WO2019157146A1 - Alpha polyglutamated antifolates and uses thereof - Google Patents

Alpha polyglutamated antifolates and uses thereof Download PDF

Info

Publication number
WO2019157146A1
WO2019157146A1 PCT/US2019/017002 US2019017002W WO2019157146A1 WO 2019157146 A1 WO2019157146 A1 WO 2019157146A1 US 2019017002 W US2019017002 W US 2019017002W WO 2019157146 A1 WO2019157146 A1 WO 2019157146A1
Authority
WO
WIPO (PCT)
Prior art keywords
alpha
apantifol
antifolate
cancer
composition according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/017002
Other languages
English (en)
French (fr)
Inventor
Clet Niyikiza
Victor Mandla MOYO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LEAF Holdings Group LLC
Original Assignee
LEAF Holdings Group LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US16/967,213 priority Critical patent/US12076402B2/en
Priority to EP19750590.2A priority patent/EP3749313A4/en
Priority to CN201980017190.9A priority patent/CN111867593A/zh
Priority to JP2020542626A priority patent/JP7487107B2/ja
Priority to CA3090500A priority patent/CA3090500A1/en
Application filed by LEAF Holdings Group LLC filed Critical LEAF Holdings Group LLC
Publication of WO2019157146A1 publication Critical patent/WO2019157146A1/en
Anticipated expiration legal-status Critical
Priority to JP2024075984A priority patent/JP7679114B2/ja
Priority to US18/755,082 priority patent/US20250161455A1/en
Priority to US19/022,038 priority patent/US20250319188A1/en
Priority to JP2025072834A priority patent/JP2025107218A/ja
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/10Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/555Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • A61K33/243Platinum; Compounds thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A61K47/6913Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome the liposome being modified on its surface by an antibody
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1277Preparation processes; Proliposomes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D475/00Heterocyclic compounds containing pteridine ring systems
    • C07D475/06Heterocyclic compounds containing pteridine ring systems with a nitrogen atom directly attached in position 4
    • C07D475/08Heterocyclic compounds containing pteridine ring systems with a nitrogen atom directly attached in position 4 with a nitrogen atom directly attached in position 2
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure generally relates to alpha polyglutamated Antifolate compositions, including delivery vehicles such as liposomes containing the alpha polyglutamated Antifolate compositions, and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system including inflammation and autoimmune diseases such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • diseases including hyperproliferative diseases such as cancer, disorders of the immune system including inflammation and autoimmune diseases such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • Folate is an essential cofactor that mediates the transfer of one-carbon units involved in nucleotide biosynthesis and DNA repair, the remethylation of homocysteine (Hey), and the methylation of DNA, proteins, and lipids.
  • the only circulating forms of folates in the blood are monoglutamates and folate monoglutamates are the only form of folate that is transported across the cell membrane - likewise, the monoglutamate form of polyglutamatable antifolates is transported across the cell membrane.
  • FPGS folylpoly-gamma-glutamate synthetase
  • Antifolate is transported into cells by the reduced folate carrier (RFC) system and folate receptors (FRs) a and b and by Proton Coupled Folate Transporter (PCFT) that is generally most active in a lower pH environment.
  • RFC is the main transporter of antifolate at physiologic pH and is ubiquitously expressed in both normal and diseased cells. Consequently, antifolate treatment often suffers from the dose-limiting toxicity that is a major obstacle in cancer chemotherapy.
  • FPGS Proton Coupled Folate Transporter
  • the L- gamma polyglutamation of antifolates by FPGS serves at least 2 main therapeutic purposes: (1) it greatly enhances antifolate affinity and inhibitory activity for DHFR; and (2) it facilitates the accumulation of polyglutamated antifolate, which unlike antifolate (monoglutamate), is not easily transported out of cells by cell efflux pumps.
  • Resistance to antifolate therapy is typically associated with one or more of, (a) increased cell efflux pump activity, (b) decreased transport of antifolates into cells (c) increased DHFR activity, (d) decreased folylpoly-gamma-glutamate synthetase (FPGS) activity, and (e) increased gamma-glutamyl hydrolase (GGH) activity, which cleaves gamma polyglutamate chains attached to folates and antifolates.
  • FPGS folylpoly-gamma-glutamate synthetase
  • GGH gamma-glutamyl hydrolase
  • the provided alpha polyglutamated Antifolate compositions deliver a strategy for overcoming the pharmacological challenges associated with the dose limiting toxicities and with treatment resistance associated with Antifolate therapy.
  • the provided methods deliver to cancer cells an alpha polyglutamated form of an Antifolate while (1) minimizing/reducing exposure to normal tissue cells, (2) optimizing/improving the cytotoxic effect of antifolate-based agents on cancer cells and (3) minimizing/reducing the impact of the efflux pumps, and other resistance mechanisms that limit the therapeutic efficacy of antifolates.
  • This disclosure generally relates to novel alpha polyglutamated Antifolate
  • hyperproliferative diseases such as cancer, disorders of the immune system such as inflam ation and rheumatoid arthritis, cardiovascular disease such as coronary artery disease, and infectious disease such as HIV, malaria, and schistomiasis.
  • the disclosure provides: [1] a composition comprising an alpha polyglutamated Antifolate, wherein at least one glutamyl group has an alpha carboxyl group linkage;
  • raltitrexed, plevitrexed, pemetrexed, lometrexol LMX; 5,10-dideazatetrahydrofolic acid
  • each of the glutamyl groups of the polyglutamated Antifolate other than the glutamyl group of the Antifolate has an alpha carboxyl group linkage
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha carboxyl group linkage;
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups has an alpha carboxyl group linkage
  • (b) is an alpha pentaglutamated Antifolate
  • (c) is an alpha hexaglutamated Antifolate
  • Antifolate comprises 1-10 glutamyl groups having an alpha carboxyl group linkage
  • each of the glutamyl groups of the alpha polyglutamated Antifolate is in the L- form
  • each of the glutamyl groups of the alpha polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form, or
  • a liposomal composition comprising the alpha polyglutamated Antifolate according to any of [l]-[l2] (Lp-aPANTIFOL);
  • the Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10- dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such
  • the Lp-aPANTIFOL composition according to any of [13]-[16], wherein the liposome comprises an alpha polyglutamated Antifolate containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups;
  • polyglutamate is linear or branched
  • each of the glutamyl groups other than the glutamyl group of the Antifolate has an alpha carboxyl group linkage, or
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha carboxyl group linkage, or
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups has an alpha carboxyl group linkage
  • each of the glutamyl groups of the alpha polyglutamated Antifolate is in the L-form
  • each of the glutamyl groups of the alpha polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form, or
  • polyglutamate is linear or branched
  • liposomes comprise at least 1% weight by weight (w/w) of the alpha polyglutamated Antifolate or wherein during the process of preparing the Lp- aPANTIFOL, at least 1% of the starting material of alpha polyglutamated Antifolate is encapsulated (entrapped) in the Lp-aPANTIFOL;
  • the Lp-aPANTIFOL composition according to any of [l3]-[29], wherein the liposome has a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm;
  • components comprise at least one of an anionic lipid and a neutral lipid
  • the Lp-aPANTIFOL composition according to [32] or [33], wherein the liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG- maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol- maleimide;
  • the Lp-aPANTIFOL composition according to any of [32]-[34], wherein the liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG- FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
  • the Lp-aPANTIFOL composition according to any of [32]-[35], wherein one or more liposomal components further comprises a steric stabilizer; [37] the Lp-aPANTIFOL composition according to [36], wherein the steric stabilizer is at least one selected from polyethylene glycol (PEG); poly-L-lysine (PLL);
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PVA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • phosphatidyl polyglycerol poly[N-(2-hydroxypropyl) methacrylamide]
  • amphiphilic poly-N- vinylpyrrolidones L-amino-acid-based polymer
  • oligoglycerol copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol
  • GM1 monosialoganglioside
  • PVP
  • a tonicity agent such as dextrose, mannitol, glycerine, potassium chloride, sodium chloride, at a concentration of greater than 1%;
  • pharmaceutically acceptable carrier comprises 1% to 15 weight of dextrose
  • pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of between 2 to 8;
  • HBS HEPES Buffered Saline
  • pharmaceutically acceptable carrier comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM;
  • the Lp-aPANTIFOL composition according to any of [l3]-[53], wherein the liposome comprises between 10 to 100,000 molecules of the alpha polyglutamated Antifolate, or any range therein between;
  • the targeting moiety comprises a targeting moiety and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest;
  • the Lp-aPANTIFOL composition according to any of [55]-[57], wherein the targeting moiety is an antibody or an antigen binding fragment of an antibody;
  • the Lp-aPANTIFOL composition according to any of [55]-[58], wherein the targeting moiety binds the surface antigen with an equilibrium dissociation constant (Kd) in a range of 0;5 x 10-10 to 10 x 10-6 as determined using BIACORE® analysis;
  • the Lp-aPANTIFOL composition according to any of [55]-[59], wherein the targeting moiety specifically binds one or more folate receptors selected from: folate receptor alpha (FR-a), folate receptor beta (FR-b), and folate receptor delta (FR-d);
  • the Lp-aPANTIFOL composition according to any of [55]-[60], wherein the targeting moiety comprises one or more selected from: an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi- specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody;
  • pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties
  • the Lp-aPANTIFOL composition according to any of [44]-[57], further comprising one or more of an immunostimulatory agent, a detectable marker and a maleimide, wherein the immunostimulatory agent, the detectable marker or the maleimide is attached to said PEG or the exterior of the liposome;
  • immunostimulating agent a chemical immunostimulating agent; a hapten; and an adjuvant;
  • immunostimulatory agent and the detectable marker is the same;
  • cryoprotectant selected from mannitol; trehalose; sorbitol; and sucrose;
  • composition comprising the composition according to any of [l]-[54] and [64]-[69] ;
  • Antifolate composition according to any of [l3]-[72];
  • [77] a method for treating or preventing disease in a subject needing such treatment or prevention, the method comprising administering the composition of any of [l]-[75] to the subject;
  • hyperproliferative cell with the composition of any of [ l]-[74] ;
  • mammalian cell and/or a human cell
  • [82] a method for treating cancer that comprises administering an effective amount of the composition of any of [l]-[74] to a subject having or at risk of having cancer;
  • [83] a method for treating cancer that comprises administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [13]-[73] to a subject having or at risk of having cancer;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias;
  • a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias
  • the cancer is selected from: the cancer is a member selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and Central Nervous System (CNS) lymphoma;
