- or 3’- UTRs.
  • the term“altered” as it relates to a UTR sequence means that the UTR has been changed in some way in relation to a reference sequence.
  • a 3’- or 5’-UTR can be altered relative to a wild type or native UTR by the change in orientation or location as taught above or can be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an“altered” UTR (whether 3’ or 5’) comprise a variant UTR.
  • a double UTR, triple UTR, or quadruple UTR such as a 5’- or 3’- UTR
  • a“double” UTR is one in which two copies of the same UTR are encoded either in series or substantially in series.
  • a double beta-globin 3’-UTR can be used in some embodiments of the invention.
  • a circular polyribonucleotide can comprise an encryptogen to reduce, evade, or avoid the innate immune response of a cell.
  • circular polyribonucleotides provided herein result in a reduced immune response from the host as compared to the response triggered by a reference compound, e.g., a linear polynucleotide corresponding to the described circular polyribonucleotide or a circular polyribonucleotide lacking an encryptogen.
  • the circular polyribonucleotide has less immunogenicity than a counterpart lacking an encryptogen.
  • the circular polyribonucleotide is non-immunogenic in a mammal, e.g., a human. In some embodiments, the circular polyribonucleotide is capable of replicating in a mammalian cell, e.g., a human cell.
  • the circular polyribonucleotide includes sequences or expression products. [0177] In some embodiments, the circular polyribonucleotide has a half-life of at least that of a linear counterpart, e.g., linear expression sequence, or linear circular polyribonucleotide. In some embodiments, the circular polyribonucleotide has a half-life that is increased over that of a linear counterpart. In some embodiments, the half-life is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or greater.
  • the circular polyribonucleotide has a half-life or persistence in a cell for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or longer or any time there between.
  • the circular polyribonucleotide has a half-life or persistence in a cell for no more than about 10 mins to about 7 days, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between.
  • the circular polyribonucleotide modulates a cellular function, e.g., transiently or long term.
  • the cellular function is stably altered, such as a modulation that persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or longer or any time there between.
  • the cellular function is transiently altered, e.g., such as a modulation that persists for no more than about 30 mins to about 7 days, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between.
  • a modulation that persists for no more than about 30 mins to about 7 days, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs,
  • the circular polyribonucleotide is at least about 20 base pairs, at least about 30 base pairs, at least about 40 base pairs, at least about 50 base pairs, at least about 75 base pairs, at least about 100 base pairs, at least about 200 base pairs, at least about 300 base pairs, at least about 400 base pairs, at least about 500 base pairs, or at least about 1,000 base pairs.
  • the circular polyribonucleotide can be of a sufficient size to accommodate a binding site for a ribosome.
  • the maximum size of a circular polyribonucleotide can be as large as is within the technical constraints of producing a circular polyribonucleotide, and/or using the circular
  • RNA polyribonucleotide While not being bound by theory, it is possible that multiple segments of RNA can be produced from DNA and their 5’ and 3’ free ends annealed to produce a“string” of RNA, which ultimately can be circularized when only one 5’ and one 3’ free end remains.
  • the maximum size of a circular polyribonucleotide can be limited by the ability of packaging and delivering the RNA to a target.
  • the size of a circular polyribonucleotide is a length sufficient to encode useful polypeptides, and thus, lengths of less than about 20,000 base pairs, less than about 15,000 base pairs, less than about 10,000 base pairs, less than about 7,500 base pairs, or less than about 5,000 base pairs, less than about 4,000 base pairs, less than about 3,000 base pairs, less than about 2,000 base pairs, less than about 1,000 base pairs, less than about 500 base pairs, less than about 400 base pairs, less than about 300 base pairs, less than about 200 base pairs, less than about 100 base pairs can be useful.
  • the circular polyribonucleotide includes at least one cleavage sequence.
  • the cleavage sequence is adjacent to an expression sequence.
  • the circular polyribonucleotide includes a cleavage sequence, such as in an immolating circRNA or cleavable circRNA or self-cleaving circRNA.
  • the circular polyribonucleotide comprises two or more cleavage sequences, leading to separation of the circular polyribonucleotide into multiple products, e.g., miRNAs, linear RNAs, smaller circular polyribonucleotide, etc.
  • the cleavage sequence includes a ribozyme RNA sequence.
  • a ribozyme (from ribonucleic acid enzyme, also called RNA enzyme or catalytic RNA) is a RNA molecule that catalyzes a chemical reaction. Many natural ribozymes catalyze either the hydrolysis of one of their own phosphodiester bonds, or the hydrolysis of bonds in other RNA, but they have also been found to catalyze the aminotransferase activity of the ribosome.
  • Catalytic RNA can be“evolved” by in vitro methods. Similar to riboswitch activity discussed above, ribozymes and their reaction products can regulate gene expression. In some
  • a catalytic RNA or ribozyme can be placed within a larger non-coding RNA such that the ribozyme is present at many copies within the cell for the purposes of chemical transformation of a molecule from a bulk volume.
  • aptamers and ribozymes can both be encoded in the same non-coding RNA.
  • circRNA described herein comprises immolating circRNA or cleavable circRNA or self-cleaving circRNA.
  • CircRNA can deliver cellular components including, for example, RNA, lncRNA, lincRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA.
  • circRNA includes miRNA separated by (i) self- cleavable elements; (ii) cleavage recruitment sites; (iii) degradable linkers; (iv) chemical linkers; and/or (v) spacer sequences.
  • circRNA includes siRNA separated by (i) self-cleavable elements; (ii) cleavage recruitment sites (e.g., ADAR); (iii) degradable linkers (e.g., glycerol); (iv) chemical linkers; and/or (v) spacer sequences.
  • self-cleavable elements include hammerhead, splicing element, hairpin, hepatitis delta virus (HDV), Varkud Satellite (VS), and glmS ribozymes.
  • HDV hepatitis delta virus
  • VS Varkud Satellite
  • glmS ribozymes Non-limiting examples of circRNA immolating applications are listed in TABLE 4.
  • the circular polyribonucleotide comprises a sequence that encodes a peptide or polypeptide.
  • the polypeptide can be linear or branched.
  • the polypeptide can have a length from about 5 to about 4000 amino acids, about 15 to about 3500 amino acids, about 20 to about 3000 amino acids, about 25 to about 2500 amino acids, about 50 to about 2000 amino acids, or any range there between.
  • the polypeptide has a length of less than about 4000 amino acids, less than about 3500 amino acids, less than about 3000 amino acids, less than about 2500 amino acids, or less than about 2000 amino acids, less than about 1500 amino acids, less than about 1000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less can be useful.
  • the circular polyribonucleotide comprises one or more RNA sequences, each of which can encode a polypeptide.
  • the polypeptide can be produced in substantial amounts.
  • the polypeptide can be any proteinaceous molecule that can be produced.
  • a polypeptide can be a polypeptide that can be secreted from a cell, or localized to the cytoplasm, nucleus or membrane compartment of a cell.
  • the circular polyribonucleotide includes a sequence encoding a protein e.g., a therapeutic protein.
  • therapeutic proteins can include, but are not limited to, an protein replacement, protein supplementation, vaccination, antigens (e.g., tumor antigens, viral, and bacterial), hormones, cytokines, antibodies, immunotherapy (e.g., cancer), cellular reprogramming/transdifferentiation factor, transcription factors, chimeric antigen receptor, transposase or nuclease, immune effector (e.g., influences susceptibility to an immune response/signal), a regulated death effector protein (e.g., an inducer of apoptosis or necrosis), a non-lytic inhibitor of a tumor (e.g., an inhibitor of an oncoprotein), an epigenetic modifying agent, epigenetic enzyme, a transcription factor, a DNA or protein modification enzyme, a DNA-intercalating agent, an efflux pump inhibitor,
  • an epigenetic modifying agent
  • the regulatory sequence is a promoter.
  • the circular polyribonucleotide includes at least one promoter adjacent to at least one expression sequence.
  • the circular polyribonucleotide includes a promoter adjacent each expression sequence.
  • the promoter is present on one or both sides of each expression sequence, leading to separation of the expression products, e.g., peptide(s) and or polypeptide(s).
  • the circular polyribonucleotide can modulate expression of RNA encoded by a gene. Because multiple genes can share some degree of sequence homology with each other, the circular polyribonucleotide can be designed to target a class of genes with sufficient sequence homology. In some embodiments, the circular polyribonucleotide can contain a sequence that has complementarity to sequences that are shared amongst different gene targets or are unique for a specific gene target. In some embodiments, the circular polyribonucleotide can be designed to target conserved regions of an RNA sequence having homology between several genes thereby targeting several genes in a gene family. In some embodiments, the circular
  • polyribonucleotide can be designed to target a sequence that is unique to a specific RNA sequence of a single gene.
  • the expression sequence has a length less than 5000bps (e.g., less than about 5000bps, 4000bps, 3000bps, 2000bps, lOOObps, 900bps, 800bps, 700bps, 600bps, 500bps, 400bps, 300bps, 200bps, lOObps, 50bps, 40bps, 30bps, 20bps, lObps, or less).
  • 5000bps e.g., less than about 5000bps, 4000bps, 3000bps, 2000bps, lOOObps, 900bps, 800bps, 700bps, 600bps, 500bps, 400bps, 300bps, 200bps, lOObps, 50bps, 40bps, 30bps, 20bps, lObps, or less.
  • the expression sequence has, independently or in addition to, a length greater than lObps (e.g., at least about lObps, 20bps, 30bps, 40bps, 50bps, 60bps, 70bps, 80bps, 90bps, lOObps, 200bps, 300bps, 400bps, 500bps, 600bps, 700bps, 800bps, 900bps, lOOOkb, l.
  • lObps e.g., at least about lObps, 20bps, 30bps, 40bps, 50bps, 60bps, 70bps, 80bps, 90bps, lOObps, 200bps, 300bps, 400bps, 500bps, 600bps, 700bps, 800bps, 900bps, lOOOkb, l.
  • the expression sequence comprises one or more of the features described herein, e.g., a sequence encoding one or more peptides or proteins, one or more regulatory nucleic acids, one or more non-coding RNA, and other expression sequences.
  • the circular polyribonucleotides described herein comprise an internal ribosome entry site (IRES) element.
  • IRES element can contain an RNA sequence capable of engaging a eukaryotic ribosome.
  • the IRES element is at least about 50 base pairs, at least about 100 base pairs, at least about 200 base pairs, at least about 250 base pairs, at least about 350 base pairs, or at least about 500 base pairs.
  • the IRES element is derived from the DNA of an organism including, but not limited to, a virus, a mammal, and a Drosophila.
  • Viral DNA can be derived from, for example, picornavirus cDNA, encephalomyocarditis virus (EMCV) cDNA, and poliovirus cDNA.
  • Drosophila DNA from which an IRES element is derived can include, for example, an Antennapedia gene from Drosophila melanogaster.
  • circular polyribonucleotides described herein include at least one IRES flanking at least one (e.g., 2, 3, 4, 5 or more) expression sequence.
  • the IRES can flank both sides of at least one (e.g., 2, 3, 4, 5 or more) expression sequence.
  • circular polyribonucleotides can include one or more IRES sequences on one or both sides of each expression sequence, leading to separation of the resulting peptide(s) and or polypeptide(s).
  • the circular polyribonucleotide encodes a polypeptide and can comprise a translation initiation sequence, e.g., a start codon.
  • the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence.
  • the circular polyribonucleotide includes the translation initiation sequence, e.g., Kozak sequence, adjacent to an expression sequence.
  • the translation initiation sequence e.g., Kozak sequence
  • the circular polyribonucleotide includes at least one translation initiation sequence adjacent to an expression sequence.
  • Natural 5’-UTRs can bear features that play a role in translation initiation. Natural 5’- UTRs can harbor signatures like Kozak sequences, which can be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another“G”. 5’-UTR can also form secondary structures that are involved in elongation factor binding.
  • the circular polyribonucleotide can include more than 1 start codon such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, or more than 60 start codons. Translation can initiate on the first start codon or initiate downstream of the first start codon.
  • the circular polyribonucleotide can initiate at a codon that is not the first start codon, e.g., AUG.
  • Translation of the circular polyribonucleotide can initiate at an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG.
  • translation begins at an alternative translation initiation sequence under selective conditions, e.g., stress induced conditions.
  • the translation of the circular polyribonucleotide can begin at alternative translation initiation sequence, such as ACG.
  • the circular polyribonucleotide translation can begin at alternative translation initiation sequence, CTG/CUG.
  • the circular polyribonucleotide translation can begin at alternative translation initiation sequence, GTG/GUG.
  • the circular polyribonucleotide can begin translation at a repeat- associated non- AUG (RAN) sequence, such as an alternative translation initiation sequence that includes short stretches of repetitive RNA, e.g., CGG, GGGGCC, CAG, CTG.
  • RAN repeat- associated non- AUG
  • Nucleotides flanking a codon that initiates translation can affect the translation efficiency, the length and/or the structure of the circular polyribonucleotide. Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length, and/or structure of the circular
  • a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon.
  • masking agents include antisense locked nucleic acids (LNA) oligonucleotides and exon-junction complexes (EJCs).
  • LNA antisense locked nucleic acids
  • EJCs exon-junction complexes
  • a masking agent can be used to mask a start codon of the circular polyribonucleotide in order to increase the likelihood that translation will initiate at an alternative start codon.
  • translation is initiated under selective conditions, such as, but not limited to, viral induced selection in the presence of GRSF-l and the circular polyribonucleotide includes GRSF-l binding sites.
  • translation is initiated by eukaryotic initiation factor 4A (eIF4A) treatment with Rocaglates. Translation can be repressed by blocking 43 S scanning, leading to premature, upstream translation initiation and reduced protein expression from transcripts bearing the RocA-eIF4A target sequence.
  • eIF4A eukaryotic initiation factor 4A
  • the circular polyribonucleotide includes one or more expression sequences and each expression sequence can have a termination sequence.
  • the circular polyribonucleotide includes one or more expression sequences and the expression sequences lack a termination sequence, such that the circular polyribonucleotide is continuously translated. Exclusion of a termination sequence can result in rolling circle translation or continuous production of expression product, e.g., peptides or polypeptides, due to lack of ribosome stalling or fall-off. In such an embodiment, rolling circle translation produces a continuous expression product through each expression sequence.
  • the circular polyribonucleotide includes a stagger sequence.
  • a stagger sequence can be included to induce ribosomal pausing during translation.
  • the stagger sequence can include a 2A-like or CHYSEL (cis-acting hydrolase element) sequence.
  • the stagger element encodes a sequence with a C-terminal consensus sequence that is X1X2X3EX5NPGP, where XI is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid.
  • stagger elements includes GDVESNPGP,
  • GDIEENPGP VEPNPGP, IETNPGP, GDIESNPGP, GDVELNPGP, GDIETNPGP,
  • GDVENPGP GDVEENPGP, GDVEQNPGP, IESNPGP, GDIELNPGP, HDIETNPGP, HDVETNPGP, HDVEMNPGP, GDMESNPGP, GDVETNPGP, GDIEQNPGP, and DSEFNPGP.
  • the circular polyribonucleotide includes a termination sequence at the end of one or more expression sequences.
  • one or more expression sequences lacks a termination sequence.
  • termination sequences include an in-frame nucleotide triplet that signals termination of translation, e.g., EGAA, ETGA, ETAG.
  • one or more termination sequences in the circular polyribonucleotide are frame- shifted termination sequences, such as but not limited to, off-frame or -1 and +1 shifted reading frames (e.g., hidden stop) that can terminate translation.
  • Frame-shifted termination sequences include nucleotide triples, TAA, TAG, and TGA that appear in the second and third reading frames of an expression sequence. Frame-shifted termination sequences can be important in preventing misreads of mRNA, which is often detrimental to the cell.
  • a stagger sequence described herein can terminate translation and/or cleave an expression product between G and P of the consensus sequence described herein.
  • the circular polyribonucleotide includes at least one stagger sequence to terminate translation and/or cleave the expression product.
  • the circular polyribonucleotide includes a stagger sequence adjacent to at least one expression sequence.
  • the circular polyribonucleotide includes a stagger sequence after each expression sequence.
  • polyribonucleotide includes a stagger sequence is present on one or both sides of each expression sequence, leading to translation of individual peptide(s) and or polypeptide(s) from each expression sequence.
  • the circular polyribonucleotide includes a poly-A sequence.
  • the length of a poly-A sequence is greater than 10 nucleotides in length.
  • the poly-A sequence is greater than 15 nucleotides in length (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500,
  • the poly-A sequence is from about 10 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to
  • the poly-A sequence is designed relative to the length of the overall circular polyribonucleotide.
  • the design can be based on the length of the coding region, the length of a particular feature or region (such as the first or flanking regions), or based on the length of the ultimate product expressed from the circular polyribonucleotide.
  • the poly-A sequence can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the circular polyribonucleotide or a feature thereof.
  • the poly-A sequence can also be designed as a fraction of the circular polyribonucleotide.
  • the poly-A sequence can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more of the total length of the construct or the total length of the construct minus the poly-A sequence.
  • engineered binding sites and conjugation of circular polyribonucleotide for Poly-A binding protein can enhance expression.
  • the circular polyribonucleotide is designed to include a polyA-G quartet.
  • the G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA.
  • the G-quartet can be incorporated at the end of the poly-A sequence.
  • the resultant circular polyribonucleotide construct can be assayed for stability, protein production, and/or other parameters including half-life at various time points.
  • the polyA-G quartet can result in protein production equivalent to at least 75% of that seen using a poly-A sequence of 120 nucleotides alone.
  • the circular polyribonucleotide comprises one or more riboswitches.
  • a riboswitch can be a part of the circular polyribonucleotide that can directly bind a small target molecule, and whose binding of the target affects RNA translation and the expression product stability and activity.
  • the circular polyribonucleotide that includes a riboswitch can regulate the activity of the circular polyribonucleotide depending on the presence or absence of the target molecule.
  • a riboswitch has a region of aptamer- like affinity for a separate molecule. Any aptamer included within a non-coding nucleic acid can be used for sequestration of molecules from bulk volumes. In some embodiments,