  • NDL Non-Hodgkin's lymphoma
  • ALL acute lymphoblastic leukemia
  • mycosis fungoides cutaneous T-cell lymphoma
  • choriocarcinoma choriocarcinoma
  • chorioadenoma nonleukemic meningeal cancer
  • soft tissue sarcoma desmoid tumors, aggressive fibromatosis
  • bladder cancer and
  • [88] a method for treating cancer that comprises administering an effective amount of the Lp-aPANTIFOL composition of any of [55]-[7l] to a subject having or at risk of having a cancer cell that expresses on its surface a folate receptor bound by the targeting moiety;
  • a maintenance therapy comprising administering an effective amount of the
  • composition of any of [l]-[74] to a subject that is undergoing or has undergone cancer therapy
  • a maintenance therapy comprising administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [l3]-[74] to a subject that is undergoing or has undergone cancer therapy;
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the composition of any of [l]-[74] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., Crohn disease
  • dermatomyositis/ polymyositis e.g., systemic erythematosus
  • Takayasu psoriasis
  • [92] amethod for treating a disorder of the immune system that comprises administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [9]-[74] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., dermatomyositis/ polymyositis
  • systemic lupus erythematosus e.g.,
  • an infectious disease that comprises administering an effective amount of the composition according to any of [l]-[74] to a subject having or at risk of having an infectious disease
  • an infectious disease, cardiovascular disease, metabolic disease, or another disease that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having an infectious disease, cardiovascular disease, or another disease, wherein the disease is a member selected from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic disease, and ectopic pregnancy;
  • an autoimmune disease that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having an autoimmune disease;
  • rheumatoid arthritis that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having rheumatoid arthritis;
  • an inflammatory condition that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having inflammation, optionally wherein the inflammation is acute, chronic, and/or systemic inflammation; or
  • [94] a method for treating an infectious disease that comprises administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [13]- [74] to a subject having or at risk of having an infectious disease;
  • a method of delivering alpha polyglutamated Antifolate to a tumor expressing a folate receptor on its surface comprising: administering the Lp-aPANTIFOL composition of any of [l]-[74] to a subject having the tumor in an amount to deliver a therapeutically effective dose of the alpha polyglutamated Antifolate to the tumor;
  • a method of preparing an alpha polyglutamated Antifolate composition comprising the liposomal alpha polyglutamated Antifolate composition of any of [13]-[74], the method comprising: forming a mixture comprising: liposomal components and alpha polyglutamated antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing alpha polyglutamated Antifolate;
  • [97] a method of preparing an alpha polyglutamated Antifolate composition comprising the liposomal alpha polyglutamated Antifolate composition of any of [13]-[74], the method comprising: forming a mixture comprising: liposomal components and alpha polyglutamated Antifolate in solution; and processing the mixture to form liposomes containing alpha polyglutamated Antifolate;
  • a method of preparing the composition of any of [55]-[74] comprising the steps of: forming a mixture comprising: liposomal components and alpha polyglutamated Antifolate in a solution; homogenizing the mixture to form liposomes in the solution; processing the mixture to form liposomes entrapping and/or encapsulating alpha polyglutamated Antifolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • [100] a method of preparing the composition of any of [55]-[74], comprising the steps of: forming a mixture comprising: liposomal components and alpha polyglutamated Antifolate in a solution; processing the mixture to form liposomes entrapping and/or encapsulating alpha polyglutamated Antifolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • the processing step comprises homogenizing the mixture to form liposomes in the solution; [102] the method according to any of [99] to [101], wherein the processing step includes one or more steps of: thin film hydration, extmsion, in-line mixing, ethanol injection technique, freezing-and-thawing technique, reverse-phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring;
  • processing step includes one or more steps of modifying the size of the liposomes by one or more of steps of extmsion, high-pressure microfluidization, and/or sonication; and/or
  • the disclosure provides an alpha polyglutamated Antifolate
  • the alpha polyglutamated Antifolate is selected from: (a) AG2034, piritrexim, pralatrexate, GW1843, Antifolate, and LY309887; or (b) PMX, MTX, RTX, and LMX, or a stereoisomer thereof.
  • the alpha polyglutamated Antifolate is selected from: LV (etoposide), L-leucovorin (L-5- formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2- desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2- desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO-deazaaminopterin; PT523, N alpha-(4- amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexo
  • the alpha polyglutamated Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • the aPANTIFOL comprises two or more glutamyl groups in the L-form.
  • the aPANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the aPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the aPANTIFOL comprises two or more glutamyl groups that have a gamma linkage.
  • the aPANTIFOL composition contains a chain of 3 glutamyl groups attached to the glutamyl group in the Antifolate (i.e., a tetraglutamated Antifolate).
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the tetraglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the tetraglutamated Antifolate comprises a glutamyl group in the D-form. In some embodiments, the tetraglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the tetraglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the tetraglutamated Antifolate comprises one, two, or three, glutamyl groups in the D-form and three, two, or one, glutamyl groups in the L-form, respectively. In additional embodiments, the alpha tetraglutamated Antifolate comprises two or more glutamyl groups that have a gamma linkage.
  • the aPANTIFOL composition contains a chain of 4 glutamyl groups attached to the glutamyl group in the Antifolate ( i. e a pentaglutamated Antifolate).
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the pentaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the pentaglutamated Antifolate comprises a glutamyl group in the D-form. In some embodiments, the pentaglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the pentaglutamated Antifolate comprises a glutamyl group in the D- form and two or more glutamyl groups in the L-form. In some embodiments, the pentaglutamated Antifolate comprises one, two, three, or four, glutamyl groups in the D-form and four, three, two, or one, glutamyl groups in the L-form, respectively. In additional embodiments, the alpha pentaglutamated Antifolate comprises two or more glutamyl groups that have a gamma linkage.
  • the aPANTIFOL composition contains a chain of 5 glutamyl groups attached to the glutamyl group in the Antifolate (i.e., a hexaglutamated Antifolate).
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the hexaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the hexaglutamated Antifolate comprises a glutamyl group in the D-form. In some embodiments, the hexaglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the hexaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the pentaglutamated Antifolate comprises one, two, three, four, or five glutamyl groups in the D-form and five, four, three, two, or one, glutamyl groups in the L-form, respectively.
  • the alpha hexaglutamated Antifolate comprises two or more glutamyl groups that have a gamma linkage.
  • compositions containing delivery vehicles such as liposomes filled with (i.e., encapsulating) and/or otherwise associated with alpha polyglutamated Antifolate, and methods of making and using the aPANTIFOL filled/associated delivery vehicle compositions (DV-aPANTIFOL) to deliver alpha polyglutamated Antifolate to diseased (e.g., cancerous) and/or targeted cells.
  • delivery vehicles such as liposomes filled with (i.e., encapsulating) and/or otherwise associated with alpha polyglutamated Antifolate
  • DV-aPANTIFOL aPANTIFOL filled/associated delivery vehicle compositions
  • These compositions have uses that include but are not li ited to treating diseases that include for example, hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • the aPANTIFOL filled/associated delivery vehicle compositions provide improvements to the efficacy and safety of delivering Antifolate to cancer cells by providing the preferential delivery of a more cytotoxic payload (e.g., polyglutamated Antifolate) compared to the cytotoxicity the Antifolate administered in its monoglutamate state (ANTIFOL).
  • alpha polyglutamated Antifolate in the DV-aPANTIFOL contains 2-20, 2-15, 2-10, 2-5, more than 5, or more than 20, glutamyl groups (including the glutamyl group of the Antifolate).
  • the delivery vehicle contains a polyglutamated Antifolate according to any of [ l]-[ 12] of the Brief Summary Section.
  • the delivery vehicle contains a polyglutamated Antifolate described in the Brief Summary Section.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) alpha polyglutamated Antifolate (Lp-aR ANTIFOL).
  • Lp-aR ANTIFOL alpha polyglutamated Antifolate
  • the alpha polyglutamated Antifolate in the Lp-aR ANTIFOL contains 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in the Antifolate).
  • the alpha polyglutamated Antifolate encapsulated by the liposome is selected from: (a) AG2034, piritrexim, pralatrexate, GW 1843, Antifolate, and LY309887; or (b) PMX, MTX, RTX, and LMX, or a stereoisomer thereof.
  • the alpha polyglutamated Antifolate encapsulated by the liposome is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5- methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; lO-EdAM, 10-ethyl- lO-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L- omithine;
  • 5-dPteHCysA N alpha -(5-deazapteroyl)-L-homocysteic acid
  • 5-dPteAPBA N alpha -(5-deazapteroyl)-DL-2-amino-4-phosphonobutanoic acid
  • 5-dPteOm N alpha-(5-deazapteroyl)-L-omithine
  • 5-dH4PteHCysA N alpha-(5-deaza-5, 6,7,8- tetrahydropteroyl)-L-homocysteic acid
  • 5-dH4PteAPBA N alpha-(5-deaza-5, 6,7,8- tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid
  • 5-dH4PteOro N alpha -(5-deaza-
  • the alpha polyglutamated Antifolate encapsulated by the liposome is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,l0-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • LMX 5,l0-dideazatetrahydrofolic acid
  • the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises two or more glutamyl groups in the L-form. In other embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises two or more glutamyl groups that have a gamma linkage.
  • the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises one or more glutamyl groups that have both an alpha linkage and a gamma linkage. In some embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises 2-10 glutamyl groups that have both an alpha linkage and a gamma linkage, or any range therein between. In some embodiments, the polyglutamate chain of the alpha polyglutamated Antifolate is linear. In some embodiments, the polyglutamate chain of the alpha polyglutamated Antifolate is branched.
  • the Lp-aPANTIFOL composition comprises an alpha polyglutamated Antifolate that contains a chain of 3 glutamyl groups attached to the glutamyl group in the Antifolate (i.e., tetraglutamated Antifolate).
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the tetraglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the tetraglutamated Antifolate comprises a glutamyl group in the D-form. In further embodiments, the tetraglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the tetraglutamated Antifolate comprises two or more glutamyl groups that have a gamma linkage.