  • the riboswitch modulates gene expression by transcriptional termination, inhibition of translation initiation, mRNA self-cleavage, and in eukaryotes, alteration of splicing pathways.
  • the riboswitch can control gene expression through the binding or removal of a trigger molecule.
  • subjecting a circular polyribonucleotide that includes the riboswitch to conditions that activate, deactivate, or block the riboswitch can alter gene expression. For example, gene expression can be altered as a result of termination of
  • Binding of a trigger molecule, or an analog thereof, can reduce/prevent expression or promote/increase expression of the RNA molecule depending on the nature of the riboswitch.
  • the riboswitch is a Cobalamin riboswitch (also Bl2-element), which binds adenosylcobalamin (the coenzyme form of vitamin B 12) to regulate the
  • the riboswitch is a cyclic di-GMP riboswitch, which binds cyclic di-GMP to regulate a variety of genes.
  • cyclic di-GMP riboswitch There are two non-structurally related classes of cyclic di-GMP riboswitch: cyclic di-GMP -I and cyclic di-GMP-II.
  • the riboswitch is a FMN riboswitch (also RFN-element) which binds flavin mononucleotide (FMN) to regulate riboflavin biosynthesis and transport.
  • FMN flavin mononucleotide
  • the riboswitch is a glmS riboswitch, which cleaves itself when there is a sufficient concentration of glucosamine-6-phosphate.
  • the riboswitch is a glutamine riboswitch, which binds glutamine to regulate genes involved in glutamine and nitrogen metabolism.
  • Glutamine riboswitches can also bind short peptides of unknown function.
  • Such riboswitches fall into two structurally related classes: the glnA RNA motif and Downstream-peptide motif.
  • the riboswitch is a glycine riboswitch, which binds glycine to regulate glycine metabolism genes. It comprises two adjacent aptamer domains in the same mRNA, and is the only known natural RNA that exhibits cooperative binding.
  • the riboswitch is a lysine riboswitch (also L-box), which binds lysine to regulate lysine biosynthesis, catabolism, and transport.
  • the riboswitch is a preQl riboswitch, which binds pre-queuosine to regulate genes involved in the synthesis or transport of this precursor to queuosine.
  • Two distinct classes of preQl riboswitches are preQl -I riboswitches and preQl -II riboswitches.
  • the binding domain of preQl -I riboswitches is unusually small among naturally occurring riboswitches.
  • PreQl -II riboswitches which are only found in certain species in the genera Streptococcus and Lactococcus, have a completely different structure and are larger than preQl - I riboswitches.
  • the riboswitch is a purine riboswitch, which binds purines to regulate purine metabolism and transport.
  • purine riboswitches bind guanine or adenine.
  • the specificity for either guanine or adenine depends upon Watson-Crick interactions with a single pyrimidine in the riboswitch at position Y74.
  • the single pyrimidine is cytosine (i.e., C74).
  • the single pyrimidine is uracil (i.e., U74). Homologous types of purine riboswitches can bind
  • deoxyguanosine but have more significant differences than a single nucleotide mutation.
  • the riboswitch is an S-adenosylhomocysteine (SAH) riboswitch, which binds SAH to regulate genes involved in recycling SAH produced from S- adenosylmethionine (SAM) in methylation reactions.
  • SAH S-adenosylhomocysteine
  • the riboswitch is an S-adenosyl methionine (SAM) riboswitch, which binds SAM to regulate methionine and SAM biosynthesis and transport.
  • SAM S-adenosyl methionine
  • SAM-I originally called S-box
  • SAM-II S-II
  • SAM-II S-II
  • SAM-II S-II
  • SAM-II is widespread in bacteria.
  • SAM-II is found only in a-, b-, and a few g-proteobacteria.
  • the SMK box riboswitch is found in Lactobacillales.
  • SAM-IV appears to have a similar ligand- binding core to that of SAM-I, but in the context of a distinct scaffold.
  • the riboswitch is a SAM-SAH riboswitch, which binds both SAM and SAH with similar affinities.
  • the riboswitch is a tetrahydrofolate riboswitch, which binds tetrahydrofolate to regulate synthesis and transport genes.
  • the riboswitch is a theophylline-binding riboswitch or a thymine pyrophosphate-binding riboswitch.
  • the riboswitch is a glmS catalytic riboswitch from
  • Thermoanaerobacter tengcongensis which senses glucosamine-6 phosphate.
  • the riboswitch is a thiamine pyrophosphate (TPP) riboswitch (also Thi-box), which binds TPP to regulate thiamine biosynthesis and transport, as well as transport of similar metabolites.
  • TPP thiamine pyrophosphate
  • the TPP riboswitch is found in eukaryotes.
  • the riboswitch is a Moco riboswitch, which binds molybdenum cofactor, to regulate genes involved in biosynthesis and transport of this coenzyme, as well as enzymes that use molybdenum or derivatives thereof as a cofactor.
  • the riboswitch is an adenine-sensing add-A riboswitch, found in the 5’-UTR of the adenine deaminase (add) encoding gene of Vibrio vulnificus.
  • the circular polyribonucleotide comprises an aptazyme.
  • Aptazyme is a switch for conditional expression in which an aptamer region is used as an allosteric control element and coupled to a region of catalytic RNA (a“ribozyme” as described below).
  • the aptazyme is active in cell type-specific translation.
  • the aptazyme is active under cell state-specific translation, e.g., virally infected cells or in the presence of viral nucleic acids or viral proteins.
  • a ribozyme is a RNA molecule that catalyzes a chemical reaction. Many natural ribozymes can catalyze the hydrolysis of phosphodiester bonds of the ribozyme itself or the hydrolysis of phosphodiester bonds in other RNA. Natural ribozymes can also catalyze the aminotransferase activity of the ribosome. Catalytic RNA can be“evolved” by in vitro methods. Ribozymes and reaction products of ribozymes can regulate gene expression.
  • a catalytic RNA or ribozyme can be placed within a larger, non-coding RNA such that the ribozyme is present at many copies within the cell for chemical transformation of a molecule from a bulk volume.
  • aptamers and ribozymes can both be encoded in the same non-coding RNA.
  • Non-limiting examples of ribozymes include hammerhead ribozyme, VL ribozyme, leadzyme, and hairpin ribozyme.
  • the aptazyme is a ribozyme that can cleave RNA sequences and can be regulated as a result of binding a ligand or modulator.
  • the ribozyme can be a self cleaving ribozyme. As such, these ribozymes can combine the properties of ribozymes and aptamers.
  • the aptazyme is included in an untranslated region of circular polyribonucleotides described herein.
  • An aptazyme in the absence of ligand/modulator is inactive, which can allow expression of the transgene. Expression can be turned off or down- regulated by addition of the ligand. Aptazymes that are downregulated in response to the presence of a particular modulator can be used in control systems where upregulation of gene expression in response to modulator is desired.
  • Aptazymes can also be used to develop of systems for self-regulation of circular polyribonucleotide expression.
  • the protein product of circular polyribonucleotides described herein that is the rate determining enzyme in the synthesis of a particular small molecule can be modified to include an aptazyme that is selected to have increased catalytic activity in the presence of the small molecule to provide an autoregulatory feedback loop for synthesis of the molecule.
  • the aptazyme activity can be selected sense accumulation of the protein product from the circular polyribonucleotide, or any other cellular macromolecule.
  • the circular polyribonucleotide can include an aptamer sequence.
  • aptamers include RNA aptamers that bind lysozyme, Toggle-25t (an RNA aptamer containing 2’-fluoropyrimidine nucleotides that binds thrombin with high specificity and affinity), RNA-Tat that binds human immunodeficiency virus trans-acting responsive element (HIV TAR), RNA aptamers that bind hemin, RNA aptamers that bind interferon g, RNA aptamer binding vascular endothelial growth factor (VEGF), RNA aptamers that bind prostate specific antigen (PSA), RNA aptamers that bind dopamine, and RNA aptamers that bind heat shock factor 1 (HSF1).
  • VEGF vascular endothelial growth factor
  • PSA prostate specific antigen
  • HSF1 heat shock factor 1
  • circRNA described herein can be used for transcription and replication of RNA.
  • circRNA can be used to encode non-coding RNA, lncRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA.
  • circRNA can include anti-sense miRNA and a transcriptional element. After transcription, such circRNA can produce functional, linear miRNAs.
  • Non-limiting examples of circRNA expression and modulation applications are listed in TABLE 5.
  • the circular polyribonucleotide can encode a sequence and/or motif useful for replication. Replication of a circular polyribonucleotide can occur by generating a complement circular polyribonucleotide.
  • the circular polyribonucleotide includes a motif to initiate transcription, where transcription is driven by either endogenous cellular machinery (DNA-dependent RNA polymerase) or an RNA-depended RNA polymerase encoded by the circular polyribonucleotide.
  • the product of rolling-circle transcriptional event can be cut by a ribozyme to generate either complementary or propagated circular polyribonucleotide at unit length.
  • the ribozymes can be encoded by the circular polyribonucleotide, its complement, or by an RNA sequence in trans.
  • the encoded ribozymes can include a sequence or motif that regulates (inhibits or promotes) activity of the ribozyme to control circRNA propagation.
  • unit-length sequences can be ligated into a circular form by a cellular RNA ligase.
  • the circular polyribonucleotide includes a replication element that aids in self-amplification. Examples of such replication elements include HDV replication domains and replication competent circular RNA sense and/or antisense ribozymes, such as antigenomic 5’-
  • the circular polyribonucleotide includes at least one cleavage sequence as described herein to aid in replication.
  • a cleavage sequence within the circular polyribonucleotide can cleave long transcripts replicated from the circular polyribonucleotide to a specific length that can subsequently circularize to form a complement to the circular polyribonucleotide.
  • the circular polyribonucleotide includes at least one ribozyme sequence to cleave long transcripts replicated from the circular polyribonucleotide to a specific length, where another encoded ribozyme cuts the transcripts at the ribozyme sequence.
  • Circularization forms a complement to the circular polyribonucleotide.
  • the circular polyribonucleotide is substantially resistant to degradation, e.g., by exonucleases.
  • the circular polyribonucleotide replicates within a cell. In some embodiments, the circular polyribonucleotide replicates within in a cell at a rate of between about l0%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, 95%-99%, or any percentage there between. In some embodiments, the circular polyribonucleotide is replicates within a cell and is passed to daughter cells.
  • a cell passes at least one circular polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%.
  • cell undergoing meiosis passes the circular polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%.
  • a cell undergoing mitosis passes the circular polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%.
  • the circular polyribonucleotide replicates within the host cell.
  • the circular polyribonucleotide is capable of replicating in a mammalian cell, e.g., human cell.
  • the circular polyribonucleotide replicates in the host cell
  • the circular polyribonucleotide does not integrate into the genome of the host, e.g., with the host’s chromosomes.
  • the circular polyribonucleotide has a negligible recombination frequency, e.g., with the host’s chromosomes.
  • the circular polyribonucleotide has a recombination frequency, e.g., less than about 1.0 cM/Mb, 0.9 cM/Mb, 0.8 cM/Mb, 0.7 cM/Mb, 0.6 cM/Mb, 0.5 cM/Mb, 0.4 cM/Mb, 0.3 cM/Mb, 0.2 cM/Mb, 0.1 cM/Mb, or less, e.g., with the host’s chromosomes.
  • a recombination frequency e.g., less than about 1.0 cM/Mb, 0.9 cM/Mb, 0.8 cM/Mb, 0.7 cM/Mb, 0.6 cM/Mb, 0.5 cM/Mb, 0.4 cM/Mb, 0.3 cM/Mb, 0.2 cM/Mb, 0.1 cM/Mb, or less, e.
  • the circular polyribonucleotide further includes another nucleic acid sequence.
  • the circular polyribonucleotide can include DNA, RNA, or artificial nucleic acid sequences.
  • the other sequences can include, but are not limited to, genomic DNA, cDNA, or sequences that encode tRNA, mRNA, rRNA, miRNA, gRNA, siRNA, or other RNAi molecules.
  • the circular polyribonucleotide includes a sequence encoding an siRNA to target a different locus or loci of the same gene expression product as the circular polyribonucleotide.
  • the circular polyribonucleotide includes a sequence encoding an siRNA to target a different locus or loci of the same gene expression product as the circular polyribonucleotide.
  • the circular polyribonucleotide includes a sequence encoding an siRNA to target a different locus or loci of the same gene expression product as the circular polyribonucleotide.
  • polyribonucleotide includes a sequence encoding an siRNA to target a different gene expression product as the circular polyribonucleotide.
  • the circular polyribonucleotide lacks a 5’-UTR. In some embodiments, the circular polyribonucleotide lacks a 3’-UTR. In some embodiments, the circular polyribonucleotide lacks a poly-A sequence. In some embodiments, the circular polyribonucleotide lacks a termination sequence. In some embodiments, the circular
  • polyribonucleotide lacks an internal ribosomal entry site. In some embodiments, the circular polyribonucleotide lacks degradation susceptibility by exonucleases. In some embodiments, the circular polyribonucleotide lacks binding to cap-binding proteins. In some embodiments, the circular polyribonucleotide lacks a 5’ cap.
  • the circular polyribonucleotide comprises one or more of the following sequences: a sequence that encodes one or more miRNA, a sequence that encodes one or more replication proteins, a sequence that encodes an exogenous gene, a sequence that encodes a therapeutic, a regulatory sequence (e.g., a promoter, enhancer), a sequence that encodes one or more regulatory sequences that targets endogenous genes (siRNA, lncRNA, shRNA), and a sequence that encodes a therapeutic mRNA or protein.
  • the other sequence can have a length from about 2 to about 5000 nts, about 10 to about 100 nts, about 50 to about 150 nts, about 100 to about 200 nts, about 150 to about 250 nts, about 200 to about 300 nts, about 250 to about 350 nts, about 300 to about 500 nts, about 10 to about 1000 nts, about 50 to about 1000 nts, about 100 to about 1000 nts, about 1000 to about 2000 nts, about 2000 to about 3000 nts, about 3000 to about 4000 nts, about 4000 to about 5000 nts, or any range there between.
  • the circular polyribonucleotide can include certain characteristics that distinguish it from linear RNA.
  • the circular polyribonucleotide is less susceptible to degradation by exonuclease as compared to linear RNA.
  • the circular polyribonucleotide is more stable than a linear RNA, especially when incubated in the presence of an exonuclease.
  • the increased stability of the circular polyribonucleotide compared with linear RNA makes circular polyribonucleotide more useful as a cell transforming reagent to produce polypeptides and can be stored more easily and for longer than linear RNA.
  • the stability of the circular polyribonucleotide treated with exonuclease can be tested using methods standard in art which determine whether RNA degradation has occurred (e.g., by gel
  • the circular polyribonucleotide is less susceptible to dephosphorylation when the circular polyribonucleotide is incubated with phosphatase, such as calf intestine phosphatase.
  • the circular polyribonucleotide comprises a spacer sequence.
  • the spacer can be a nucleic acid molecule having low GC content, for example less than 65%, 60%, 55%, 50%, 55%, 50%, 45%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31 %, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 20%, 19%, 18%, 17%, 1 6%, 15%, 14%, 13%, 12%, 1 1 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1 %, across the full length of the spacer, or across at least 50%, 60%, 70%, 80%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% contiguous nucleic acid residues of the spacer.
  • the spacer is substantially free of a secondary structure, such as less than 40kcal/mol, less than -39, -38, -37, - 36, -35, -34, -33, -32, -31, -30, -29, -28, -27, -26, -25, -24, -23, -22, -20, -19, -18, -17, -16, -15, - 14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2 or -1 kcal/mol.
  • the spacer can include a nucleic acid, such as DNA or RNA.
  • the spacer sequence can encode an RNA sequence, and preferably a protein or peptide sequence, including a secretion signal peptide.
  • the spacer sequence can be non-coding. Where the spacer is a non-coding sequence, a start codon can be provided in the coding sequence of an adjacent sequence.
  • the first nucleic acid residue of the coding sequence can be the A residue of a start codon, such as AUG.
  • a start codon can be provided in the spacer sequence.
  • the spacer is operably linked to another sequence described herein.
  • Non-nucleic acid linkers are operably linked to another sequence described herein.
  • the circular polyribonucleotide described herein can also comprise a non-nucleic acid linker.
  • the circular polyribonucleotide described herein has a non-nucleic acid linker between one or more of the sequences or elements described herein.
  • one or more sequences or elements described herein are linked with the linker.
  • the non-nucleic acid linker can be a chemical bond, e.g., one or more covalent bonds or non- covalent bonds.
  • the non-nucleic acid linker is a peptide or protein linker. Such a linker can be between 2-30 amino acids, or longer.
  • the linker includes flexible, rigid or cleavable linkers described herein.
  • GS linker The most commonly used flexible linkers have sequences consisting primarily of stretches of Gly and Ser residues (“GS” linker).
  • Flexible linkers can be useful for joining domains that require a certain degree of movement or interaction and can include small, non polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids. Incorporation of Ser or Thr can also maintain the stability of the linker in aqueous solutions by forming hydrogen bonds with the water molecules, and therefore reduce unfavorable interactions between the linker and the protein moieties.
  • Rigid linkers are useful to keep a fixed distance between domains and to maintain their independent functions. Rigid linkers can also be useful when a spatial separation of the domains is critical to preserve the stability or bioactivity of one or more components in the fusion. Rigid linkers can have an alpha helix-structure or Pro-rich sequence, (XP) n , with X designating any amino acid, preferably Ala, Lys, or Glu.
  • Cleavable linkers can release free functional domains in vivo.
  • linkers can be cleaved under specific conditions, such as the presence of reducing reagents or proteases.
  • In vivo cleavable linkers can utilize the reversible nature of a disulfide bond.
  • One example includes a thrombin-sensitive sequence (e.g., PRS) between the two Cys residues.
  • PRS thrombin-sensitive sequence
  • In vivo cleavage of linkers in fusions can also be carried out by proteases that are expressed in vivo under pathological conditions (e.g., cancer or inflammation), in specific cells or tissues, or constrained within certain cellular compartments.
  • pathological conditions e.g., cancer or inflammation
  • the specificity of many proteases offers slower cleavage of the linker in constrained compartments.
  • linking molecules include a hydrophobic linker, such as a negatively charged sulfonate group; lipids, such as a poly (-CH 2- ipids, such as a poly (-CHe g
  • polyethylene glycol (PEG) group unsaturated variants thereof, hydroxylated variants thereof, amidated or otherwise N-containing variants thereof, noncarbon linkers; carbohydrate linkers; phosphodiester linkers, or other molecule capable of covalently linking two or more polypeptides.
  • Non-covalent linkers are also included, such as hydrophobic lipid globules to which the polypeptide is linked, for example through a hydrophobic region of the polypeptide or a hydrophobic extension of the polypeptide, such as a series of residues rich in leucine, isoleucine, valine, or perhaps also alanine, phenylalanine, or even tyrosine, methionine, glycine or other hydrophobic residue.
  • the polypeptide can be linked using charge-based chemistry, such that a positively charged moiety of the polypeptide is linked to a negative charge of another polypeptide or nucleic acid.
  • a linear circular polyribonucleotide can be cyclized or
  • linear circular polyribonucleotide can be cyclized in vitro prior to formulation and/or delivery. In some embodiments, linear circular ribonucleotide
  • polyribonucleotides can be cyclized within a cell.
  • a linear circular polyribonucleotide is cyclized, or concatemerized using a chemical method to form a circular polyribonucleotide.
  • the 5’ -end and the 3’ -end of the nucleic acid includes chemically reactive groups that, when close together, can form a new covalent linkage between the 5’ -end and the 3’ -end of the molecule.
  • the 5’ -end can contain an NHS-ester reactive group and the 3’ -end can contain a 3’ -amino-terminated nucleotide such that in an organic solvent the 3’ -amino-terminated nucleotide on the 3’ -end of a linear RNA molecule will undergo a nucleophilic attack on the 5’ -NHS-ester moiety forming a new 5’ -or 3’ -amide bond.
  • a DNA or RNA ligase can be used to enzymatically link a 5’- phosphorylated nucleic acid molecule (e.g., a linear circular polyribonucleotide) to the 3’- hydroxyl group of a nucleic acid (e.g., a linear nucleic acid) forming a new phosphodiester linkage.
  • a linear circular polyribonucleotide is incubated at 37 °C for 1 hour with 1-10 units of T4 RNA ligase according to the manufacturer’s protocol.
  • the ligation reaction can occur in the presence of a linear nucleic acid capable of base-pairing with both the 5’- and 3’-region in juxtaposition to assist the enzymatic ligation reaction.
  • a DNA or RNA ligase can be used in the synthesis of the circular polynucleotides.
  • the ligase can be a circ ligase or circular ligase.
  • either the 5’-or 3’-end of the linear circular polyribonucleotide can encode a ligase ribozyme sequence such that during in vitro transcription, the resultant linear circular polyribonucleotide includes an active ribozyme sequence capable of ligating the 5’-end of the linear circular polyribonucleotide to the 3’ -end of the linear circular polyribonucleotide.
  • the ligase ribozyme can be derived from the Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or can be selected by SELEX (systematic evolution of ligands by exponential enrichment). The ribozyme ligase reaction can take 1 to 24 hours at temperatures between 0 and 37°C.
  • a linear circular polyribonucleotide can be cyclized or concatermerized by using at least one non-nucleic acid moiety.
  • the at least one non-nucleic acid moiety can react with regions or features near the 5’ -terminus and/or near the 3’ -terminus of the linear circular polyribonucleotide in order to cyclize or concatermerize the linear circular polyribonucleotide.
  • the at least one non-nucleic acid moiety can be located in or linked to or near the 5’ -terminus and/or the 3’ -terminus of the linear circular polyribonucleotide.
  • the non-nucleic acid moieties contemplated can be homologous or heterologous.
  • the non-nucleic acid moiety can be a linkage such as a hydrophobic linkage, ionic linkage, a biodegradable linkage and/or a cleavable linkage.
  • the non-nucleic acid moiety is a ligation moiety.
  • the non-nucleic acid moiety can be an oligonucleotide or a peptide moiety, such as an aptamer or a non-nucleic acid linker as described herein.
  • a linear circular polyribonucleotide can be cyclized or concatermerized due to a non-nucleic acid moiety that causes an attraction between atoms, molecular surfaces at, near or linked to the 5’- and 3’ -ends of the linear circular
  • polyribonucleotide As a non-limiting example, one or more linear circular polyribonucleotides can be cyclized or concantermized by intermolecular forces or intramolecular forces.
  • intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, Van der Waals forces, and London dispersion forces.
  • intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonant bonds, agnostic bonds, dipolar bonds, conjugation, hyperconjugation and antibonding.
  • the linear circular polyribonucleotide can comprise a ribozyme RNA sequence near the 5’ -terminus and near the 3’ -terminus.
  • the ribozyme RNA sequence can covalently link to a peptide when the sequence is exposed to the remainder of the ribozyme.
  • the peptides covalently linked to the ribozyme RNA sequence near the 5’ -terminus and the 3’ -terminus can associate with each other causing a linear circular polyribonucleotide to cyclize or concatemerize.
  • the peptides covalently linked to the ribozyme RNA near the 5’ -terminus and the 3’ -terminus can cause the linear primary construct or linear mRNA to cyclize or concatemerize after being subjected to ligation using various methods known in the art such as, but not limited to, protein ligation.
  • the linear circular polyribonucleotide can include a 5’ triphosphate of the nucleic acid converted into a 5’ monophosphate, e.g., by contacting the 5’ triphosphate with RNA 5’ pyrophosphohydrolase (RppH) or an ATP diphosphohydrolase (apyrase).
  • RppH RNA 5’ pyrophosphohydrolase
  • apyrase an ATP diphosphohydrolase
  • converting the 5’ triphosphate of the linear circular polyribonucleotide into a 5’ monophosphate can occur by a two-step reaction comprising: (a) contacting the 5’ nucleotide of the linear circular polyribonucleotide with a phosphatase (e.g.,
  • a kinase e.g., Polynucleotide Kinase
  • the circular polyribonucleotide includes at least one splicing element.
  • the splicing element is adjacent to at least one expression sequence.
  • the circular polyribonucleotide includes a splicing element adjacent each expression sequence.
  • the splicing element is on one or both sides of each expression sequence, leading to separation of the expression products, e.g., peptide(s) and or polypeptide(s).
  • the circular polyribonucleotide includes an internal splicing element that when replicated the spliced ends are joined together.
  • Some examples can include miniature introns ( ⁇ 100 nt) with splice site sequences and short inverted repeats (30-40 nt) such as AluSq2, AluJr, and AluSz, inverted sequences in flanking introns, Alu elements in flanking introns, and motifs found in (suptable4 enriched motifs) cis-sequence elements proximal to backsplice events such as sequences in the 200 bp preceding (upstream of) or following
  • the circular polyribonucleotide includes at least one repetitive nucleotide sequence described elsewhere herein as an internal splicing element.
  • the repetitive nucleotide sequence can include repeated sequences from the Alu family of introns.
  • a splicing-related ribosome binding protein can regulate circular polyribonucleotide biogenesis, e.g., the Muscleblind and Quaking (QKI) splicing factors.
  • the circular polyribonucleotide can include canonical splice sites that flank head-to-tail junctions of the circular polyribonucleotide.
  • the circular polyribonucleotide can include a bulge-helix-bulge motif, comprising a 4-base pair stem flanked by two 3-nucleotide bulges. Cleavage occurs at a site in the bulge region, generating characteristic fragments with terminal 5’-hydroxyl group and 2’, 3’-cyclic phosphate. Circularization proceeds by nucleophilic attack of the 5’-OH group onto the 2’, 3’-cyclic phosphate of the same molecule forming a 3’,5’-phosphodiester bridge.
  • the circular polyribonucleotide can include a multimeric repeating RNA sequence that harbors a HPR element.
  • the HPR comprises a 2’,3’-cyclic phosphate and a 5’ -OH termini.
  • the HPR element self-processes the 5’- and 3’ -ends of the linear circular polyribonucleotide, thereby ligating the ends together.
  • the circular polyribonucleotide can include a sequence that mediates self-ligation.
  • the circular polyribonucleotide can include a HDV sequence (e.g., HDV replication domain conserved sequence,
  • GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAA GAGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (SEQ ID NO: 3) (Beeharry et al 2004) or
  • the circular polyribonucleotide can include loop E sequence (e.g., in PSTVd) to self-ligate.
  • the circular polyribonucleotide can include a self-circularizing intron, e.g., a 5’ and 3’-slice junction, or a self-circularizing catalytic intron such as a Group I, Group II or Group III Introns.
  • Non-limiting examples of group I intron self-splicing sequences can include self-splicing permuted intron-exon sequences derived from T4 bacteriophage gene td, and the intervening sequence (IVS) rRNA of Tetrahymena.
  • linear circular polyribonucleotides can include complementary sequences, including either repetitive or nonrepetitive nucleic acid sequences within individual introns or across flanking introns. Repetitive nucleic acid sequences are sequences that occur within a segment of the circular polyribonucleotide.
  • the circular polyribonucleotide includes a repetitive nucleic acid sequence.
  • the repetitive nucleotide sequence includes poly CA or poly EiG sequences.
  • the circular polyribonucleotide includes at least one repetitive nucleic acid sequence that hybridizes to a complementary repetitive nucleic acid sequence in another segment of the circular polyribonucleotide, with the hybridized segment forming an internal double strand.
  • repetitive nucleic acid sequences and complementary repetitive nucleic acid sequences from two separate circular polyribonucleotides hybridize to generate a single circularized polyribonucleotide, with the hybridized segments forming internal double strands.
  • the complementary sequences are found at the 5’- and 3’ -ends of the linear circular polyribonucleotides.
  • the complementary sequences include about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
  • the invention described herein comprises compositions and methods of using and making modified circular polyribonucleotides, and delivery of modified circular polyribonucleotides.
  • modified nucleotide can refer to any nucleotide analog or derivative that has one or more chemical modifications to the chemical composition of an unmodified natural ribonucleotide, such as a natural unmodified nucleotide adenosine (A), uridine (U), guaninie (G), cytidine (C) as shown by the chemical formulae in TABLE 5, and monophosphate.
  • A natural unmodified nucleotide adenosine
  • U uridine
  • G guaninie
  • C cytidine
  • the chemical modifications of the modified ribonucleotide can be any nucleotide analog or derivative that has one or more chemical modifications to the chemical composition of an unmodified natural ribonucleotide, such as a natural unmodified nucleotide
  • any one or more functional groups of the ribonucleotide such as, the sugar the nucleobase, or the internucleoside linkage (e.g. to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone).
  • the circular polyribonucleotide can include one or more substitutions, insertions and/or additions, deletions, and covalent modifications with respect to reference sequences, in particular, the parent polyribonucleotide, are included within the scope of this invention.
  • the circular polyribonucleotide includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.).
  • the circular polyribonucleotide can include any useful modification, such as to the sugar, the nucleobase, or the intemucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone).
  • One or more atoms of a pyrimidine nucleobase can be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro).
  • modifications e.g., one or more modifications
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • TAA threose nucleic acids
  • GNA glycol nucleic acids
  • PNA peptide nucleic acids
  • LNA locked nucleic acids
  • the circular polyribonucleotide includes at least one
  • N(6)methyladenosine (m6A) modification to increase translation efficiency.
  • the modification may include a chemical or cellular induced modification.
  • a chemical or cellular induced modification for example, some nonlimiting examples of intracellular RNA modifications are described by Lewis and Pan in“RNA modifications and structures cooperate to guide RNA- protein interactions” from Nat Reviews Mol Cell Biol, 2017, 18:202-210.
  • “Pseudouridine” refers, in another embodiment, to nVcpV (1 -methyl-3 -(3 -amino-3 - carboxypropyl) pseudouridine.
  • the term refers to m (1- methylpseudouridine).
  • the term refers to Yih (2'-0- methylpseudouridine.
  • the term refers to m5D (5-methyldihydrouridine).
  • the term refers to mV (3-methylpseudouridine).
  • the term refers to a pseudouridine moiety that is not further modified.
  • the term refers to a monophosphate, diphosphate, or triphosphate of any of the above pseudouridines.
  • the term refers to any other pseudouridine known in the art. Each possibility represents a separate embodiment of the present invention.
  • chemical modifications to the ribonucleotides of the circular polyribonucleotide can enhance immune evasion.
  • Modifications include, for example, end modifications, e.g., 5’ -end modifications (phosphorylation (mono-, di- and tri-), conjugation, inverted linkages, etc.), 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), base modifications (e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners), removal of bases (abasic nucleotides), or conjugated bases.
  • the modified ribonucleotide bases can also include 5-methylcytidine and pseudouridine.
  • base modifications can modulate expression, immune response, stability, subcellular localization, to name a few functional effects, of the circular polyribonucleotide.
  • the modification includes a bi-orthogonal nucleotide, e.g., an unnatural base.
  • sugar modifications e.g., at the T position or 4’ position
  • replacement of the sugar one or more ribonucleotides of the circular polyribonucleotide can, as well as backbone modifications, include modification or replacement of the phosphodiester linkages.
  • Non-limiting examples of circular polyribonucleotide include circular
  • Circular polyribonucleotides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
  • modified RNA that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • the circular polyribonucleotide will include ribonucleotides with a phosphorus atom in its internucleoside backbone.
  • Modified circular polyribonucleotide backbones can include, for example,
  • phosphorothioates chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates,
  • polyribonucleotide can be negatively or positively charged.
  • polyribonucleotide can be modified on the internucleoside linkage (e.g., phosphate backbone).
  • internucleoside linkage e.g., phosphate backbone
  • phosphodiester are used interchangeably.
  • Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent.
  • the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage as described herein.
  • modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters.
  • Phosphorodithioates have both non-linking oxygens replaced by sulfur.
  • the phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene -phosphonates).
  • the a-thio substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages.
  • Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment.
  • Phosphorothioate linked to the circular polyribonucleotide is expected to reduce the innate immune response through weaker binding/activation of cellular innate immune molecules.
  • a modified nucleoside includes an a-thio-nucleoside (e.g., 5’-0- (l-thiophosphate)-adenosine, 5’-0-(l-thiophosphate)-cytidine (a-thio-cytidine), 5’-0-(l- thiophosphate)-guanosine, 5’-0-(l-thiophosphate)-uridine, or 5’-0-(l-thiophosphate)- pseudouridine).
  • a-thio-nucleoside e.g., 5’-0- (l-thiophosphate)-adenosine, 5’-0-(l-thiophosphate)-cytidine (a-thio-cytidine), 5’-0-(l- thiophosphate)-guanosine, 5’-0-(l-thiophosphate)-uridine, or 5’-0-(l-thiophosphate)- pseudouridine.
  • the circular polyribonucleotide can include one or more cytotoxic nucleosides.
  • cytotoxic nucleosides can be incorporated into circular
  • Cytotoxic nucleoside can include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4’-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, l-(2-C-cyano-2-deoxy-beta-D-arabino- pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((R,S)-5-fluoro-l-(tetrahydrofuran-2-yl)pyrimidine- 2,4(lH,3H)-dione), troxacitabine, tezacitabine, 2’-deoxy-2’-methylidenecytidine (DM)
  • Additional examples include fludarabine phosphate, N4-behenoyl-l-beta-D- arabinofuranosylcytosine, N4-octadecyl- 1 -beta-D-arabinofuranosylcytosine, N4-palmitoyl-l-(2- C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5’-elaidic acid ester).
  • the circular polyribonucleotide can be uniformly modified along the entire length of the molecule.
  • nucleotide e.g., naturally-occurring nucleotides, purine or pyrimidine, or any one or more or all of A, G, U, C, I, pU
  • the circular polyribonucleotide includes a pseudouridine.
  • the circular polyribonucleotide includes an inosine, which can aid in the immune system characterizing the circular polyribonucleotide as endogenous versus viral RNA. The incorporation of inosine can also mediate improved RNA stability/reduced degradation.
  • all nucleotides in the circular polyribonucleotide are modified.
  • nucleotide modifications can exist at various positions in the circular polyribonucleotide.
  • nucleotide analogs or other modification(s) can be located at any position(s) of the circular polyribonucleotide, such that the function of the circular polyribonucleotide is not substantially decreased.
  • a modification can also be a non coding region modification.
  • the circular polyribonucleotide can include from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U, or C) or any intervening percentage (e.g., from 1% to 20%>, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 20% to 95%, from 20%
  • the circular polyribonucleotide provided herein is a modified circular polyribonucleotide.
  • a completely modified circular polyribonucleotide comprises all or substantially all modified adenosine residues, all or substantially all modified uridine residues, all or substantially all modified guanine residues, all or substantially all modified cytidine residues, or any combination thereof.
  • the circular polyribonucleotide provided herein is a hybrid modified circular polyribonucleotide.
  • a hybrid modified circular polyribonucleotide can have at least one modified nucleotide and can have a portion of contiguous unmodified nucleotides.
  • This unmodified portion of the hybrid modified circular polyribonucleotide can have at least about 5, 10, 15, or 20 contiguous unmodified nucleotides, or any number therebetween.
  • the unmodified portion of the hybrid modified circular polyribonucleotide has at least about 30, 40, 40, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 180, 200, 220, 250, 280, 300, 320, 350, 380, 400, 420, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, or 1000 contiguous unmodified nucleotides, or any number therebetween.
  • the hybrid modified circular polyribonucleotide has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more unmodified portions. In some embodiments, the hybrid modified circular polyribonucleotide has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30, 40,
  • the hybrid modified circular polyribonucleotide has at least 1%, 2%, 5%, 7%, 8%, 10%, 12%, 15%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 99% but less than 100% nucleotides that are modified.
  • the unmodified portion comprises a binding site.
  • the unmodified portion comprises a binding site configured to bind a protein, DNA, RNA, or a cell target.
  • the unmodified portion comprises an IRES.
  • the hybrid modified circular polyribonucleotide has a lower immunogenicity than a corresponding unmodified circular polyribonucleotide.
  • the hybrid modified circular polyribonucleotide has an immunogenicity that is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 fold lower than a corresponding unmodified circular polyribonucleotide .
  • the immunogenicity as described herein is assessed by the level of expression or signaling or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-beta.
  • the hybrid modified circular polyribonucleotide has a higher half-life than a corresponding unmodified circular polyribonucleotide.
  • the hybrid modified circular polyribonucleotide has a half-life that is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 fold higher than a corresponding unmodified circular polyribonucleotide.
  • the half-life is measured by introducing the circular polyribonucleotide or the corresponding circular polyribonucleotide into a cell and measuring a level of the introduced circular
  • the hybrid modified circular polyribonucleotide comprises one or more expression sequences.
  • the one or more expression sequences of the hybrid modified circular polyribonucleotide has a translation efficiency similar to or higher than a corresponding unmodified circular polyribonucleotide.
  • the one or more expression sequences of the hybrid modified circular polyribonucleotide have a translation efficiency of that is at least about 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, or 3 fold higher than a corresponding unmodified circular polyribonucleotide.