  • the polyglutamate chain of the alpha polyglutamated Antifolate is linear. In some embodiments, the polyglutamate chain of the alpha polyglutamated Antifolate is branched.
  • the Lp-aPANTIFOL composition comprises an alpha polyglutamated Antifolate that contains a chain of 4 glutamyl groups attached to the glutamyl group in the Antifolate (i.e., pentaglutamated Antifolate).
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the pentaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the pentaglutamated Antifolate comprises a glutamyl group in the D-form. In further embodiments, the pentaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the pentaglutamated Antifolate comprises two or more glutamyl groups that have a gamma linkage.
  • the polyglutamate chain of the alpha polyglutamated Antifolate is linear. In some embodiments, the polyglutamate chain of the alpha polyglutamated Antifolate is branched.
  • the Lp-aPANTIFOL composition comprises an alpha polyglutamated Antifolate that contains a chain of 5 glutamyl groups attached to the glutamyl group in the Antifolate ( i.e hexaglutamated Antifolate).
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the hexaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the hexaglutamated Antifolate comprises a glutamyl group in the D-form. In some embodiments, the hexaglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the hexaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the pentaglutamated Antifolate comprises one, two, three, four, or five glutamyl groups in the D-form and five, four, three, two, or one, glutamyl groups in the L-form, respectively.
  • the hexaglutamated Antifolate comprises two or more glutamyl groups that have a gamma linkage.
  • the polyglutamate chain of the alpha polyglutamated Antifolate is linear. In some embodiments, the polyglutamate chain of the alpha polyglutamated Antifolate is branched.
  • the Lp-aPANTIFOL composition is cationic.
  • the Lp-aPANTIFOL liposome is cationic and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between.
  • the Lp-aPANTIFOL liposome is cationic and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the cationic Lp-aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha polyglutamated Antifolate.
  • at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, of the starting material of alpha polyglutamated Antifolate is encapsulated (entrapped) in the cationic Lp-aPANTIFOL.
  • the alpha polyglutamated Antifolate encapsulated by the liposome is in a HEPES buffered solution within the liposome.
  • Lp-aPANTIFOL composition is anionic or neutral. In some embodiments, the Lp-aPANTIFOL composition is cationic. In some embodiments, the Lp- aPANTIFOL liposome is anionic or neutral and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-aPANTIFOL liposome is anionic or neutral and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the Lp-aPANTIFOL liposome is anionic and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-aPANTIFOL liposome is anionic and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the Lp-aPANTIFOL liposome is neutral and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-aPANTIFOL liposome is neutral and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the anionic or neutral Lp-aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha polyglutamated Antifolate.
  • at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, of the starting material of alpha polyglutamated Antifolate is encapsulated (entrapped) in the anionic or neutral Lp- aPANTIFOL.
  • the anionic or neutral Lp-aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha tetraglutamated Antifolate. In some embodiments, the anionic or neutral Lp-aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha pentaglutamated Antifolate.
  • the anionic or neutral Lp-aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha hexaglutamated Antifolate.
  • the alpha polyglutamated Antifolate encapsulated by the liposome is in a HEPES buffered solution within the liposome.
  • the liposomal alpha polyglutamated Antifolate composition is pegylated (PLp-aPANTIFOL).
  • the liposomal alpha polyglutamated Antifolate composition is non-targeted (NTLp-aPANTIFOL). That is, the NTLp-aPANTIFOL composition does not have specific affinity towards an epitope (e.g., an epitope on a surface antigen) expressed on the surface of a target cell of interest. In some embodiments, the NTLp-aPANTIFOL composition does not comprise a targeting moiety. In further embodiments, the non-targeted liposomal alpha polyglutamated Antifolate composition is pegylated (NTPLp-aPANTIFOL).
  • the liposomal alpha polyglutamated Antifolate composition is targeted (TLp-aPANTIFOL). That is, the TLp-aPANTIFOL composition contains a targeting moiety that has specific affinity for an epitope (surface antigen) on a target cell of interest. In some embodiments, the targeting moiety of the TLp-aPANTIFOL or TPLp-aPANTIFOL is not attached to the liposome through a covalent bond. In other embodiments, the targeting moiety of the TLp-aPANTIFOL or TPLp-aPANTIFOL is attached to one or both of a PEG and the exterior of the liposome.
  • the targeting moiety of the TLp- aPANTIFOL or TPLp-aPANTIFOL is attached to the liposome through a covalent bond.
  • Functions of the targeting moiety of the TLp-aPANTIFOL and/or TPLp-aPANTIFOL compositions include but are not limited to, targeting the liposome to the target cell of interest in vivo or in vitro; interacting with the surface antigen for which the targeting moiety has specific affinity, and delivering the liposome payload (aPANTIFOL) into the cell.
  • Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen binding antibody fragments, scaffold proteins, polypeptides, and peptides.
  • the targeting moiety is a polypeptide.
  • the targeting moiety is a polypeptide that comprises at least 3, 5, 10, 15, 20, 30, 40, 50, or 100, amino acid residues.
  • Targeted liposomal alpha polyglutamated Antifolate compositions provide further improvements over the efficacy and safety profile of the Antifolate, by specifically delivering alpha polyglutamated (e.g., tetraglutamated, pentaglutamated and hexaglutamated) Antifolate to target cells such as cancer cells.
  • alpha polyglutamated e.g., tetraglutamated, pentaglutamated and hexaglutamated
  • the targeted liposomal alpha polyglutamated Antifolate composition is pegylated (TPLp-aPANTIFOL).
  • Function of the targeting moiety of the TLp- aPANTIFOL and/or TPLp-aPANTIFOL compositions include but are not limited to, targeting the liposome to the target cell of interest in vivo or in vitro; interacting with the surface antigen for which the targeting moiety has specific affinity, and delivering the liposome payload (aPANTIFOL) into the cell.
  • Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen-binding antibody fragments, scaffold proteins, polypeptides, and peptides.
  • the targeting moiety is a polypeptide.
  • the targeting moiety is a polypeptide that comprises at least 3, 5, 10, 15, 20, 30, 40, 50, or 100, amino acid residues.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the targeting moiety comprises one or more of an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi-specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody.
  • the targeting moiety of the TLp-aPANTIFOL or TPLp-aPANTIFOL has specific affinity for an epitope that is preferentially expressed on a target cell such as a tumor cell, compared to normal or non-tumor cells.
  • the targeting moiety has specific affinity for an epitope on a tumor cell surface antigen that is present on a tumor cell but absent or inaccessible on a non-tumor cell.
  • the targeting moiety binds an epitope of interest with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10 10 to 10 x 10 6 as determined using BIACORE® analysis.
  • the TLp-aPANTIFOL or TPLp-aPANTIFOL targeting moiety comprises a polypeptide that specifically binds a folate receptor.
  • the targeting moiety is an antibody or an antigen-binding antibody fragment.
  • the folate receptor bound by the targeting moiety is one or more folate receptors selected from: folate receptor alpha (FR-a, FOFR1), folate receptor beta (FR-b, FOFR2), and folate receptor delta (FR-d, FOFR4).
  • the folate receptor bound by the targeting moiety is folate receptor alpha (FR-a).
  • the folate receptor bound by the targeting moiety is folate receptor beta (FR-b).
  • the targeting moiety specifically binds FR-a and FR-b.
  • the liposome aPANTIFOL composition comprises one or more of an immuno stimulatory agent, a detectable marker, and a maleimide, disposed on at least one of the PEG and the exterior of the liposome.
  • the liposome aPANTIFOL composition e.g., Lp-aPANTIFOL, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL, or TPLp-aPANTIFOL
  • Lp-aPANTIFOL e.g., Lp-aPANTIFOL, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL, or TPLp-aPANTIFOL
  • the liposome aPANTIFOL composition e.g., Lp-aPANTIFOL, PLp- aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL or TPLp- aPANTIFOL
  • Lp-aPANTIFOL, PLp- aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL or TPLp- aPANTIFOL is anionic or neutral.
  • the liposome of the liposome aPANTIFOL composition (e.g., Lp-aPANTIFOL, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL or TPLp-aPANTIFOL) has a diameter in the range of 20 nm to 200 nm, or any range therein between. In further embodiments, the liposome of the liposome aPANTIFOL composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the liposome aPANTIFOL composition is pegylated (e.g., PLp-aPANTIFOL, NTPLp-aPANTIFOL, or TPLp-aPANTIFOL).
  • the liposome aPANTIFOL composition comprises a targeting moiety (e.g., TLp-aPANTIFOL or TPLp-aPANTIFOL).
  • the liposome aPANTIFOL composition is pegylated and targeted (e.g., TPLp-aPANTIFOL).
  • the liposome aPANTIFOL composition comprises an alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome aPANTIFOL composition comprises an alpha tetraglutamated Antifolate. In some embodiments, the liposome aPANTIFOL composition comprises an alpha pentaglutamated Antifolate. In other embodiments, the liposome aPANTIFOL composition comprises an alpha hexaglutamated Antifolate. In some embodiments, the aPANTIFOL is a polyglutamate of an Antifolate listed in [2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamate of an Antifolate listed in [3] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamate of an Antifolate listed in [4] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamate of an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome compositions comprises an alpha polyglutamated
  • the Lp- aPANTIFOL composition comprises an alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups and 1 %-98.5% w/w of the alpha polyglutamated Antifolate.
  • the liposomes comprise alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups and wherein during the process of preparing the Lp-aPANTIFOL, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of alpha polyglutamated Antifolate is encapsulated (entrapped) in the Lp-aPANTIFOL.
  • the liposome composition comprises an alpha polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section.
  • the liposome composition comprises a liposome according to any of [13] -[72] of the Brief Summary Section.
  • the composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome aPANTIFOL composition (i.e., Lp- aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL or TPLp-aPANTIFOL) comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped alpha polyglutamated Antifolate.
  • Lp- aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL or TPLp-aPANTIFOL
  • the liposome aPANTIFOL composition comprises 1% - 98.5% liposome entrapped alpha polyglutamated Antifolate. In additional embodiments, the liposome aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the liposome aPANTIFOL composition comprises 1% - 98.5% liposome entrapped alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped alpha tetraglutamated Antifolate. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [13] -[72] of the Brief Summary Section. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome compositions comprise of alpha tetraglutamated
  • the Lp-aPANTIFOL composition comprises an alpha tetraglutamated Antifolate and 1 %-98.5% w/w of the alpha tetraglutamated Antifolate.