  • polyribonucleotide have a higher translation efficiency than a corresponding circular
  • polyribonucleotide having a portion comprising a modified nucleotide (e.g., the portion corresponds to the unmodified portion of the hybrid modified circular polyribonucleotide).
  • one or more expression sequences of the circular polyribonucleotide are configured to have a higher translation efficiency than a corresponding circular
  • polyribonucleotide having a first portion comprising more than 10%, or at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% modified nucleotides.
  • the one or more expression sequences of the hybrid modified circular polyribonucleotide has a translation efficiency that is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 fold higher than a
  • the translation efficiency is measured either in a cell comprising the circular polyribonucleotide or the corresponding circular polyribonucleotide, or in an in vitro translation system (e.g., rabbit reticulocyte lysate).
  • the hybrid modified circular polyribonucleotide has a binding site that is unmodified, e.g., having no modified nucleotides. In some embodiments, the hybrid modified circular polyribonucleotide has a binding site configured to bind to a protein, DNA, RNA, or cell target that is unmodified, e.g., having no modified nucleotides. In some embodiments, the hybrid modified circular polyribonucleotide has an internal ribosome entry site (IRES) that is unmodified, e.g., having no modified nucleotides.
  • IRS internal ribosome entry site
  • the hybrid modified circular polyribonucleotide has no more than 10% of the nucleotides in the binding site that are modified nucleotides. In some embodiments, the hybrid modified circular polyribonucleotide has no more than 10% of the nucleotides in the binding site configured to bind to a protein, DNA, RNA, or cell target that are modified nucleotides. In some
  • the hybrid modified circular polyribonucleotide has no more than 10% of the nucleotides in the internal ribosome entry site (IRES) that are modified nucleotides.
  • a hybrid modified circular polyribonucleotide has modified nucleotides throughout except the binding site. In some embodiments, a hybrid modified circular polyribonucleotide
  • polyribonucleotide has modified nucleotides throughout except the binding site configured to bind a protein, DNA, RNA, or a cell target.
  • a hybrid modified circular polyribonucleotide has modified nucleotides throughout except the IRES element.
  • the hybrid modified circular polyribonucleotide has modified nucleotides throughout except the IRES element and one or more other portions.
  • the unmodified IRES element renders the hybrid modified circular polyribonucleotide translation competent, e.g., having a translation efficiency for the one or more expression sequences that is similar to or higher than a corresponding circular
  • polyribonucleotide that does not have any modified nucleotides.
  • the hybrid modified circular polyribonucleotide has modified nucletoides, e.g., 5’ methylcytidine and pseudouridine, throughout the circular
  • the hybrid modified circular polyribonucleotide except the IRES element or a binding site configured to bind a protein, DNA, RNA, or a cell target.
  • the hybrid modified circular polyribonucleotide has a higher a lower immnogeneicity as compared to a corresponding circular polyribonucleotide that does not comprise 5’ methylcytidine and pseudouridine.
  • the hybrid modified circular polyribonucleotide has an immunogenicity that is at least about 1.1, 1.2, 1.3,
  • the immunogenicity as described herein is assessed by expression or signaling or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-beta.
  • the hybrid modified circular segment as described herein is assessed by expression or signaling or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-beta.
  • polyribonucleotide has n higher half-life than a corresponding unmodified circular
  • the hybrid modified circular polyribonucleotide has a higher half-life that is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 fold higher than a corresponding unmodified circular polyribonucleotide.
  • the half-life is measured by introducing the circular polyribonucleotide or the corresponding circular polyribonucleotide into a cell and measuring a level of the introduced circular polyribonucleotide or corresponding circular polyribonucleotide inside the cell.
  • the hybrid modified circular polyribonucleotide as described herein has similar immunogenicity as compared to a corresponding circular polyribonucleotide that is otherwise the same but completely modified.
  • a hybrid modified circular polyribonucleotide that has 5’ methylcytidine and pseudouridine throughout except its IRES element can have similar immunogenicity or lower immunogenicity as compared to a
  • the hybrid modified circular polyribonucleotide that has 5’ methylcytidine and pseudouridine throughout except its IRES element has translation efficiency that is similar to or higher than the translation efficiency of a corresponding circular polyribonucleotide that is otherwise the same but has 5’ methylcytidine and pseudouridine throughout and no unmodified cytidine and uridine.
  • a circRNA of the disclosure can be conjugated, for example, to a chemical compound (e.g., a small molecule), an antibody or fragment thereof, a peptide, a protein, an aptamer, a drug, or a combination thereof.
  • a small molecule can be conjugated to a circRNA, thereby generating a circRNA comprising a small molecule.
  • a circRNA of the disclosure can comprise a conjugation moiety to facilitate conjugation.
  • a conjugation moiety can be incorporated, for example, at an internal site of a circular polynucleotide, or at a 5' end, 3' end, or internal site of a linear polynucleotide.
  • a conjugation moiety can be incorporated chemically or enzymatically.
  • a conjugation moiety can be incorporated during solid phase oligonuleotide synthesis, cotranscriptionally (e.g., with a tolerant RNA polymerase) or posttranscriptionally (e.g., with a RNA methyltransferase).
  • a conjugation moiety can be a modified nucleotide or a nucleotide analog, e.g.,
  • a conjugation moiety can comprise a reactive group or a functional group, e.g., an azide group or an alkyne group.
  • a conjugation moiety can be capable of undergoing a chemoselective reaction.
  • a conjugation moiety can be a hapten group, e.g., comprising digoxigenin, 2,4-dinitrophenyl, biotin, avidin, or selected from azoles, nitroaryl compounds, benzofurazans, triterpenes, ureas, thioureas, rotenones, oxazoles, thiazoles, coumarins, cyclolignans, heterobiaryl compounds, azoaryl compounds or benzodiazepines.
  • a conjugation moiety can comprise a diarylethene photoswitch capable of undergoing reversible electrocyclic rearrangement.
  • a conjugation moiety can comprise a nucleophile, a carbanion, and/or an a,b- unsaturated carbonyl compound.
  • a circRNA can be conjugated via a chemical reaction, e.g., using click chemistry, Staudinger ligation, Pd-catalyzed C-C bond formation (e.g., Suzuki-Miyaura reaction), Michael addition, olefin metathesis, or inverse electron demand Diels-Alder.
  • Click chemistry can utilize pairs of functional groups that rapidly and selectively react (“click”) with each other in appropriate reaction conditions.
  • Non-limiting click chemistry reactions include azide-alkyne cycloaddition, copper-catalyzed l,3-dipolar azide-alkyne cycloaddition (CuAAC), strain- promoted Azide -Alkyne Click Chemistry reaction (SPAAC), and tetrazine - alkene Ligation.
  • Non-limiting examples of functionalized nucleotides include azide modified UTP analogs, 5-Azidomethyl-UTP, 5-Azido-C3-UTP, 5-Azido-PEG4-UTP, 5-Ethynyl-UTP, DBCO- PEG4-UTP, Vinyl-UTP, 8-Azido-ATP, 3'-Azido-2',3'-ddATP, 5-Azido-PEG4-CTP, 5-DBCO- PEG4-CTP, N6-Azidohexyl-3'-dATP, 5-DBCO-PEG4-dCpG, and 5-azidopropyl-UTP.
  • a circRNA comprises at least one 5-Azidomethyl-UTP, 5-Azido-C3-UTP, 5- Azido-PEG4-UTP, 5-Ethynyl-UTP, DBCO-PEG4-UTP, Vinyl-UTP, 8-Azido-ATP, 5-Azido- PEG4-CTP, 5-DBCO-PEG4-CTP, or 5-azidopropyl-UTP.
  • a single modified nucleotide of choice e.g., modified A, C, G, U, or T containing an azide at the 2'-position
  • modified A, C, G, U, or T containing an azide at the 2'-position can be incorporated site-specifically under optimized conditions (e.g., via solid-phase chemical synthesis).
  • a plurality of nucleotides containing an azide at the 2'- position can be incorporated, for example, by substituting a nucleotide during an in vitro transcription reaction (e.g., substituting UTP for 5-azido-C3-UTP).
  • a circRNA conjugate can be generated using a copper-catalyzed click reaction, e.g., copper-catalyzed 1,3 -dipolar azide-alkyne cycloaddition (CuAAC) of an alkyne-functionalized small molecule and an azide-functionalized polyribonucleic acid.
  • a linear RNA can be conjugated with a small molecule.
  • a linear RNA can be modified at its 3 '-end by a poly(A) polymerase with an azido-derivatized nucleotide.
  • the azide can be conjugated to a small molecule via copper-catalyzed or strain-promoted azide-alkyne click reaction, and the linear RNA can be circularized.
  • a circRNA conjugate can be generated using a Staudinger reaction.
  • a circular RNA comprising an azide-functionalized nucleotide can be conjugated with an alkyne- functionalized small molecule in the presence of triphenylphosphine-3,3',3"-trisulfonic acid (TPPTS).
  • TPTS triphenylphosphine-3,3',3"-trisulfonic acid
  • a circRNA conjugate can be generated using a Suzuki-Miyaura reaction.
  • a circRNA comprising a halogenated nucleotide analog can be subjected to Suzuki-Miyaura reaction in the presence of a cognate reactive partner.
  • a a circRNA comprising 5-Iodouridine triphosphate (IUTP), for example, can be used in a catalytic system with Pd(OAc) 2 and 2- aminopyrimidine-4,6-diol (ADHP) or dimethylamino-substituted ADHP (DMADHP) to functionalize iodouridine-labeled circRNA in the presence of various boronic acid and ester substrates.
  • IUTP 5-Iodouridine triphosphate
  • ADHP 2- aminopyrimidine-4,6-diol
  • DMADHP dimethylamino-substituted ADHP
  • a circRNA comprising 8-bromoguanosine can be reacted with arylboronic acids in the presence of a catalytic system made of Pd(OAc) 2 and a water-soluble triphenylphosphan-3,3 ',3 "-tri sulfonate ligand.
  • a circRNA conjugate can be generated using Michael addition, for example, via reaction of an an electron-rich Michael Donor with an a,b-unsaturated compound (Michael Acceptor).
  • the circular polyribonucleotide comprises a higher order structure, e.g., a secondary or tertiary structure.
  • complementary segments of the circular polyribonucleotide fold itself into a double stranded segment, held together with hydrogen bonds between pairs, e.g., A-U and C-G.
  • helices also known as stems, are formed intra-molecularly, having a double-stranded segment connected to an end loop.
  • the circular polyribonucleotide has at least one segment with a quasi-double-stranded secondary structure.
  • a segment having a quasi- double-stranded secondary structure has at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
  • the circular polyribonucleotide has one or more segments (e.g., 2, 3, 4, 5, 6, or more) having a quasi-double-stranded secondary structure. In some embodiments, the segments are separated by 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
  • nucleotides 80, 85, 90, 95, 100, or more nucleotides.
  • the circular polyribonucleotide has a quasi-helical structure. In some embodiments, the circular polyribonucleotide has at least one segment with a quasi-helical structure. In some embodiments, a segment having a quasi-helical structure has at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleotides. In some embodiments, the circular polyribonucleotide has one or more segments (e.g., 2, 3, 4, 5, 6, or more) having a quasi-helical structure.
  • the segments are separated by 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleotides.
  • the circular polyribonucleotide includes at least one of a U-rich or A-rich sequence or a combination thereof.
  • the U-rich and/or A-rich sequences are arranged in a manner that would produce a triple quasi-helix structure.
  • the circular polyribonucleotide has a double quasi-helical structure. In some embodiments, the circular polyribonucleotide has one or more segments (e.g., 2, 3, 4, 5, 6, or more) having a double quasi-helical structure. In some embodiments, the circular polyribonucleotide has a double quasi-helical structure. In some embodiments, the circular polyribonucleotide has one or more segments (e.g., 2, 3, 4, 5, 6, or more) having a double quasi-helical structure. In some embodiments, the circular
  • polyribonucleotide includes at least one of a C-rich and/or G-rich sequence.
  • the C-rich and/or G-rich sequences are arranged in a manner that would produce triple quasi-helix structure.
  • the circular polyribonucleotide has an intramolecular triple quasi-helix structure that aids in stabilization.
  • the circular polyribonucleotide has two quasi-helical structure (e.g., separated by a phosphodiester linkage), such that their terminal base pairs stack, and the quasi-helical structures become colinear, resulting in a“coaxially stacked” substructure.
  • the circular polyribonucleotide has at least one miRNA binding site, at least one lncRNA binding site, and/or at least one tRNA motif.
  • the circular polyribonucleotide described herein may be included in pharmaceutical compositions with a delivery carrier.
  • compositions described herein can be formulated for example including a pharmaceutical excipient or carrier.
  • a pharmaceutical carrier may be a membrane, lipid bilayer, and/or a polymeric carrier, e.g., a liposome or particle such as a nanoparticle, e.g., a lipid nanoparticle, and delivered by known methods to a subject in need thereof (e.g., a human or non-human agricultural or domestic animal, e.g., cattle, dog, cat, horse, poultry).
  • transfection e.g., lipid-mediated, cationic polymers, calcium phosphate
  • electroporation or other methods of membrane disruption e.g.,
  • the invention is further directed to a host or host cell comprising the circular
  • the host or host cell is a plant, insect, bacteria, fungus, vertebrate, mammal (e.g., human), or other organism or cell.
  • the circular polyribonucleotide is non-immunogenic in the host.
  • the circular polyribonucleotide has a decreased or fails to produce a response by the host’s immune system as compared to the response triggered by a reference compound, e.g., a linear polynucleotide corresponding to the described circular
  • Some immune responses include, but are not limited to, humoral immune responses (e.g., production of antigen-specific antibodies) and cell-mediated immune responses (e.g., lymphocyte proliferation).
  • humoral immune responses e.g., production of antigen-specific antibodies
  • cell-mediated immune responses e.g., lymphocyte proliferation
  • a host or a host cell is contacted with (e.g., delivered to or administered to) the circular polyribonucleotide.
  • the host is a mammal, such as a human.
  • the amount of the circular polyribonucleotide, expression product, or both in the host can be measured at any time after administration. In certain embodiments, a time course of host growth in a culture is determined. If the growth is increased or reduced in the presence of the circular polyribonucleotide, the circular polyribonucleotide or expression product or both is identified as being effective in increasing or reducing the growth of the host.
  • the circular polyribonucleotide includes a deoxyribonucleic acid sequence that is non-naturally occurring and can be produced using recombinant DNA technology or chemical synthesis.
  • a DNA molecule used to produce an RNA circle can comprise a DNA sequence of a naturally-occurring original nucleic acid sequence, a modified version thereof, or a DNA sequence encoding a synthetic polypeptide not normally found in nature (e.g., chimeric molecules or fusion proteins).
  • DNA molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to“build” a mixture of nucleic acid molecules and combinations thereof.
  • the circular polyribonucleotide can be prepared, for example, by chemical synthesis and enzymatic synthesis.
  • a linear primary construct or linear mRNA can be cyclized, or concatemerized to create a circular polyribonucleotide described herein.
  • the mechanism of cyclization or concatemerization can occur through methods such as, but not limited to, chemical, enzymatic, or ribozyme catalyzed methods.
  • the newly formed 5’ - or 3’- linkage can be an intramolecular linkage or an intermolecular linkage.
  • the present invention includes compositions in combination with one or more pharmaceutically acceptable excipients.
  • Pharmaceutical compositions can optionally comprise one or more additional active substances, e.g., therapeutically and/or prophylactically active substances.
  • Pharmaceutical compositions of the present invention can be sterile and/or pyrogen- free. General considerations in the formulation and/or manufacture of pharmaceutical agents can be found, for example, in Remington: The Science and Practice of Pharmacy 2lst ed., Lippincott Williams & Wilkins, 2005, which is incorporated herein by reference.
  • the invention includes a method of producing the pharmaceutical composition described herein comprising generating the circular polyribonucleotide.
  • compositions are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., non-human animals and non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
  • Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys.
  • Formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product.
  • Pharmaceutical compositions described herein can be in unit dosage forms suitable for single administration of precise dosages. In unit dosage form, the formulation is divided into unit doses containing appropriate quantities of one or more compounds. The unit dosage can be in the form of a package containing discrete quantities of the formulation. Non-limiting examples are packaged injectables, vials, or ampoules.
  • Aqueous suspension compositions can be packaged in single-dose non-reclosable containers. Multiple-dose reclosable containers can be used, for example, in combination with or without a preservative. Formulations for injection can be presented in unit dosage form, for example, in ampoules, or in multi-dose containers with a preservative.
  • the invention includes a pharmaceutical composition
  • a pharmaceutical composition comprising (a) a circular polyribonucleotide comprising a binding site that binds a target, e.g., a RNA, DNA, protein, membrane of a cell, etc.; and (b) a pharmaceutically acceptable carrier or excipient; wherein the target and the circular polyribonucleotide form a complex, wherein the target is a not a microRNA.
  • the binding site is a first binding site and the target is a first target.
  • the circular polyribonucleotide further comprises a second binding site that binds to a second target.
  • the invention includes a pharmaceutical composition
  • a pharmaceutical composition comprising (a) a circular polribonucleotidecomprising: (i) a first binding site that binds a first target; and (ii) a second binding site that binds a second target; and (b) a pharmaceutically acceptable carrier or excipient; wherein the first binding site is different than the second binding site, wherein the first target and the second target are microRNA.
  • the first target comprises a first circular polyribonucleotide (circ- RNA)-binding motif.
  • the second target comprises a second circular polyribonucleotide (circRNA)-binding motif.
  • the first target, the second target, and the circular polyribonucleotide form a complex.
  • the first target and second targets interact with each other.
  • the complex modulates a cellular process when contacted to the cell.
  • formation of the complex modulates a cellular process when contacted to the cell.
  • the cellular process is associated with pathogenesis of a disease or condition.
  • the circular polyribonucelotide modulates a cellular process associated with the first or second target when contacted to the cell.
  • the first and second targets interact with each other in the complex.
  • the cellular process is associated with pathogenesis of a disease or condition.
  • the cellular process is different than translation of the circular polyribonucleotide.
  • the first target comprises a deoxyribonucleic acid (DNA) molecule
  • thetarget comprises a protein.
  • the complex modulates directed transcription of the DNA molecule, epigenetic remodeling of the DNA molecule, or degradation of the DNA molecule.
  • the first target comprises a first protein
  • the second target comprises a second protein
  • the complex modulates degradation of the first protein, translocation of the first protein, or signal transduction, or modulates formation of a complex formed by direct interaction between the first and second proteins (e.g., inhibits or promotes formation of a complex).
  • the first target comprises a first ribonucleic acid (RNA) molecule
  • the second target comprises a second RNA molecule.
  • the complex can modulate degradation of the first RNA molecule.
  • the target comprises a protein
  • the second target comprises a RNA molecule.
  • the complex modulates translocation of the protein or inhibits formation of a complex formed by direct interaction between the protein and the RNA molecule.
  • the first target is a receptor
  • the second target is a substrate of the receptor.
  • the complex inhibits activation of the receptor.
  • a“receptor” can refer to a protein molecule that receives chemical signals from outside a cell.
  • the chemical signals can include, without limitation, small molecule organic compounds (e.g., amino acids and derivatives thereof, e.g., glutamate, glycine, gamma-butyrateric acid), lipids, protein or polypeptides, DNA and RNA molecules, and ions.
  • a receptor can be present on cell membrane, in cytoplasm, or in cell nucleus.
  • the chemical signals that bind to a receptor can be generally referred to as“substrate” of the receptor.
  • a receptor Upon binding to the chemical signal, a receptor can cause some form of cellular response by initiating one or more cellular processes, e.g., signaling pathways.
  • a receptor as provided herein can be any type one skilled in the art would recognize, including: (1) ionotropic receptors, which can be the targets of fast
  • neurotransmitters such as acetylcholine (nicotinic) and GABA; and, activation of these receptors results in changes in ion movement across a membrane.
  • They can have a heteromeric structure in that each subunit consists of the extracellular ligand-binding domain and a transmembrane domain where the transmembrane domain in turn includes four transmembrane alpha helices.
  • the ligand-binding cavities can be located at the interface between the subunits;
  • G protein- coupled receptors which can include the receptors for several hormones and slow transmitters e.g., dopamine, metabotropic glutamate. They can be composed of seven transmembrane alpha helices.
  • the loops connecting the alpha helices can form extracellular and intracellular domains; (3) kinase-linked and related receptors ( or receptor tyrosine kinase), which can be composed of an extracellular domain containing the ligand binding site and an intracellular domain, often with enzymatic-function, linked by a single transmembrane alpha helix.
  • Insulin receptor is an example of this type of receptor, of which insulin can be its corresponding substrate;
  • Nuclear_receptor nuclear receptors which can be located in either nucleus, or in the cytoplasm and migrate to the nucleus after binding with their ligands. They can be composed of a C-terminal ligand-binding region, a core DNA-binding domain (DBD) and an N-terminal domain that contains the AF1 (activation function 1) region.
  • DBD core DNA-binding domain
  • AF1 activation function 1
  • the invention includes a pharmaceutical composition
  • a pharmaceutical composition comprising (a) a circular polyribonucleotide comprising a binding site that binds a target; and (b) a
  • the circular polyribonucleotide is translation incompetent or translation defective, wherein the target is not a microRNA.
  • the invention includes a pharmaceutical composition
  • a pharmaceutical composition comprising (a) a circular polyribonucleotide comprising a binding site that binds a target, wherein the target comprises a first ribonucleic acid (RNA)-binding motif; and (b) a pharmaceutically acceptable carrier or excipient; wherein the circular polyribonucleotide is translation incompetent or translation defective, wherein the target is a microRNA.
  • target comprises a DNA molecule.
  • binding of the target to the circular polyribonucleotide modulates interference of transcription of the DNA molecule.
  • the target comprises a protein.
  • binding of target to the circular polyribonucleotide inhibits interaction of the protein with other molecules.
  • the protein is a receptor, and binding of the target to the circular polyribonucleotide activates the receptor.
  • the protein is a first enzyme
  • the circular polyribonucleotide further comprises a second binding site that binds to a second enzyme
  • binding of the first and second enzymes to the circular polyribonucleotide modulates enzymatic activity of the first and second enzymes.
  • the target comprises a messenger RNA (mRNA) molecule.
  • mRNA messenger RNA
  • binding of the target to the circular polyribonucleotide modulates interference of translation of the mRNA molecule.
  • the target comprises a ribosome.
  • binding of the target to the circular polyribonucleotide modulates interference of a translation process.
  • the target comprises a circular RNA molecule.
  • the invention includes a pharmaceutical composition comprising (a) a circular polyribonucleotide comprising a binding site that binds a cell membrane of a target cell; and wherein the cell membrane of a target cell comprises a first ribonucleic acid (RNA)-binding motif; and (b) a pharmaceutically acceptable carrier or excipient.
  • a pharmaceutical composition comprising (a) a circular polyribonucleotide comprising a binding site that binds a cell membrane of a target cell; and wherein the cell membrane of a target cell comprises a first ribonucleic acid (RNA)-binding motif; and (b) a pharmaceutically acceptable carrier or excipient.
  • the circular polyribonucleic acid further comprises a second binding site that binds a second membrane of a second target cell, wherein the second cell membrane of the second target cell comprises a second RNA-binding motif.
  • the circular polyribonucleotide binds to both the cell membrane on the target cell and the second cell membrane of the second target cell, and cellular fusion of the first and second target cells is modulated.
  • the circular polyribonucleotide further comprises a second binding site that binds a second target, and binding of both the first and targets to the circular polyribonucleotide induces a conformational change in the first target, thereby inducing signal transduction downstream of the first target in the first cell.
  • the circular polyribonucleotide is translation incompetent or translation defective.
  • the circular polyribonucleic acid further comprises at least one structural element selected from: a) an encryptogen; b) a splicing element; c) a regulatory sequence; d) a replication sequence; e) quasi-double-stranded secondary structure; and f) expression sequence.
  • the quasi-helical structure comprises at least one double-stranded RNA segment with at least one non-double-stranded segment.
  • the quasi-helical structure comprises a first sequence and a second sequence linked with a repetitive sequence, e.g., an A-rich sequence.
  • the encryptogen comprises a splicing element.
  • the circular polyribonucleic acid comprises at least one modified nucleic acid.
  • the at least one modified nucleic acid is selected from the group consisting of 2’-0-methyl, 2’-0-methoxyethyl (2’-0-MOE), 2’-0-aminopropyl, 2’-deoxy, T-deoxy-2’-fluoro, 2’-0-aminopropyl (2’-0-AP), 2’-0-dimethylaminoethyl (2’-0-DMAOE), 2’-0-dimethylaminopropyl (2’-0-DMAP), T-O-dimethylaminoethyloxyethyl (2’-0-DMAEOE), 2’-0-N-methylacetamido (2’-0-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a l’,5’-anhydrohex
  • polyribonucleotide comprises modified nucleotides and an unmodified IRES.
  • the encryptogen comprises at least one modified nucleic acid, e.g., pseudo-uridine and N(6)methyladenosine (m6A).
  • the encryptogen comprises a protein binding site, e.g., a ribonucleic acid binding protein.
  • the encryptogen comprises an immunoprotein binding site, e.g., to evade CTL responses.
  • the circular polyribonucleic acid has at least 2x lower
  • the circular polyribonucleic acid has a size in the range of about 20 bases to about 20 kb. In some embodiments, the circular polyribonucleic acid is synthesized through circularization of a linear polynucleotide. In some embodiments, the circular polyribonucleic acid is substantially resistant to degradation.
  • Circular polyribonucleotides described herein can be administered to a cell, tissue or subject in need thereof, e.g., to modulate cellular function or a cellular process, e.g., gene expression in the cell, tissue or subject.
  • the invention also contemplates methods of modulating cellular function or a cellular process, e.g., gene expression, comprising adminstering to a cell, tissue or subject in need thereof a circular polyribonucleotide described herein.
  • the administered circular polyribonucleotides can be modified circular polyribonucleotides.
  • the administered circular polyribonucleotides are completely modified circular polyribonucleotides. In some embodiments, the administered circular polyribonucleotides are hybrid modified circular polyribonucleotides. In other embodiments, the administered circular polyribonucleotides are unmodified circular polyribonucleotides.
  • a pharmaceutical composition comprising:
  • a circular polyribonucleotide comprising a binding site that binds a target, e.g., a RNA, DNA, protein, membrane of cell etc.;
  • the target is a not a microRNA.
  • a pharmaceutical composition comprising:
  • first and second targets interact with each other in the complex.
  • a pharmaceutical composition comprising:
  • circular polyribonucleotide is translation incompetent or translation defective, and wherein the target is not a microRNA.
  • a pharmaceutical composition comprising:
  • RNA ribonucleic acid
  • the circular polyribonucleotide is translation incompetent or translation defective, and wherein the target is a microRNA.
  • a pharmaceutical composition comprising:
  • RNA ribonucleic acid
  • the binding site comprises an aptamer sequence having a secondary structure that binds the membrane of the cell (e.g., cell wall membrane, organelle membrane, etc.).
  • the circular polyribonucleotide further comprises a second binding site that binds to a second target, wherein the second target comprises a second RNA-binding motif.
  • polyribonucleotide binds to the membrane of the cell and the second target.
  • polyribonucleotide induces a conformational change in the cell target, thereby inducing signal transduction downstream of the cell target.
  • encryptogen comprises a splicing element.
  • encryptogen comprises at least one modified nucleic acid.
  • encryptogen comprises a protein binding site.
  • encryptogen comprises an immunoprotein binding site.
  • a pharmaceutical composition comprising:
  • RNA ribonucleic acid
  • the circular polyribonucleotide comprises at least one modified nucleotide and a first portion that comprises at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous unmodified nucleotides.
  • a pharmaceutical composition comprising:
  • RNA ribonucleic acid
  • the circular polyribonucleotide comprises at least one modified nucleotide and a first portion that comprises at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides, and wherein the first portion lacks pseudouridine or 5’-methylcytidine.
  • nucleic acid is selected from the group consisting of 2’-0-methyl, 2’-0- methoxyethyl (2’-0-MOE), 2’-0-aminopropyl, 2’-deoxy, T-deoxy-2’-fluoro, 2’-0- aminopropyl (2’-0-AP), 2’-0-dimethylaminoethyl (2’-0-DMAOE), 2’-0- dimethylaminopropyl (2’-0-DMAP), T-O-dimethylaminoethyloxy ethyl (2’-0-DMAEOE), 2’-0-N-methylacetamido (2’-0-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a l’,5’-anhydrohexitol nucleic acid (HNA), a morpholin
  • translation efficiency is measured either in a cell comprising the circular polyribonucleotide or the corresponding circular polyribonucleotide, or in an in vitro translation system (e.g., rabbit reticulocyte lysate).
  • an in vitro translation system e.g., rabbit reticulocyte lysate
  • a method of treatment comprising administering the pharmaceutical composition of any one of paragraphs [l]-[95] to a subject with a disease or condition.
  • a method of producing a pharmaceutical composition comprising generating the
  • a method of binding a target in a cell comprising:
  • a translation incompetent circular polyribonucleotide comprising an aptamer sequence, wherein the aptamer sequence has a secondary structure that binds the target;
  • a method of binding a target in a cell comprising: delivering a translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the target, and wherein the translation incompetent circular polyribonucleotide forms a complex with the target detectable at least 5 days after delivery.
  • nucleic acid molecule is a DNA molecule or an RNA molecule.
  • DNA molecule directed transcription of a DNA molecule, epigenetic remodeling of a DNA molecule, or degradation of DNA molecule.
  • a method of binding a transcription factor in a cell comprising:
  • a method of binding a transcription factor in a cell comprising:
  • the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the transcription factor, and wherein the translation incompetent circular polyribonucleotide
  • polyribonucleotide forms a complex with the transcription factor and modulates gene expression.
  • a method of sequestering a transcription factor in a cell comprising:
  • the translation incompetent circular polyribonucleotide sequesters the transcription factor by binding the transcription factor to form a complex in the cell.
  • a method of sequestering a transcription factor in a cell comprising:
  • the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the transcription factor, and wherein the translation incompetent circular polyribonucleotide
  • polyribonucleotide sequesters the transcription factor by binding the transcription factor to form a complex.
  • a method of sensitizing a cell to a cytotoxic agent comprising:
  • the cytotoxic agent and the translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide forms a complex with the transcription factor in the cell; thereby sensitizing the cell to the cytotoxic agent compared to a cell lacking the translation incompetent circular polyribonucleotide.
  • a method of sensitizing a cell to a cytotoxic agent comprising:
  • the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the transcription factor
  • incompetent circular polyribonucleotide forms a complex with the transcription factor in the cell
  • a method of binding a pathogenic protein in a cell comprising:
  • a method of binding a pathogenic protein in a cell comprising:
  • the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the pathogenic protein; and wherein the translation incompetent circular polyribonucleotide
  • polyribonucleotide forms a complex with the pathogenic protein for degrading the pathogenic protein.
  • a method of binding a ribonucleic acid molecule in a cell comprising:
  • a method of binding a ribonucleic acid molecule in a cell comprising: delivering a translation incompetent circular polyribonucleotide to the cell, wherein the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the ribonucleic acid molecule; wherein the translation incompetent circular polyribonucleotide forms a complex with the ribonucleic acid molecule in the cell.
  • a method of binding genomic deoxyribonucleic acid molecule in a cell comprising:
  • the translation incompetent circular polyribonucleotide forms a complex with the genomic deoxyribonucleic acid molecule and modulates gene expression.
  • a method of binding genomic deoxyribonucleic acid molecule in a cell comprising:
  • the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the genomic deoxyribonucleic acid molecule; wherein the translation incompetent circular polyribonucleotide forms a complex with the genomic deoxyribonucleic acid molecule and modulates gene expression.
  • a method of binding a small molecule in a cell comprising:
  • the translation incompetent circular polyribonucleotide forms a complex with the small molecule and modulates a cellular process (e.g., protein degradation, cell signaling, gene expression, etc.).
  • a cellular process e.g., protein degradation, cell signaling, gene expression, etc.
  • a method of binding a small molecule in a cell comprising:
  • the translation incompetent circular polyribonucleotide comprises an aptamer sequence that binds the small molecule; wherein the translation incompetent circular polyribonucleotide forms a complex with the small molecule and modulates a cellular process (e.g., protein degradation, cell signaling, gene expression, etc.).
  • a cellular process e.g., protein degradation, cell signaling, gene expression, etc.
  • composition comprising a translation incompetent circular polyribonucleotide
  • aptamer sequence comprising an aptamer sequence, wherein the aptamer sequence has a secondary structure that binds a target.
  • a pharmaceutical composition comprising a translation incompetent circular
  • polyribonucleotide comprising an aptamer sequence, wherein the aptamer sequence has a secondary structure that binds the target; and a pharmaceutically acceptable carrier or excipient.
  • a cell comprising the translation incompetent circular polyribonucleotide of any one of paragraphs [101]-[141]
  • a method of treating a subject in need thereof comprising administering the composition of any one of paragraphs [101]-[140] or the pharmaceutical composition of paragraph [141]
  • Example 1 Circular RNA that binds DNA to regulate gene expression
  • This Example describes circular RNA binding to DNA to regulate gene expression.
  • a non-naturally occurring circular RNA is engineered to include a sequence within a model target gene, in this case, the dihydrofolate reductase (DHFR) gene.
  • DHFR dihydrofolate reductase
  • DHFR plays a critical role in regulating the amount of tetrahydrofolate in the cell. Tetrahydrofolate and its derivatives are essential for purine and thymidylate synthesis, which are important for cell proliferation and cell growth.
  • DHFR plays a central role in the synthesis of nucleic acid precursors. As shown in the following Example, the circular RNA binds to the DHFR gene to suppress its transcription.
  • Circular RNA is designed to include the DHFR binding sequence 5’- AC A A AU GGGG AC G AGGGGGGC GGGGC GGC C - 3’ (SEQ ID NO: 5).
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment including the DHFR binding sequence described above.
  • RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • one circular RNA binding to the DHFR genomic DNA is assessed through several methods including CHART-qPCR, which evaluates direct RNA binding to the genomic DNA, DHFR transcript specific qPCR, as well as cellular proliferation and cell growth assays. Active binding of circular RNA to the DHFR gene is expected to result in decreased DHFR transcription, a decrease in purine and thymidylate synthesis, and decreased cell proliferation and cell growth.
  • Example 2 Circular RNA that binds dsDNA to regulate gene expression
  • This Example describes circular RNA binding to dsDNA to regulate gene expression.
  • a non-naturally occurring circular RNA is engineered to include a sequence that binds to a model target gene, in this case, transforming growth factor beta (TGF-b) target sequences.
  • TGF-b is secreted by many cell types. After binding to the TGF-b receptor, the receptor phosphorylates and activates a signaling cascade that leads to the activation of different downstream substrates and regulatory proteins.
  • TGF-b target genes to suppress their transcription.
  • Circular RNA is designed to include the TGF-b target binding sequence 5’- CGGAGAGCAGAGAGGGAGCG-3’ (SEQ ID NO: 6).
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the TGF-b binding sequence. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M), or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to dsDNA is evaluated through a triplex immune capture assay.
  • TFO Triplex Forming Oligonucleotide
  • ssRNA molecule either control sequence or targeting sequence 5’ -CGGAGAGC AGAGAGGGAGCG-3’ (SEQ ID NO: 7)
  • DNA pulled down by the biotinylated targeting or control TFOs are sequenced to determine DNA sequences enriched following RNA- dsDNA pulldown.
  • RNA-DNA binding alternatives include CHART-qPCR and gel mobility shift assay where the targeting ssRNA oligo (5’-CGGAGAGC AGAGAGGGAGCG-3’ (SEQ ID NO: 7)) interacts with the target dsDNA oligo (5’-AGAGAGAGGGAGAGAG-3’ (SEQ ID NO: 8) and 3’-TCTCTCTCCCTCTCTC-5’ (SEQ ID NO: 9)) but not control DNA oligos.
  • Additional assessments for functional changes induced following target RNA binding include changes in TGF-b target genes, including TGFB2, TGFBR1 and/or SMAD2, measured by qPCR.
  • Example 3 Circular RNA that binds DNA to regulate gene expression
  • This Example describes circular RNA binding to DNA to inhibit transcription factor binding.
  • a non-naturally occurring circular RNA is engineered to include a binding sequence to a target sequence, here a gamma globin transcription factor binding sequence.