  • the liposomes comprise alpha tetraglutamated Antifolate and wherein during the process of preparing the Lp-aPANTIFOL, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of alpha tetraglutamated Antifolate is encapsulated (entrapped) in the Lp-aPANTIFOL.
  • the liposome composition comprises an alpha polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section.
  • the liposome composition comprises a liposome according to any of [13] -[72] of the Brief Summary Section.
  • the liposome composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome compositions comprise of alpha pentaglutamated
  • the Lp-aPANTIFOL composition comprises an alpha pentaglutamated Antifolate and 1 %-98.5% w/w of the alpha pentaglutamated Antifolate.
  • the liposomes comprise alpha pentaglutamated Antifolate and wherein during the process of preparing the Lp-aPANTIFOL, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of alpha pentaglutamated Antifolate is encapsulated (entrapped) in the Lp-aPANTIFOL.
  • the liposome compositions comprise of alpha hexaglutamated Antifolate and at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha hexaglutamated Antifolate.
  • the Lp-aPANTIFOL composition comprises an alpha hexaglutamated Antifolate and 1 %-98.5% w/w of the alpha hexaglutamated Antifolate.
  • the liposomes comprise alpha hexaglutamated Antifolate and wherein during the process of preparing the Lp-aPANTIFOL, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of alpha pentaglutamated Antifolate is encapsulated (entrapped) in the Lp-aPANTIFOL.
  • the liposome aPANTIFOL composition comprises l%-98.5% liposome entrapped alpha pentaglutamated Antifolate.
  • the liposome composition comprises an alpha polyglutamated Antifolate according to any of [1]-[12] of the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome aPANTIFOL composition comprises 1% - 98.5% liposome entrapped alpha tetraglutamated Antifolate In some embodiments, the liposome aPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped alpha pentaglutamated Antifolate. In some embodiments, the liposome aPANTIFOL composition comprises 1% - 98.5% liposome entrapped alpha pentaglutamated Antifolate.
  • the liposome aPANTIFOL composition comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped alpha hexaglutamated Antifolate.
  • the liposome composition comprises an alpha polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section.
  • the liposome composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the liposome composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • Liposomal compositions comprising liposomes encapsulating aPANTIFOL are also provided.
  • the liposomal composition comprises a pegylated aPANTIFOL composition.
  • the liposomal composition comprise a aPANTIFOL composition that is linked to or otherwise associated with a targeting moiety.
  • the liposomal composition comprises a aPANTIFOL composition that is pegylated and linked to or otherwise associated with a targeting moiety.
  • the liposomal composition comprises aPANTIFOL that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the liposomal composition comprises an alpha tetraglutamated Antifolate. In some embodiments, the liposomal composition comprises an alpha pentaglutamated Antifolate. In other embodiments, the liposomal composition comprises an alpha hexaglutamated Antifolate. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate according to any of [l]-[ 12] of the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the liposomal composition comprises a liposome aPANTIFOL
  • the liposome aPANTIFOL is pegylated (e.g., NTPLp- aPANTIFOL, and TPLp-aPANTIFOL).
  • the pharmaceutical composition comprises aPANTIFOL that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises alpha tetraglutamated Antifolate.
  • the pharmaceutical composition comprises alpha pentaglutamated Antifolate. In other embodiments, the pharmaceutical composition comprises alpha hexaglutamated Antifolate. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [13] -[72] of the Brief Summary Section. In some embodiments, the liposome composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome aPANTIFOL comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TLp-aPANTIFOL or TPLp-aPANTIFOL).
  • the liposomal composition comprises a liposome aPANTIFOL that is pegylated and further comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TPLp-aPANTIFOL).
  • the liposomal composition comprises a liposome aPANTIFOL that is cationic.
  • the liposomal composition comprises a liposome aPANTIFOL that is anionic or neutral.
  • the liposomal composition comprises a liposome aPANTIFOL that has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, or any range therein between.
  • the liposome aPANTIFOL has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • compositions comprising alpha polyglutamated Antifolate
  • the pharmaceutical composition comprises a pegylated aPANTIFOL composition.
  • the pharmaceutical composition comprise a aPANTIFOL composition that is linked to or otherwise associated with a targeting moiety.
  • the pharmaceutical composition comprise a aPANTIFOL composition that is pegylated and linked to or otherwise associated with a targeting moiety.
  • the pharmaceutical composition comprises aPANTIFOL that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises an alpha tetraglutamated Antifolate.
  • the pharmaceutical composition comprises an alpha pentaglutamated Antifolate. In other embodiments, the pharmaceutical composition comprises an alpha hexaglutamated Antifolate. In other embodiments, the pharmaceutical composition comprises alpha hexaglutamated Antifolate. In some embodiments, the composition comprises an alpha polyglutamated Antifolate according to any of [ l]-[ 12] of the Brief Summary Section. In some embodiments, the pharmaceutical composition comprises a liposome composition according to any of [l3]-[74] of the Brief Summary Section. In some embodiments, the pharmaceutical composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the pharmaceutical composition comprises a polyglutamated Antifolate described in the Brief Summary Section.
  • the pharmaceutical compositions comprise a liposome aPANTIFOL (e.g., Lp-aPANTIFOL, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp-aPANTIFOL, and TPLp-aPANTIFOL).
  • a liposome aPANTIFOL e.g., Lp-aPANTIFOL, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp-aPANTIFOL, and TPLp-aPANTIFOL.
  • the liposome aPANTIFOL composition is pegylated (e.g., NTPLp-aPANTIFOL, and TPLp- aPANTIFOL).
  • the liposome aPANTIFOL comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TLp-aPANTIFOL or TPLp-aPANTIFOL).
  • the pharmaceutical composition comprises a liposome aPANTIFOL composition that is pegylated and further comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TPLp-aPANTIFOL).
  • the pharmaceutical composition comprises a liposome aPANTIFOL that is cationic.
  • the pharmaceutical composition comprises a liposome aPANTIFOL that is anionic or neutral.
  • the pharmaceutical composition comprises a liposome aPANTIFOL that has a diameter in the range of 20 nm to 500 nm or 20 nm to 500 nm, or any range therein between.
  • the liposome aPANTIFOL composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the pharmaceutical composition comprises aPANTIFOL that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises alpha tetraglutamated Antifolate.
  • the pharmaceutical composition comprises alpha pentaglutamated Antifolate. In some embodiments, the pharmaceutical composition comprises an alpha polyglutamated Antifolate according to any of [ 1 ] - [ 12] of the Brief Summary Section. In some embodiments, the pharmaceutical composition comprises a liposome composition according to any of [l3]-[74] of the Brief Summary Section. In some embodiments, the pharmaceutical composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the disclosure provides a method of modulating the activation, chemokine production, or metabolic activity of a cell that comprises contacting the cell with a composition comprising an alpha polyglutamated Antifolate (aPANTIFOL) composition.
  • aPANTIFOL alpha polyglutamated Antifolate
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the cell is an immune cell.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the aPANTIFOL contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the aPANTIFOL composition comprises an alpha tetraglutamated Antifolate. In some embodiments, the aPANTIFOL composition comprises an alpha pentaglutamated Antifolate. In other embodiments, the aPANTIFOL composition comprises an alpha hexaglutamated Antifolate. In some embodiments, the aPANTIFOL composition comprises an alpha polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section. In some embodiments, the composition comprises a liposome composition according to any of [13] -[72] of the Brief Summary Section ln some embodiments, the composition comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the disclosure provides a method of modulating the activation, chemokine production, or metabolic activity of a cell that comprises contacting the cell with a liposome comprising an alpha polyglutamated Antifolate (aPANTIFOL) composition.
  • aPANTIFOL alpha polyglutamated Antifolate
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the cell is an immune cell.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the aPANTIFOL contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the aPANTIFOL composition comprises an alpha tetraglutamated Antifolate. In some embodiments, the aPANTIFOL composition comprises an alpha pentaglutamated Antifolate. In other embodiments, the aPANTIFOL composition comprises an alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises an alpha polyglutamated Antifolate according to any of [ 1 ] - [ 12] of the Brief Summary Section. In some embodiments, the liposome is a liposome according to any of [l3]-[72] of the Brief Summary Section. In some embodiments, the liposome comprises an alpha polyglutamated Antifolate described in the Brief Summary Section.
  • the disclosure provides a method of killing a cell that comprises contacting the cell with a composition comprising an alpha polyglutamated Antifolate (aPANTIFOL) composition.
  • aPANTIFOL alpha polyglutamated Antifolate
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the hyperproliferative cell is a cancer cell.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central nervous system (CNS) lymphoma.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the aPANTIFOL contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the aPANTIFOL composition comprises an alpha tetraglutamated Antifolate.
  • the aPANTIFOL composition comprises an alpha pentaglutamated Antifolate.
  • the aPANTIFOL composition comprises an alpha hexaglutamated Antifolate.
  • the aPANTIFOL is a polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the aPANTIFOL composition comprises a liposome according to any of [13]-[72] of the Brief Summary Section.
  • the disclosure provides a method of killing a cell that comprises contacting the cell with a liposome containing alpha polyglutamated Antifolate (e.g. an Lp-aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aP ANTIF OL, TLp-aPANTIFOL or TPLp-aPANTIFOL).
  • a liposome containing alpha polyglutamated Antifolate e.g. an Lp-aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aP ANTIF OL, TLp-aPANTIFOL or TPLp-aPANTIFOL.
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the contacted hyperproliferative cell is a cancer
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma ( e.g ., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
  • the cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central nervous system (CNS) lymphoma.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the liposome contains a aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome contains alpha tetraglutamated Antifolate. In some embodiments, the liposome contains alpha pentaglutamated Antifolate. In other embodiments, the liposome contains alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [ l]-[ 12] of the Brief Summary Section. In some embodiments, the liposome comprises a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposomal composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a delivery vehicle (e.g., an antibody immunoconjugate or liposome) comprising alpha polyglutamated Antifolate to a subject having or at risk of having cancer.
  • a delivery vehicle e.g., an antibody immunoconjugate or liposome
  • the delivery vehicle is an antibody- containing immunoconjugate (comprising e.g., a full-length IgG antibody, a bispecific antibody, or a scFv).
  • the delivery vehicle is a liposome (e.g., an Lp- aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL, or TPLp-aPANTIFOL).
  • the administered delivery vehicle is pegylated. In some embodiments, the administered delivery vehicle is not pegylated.
  • the administered delivery vehicle comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a cancer cell.
  • the delivery vehicle comprises a targeting moiety that specifically binds a cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g ., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR
  • GONMB
  • the delivery vehicle comprises a targeting moiety that specifically binds a cell surface antigen(s) derived from, or determined to be expressed on, a specific subject’s cancer (tumor) such as a neoantigen.
  • the targeting moiety specifically binds a cell surface antigen(s) derived from or determined to be expressed on a specific subject’s tumor such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the administered delivery vehicle comprises aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered delivery vehicle comprises an alpha tetraglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises an alpha pentaglutamated Antifolate. In other embodiments, the administered delivery vehicle comprises an alpha hexaglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises L alpha polyglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, F-alpha glutamyl groups. In some embodiments, the administered delivery vehicle comprises D alpha polyglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-alpha glutamyl groups.
  • the administered delivery vehicle comprises L and D alpha polyglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-alpha glutamyl groups and 2, 3, 4, 5, or more than 5, D-alpha glutamyl groups.
  • the cancer is selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma ⁇ e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central nervous system (CNS) cancer.
  • a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from colorectal cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from ovarian cancer.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from endometrial cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from pancreatic cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from liver cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from head and neck cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from osteosarcoma.
  • the administered delivery vehicle comprises a polyglutamated Antifolate according to any of [1]-[12] of the Brief Summary Section. In some embodiments, the delivery vehicle comprises a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposomal composition comprises a liposome according to any of [13]-[72] of the Brief Summary Section.
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a liposome comprising alpha polyglutamated Antifolate (e.g ., an Lp-aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL, or TPLp-aPANTIFOL) to a subject having or at risk of having cancer.
  • an Lp-aPANTIFOL such as, PLp-aPANTIFOL, NTLp-aPANTIFOL, NTPLp-aPANTIFOL, TLp-aPANTIFOL, or TPLp-aPANTIFOL
  • the liposome is pegylated. In some embodiments, the liposome is not pegylated.
  • the liposome comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a cancer cell.
  • the liposome comprises a targeting moiety that specifically binds a cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC- 1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC- 16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD
  • the liposome comprises a targeting moiety that specifically binds a cell surface antigen(s) derived from or determined to be expressed on a specific subject’s tumor such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the liposome comprises aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the liposome comprises an alpha tetraglutamated Antifolate.
  • the liposome comprises an alpha pentaglutamated Antifolate. In other embodiments, the liposome comprises an alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [l]-[ 12] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposome is a liposome according to any of [l3]-[72] of the Brief Summary Section. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-alpha glutamyl groups.
  • the liposome comprises D alpha polyglutamated Antifolate. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, D-alpha glutamyl groups. In some embodiments, the liposome comprises L and D alpha polyglutamated Antifolate. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-alpha glutamyl groups and 2, 3, 4, 5, or more than 5, D-alpha glutamyl groups.
  • the cancer is selected from: lung (e.g ., non-small lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, and a hematologic malignancy (e.g., a leukemia or lymphoma).
  • lung e.g ., non-small lung cancer
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esophageal cancer
  • cervical cancer cervical cancer
  • liver cancer liver cancer
  • kidney cancer biliary duct cancer
  • gallbladder cancer gallbladder cancer
  • bladder cancer sarcoma (e.g.
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the cancer is lung cancer (e.g., NSCLC or mesothelioma).
  • the cancer is breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma.
  • the disclosure provides a method for treating cancer that comprises administering to a subject having or at risk of having cancer, an effective amount of a liposomal composition comprising a liposome that comprises an alpha polyglutamated Antifolate and a targeting moiety that has a specific affinity for an epitope of antigen on the surface of the cancer.
  • the liposome comprises a targeting moiety that specifically binds a cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, en doth el in receptor, HER2, HER3, EGFR,
  • the administered liposome comprises a targeting moiety that specifically binds a cell surface antigen(s) derived from, or determined to be expressed on, a specific subject’s tumor such as a neoantigen.
  • the administered liposomal composition comprises pegylated liposomes (e.g., TPLp- aPANTIFOL).
  • the administered liposomal composition comprises liposomes that are not pegylated.
  • liposomes of the administered liposomal composition comprise a aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • liposomes of the administered liposomal composition comprise alpha tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome composition comprises a liposome according to any of [13]- [72] of the Brief Summary Section.
  • the liposomal composition is administered to treat a cancer selected from: lung cancer (e.g., non-small cell), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, myeloma and other plasma cell dysplasias or dyscrasias, and leukemia and a lymphoma and other B cell malignancies.
  • lung cancer e.g., non-small cell
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esoph
  • the liposomal composition is administered to treat a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central nervous system (CNS) cancer.
  • the liposomal composition is administered to treat lung cancer (e.g., NSCLC or mesothelioma).
  • the liposomal composition is administered to treat breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the liposomal composition is administered to treat colorectal cancer. In some embodiments, the liposomal composition is administered to treat ovarian cancer. In some embodiments, the liposomal composition is administered to treat endometrial cancer. In some embodiments, the liposomal composition is administered to treat pancreatic cancer. In some embodiments, the liposomal composition is administered to treat liver cancer. In some embodiments, the liposomal composition is administered to treat head and neck cancer. In some embodiments, the liposomal composition is administered to treat osteosarcoma. .
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a liposomal composition to a subject having or at risk of having a cancer that expresses folate receptor on its cell surface, wherein the liposomal composition comprises liposomes that comprise (a) alpha polyglutamated Antifolate (aPANTIFOL) and (b) a targeting moiety that has specific binding affinity for a folate receptor.
  • the targeting moiety has specific binding affinity for folate receptor alpha (FR-a), folate receptor beta (FR-b), and/or folate receptor delta (FR-d).
  • the targeting moiety has a specific binding affinity for folate receptor alpha (FR- a) and folate receptor beta (FR-b).
  • the administered liposomal composition comprises pegylated liposomes (e.g., TPLp-aPANTIFOL).
  • the administered liposomal composition comprises liposomes that are not pegylated.
  • liposomes of the administered liposomal composition comprises an aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • liposomes of the administered liposomal composition comprise alpha tetraglutamated Antifolate.
  • liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprises an alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the liposomal composition is administered to treat a cancer selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a cancer selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorec
  • the liposomal composition is administered to treat a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central nervous system (CNS) cancer.
  • the liposomal composition is administered to treat lung cancer (e.g ., NSCLC or mesothelioma).
  • the liposomal composition is administered to treat breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the liposomal composition is administered to treat colorectal cancer. In some embodiments, the liposomal composition is administered to treat ovarian cancer. In some embodiments, the liposomal composition is administered to treat endometrial cancer. In some embodiments, the liposomal composition is administered to treat pancreatic cancer. In some embodiments, the liposomal composition is administered to treat liver cancer. In some embodiments, the liposomal composition is administered to treat head and neck cancer. In some embodiments, the liposomal composition is administered to treat osteosarcoma.
  • breast cancer e.g., HER2++ or triple negative breast cancer.
  • the liposomal composition is administered to treat colorectal cancer.
  • the liposomal composition is administered to treat ovarian cancer.
  • the liposomal composition is administered to treat endometrial cancer.
  • the liposomal composition is administered to treat
  • the disclosure provides a method for cancer maintenance therapy that comprises administering an effective amount of a liposomal composition comprising liposomes that contain alpha polyglutamated Antifolate (Lp-aPANTIFOL) to a subject that is undergoing or has undergone cancer therapy.
  • the administered liposomal composition is a PLp-aPANTIFOL, NTLp-aPANTIFOF, NTPFp- aPANTIFOL, TFp-aPANTIFOL or TPLp-aPANTIFOL.
  • liposomes of the administered liposomal composition comprises pegylated liposomes (e.g., PLp- aPANTIFOL, NTPFp-aPANTIFOF, or TPFp-aPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TFp-aPANTIFOL or TPLp-aPANTIFOL).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPFp- aPANTIFOL).
  • liposomes of the administered liposomal composition comprises an alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, liposomes of the administered liposomal composition comprise alpha tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise alpha hexaglutamated Antifolate. In some embodiments, the liposomal composition comprises a polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section.
  • the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the liposomal composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the disclosure provides a method for treating a disorder of the immune system that comprises administering an effective amount of a liposomal composition comprising liposomes that contain alpha polyglutamated Antifolate (e.g., Lp- aPANTIFOL, PLp- aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL or TPLp-aPANTIFOL) to a subject having or at risk of having a disorder of the immune system.
  • the liposomal composition is administered to treat an autoimmune disease.
  • the liposomal composition is administered to treat rheumatoid arthritis.
  • the liposomal composition is administered to treat inflammation.
  • the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, Takayasu, and psoriasis.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-aPANTIFOL, NTPLp- aPANTIFOL, or TPLp-aPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-aPANTIFOL or TPLp-aPANTIFOL) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-aPANTIFOL).
  • liposomes of the administered liposomal composition comprise alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • liposomes of the administered liposomal composition comprise alpha tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise alpha hexaglutamated Antifolate. In some embodiments, the administered liposomal composition comprises an alpha polyglutamated Antifolate according to any of [l]-[12] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposomal composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the disclosure provides a method for treating an autoimmune disease that comprises administering an effective amount of a liposomal composition comprising liposomes that contain alpha polyglutamated Antifolate (e.g ., Lp- aPANTIFOL, PLp- aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL or TPLp-aPANTIFOL) to a subject having or at risk of having an autoimmune disease.
  • the autoimmune disease is rheumatoid arthritis.
  • the autoimmune disease is selected from: inflammatory bowel disease (IBD), Crohn disease, systemic lupus erythematosus, and psoriasis.
  • the autoimmune disease is a disease or disorder selected from: Addison’s disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, diabetes (Type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain- Barr syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthr
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-aPANTIFOL, NTPLp-aPANTIFOL, or TPLp-aPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-aPANTIFOL or TPLp-aPANTIFOL) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-aPANTIFOL).