  • Fetal hemoglobin is the main oxygen transport protein in the human fetus during the last seven months of development in the uterus and persists in the newborn until roughly 6 months after birth. Fetal hemoglobin binds oxygen with greater affinity than adult hemoglobin, giving the developing fetus better access to oxygen from the mother’s bloodstream. In newborns, fetal hemoglobin is nearly completely replaced by adult hemoglobin by approximately 6 months postnatally.
  • GATA-l is a constituent of the repressor complex GATA-l-FOG-l-Mi2b that binds at the -567 G g/-566 A g-globin GATA motifs.
  • the following Example describes circular RNA binding to the -567 c 'y/-566 A y-globin GATA motifs (GenBank coordinates 33992 to 33945 from accession file GI455025 and GenBank coordinates 38772 to 38937 from accession file
  • Circular RNA is designed to include the non-deletional binding sequence where inhibitory transcription factor complex GATA1, Mi2b or FOG1, binds.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the transcription factor binding sequence. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to DNA is assessed through a direct DNA binding method like CHART-qPCR and function is assessed through methods like the activation and expression of fetal hemoglobin. Active binding of circular RNA to regulatory elements upstream of the y- globin genes is expected to result in competitive inhibition of the transcription factor, BCL11 A, or other inhibitory transcription factors to activate HbF transcription. Changes in HbF levels may be measured through HPLC analysis, flow cytometric analysis, and/or qPCR.
  • This Example describes circular RNA binding to a DNA duplex.
  • a non-naturally occurring circular RNA can be engineered to include a DNA binding sequence to the major groove.
  • Short (l5-mer) RNA oligonucleotides can form a stable triple helical RNA:DNA complex.
  • the third strand in the triplex structure i.e. the TFO
  • the specificity and stability of the triplex structure is afforded via Hoogsteen hydrogen bonds, which are different from those formed in classical Watson- Crick base pairing in duplex DNA.
  • the TFO binds to the purine-rich strand of the target duplex through the major groove.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having polypurine sequence of 10-15 bases. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to DNA is assessed through a direct DNA binding method, such as CHART-qPCR, which evaluates direct RNA binding to the genomic DNA.
  • Alternative methods to evaluate circular RNA binding to dsDNA include a triplex immune capture assay and gel mobility shift assay.
  • This Example describes circular RNA binding to and sequestering RNA transcripts.
  • a non-naturally occurring circular RNA is engineered to include one or more novel binding sequences for RNA transcripts.
  • RNA molecules with expanded CGG tracts are targeted for circular RNA binding.
  • the circular RNA binds to the repeat region of the RNA for sequestration.
  • Circular RNA is designed to include the complementary sequence to 50-220 FMR1 expansion repeats 5’-CGG-3’.
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the 50-220 FMR1 expansion repeats. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to FMR1 mRNA is evaluated by an oligonucleotide pull-down- qPCR assay, in which modified oligonucleotides complementary to the circular RNA are used to pull-down the FMR1 mRNA, which is reverse transcribed and qPCR amplified. Binding is also assessed by colocalization of two fluorescent oligos, one specific for the FMR1 mRNA and one complementary to the circular RNA and evaluation by RNA FISH.
  • Example 6 Circular RNA that binds and sequesters RNA transcripts
  • This Example describes circular RNA binding to and sequestering RNA transcripts.
  • a non-naturally occurring circular RNA is engineered to include one or more novel binding sequences for RNA transcripts.
  • SCA8 utilizes an expansion repeat of CTG.
  • the CTG repeat occurs in a gene that is transcribed but not translated. As shown in the following
  • the circular RNA binds to the repeat region of the mRNA for sequestration.
  • Circular RNA is designed to include the complementary sequence to 50-120 SCA8 expansion repeats 5’-CUG-3’.
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the 50-120 SCA8 expansion repeats. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to SCA1 RNA is evaluated by an oligonucleotide pull-down- qPCR assay, in which modified oligonucleotides complementary to the circular RNA are used to pull-down the SCA8 expansion repeats, which are reverse transcribed and qPCR amplified.
  • RNA FISH is also used to asses binding by colocalization of two fluorescent oligos, one specific for the SCA8 RNA and one complementary to the circular RNA is evaluated by RNA FISH.
  • This Example describes circular RNA binding to and sequestering RNA transcripts.
  • a synthetic circular RNA is engineered to include one or more novel binding sequences for RNA transcripts.
  • the huntingtin (HTT) gene includes a segment of 6-35 glutamine residues in its wild-type form. As shown in the following Example, the circular RNA binds to the repeat region of the mRNA for sequestration.
  • Circular RNA is designed to include the complementary sequence to 40-120 HTT expansion repeats 5’-C AG-3’.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the 40-120 HTT expansion repeats. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • oligonucleotide pull-down-qPCR assay in which modified oligonucleotides complementary to the circular RNA are used to pull-down the HTT RNA, which are reverse transcribed and qPCR amplified.
  • RNA FISH is also used to asses binding by colocalization of two fluorescent oligos, one specific for the HTTA and one complementary to the circular RNA is evaluated by RNA FISH.
  • Example 8 Circular RNA that binds and sequesters RNA transcripts and enzyme
  • This Example describes circular RNA simultaneously binding to and sequestering RNA transcripts and protein to aid in RNA degradation.
  • a non-naturally occurring circular RNA is engineered to include one or more novel binding sequences for transcripts as well as a protein to aid in transcript degradation.
  • the atrophin-l protein is encoded by the ATN1 and is used as a model system.
  • the encoded protein includes a serine repeat, a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat.
  • ATN1 gene has a segment of DNA called the C AG trinucleotide repeat.
  • mRNAs In eukaryotic cells, most mRNAs have a 5' monomethyl guanosine cap structure and a 3' poly(A) tail which are important for mRNA translation and stability. Removal of the 5 'cap structure (decapping) is a prerequisite for decay of the mRNA body from the 5' end.
  • the Dcp2 protein has been identified as the major mRNA decapping enzyme in cells. As shown in the following Example, the circular RNA binds to the repeat region of the mRNA for sequestration and Dcp2 protein for decapping of the mRNA.
  • Circular RNA is designed to include the complementary sequence to 40-120 ATN1 expansion repeats 5’-CAG-3’ and RNA cap structure for recognition by Dcp2.
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the 40-120 ATN1 expansion repeats and RNA cap structure for recognition by Dcp2. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated electrophoresis (Agilent).
  • One method to assess circular RNA binding to ATN1 RNA is evaluated by an oligonucleotide pull-down-qPCR assay, in which modified oligonucleotides complementary to the circular RNA are used to pull-down the ATN1 RNA, which are reverse transcribed and qPCR amplified. Decapping function is evaluated by qSL-RT-PCR, which combines splinted ligation and quantitative RT-PCR (Blewett, et al., RNA, 2011, Mar, 17(3): 535-543).
  • This Example describes circular RNA binding to a target mRNA, creating a ribozyme cleavage site.
  • a non-naturally occurring circular RNA is engineered to include a sequence that binds to the M2 isoform of pyruvate kinase mRNA. As shown in the following Example, the circular RNA binds to the target M2 isoform of pyruvate kinase (PK), resulting in its cleavage.
  • PK pyruvate kinase
  • Circular RNA is designed to include sequences complementary to the M2 isoform of pyruvate kinase that will generate a VS ribozyme cleavage site in the target. Circular RNA additionally includes sequences for the trans-acting VS ribozyme and the coding sequence for the Ml isoform of pyruvate kinase.
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the M2 isoform complementary sequence, VS ribozyme, and Ml coding sequence. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M), or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to, and concomitant degradation of, PK M2 mRNA is evaluated by RT-PCR. Restored expression of PK Ml mRNA is evaluated in a similar manner.
  • PK Ml and PK M2 proteins are evaluated by western blotting.
  • Evidence for functional changes induced following target RNA binding and cleavage include cell proliferation assays.
  • This Example describes circular RNA binding to a model target mRNA, creating a ribozyme cleavage site.
  • a non-naturally occurring circular RNA is engineered to include a sequence that binds to the SRSF1 mRNA
  • the following Example describes the circular RNA binding to the target SRSF1 mRNA, resulting in its cleavage.
  • Circular RNA is designed to include sequences complementary to tSRSFl mRNA that will generate a VS ribozyme cleavage site in the target. Circular RNA additionally contains sequences for the trans-acting VS ribozyme and the coding sequence for the Ml isoform of pyruvate kinase. Other trans-acting ribozymes, such as HDV, hammerhead, group I, and/or group II, are utilized.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having SRSF1 complementary sequence, VS ribozyme. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M), or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to, and concomitant degradation of, SRSF1 mRNA is evaluated by RT-PCR.
  • Expression of SRSF1 protein is evaluated by western blotting. Additional evidence for changes induced following target RNA binding and cleavage include cell proliferation assays.
  • This Example describes circular RNA binding circular RNA.
  • Circular RNA may be present in certain cell lines.
  • One such example is circ-Dnmtl.
  • the circular RNA binds to circ-Dnmtl.
  • a circular RNA is designed to include a complementary sequence to circ-Dnmtl to inhibit its RNA-protein interactions.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the appropriate sequences. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • One method to assess circular RNA binding to circ-Dnmtl is by pull-down of circular RNA using a biotinylated oligo complementary to a region of the circular RNA followed by RT- PCR. Additionally, electrophoretic mobility shift assay is used to visualize circular RNA- circDnmtl complexes.
  • This Example describes circular RNA binding two separate miRNAs.
  • a circular RNA is designed to include a complementary sequence to two model miRNAs, here miR-9 and miR-l269.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment having the appropriate sequences. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • RNA binding to miR-9 and miR-l269 is by pull-down of circular RNA using a biotinylated oligo complementary to a region of the circular RNA followed by RT-PCR. Additionally, electrophoretic mobility shift assay is used to visualize circular RNA-miRNA-miRNA complexes.
  • Example 13 Circular RNA that binds and sequesters at least two individual RNA transcripts
  • This Example describes circular RNA binding to and sequestering at least two model RNA transcripts.
  • a synthetic circular RNA is engineered to include two or more novel binding sequences for RNA transcripts.
  • SCA8 utilizes an expansion repeat of CTG.
  • the FMR1 gene includes CGG expansions.
  • the circular RNA binds to the repeat region of RNA transcripts for sequestration.
  • the circular RNA binds to the repeat region of the RNA for sequestration of either the FMR1 or SCA8 expansion repeats.
  • Circular RNA is designed to include the complementary sequence to 50-220 FMR1 expansion repeats 5’-CGG-3’ and the complementary sequence to 50-120 SCA8 expansion repeats 5’-CUG-3 ⁇
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA
  • RNA purification system QIAGEN
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to FMR1 or SCA1 mRNA is evaluated by an oligonucleotide pull- down-qPCR assay, in which modified oligonucleotides complementary to the circular RNA are used to pull-down the FMR1 or SCA1 mRNA, which is reverse transcribed and qPCR amplified. Binding is also assessed by colocalization of fluorescent oligos, one specific for the FMR1 or SCA1 mRNA and one complementary to the circular RNA and fluorescence is evaluated by RNA FISH.
  • This Example describes circular RNA binding to protein for sequestration.
  • TAR-DNA binding protein-43 (TDP-43) is a multifunctional heterogeneous
  • TDP-43 comprises two RNA recognition motifs (RRMs), a nuclear localization signal and a nuclear export sequence mediating nuclear shuttling, as well as a C-terminal glycine-rich domain (GRD) implicated in TDP-43 protein interactions and functions.
  • RRMs RNA recognition motifs
  • GGD C-terminal glycine-rich domain
  • Circular RNA is designed to include the TDP-43 RNA binding motifs: 5’- (UG)nUA(UG)m-3 ⁇ 5’ -GAGAGAGCGCGUGUGUGUGUGUGGUGGUGCAUA-3’ (SEQ ID NO: 10) or (EiG) 6 and a protein binding sequence for the C-terminal glycine-rich domain to competitively bind TDP-43 and inhibit its binding/downstream functions.
  • ETnmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment comprising the TDP-43 RNA motif and protein binding sequence for the C-terminal glycine-rich domain. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • Circular RNA binding to TDP-43 is evaluated in vitro by EMSA (RNA electrophoretic mobility shift assay). When TDP-43 is bound to circRNA migration speed during the gel electrophesis is slower than that of unbound circular RNA. Also, RIP (RNA
  • TDP-43 localization is analyzed in cells treated with and without circular RNA. If circular RNA sequesters TDP-43, TDP-43 localization is expected to remain in the cytoplasm. Additionally, in TDP43 sequestration by circular RNA is expected to result in increased survival.
  • This Example describes circular RNA binding to protein for sequestration.
  • Pre-mRNA-processing-splicing factor 8 is a protein that in humans is encoded by the PRPF8 gene and is a component of both U2- and Ul2-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. As shown in the following Example, the circular RNA binds to PRPF8 for sequestration.
  • Circular RNA is designed to include at the PRPF8 RNA binding motif 5’- AUUGCCUAUAGAACUUAUAACGAACAUGGUUCUUGCCUUUACCAGAACCAUCC GGGUGUUGUCUCC AUAGA-3’ (SEQ ID NO: 11) to competitively bind PRPF8 and inhibit its function.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA
  • RNA purification system QIAGEN
  • RNA purification system (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • RNA electrophoretic mobility shift assay RNA electrophoretic mobility shift assay
  • This Example describes circular RNA binding to a model protein for sequestration.
  • the human LIN28A homolog is an RNA binding protein (RBP) with an N-terminal cold- shock domain (CSD) and two C-terminal CysCysHisCys (CCHC) zinc finger domains.
  • RBP RNA binding protein
  • CCD cold- shock domain
  • CCHC CysCysHisCys
  • Human LIN28A is predominantly cytoplasmic and associates with cellular components, such as ribosomes, P-bodies, and stress granules.
  • the circular RNA binds to LIN28A for sequestration.
  • Circular RNA is designed to include the preE M -let-7f sequence, 5’- GGGGUAGUGAUUUUACCCUGGAGAU-3’ (SEQ ID NO: 12), an RNA sequence with the LIN28A GGAG binding motif to competitively bind LIN28A.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA
  • RNA purification system QIAGEN
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • RNA electrophoretic mobility shift assay RNA electrophoretic mobility shift assay
  • Example 17 Circular RNA that binds protein
  • This Example describes circular RNA binding to a model protein for sequestration.
  • CUG-binding protein 1 regulates gene expression at the levels of alternative splicing, mRNA degradation, and translation.
  • Posttranscriptional regulatory network involves the RNA-binding protein CUG-binding protein 1 (CUGBP1), also referred to as CUGBP- and ELAV-like family member 1 (CELF1), which binds to a GU-rich element (GRE) residing in the 3'-UTR of target transcripts and mediates degradation of GRE-containing transcripts.
  • GRE GU-rich element
  • the circular RNA binds to CUGBP 1 for sequestration.
  • Circular RNA is designed to include at least one RNA motif having
  • UGU(G/U)UGU(G/U)UGU that is recognized by CUGBP1 and competitively bind CUGBP1.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment‘comprising CUGBP 1 binding sequence. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • RNA electrophoretic mobility shift assay RNA electrophoretic mobility shift assay
  • This Example describes circular RNA binding to a model protein for sequestration.
  • Gemin5 is a RNA-binding protein (RBP) is a predominantly cytoplasmic protein with a C-terminal domain harboring a non-canonical bipartite RNA-binding site consisting of RBS1 and RBS2 domains. Additionally, Gemin5 binds the 7-methylguanosine (m7G) cap present in RNA Polymerase II transcripts and downregulates internal ribosome entry site-dependent translation. Gemin5 may control global protein synthesis through its direct binding to the ribosome by acting as a platform, serving as a hub for distinct RNA-protein networks. The following Example describes the circular RNA binding to GEMIN5 for sequestration.
  • RBP RNA-binding protein
  • m7G 7-methylguanosine
  • Circular RNA is designed to include the domain 5 of the Foot and Mouth Disease Virus (FMDV) IRES sequence and competitively bind GEMIN5.
  • FMDV Foot and Mouth Disease Virus
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA polymerase from a DNA segment comprising GEMIN5 binding sequence. Transcribed RNA is purified with an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) following the manufacturer’s instructions, and purified again with the RNA purification system.
  • QIAGEN RNA purification system
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated electrophoresis (Agilent). [0452] One method to assess circular RNA binding to GEMIN5 is EMSA (RNA electrophoretic mobility shift assay). When GEMIN5 is bound to circular RNA, migration speed during the gel electrophesis is slower than that of unbound circular RNA. Also, RIP (RNA
  • This Example describes circular RNA simultaneously binding to two model proteins.
  • the E3 ubiquitin ligase, MDM2 binds and ubiquitinates proteins, such as p53, marking them for degradation by the proteasome.
  • MDM2 The E3 ubiquitin ligase, MDM2 binds and ubiquitinates proteins, such as p53, marking them for degradation by the proteasome.
  • the following example describes the circular RNA simultaneously binding to MDM2 and p53 to enhance the MDM2-dependent ubiquitination of p53, as illustrated in FIG. 16.
  • Circular RNA is designed to include the sequence of FOX3 RNA that binds MDM2 and p53.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA
  • RNA purification system QIAGEN
  • alkaline phosphatase ThermoFisher Scientific, EF0652
  • Splint ligation circular RNA is generated by treatment of the transcribed linear RNA and a DNA splint using T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S) and the circular RNA is isolated following enrichment with RNase R treatment. RNA quality is assessed by agarose gel or through automated
  • One method to assess circular RNA binding to MDM2 and p53 is by electrophoretic mobility shift assay to visualize each RNA-protein complex or alternatively by pull-down of circular RNA using a biotinylated oligo complementary to a region of the circular RNA followed by immunoblotting. Additionally, MDM2 ubiquitination of p53 through binding of circular RNA is assayed via immunoblotting with anti-ubiquitin antibodies or by mass- spectrometry.
  • Example 20 Circular RNA that binds DNA and protein
  • This Example describes circular RNA simultaneously binding to DNA and a model protein, here CBP/p300.
  • CBP/p300 proteins associate with enhancer regions through interactions with eRNAs. RNA binding by CBP/p300 in turn enhances CBP’s histone acetyl transferase (HAT) activity. Additionally, CBP and p300 associate with other HATs as well as transcription factors and components of the transcription machinery.
  • HAT histone acetyl transferase
  • Circular RNA is designed to include the CBP/p300-binding region of eMdm2 eRNA as well as a region complementary to a target genomic locus.
  • Unmodified linear RNA is synthesized by in vitro transcription using T7 RNA
  • RNA purification system QIAGEN
  • alkaline phosphatase alkaline phosphatase

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2019/043272 2018-07-24 2019-07-24 Compositions comprising circular polyribonucleotides and uses thereof Ceased WO2020023655A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
EP19840286.9A EP3827084A4 (en) 2018-07-24 2019-07-24 COMPOSITIONS WITH CIRCULAR POLYRIBONUCLEOTIDS AND USES THEREOF
BR112021001343-1A BR112021001343A2 (pt) 2018-07-24 2019-07-24 composições compreendendo poliribonucleotídeos circulares e seus usos
US17/262,591 US20210292761A1 (en) 2018-07-24 2019-07-24 Compositions comprising circular polyribonucleotides and uses thereof
SG11202100750XA SG11202100750XA (en) 2018-07-24 2019-07-24 Compositions comprising circular polyribonucleotides and uses thereof
AU2019312269A AU2019312269A1 (en) 2018-07-24 2019-07-24 Compositions comprising circular polyribonucleotides and uses thereof
CN201980051856.2A CN112567038A (zh) 2018-07-24 2019-07-24 包含环状多核糖核苷酸的组合物及其用途
MX2021000965A MX2021000965A (es) 2018-07-24 2019-07-24 Composiciones que comprenden polirribonucleotidos circulares y usos de estas.
KR1020217005234A KR102950624B1 (ko) 2018-07-24 2019-07-24 원형 폴리리보뉴클레오티드를 포함하는 조성물 및 이의 용도
EA202190282A EA202190282A1 (ru) 2019-06-19 2019-07-24 Композиции, содержащие кольцевые полирибонуклеотиды, и пути их применения
CA3107683A CA3107683A1 (en) 2018-07-24 2019-07-24 Compositions comprising circular polyribonucleotides and uses thereof
JP2021504230A JP2021531022A (ja) 2018-07-24 2019-07-24 環状ポリリボヌクレオチドを含む組成物及びその使用
IL280354A IL280354A (en) 2018-07-24 2021-01-24 Compositions comprising circular polyribonucleotides and uses thereof
JP2024159028A JP2024169484A (ja) 2018-07-24 2024-09-13 環状ポリリボヌクレオチドを含む組成物及びその使用
AU2026201251A AU2026201251A1 (en) 2018-07-24 2026-02-19 Compositions comprising circular polyribonucleotides and uses thereof