  • liposomes of the administered liposomal composition comprise alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, liposomes of the administered liposomal composition comprise alpha tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [ 1 ] - [ 12] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [13]-[72] of the Brief Summary Section.
  • the disclosure provides a method for treating an inflammatory disorder that comprises administering an effective amount of a liposomal composition comprising liposomes that contain alpha polyglutamated Antifolate (e.g., Lp- aPANTIFOL, PLp- aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL or TPLp-aPANTIFOL) to a subject having or at risk of having an inflammatory disorder.
  • alpha polyglutamated Antifolate e.g., Lp- aPANTIFOL, PLp- aPANTIFOL, NTLp-aPANTIFOL, NTPLp- aPANTIFOL, TLp- aPANTIFOL or TPLp-aPANTIFOL
  • the inflammatory disorder is a disorder selected from: acute inflammation, chronic inflammation, systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, and systemic lupus erythematosus.
  • IBD inflammatory bowel disease
  • Crohn disease dermatomyositis/ polymyositis
  • systemic lupus erythematosus selected from: acute inflammation, chronic inflammation, systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, and systemic lupus erythematosus.
  • the inflammatory disorder is a disorder selected from: a rheumatoid disease or other arthritic disease (e.g., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis, neuropathic arthritis, polyarthritis, proliferative arthritis, psoriatic arthritis, venereal arthritis, viral arthritis), fibrositis, pelvic inflammatory disease, acne, psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat rash, Stevens-Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis.
  • a rheumatoid disease or other arthritic disease e.g., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis,
  • the inflammatory disorder is an inflammatory bowel disease.
  • Inflammatory bowel diseases are chronic inflammatory diseases of the gastrointestinal tract which include, without limitation, Crohn's disease, ulcerative colitis, and indeterminate colitis.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-aPANTIFOL, NTPLp-aPANTIFOL, or TPLp- aPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-aPANTIFOL or TPLp-aPANTIFOL) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-aPANTIFOL).
  • liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • liposomes of the administered liposomal composition comprise alpha tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise alpha pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise alpha hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [1]- [12] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [13]-[72] of the Brief Summary Section.
  • the disclosure also provides a method of delivering alpha polyglutamated Antifolate to a site of inflammation in a subject that comprises: administering to the subject having the inflammation, a composition comprising alpha polyglutamated Antifolate (L-aPANTIFOL) and a targeting moiety that has a specific binding affinity for an epitope on a surface antigen on a cell that is located at, or otherwise influences the inflammation (e.g., via proinflammatory cytokine production).
  • the administered targeting moiety is associated with a delivery vehicle.
  • the delivery vehicle is an antibody or an antigen binding fragment of an antibody.
  • the delivery vehicle is a liposome.
  • the antibody, antigen-binding antibody fragment, or liposome is pegylated liposomes (e.g TPLp-aPANTIFOL).
  • the administered composition comprises an alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered composition comprises an alpha tetraglutamated Antifolate.
  • the administered composition comprises an alpha pentaglutamated Antifolate.
  • the administered composition comprises an alpha hexaglutamated Antifolate.
  • the aPANTIFOL is a polyglutamated Antifolate according to any of [ l]-[ 12] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the delivery vehicle is a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the disclosure also provides a method of delivering alpha polyglutamated Antifolate to a tumor cancer cell that comprises: administering to a subject having the tumor, a composition comprising alpha polyglutamated Antifolate (L-aPANTIFOL) and a targeting moiety that has a specific binding affinity for an epitope on a surface antigen on the tumor cell or cancer cell.
  • the administered targeting moiety is associated with a delivery vehicle.
  • the delivery vehicle is an antibody or an antigen binding fragment of an antibody.
  • the delivery vehicle is a liposome.
  • the antibody, antigen-binding antibody fragment, or liposome is pegylated liposomes (e.g., TPLp-aPANTIFOL).
  • the administered composition comprises an alpha polyglutamated Antifolate that contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered composition comprises an alpha tetraglutamated Antifolate.
  • the administered composition comprises an alpha pentaglutamated Antifolate.
  • the administered composition comprises an alpha hexaglutamated Antifolate.
  • the aPANTIFOL is a polyglutamated Antifolate according to any of [ l]-[ 12] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the delivery vehicle is a liposome according to any of [13]-[72] of the Brief Summary Section.
  • the disclosure provides a method of preparing a liposomal composition that comprises a liposomal alpha polyglutamated Antifolate (aPANTIFOL) composition, the method comprising: forming a mixture comprising: liposomal components and a polyglutamated Antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing polyglutamated Antifolate.
  • the alpha polyglutamated Antifolate contains 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the polyglutamated Antifolate composition comprises an alpha tetraglutamated Antifolate.
  • the polyglutamated Antifolate composition comprises an alpha pentaglutamated Antifolate. In other embodiments, the polyglutamated Antifolate composition comprises an alpha hexaglutamated Antifolate.
  • the aPANTIFOL is a polyglutamated Antifolate according to any of [l]-[l2] of the Brief Summary Section. In some embodiments, the aPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the liposomal composition comprises a liposome according to any of [l3]-[72] of the Brief Summary Section.
  • the disclosure provides a kit comprising an Antifolate alpha polyglutamate composition and/or aPANTIFOL delivery vehicles such as liposomes containing aPANTIFOL and aPANTIFOL immunoconjugates (e.g., ADCs) described herein.
  • aPANTIFOL delivery vehicles such as liposomes containing aPANTIFOL and aPANTIFOL immunoconjugates (e.g., ADCs) described herein.
  • FIGS. 1A-1R show chemical formulas of the Antifolate pemetrexed (FIG. 1A), exemplary alpha pemetrexed poly glutamates, alpha pemetrexed diglutamate (FIG. IB), alpha pemetrexed triglutamate (FIGS. 1C and ID), alpha pemetrexed tetraglutamate (FIGS. IE and IF), alpha pemetrexed pentaglutamates (FIGS. 1G and 1H), alpha pemetrexed hexaglutamates (FIGS. II and 1J), alpha pemetrexed heptaglutamate (FIGS.
  • FIGS. 1A-1R show chemical formulas of the Antifolate pemetrexed (FIG. 1A), exemplary alpha pemetrexed poly glutamates, alpha pemetrexed diglutamate (FIG. IB), alpha pemetrexed triglutamate (FIGS. 1C and ID), alpha pemetrexe
  • FIGS. lO-lR present depictions of exemplary branched alpha pemetrexed polyglutamate structures, including a branched polyglutamate having a gamma glutamyl backbone and alpha glutamyl branches (FIG. IP) and a branched polyglutamate having an alpha glutamyl backbone and gamma glutamyl branches (FIG. IQ and 1R).
  • FIG. 2 presents the relative potency of liposomal pemetrexed alpha-L hexaglutamate
  • liposomal aG6 liposomal alpha-D hexaglutamate
  • liposomal aDG6 liposomal alpha-D hexaglutamate
  • FIG. 3 presents an example dose response relationship of free pemetrexed L-gamma hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6), pemetrexed, and folate receptor alpha targeting antibody (FRlAb) liposomal pemetrexed L- gamma hexaglutamate (liposomal gG6-FRlAb) in the NCI H2342 non-small cell lung cancer (NSCLC), adenocarcinoma subtype depicted as the percentage of viable cells after 48 hours of treatment.
  • NCI H2342 non-small cell lung cancer NCI H2342 non-small cell lung cancer
  • Folate receptor alpha targeted liposomes containing alpha polyglutamated pemetrexed are expected to also be successful in targeting and reducing the viability of NCI H2342 non-small cell lung cancer cells.
  • FIG. 4 presents an example dose response relationship of free pemetrexed L-gamma hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6), pemetrexed, and folate receptor alpha targeting antibody (FRlAb) liposomal pemetrexed L- gamma hexaglutamate (liposomal gG6-FRl Ab) in the HT-29 (colon cancer) at 48 hours.
  • Folate receptor alpha targeted liposomes containing alpha polyglutamated pemetrexed are expected to also be successful in targeting and reducing the viability of HT-29 (colon cancer) cells.
  • FIG. 5 presents the treatment effect on HCC1806 triple negative breast cancer cells following exposure of liposomal pemetrexed alpha-L hexaglutamate (Lps Hexa aG6), liposomal pemetrexed alpha-D hexaglutamate (Lps Hexa aDG6), and to pemetrexed over 48 hours.
  • Lps Hexa aG6 liposomal pemetrexed alpha-L hexaglutamate
  • Lps Hexa aDG6 liposomal pemetrexed alpha-D hexaglutamate
  • FIG. 6 presents the treatment effect on OAW28 ovarian cancer cells following exposure of liposomal pemetrexed alpha-L hexaglutamate (Lps Hexa aG6), liposomal pemetrexed alpha-D hexaglutamate (Lps Hexa aDG6), and to pemetrexed over 48 hours.
  • Lps Hexa aG6 liposomal pemetrexed alpha-L hexaglutamate
  • Lps Hexa aDG6 liposomal pemetrexed alpha-D hexaglutamate
  • Lps Hexa aG6 liposomal pemetrexed alpha-L hexaglutamate
  • Lps Hexa aDG6 liposomal pemetrexed alpha-D hexaglutamate
  • FIG. 8 presents the treatment effect on H292 non-small cell lung cancer cells following exposure of various dose levels ranging from 16 to 128 nM of liposomal pemetrexed alpha-L hexaglutamate (Liposomal aG6), liposomal pemetrexed alpha-D hexaglutamate (Liposomal aDG6), and pemetrexed over 48 hours.
  • the liposomal pemetrexed aG6 formulation is superior to inhibiting H292 non-small cell lung cancer cells compared to pemetrexed.
  • FIG. 9 presents the treatment effect on HCC1806 triple negative breast cancer cells following exposure of various dose levels ranging from 16 to 128 nM of liposomal pemetrexed alpha-L hexaglutamate (Liposomal aG6), liposomal pemetrexed alpha-D hexaglutamate (Liposomal aDG6), and pemetrexed over 48 hours.
  • the liposomal pemetrexed aG6 formulation is superior to pemetrexed in inhibiting HCC 1806 triple negative breast cancer cells.