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201862702714P 2018-07-24 2018-07-24
US62/702,714 2018-07-24
US201962823569P 2019-03-25 2019-03-25
US62/823,569 2019-03-25
US201962863670P 2019-06-19 2019-06-19
US62/863,670 2019-06-19

Publications (1)

Publication Number Publication Date
WO2020023655A1 true WO2020023655A1 (en) 2020-01-30

Family

ID=69182387

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/043272 Ceased WO2020023655A1 (en) 2018-07-24 2019-07-24 Compositions comprising circular polyribonucleotides and uses thereof

Country Status (12)

Country Link
US (1) US20210292761A1 (enExample)
EP (1) EP3827084A4 (enExample)
JP (2) JP2021531022A (enExample)
KR (1) KR102950624B1 (enExample)
CN (1) CN112567038A (enExample)
AU (2) AU2019312269A1 (enExample)
BR (1) BR112021001343A2 (enExample)
CA (1) CA3107683A1 (enExample)
IL (1) IL280354A (enExample)
MX (1) MX2021000965A (enExample)
SG (1) SG11202100750XA (enExample)
WO (1) WO2020023655A1 (enExample)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111500681A (zh) * 2020-03-20 2020-08-07 青岛大学 用于检测piRNA与mRNA结合的可视化方法及其应用
WO2020198403A3 (en) * 2019-03-25 2020-11-05 Flagship Pioneering Innovations Vi, Llc Compositions comprising modified circular polyribonucleotides and uses thereof
WO2021155175A1 (en) 2020-01-29 2021-08-05 Flagship Pioneering Innovations Vi, Llc Compositions for translation and methods of use thereof
CN113249811A (zh) * 2021-05-13 2021-08-13 太原理工大学 一种中空纳米纤维内部固定化生物酶的制备方法
WO2022006399A1 (en) * 2020-07-01 2022-01-06 Elevatebio Technologies, Inc. Compositions and methods for cellular reprogramming using circular rna
WO2021263124A3 (en) * 2020-06-25 2022-02-03 The Board Of Trustees Of The Leland Stanford Junior University Genetic elements driving circular rna translation and methods of use
US20220288176A1 (en) * 2019-08-28 2022-09-15 The Board Of Trustees Of The Leland Stanford Junior University Circular rna modification and methods of use
US11479775B2 (en) 2017-03-03 2022-10-25 The Regents Of The University Of California RNA targeting of mutations via suppressor tRNAs and deaminases
WO2022245942A1 (en) 2021-05-18 2022-11-24 Flagship Pioneering Innovations Vi, Llc Methods of enriching for circular polyribonucleotides
WO2022245901A1 (en) 2021-05-18 2022-11-24 Flagship Pioneering Innovations Vi, Llc Methods of enriching for circular polyribonucleotides
WO2022256578A3 (en) * 2021-06-02 2023-01-12 Beam Therapeutics Inc. Circular guide rnas for crispr/cas editing systems
EP4124347A1 (en) * 2021-07-29 2023-02-01 Suzhou Curemed Biomedical Technology Co. Ltd Circular rna molecule and use thereof in targeted degradation of protein of interest
WO2023009568A1 (en) 2021-07-27 2023-02-02 Flagship Pioneering Innovations Vi, Llc Devices systems and methods for processing
WO2023115013A1 (en) 2021-12-17 2023-06-22 Flagship Pioneering Innovations Vi, Llc Methods for enrichment of circular rna under denaturing conditions
US11690922B2 (en) 2021-07-21 2023-07-04 Purecodon (Hong Kong) Biopharma Ltd. Lipid compound as well as lipid carrier, nucleic acid lipid nanoparticle composition and pharmaceutical preparation containing same
US11814627B2 (en) 2016-06-20 2023-11-14 The Board Of The Leland Stanford Junior University Circular RNAs and their use in immunomodulation
US11827880B2 (en) 2019-12-02 2023-11-28 Shape Therapeutics Inc. Therapeutic editing
US11844759B2 (en) 2017-12-15 2023-12-19 Flagship Pioneering Innovations Vi, Llc Compositions comprising circular polyribonucleotides and uses thereof
WO2024159172A1 (en) 2023-01-27 2024-08-02 Senda Biosciences, Inc. A modified lipid composition and uses thereof
EP4359521A4 (en) * 2021-06-25 2025-12-17 Univ Leland Stanford Junior COMPOSITIONS AND METHOD FOR IMPROVED PROTEIN TRANSLATION FROM RECOMBINANT CIRCULAR RNAS

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230203192A1 (en) * 2020-05-20 2023-06-29 Flagship Pioneering, Inc. Compositions and methods for producing human polyclonal antibodies
MX2024003262A (es) 2021-09-17 2024-06-19 Flagship Pioneering Innovations Vi Llc Composiciones y metodos para producir poliribonucleotidos circulares.
CN116103284B (zh) * 2021-11-09 2025-09-23 中国科学院天津工业生物技术研究所 环形gRNA及其相关生物材料与应用
WO2025127854A1 (ko) * 2023-12-14 2025-06-19 한국과학기술원 Circular rna를 이용한 표적 mrna 발현 저해

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050176940A1 (en) * 2001-06-29 2005-08-11 Unisearch Limited Aptamers and antiaptamers
WO2007016507A2 (en) * 2005-08-01 2007-02-08 Purdue Research Foundation Multivalent rna nanoparticles for delivery of active agents to a cell
US20140068797A1 (en) * 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110065086A1 (en) 2008-02-21 2011-03-17 Otc Biotechnologies, Llc Methods of producing homogeneous plastic-adherent aptamer-magnetic bead-fluorophore and other sandwich assays
CN120574876A (zh) 2013-08-22 2025-09-02 纳幕尔杜邦公司 使用向导rna/cas内切核酸酶系统的植物基因组修饰及其使用方法
JP7106461B2 (ja) * 2016-06-07 2022-07-26 セファイド 熱安定性ポリメラーゼ阻害剤組成物及び方法
WO2020257730A1 (en) * 2019-06-19 2020-12-24 Flagship Pioneering Innovations Vi, Llc Compositions comprising circular polyribonucleotides for protein modulation and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050176940A1 (en) * 2001-06-29 2005-08-11 Unisearch Limited Aptamers and antiaptamers
WO2007016507A2 (en) * 2005-08-01 2007-02-08 Purdue Research Foundation Multivalent rna nanoparticles for delivery of active agents to a cell
US20140068797A1 (en) * 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3827084A4 *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11814627B2 (en) 2016-06-20 2023-11-14 The Board Of The Leland Stanford Junior University Circular RNAs and their use in immunomodulation
US11479775B2 (en) 2017-03-03 2022-10-25 The Regents Of The University Of California RNA targeting of mutations via suppressor tRNAs and deaminases
US11932856B2 (en) 2017-03-03 2024-03-19 The Regents Of The University Of California RNA targeting of mutations via suppressor tRNAs and deaminases
US11608503B2 (en) 2017-03-03 2023-03-21 The Regents Of The University Of California RNA targeting of mutations via suppressor tRNAs and deaminases
US11844759B2 (en) 2017-12-15 2023-12-19 Flagship Pioneering Innovations Vi, Llc Compositions comprising circular polyribonucleotides and uses thereof
US12539309B2 (en) 2017-12-15 2026-02-03 Flagship Pioneering Innovations Vi, Llc Compositions comprising circular polyribonucleotides and uses thereof
US12357653B2 (en) 2017-12-15 2025-07-15 Flagship Pioneering Innovations Vi, Llc Compositions comprising circular polyribonucleotides and uses thereof
US12480117B2 (en) 2019-03-25 2025-11-25 Flagship Pioneering Innovations Vi, Llc Compositions comprising modified circular polyribonucleotides and uses thereof
WO2020198403A3 (en) * 2019-03-25 2020-11-05 Flagship Pioneering Innovations Vi, Llc Compositions comprising modified circular polyribonucleotides and uses thereof
US20220288176A1 (en) * 2019-08-28 2022-09-15 The Board Of Trustees Of The Leland Stanford Junior University Circular rna modification and methods of use
US11827880B2 (en) 2019-12-02 2023-11-28 Shape Therapeutics Inc. Therapeutic editing
WO2021155175A1 (en) 2020-01-29 2021-08-05 Flagship Pioneering Innovations Vi, Llc Compositions for translation and methods of use thereof
CN111500681A (zh) * 2020-03-20 2020-08-07 青岛大学 用于检测piRNA与mRNA结合的可视化方法及其应用
US11685924B2 (en) 2020-06-25 2023-06-27 The Board Of Trustees Of The Leland Stanford Junior University Genetic elements driving circular RNA translation and methods of use
US11560567B2 (en) 2020-06-25 2023-01-24 The Board Of Trustees Of The Leland Stanford Junior University Genetic elements driving circular RNA translation and methods of use
WO2021263124A3 (en) * 2020-06-25 2022-02-03 The Board Of Trustees Of The Leland Stanford Junior University Genetic elements driving circular rna translation and methods of use
WO2022006399A1 (en) * 2020-07-01 2022-01-06 Elevatebio Technologies, Inc. Compositions and methods for cellular reprogramming using circular rna
CN113249811A (zh) * 2021-05-13 2021-08-13 太原理工大学 一种中空纳米纤维内部固定化生物酶的制备方法
CN113249811B (zh) * 2021-05-13 2022-11-08 太原理工大学 一种中空纳米纤维内部固定化生物酶的制备方法
WO2022245901A1 (en) 2021-05-18 2022-11-24 Flagship Pioneering Innovations Vi, Llc Methods of enriching for circular polyribonucleotides
WO2022245942A1 (en) 2021-05-18 2022-11-24 Flagship Pioneering Innovations Vi, Llc Methods of enriching for circular polyribonucleotides
WO2022256578A3 (en) * 2021-06-02 2023-01-12 Beam Therapeutics Inc. Circular guide rnas for crispr/cas editing systems
EP4359521A4 (en) * 2021-06-25 2025-12-17 Univ Leland Stanford Junior COMPOSITIONS AND METHOD FOR IMPROVED PROTEIN TRANSLATION FROM RECOMBINANT CIRCULAR RNAS
US11690922B2 (en) 2021-07-21 2023-07-04 Purecodon (Hong Kong) Biopharma Ltd. Lipid compound as well as lipid carrier, nucleic acid lipid nanoparticle composition and pharmaceutical preparation containing same
WO2023009568A1 (en) 2021-07-27 2023-02-02 Flagship Pioneering Innovations Vi, Llc Devices systems and methods for processing
EP4124347A1 (en) * 2021-07-29 2023-02-01 Suzhou Curemed Biomedical Technology Co. Ltd Circular rna molecule and use thereof in targeted degradation of protein of interest
WO2023115013A1 (en) 2021-12-17 2023-06-22 Flagship Pioneering Innovations Vi, Llc Methods for enrichment of circular rna under denaturing conditions
WO2024159172A1 (en) 2023-01-27 2024-08-02 Senda Biosciences, Inc. A modified lipid composition and uses thereof

Also Published As

Publication number Publication date
SG11202100750XA (en) 2021-02-25
US20210292761A1 (en) 2021-09-23
MX2021000965A (es) 2021-06-15
EP3827084A1 (en) 2021-06-02
KR20210039401A (ko) 2021-04-09
JP2021531022A (ja) 2021-11-18
IL280354A (en) 2021-03-25
KR102950624B1 (ko) 2026-04-10
AU2026201251A1 (en) 2026-03-12
EP3827084A4 (en) 2023-03-15
BR112021001343A2 (pt) 2021-05-04
AU2019312269A1 (en) 2021-03-04
CA3107683A1 (en) 2020-01-30
CN112567038A (zh) 2021-03-26
JP2024169484A (ja) 2024-12-05

Similar Documents

Publication Publication Date Title
AU2026201251A1 (en) Compositions comprising circular polyribonucleotides and uses thereof
JP7618577B2 (ja) 修飾環状ポリリボヌクレオチドを含む組成物及びその使用
US20260115219A1 (en) Compositions comprising circular polyribonucleotides and uses thereof
US20230104113A1 (en) Delivery of compositions comprising circular polyribonucleotides
CN121081490A (zh) 环状多核糖核苷酸及其药物组合物
JP2026040556A (ja) 環状ポリリボヌクレオチドを投与する方法
JP2024521304A (ja) 環状ポリリボヌクレオチドを濃縮する方法
US20240240218A1 (en) Methods of enriching for circular polyribonucleotides
US20260124228A1 (en) Compositions comprising circular polyribonucleotides and uses thereof
EA048586B1 (ru) Способ получения фармацевтической композиции, содержащей кольцевые полирибонуклеотиды

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19840286

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3107683

Country of ref document: CA

Ref document number: 2021504230

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021001343

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20217005234

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019840286

Country of ref document: EP

Effective date: 20210224

ENP Entry into the national phase

Ref document number: 2019312269

Country of ref document: AU

Date of ref document: 20190724

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112021001343

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210125

WWW Wipo information: withdrawn in national office

Ref document number: 202190282

Country of ref document: EA

WWW Wipo information: withdrawn in national office

Ref document number: 280354

Country of ref document: IL