  • FIG. 10 presents the treatment effect on OAW28 ovarian cancer cells of liposomal pemetrexed alpha-L hexaglutamate (Liposomal aG6), liposomal alpha-D hexaglutamate (Liposomal aDG6), and pemetrexed following exposure over 48 hours following exposure over a range of concentrations.
  • pemetrexed appears to more effective than the Liposomal pemetrexed aG6 liposomal formulation, whereas the liposomal formulation at the dose of 32 nM and 64 nM has a better treatment effect than pemetrexed; at 16 nM the Liposomal pemetrexed aG6 treatment effect is similar in to pemetrexed.
  • FIG. 11 shows the toxicity of liposomal pemetrexed alpha-L hexaglutamate
  • FIG. 1 Liposomal aG6
  • Liposomal aDG6 liposomal pemetrexed alpha-D hexaglutamate
  • pemetrexed on differentiating human neutrophils 64 nM, 128 nM, and 264 nM.
  • the figure demonstrates that liposomal pemetrexed aG6 is significantly less toxic to differentiating human neutrophils than pemetrexed.
  • liposomal aG6 liposomal pemetrexed alpha-L hexaglutamate
  • liposomal alpha-D hexaglutamate liposomal aDG6
  • pemetrexed on neutrophils following exposure of various dose levels ranging from 16 to 128 nM of the corresponding agent over 48 hours.
  • FIG. 13 shows the effect of liposomal pemetrexed alpha-L hexaglutamate (liposomal aG6), liposomal pemetrexed alpha-D hexaglutamate (liposomal aDG6), and pemetrexed on AML12 liver cells following exposure over 48 hours at 16 nM, 32 nM, and 64 nM, and 128 nM of the corresponding agent. Strikingly, there does not appear to be any toxicity to the AML 12 liver cells following treatment with a liposomal pemetrexed aG6 at any of the liposomal agents at the dose levels tested. In contrast, pemetrexed treatment results in a reduction in the AML12 liver cell counts of approximately 40% at all doses studied.
  • FIG. 14 shows the effect of liposomal pemetrexed alpha-L hexaglutamate (liposomal aG6), liposomal pemetrexed alpha-D hexaglutamate (liposomal aDG6), and pemetrexed on CCD841 colon epithelium cells following exposure over 48 hours at 16 nM, 32 nM, and 64 nM, and 128 nM, of the corresponding agent. At all of the concentrations tested, pemetrexed leads to approximately a >50% decrease in the number of CCD841 colon epithelium cells compared to approximately a 20% or less decrease in cell number after treatment with each of the liposome compositions tested.
  • FIG. 15 depicts the stmcture of polyglutamate antifolate, cisplatin (CDDP) and two potential aG6-Cisplatin complexes.
  • CDDP polyglutamate antifolate
  • aG6-Cisplatin complexes The pH dependent formation of the interstrand and/or instrastrand coordination between the carboxyl groups of the polyglutamated Antifolate and cisplatin is likely to disassemble into individual molecules of aG6 and cisplatin upon encountering acidic pH of lysosomes (pH 4-5) and presence of chloride ions inside the cells.
  • FIG. 16 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and
  • WBC white blood cell
  • FIG. 17 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and 80 mg/kg given once weekly for 4 weeks upon hemoglobin and reticulocyte indices. There is a minimal decrease in mean hemoglobin concentrations at the higher dose level. In parallel there is a slight increase in mean reticulocytosis indices
  • FIG. 18 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and
  • liver transaminases 80 mg/kg given once weekly for 4 weeks upon hepatic markers including serum aspartate transaminase (AST) and serum alanine transaminase (ALT) along with serum albumin.
  • AST serum aspartate transaminase
  • ALT serum alanine transaminase
  • FIG. 19 presents the relative tumor volume of immunodeficient female Nu/J mice (6- 8 weeks old) inoculated with NCI-H292 (Non-Small Cell Lung Cancer) cells and administered control, pemetrexed, and Liposomal aG6 intravenously at 167 mg/kg once every three weeks.
  • liposomal aG6 provides reduced tumor control compared to pemetrexed.
  • FIG. 20 presents the results of a liposomal pemetrexed alpha-L hexaglutamate (Liposomal aG6) treatment survival study in a NSCLC (H292) xenograft model.
  • the survival curve of mice (10) dosed intravenously with 90 mg/kg Liposomal aG6 once a week for four weeks (90 mg/kg subQ weekly for 6 weeks) is depicted with a solid circle.
  • the survival curve of mice (10) dosed with pemetrexed (167 mg/kg intravenously every three weeks for 6 weeks) is depicted with a solid triangle.
  • the dose of 167 mg/kg of pemetrexed in mice is equivalent to a dose of 500 mg/m 2 in humans.
  • the survival curve of control mice (10) is depicted with an open diamond.
  • FIGS. 21A-F present the dose response relationship of liposomal pemetrexed alpha- L triglutamate (Liposomal aG3), liposomal pemetrexed alpha-L pentaglutamate (Liposomal aG5), liposomal pemetrexed alpha-L octaglutamate (Liposomal aG7), and a combination of liposomal pemetrexed alpha-L hexaglutamate (aG6) and alpha-L dodecaglutamate (aGl2) (Liposomal aG6 and aGl2) over 48 hours on H2342 (NSCLC, adenocarcinoma subtype)(FIG.
  • NSCLC adenocarcinoma subtype
  • FIG. 21A H292 (NSCLC, adenocarcinoma subtype)(FIG. 21B), HT-29 (colon cancer)(FIG. 21C), HCC1806 (triple negative breast cancer)(FIG. 21D), MCF7 (ER+ breast cancer)(FIG. 21E), and OAW28 (ovarian cancer)(FIG. 21F).
  • CCG CellTiter-Glo®
  • the disclosure generally relates to novel alpha polyglutamated Antifolate compositions.
  • the compositions provide advances over prior treatments of hyperproliferative diseases such as cancer.
  • Methods of making, delivering and using the alpha polyglutamated Antifolate compositions are also provided.
  • the alpha polyglutamated compositions have uses that include but are not limited to treating or preventing hyperproliferative diseases such as cancer, disorders of the immune system including inflammation and autoimmune disease such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • the term“and/or” as used in a phrase such as“A and/or B” herein is intended to include both A and B; A or B; A (alone); and B (alone).
  • the term“and/or” as used in a phrase such as“A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
  • Headings and subheadings are used for convenience and/or formal compliance only, do not limit the subject technology, and are not referred to in connection with the interpretation of the description of the subject technology.
  • Features described under one heading or one subheading of the subject disclosure may be combined, in various embodiments, with features described under other headings or subheadings. Further it is not necessarily the case that all features under a single heading or a single subheading are used together in embodiments.
  • Antifolate and “ANTIFOL” are used interchangeably to include a salt, acid and and/or free base form of an antifolate (e.g., Antifolate disodium).
  • Compositions containing a ANTIFOL salt may further contain any of a variety of cations, such as Na+, Mg2+, K+, NH4+, and/or Ca2+.
  • the salts are pharmaceutically acceptable salts.
  • the Antifolate salt contains Na+.
  • Antifolates typically contain one L-gamma glutamyl group, and are therefore considered to be monoglutamated for the purpose of this disclosure.
  • the compounds of the present invention can exist as a mixture of stereoisomers it is preferred that they are resolved into one optically active isomeric form. Such a requirement complicates the synthesis of the compounds and it is preferred therefore that they contain as few asymmetric carbon atoms as possible consistent with achieving the desired activity.
  • the cyclopenta[g]quinazolines of the present invention contain at least three asymmetric carbon atoms.
  • that at the 6 position of the ring system preferably has the 6S orientation rather than the 6R orientation.
  • the preferred compounds (I) described hereinbefore thus preferably have such a configuration at this asymmetric carbon atoms or less preferably are a mixture in which one or both of these asymmetric carbon atoms is unresolved.
  • the antifolate can be any known or future derived folate or Antifolate that is polyglutamated.
  • the Antifolate is selected from LV (etoposide), L- leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2- CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2- CH3-AMT, 2-desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO-deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroyl)-N delta-
  • the Antifolate is a member selected from: Aminopterin, methotrexate, raltitrexed (also referred to as TOMUDEX, ZD 1694 (RTX)), plevitrexed (also referred to as BGC 9331; ZD9331), pemetrexed (also referred to as ALIMTA, LY231514), lometrexol (LMX) (5,l0-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945 (also referred to as BGC945) or a stereoisomer thereof such as 6-R,S-BGC945 (ONX-0801), CB300638 (also referred to as BGC638), and BW1843U89
  • polyglutamate refers to a composition comprising at least one chain of 2 or more linked glutamyl groups.
  • Polyglutamate chains can be linear or branched.
  • Linear polyglutamate chains can contain for example, glutamyl groups containing either an alpha carboxyl group or a gamma carboxyl group linkage.
  • Branched polyglutamate chains can comprise for example, one or more glutamyl groups that contain both an alpha carboxyl group and a gamma carboxyl group linkage to other glutamyl groups, thereby providing a branch point of the poly glutamate.
  • Exemplary branched polyglutamates are depicted in FIGS. 10- 1R.
  • Poly glutamate chains comprise an N-terminal glutamyl group and one or more C-terminal glutamyl groups.
  • the N-terminal glutamyl group of a polyglutamate chain is not linked to another glutamyl group via its amine group, but is linked to one or more glutamyl group via its carboxylic acid group.
  • the N-terminal glutamyl group of a polyglutamated- Antifolate is the glutamyl group of the Antifolate.
  • the C-terminal glutamyl group or groups of a polyglutamate chain are linked to another glutamyl group via their amine group, but are not linked to another glutamyl group via their carboxylic acid group.
  • PG “PANTIFOL” and iterations thereof, are used interchangeably herein to refer to a Antifolate composition that comprises at least one glutamyl group in addition to the glutamyl group in the Antifolate (i.e ., ANTIFOF-PGn, wherein n > 1).
  • Reference to the number of glutamyl groups in a aPANTIFOL (ANTIFOL-PG) herein takes into account the glutamyl group in the Antifolate.
  • an ANTIFOL-PG composition containing 5 glutamyl residues in addition to the glutamyl group of ANTIFOL is referred to herein as hexaglutamated Antifolate or Antifolate hexaglutamate.
  • alpha glutamyl group refers to a glutamyl group that contains an alpha carboxyl group linkage.
  • the alpha linkage is an amide bond between the alpha carboxyl group of one glutamyl group and a second glutamyl group.
  • the alpha linkage can be between a glutamyl group and the glutamyl group in the Antifolate, or between the glutamyl group and a second glutamyl group that is not present in Antifolate, such as a glutamyl group within a polyglutamate chain attached to Antifolate.
  • gamma glutamyl group refers to a glutamyl group that contains a gamma carboxyl group linkage.
  • FPGS folylpoly-gamma-glutamate synthetase
  • the gamma linkage is an amide bond between the gamma carboxyl group of one glutamyl group and a second glutamyl group.
  • the gamma linkage can be between a glutamyl group and the glutamyl group in the Antifolate, or between the glutamyl group and a second glutamyl group that is not present in Antifolate, such as a glutamyl group within a polyglutamate chain attached to Antifolate.
  • the gamma linkage refers to the amide bond of the glutamyl group of the Antifolate.
  • Reference to gamma linkages are inclusive of gamma linkage of the glutamyl group of the Antifolate unless it is expressly stated or is unambiguously clear from the context that such is not intended.
  • alpha polyglutamated Antifolate aPANTIFOL”,“alpha-ANTIFOL-PG”, and iterations thereof, are used interchangeably herein to refer to a polyglutamated- Antifolate composition that comprises at least one glutamyl group that contains an alpha linkage.
  • a pentaglutamated-ANTIFOL composition wherein the 3rd glutamyl group have an alpha linkage, but each of the other glutamyl groups has a gamma linkage, is considered to be an alpha-ANTIFOL-PG for the purposes of this disclosure.
  • Isolated refers to a composition which is in a form not found in nature.
  • Isolated alpha polyglutamated compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature.
  • an alpha polyglutamated Antifolate which is isolated is substantially pure. Isolated compositions will be free or substantially free of material with which they are naturally associated such as other cellular components such as proteins and nucleic acids with which they may potentially be found in nature, or the environment in which they are prepared (e.g., cell culture).
  • the alpha polyglutamated compositions may be formulated with diluents or adjuvants and still for practical purposes be isolated - for example, the alpha polyglutamated compositions will normally be mixed with pharmaceutically acceptable carriers or diluents when used in diagnosis or therapy.
  • the isolated alpha polyglutamated compositions e.g., alpha polyglutamates and delivery vehicles such as liposomes containing the alpha polyglutamate contain less than 1% or less than 0.1% undesired DNA or protein content.
  • the alpha polyglutamate compositions e.g., alpha polyglutamate and delivery vehicles such as liposomes containing the alpha polyglutamate
  • targeting moiety is used herein to refer to a molecule that provides an enhanced affinity for a selected target, e.g., a cell, cell type, tissue, organ, region of the body, or a compartment, e.g., a cellular, tissue or organ compartment.
  • the targeting moiety can comprise a wide variety of entities. Targeting moieties can include naturally occurring molecules, or recombinant or synthetic molecules. In some embodiments, the targeting moiety is an antibody, antigen-binding antibody fragment, bispecific antibody or other antibody-based molecule or compound.
  • the targeting moiety is an aptamer, avimer, a receptor-binding ligand, a nucleic acid, a biotin-avidin binding pair, a peptide, protein, carbohydrate, lipid, vitamin, toxin, a component of a microorganism, a hormone, a receptor ligand or any derivative thereof.
  • Other targeting moieties are known in the art and are encompassed by the disclosure.
  • the terms“specific affinity” or“specifically binds” mean that a targeting moiety such as an antibody or antigen binding antibody fragment, reacts or associates more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to the epitope, protein, or target molecule than with alternative substances, including proteins unrelated to the target epitope. Because of the sequence identity between homologous proteins in different species, specific affinity can, in several embodiments, include a binding agent that recognizes a protein or target in more than one species. Likewise, because of homology within certain regions of polypeptide sequences of different proteins, the term “specific affinity” or“specifically binds” can include a binding agent that recognizes more than one protein or target.
  • a targeting moiety that specifically binds a first target may or may not specifically bind a second target.
  • “specific affinity” does not necessarily require (although it can include) exclusive binding, e.g., binding to a single target.
  • a targeting moiety may, in certain embodiments, specifically bind more than one target. In certain embodiments, multiple targets may be bound by the same targeting moiety.
  • epitope refers to that portion of an antigen capable of being recognized and specifically bound by a targeting moiety (i.e., binding moiety) such as an antibody.
  • a targeting moiety i.e., binding moiety
  • epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing.
  • An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
  • Expressions like“binding affinity for a target”,“binding to a target” and analogous expressions known in the art refer to a property of a targeting moiety which may be directly measured through the determination of the affinity constants, e.g., the amount of targeting moiety that associates and dissociates at a given antigen concentration.
  • Different methods can be used to characterize the molecular interaction, such as, but not limited to, competition analysis, equilibrium analysis and microcalorimetric analysis, and real-time interaction analysis based on surface plasmon resonance interaction (for example using a BIACORE® instmment).
  • delivery vehicle refers generally to any compositions that acts to assist, promote or facilitate entry of alpha polyglutamated Antifolate into a cell.
  • delivery vehicles include, but are not limited to, liposomes, lipospheres, polymers ( e.g ., polymer-conjugates), peptides, proteins such as antibodies ⁇ e.g., immunoconjugates, such as Antibody Drug Conjugates (ADCs)) and antigen binding antibody fragments and derivatives thereof), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), micelles, microparticles (e.g., microspheres), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), hydrogels, lipoprotein particles, viral sequences, viral material, or lipid or liposome formulations, and combinations thereof.
  • the delivery vehicle can be linked directly
  • A“subject” refers to a human or vertebrate mammal including but not limited to a dog, cat, horse, goat and primate, e.g., monkey.
  • the invention can also be used to treat diseases or conditions in non-human subjects. For instance, cancer is one of the leading causes of death in companion animals (i.e., cats and dogs).
  • the subject is a human.
  • the term “subject” and “patient” is used interchangeably and has the same meaning. It is preferred generally that a maximum dose be used, that is, the highest safe dose according to sound medical judgment.
  • an“effective amount” refers to a dosage of an agent sufficient to provide a medically desirable result.
  • the effective amount will vary with the desired outcome, the particular condition being treated or prevented, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent or combination therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner.
  • An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
  • the effective amount of an agent may reduce the number of cancer cells; reduce the tumor size; inhibit ⁇ i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit ⁇ i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the disorder.
  • the dmg may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic.
  • efficacy in vivo can, for example, be measured by assessing the duration of survival, duration of progression free survival (PFS), the response rates (RR), duration of response, and/or quality of life.
  • the terms“hyperproliferative disorder”, “proliferative disease”, and“proliferative disorder”, are used interchangeably herein to pertain to an unwanted or uncontrolled cellular proliferation of excessive or abnormal cells which is undesired, such as, neoplastic or hyperplastic growth, whether in vitro or in vivo.
  • the proliferative disease is cancer or tumor disease (including benign or cancerous) and/or any metastases, wherever the cancer, tumor and/or the metastasis is located.
  • the proliferative disease is a benign or malignant tumor.
  • the proliferative disease is a non-cancerous disease.
  • the proliferative disease is a hyperproliferative condition such as hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • hyperproliferative condition such as hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • Cancer “tumor,” or“malignancy” are used as synonymous terms and refer to any of a number of diseases that are characterized by uncontrolled, abnormal proliferation of cells, the ability of affected cells to spread locally or through the bloodstream and lymphatic system to other parts of the body (metastasize) as well as any of a number of characteristic structural and/or molecular features.“Tumor,” as used herein refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. A“cancerous tumor,” or“malignant cell” is understood as a cell having specific structural properties, lacking differentiation and being capable of invasion and metastasis.
  • a cancer that can be treated using an aPANTIFOL composition provided herein includes without limitation, a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the cancer is lung cancer (e.g., NSCLC or mesothelioma).
  • the cancer is breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma. Other types of cancer and tumors that may be treated using a aPANTIFOL composition are described herein or otherwise known in the art.
  • tumor refers to spread or dissemination of a tumor, cancer or neoplasia to other sites, locations, regions or organ or tissue systems within the subject, in which the sites, locations regions or organ or tissue systems are distinct from the primary tumor, cancer or neoplasia.
  • Terms such as “treating,” or “treatment,” or “to treat” refer to both (a) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and (b) prophylactic or preventative measures that prevent and/or slow the development of a targeted disease or condition.
  • subjects in need of treatment include those already with the cancer, disorder or disease; those at risk of having the cancer or condition; and those in whom the infection or condition is to be prevented.
  • Subjects are identified as“having or at risk of having” cancer, an infectious disease, a disorder of the immune system, a hyperproliferative disease, or another disease or disorder referred to herein using well-known medical and diagnostic techniques.
  • a subject is successfully "treated” according to the methods provided herein if the subject shows, e.g., total, partial, or transient amelioration or elimination of a symptom associated with the disease or condition (e.g., cancer, rheumatoid arthritis).
  • the terms treating," or “treatment,” or “to treat” refer to the amelioration of at least one measurable physical parameter of a proliferative disorder, such as growth of a tumor, not necessarily discernible by the patient.
  • the terms treating,” or “treatment,” or “to treat” refer to the inhibition of the progression of a proliferative disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both.
  • the terms treating,” or “treatment,” or “to treat” refer to the reduction or stabilization of tumor size, tumor cell proliferation or survival, or cancerous cell count. Treatment can be with a a-PANTIFOL composition, alone or in combination with an additional therapeutic agent.
  • Subject and“patient,” and“animal” are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals.
  • Animal include all vertebrates, e.g., mammals and non-mammals, such as chickens, amphibians, and reptiles.
  • “Mammal” as used herein refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and other members of the class Mammalia known in the art.
  • the patient is a human.
  • “Treatment of a proliferative disorder” is used herein to include maintaining or decreasing tumor size, inducing tumor regression (either partial or complete), inhibiting tumor growth, and/or increasing the life span of a subject having the proliferative disorder.
  • the proliferative disorder is a solid tumor.
  • Such tumors include, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma.
  • the proliferative disorder is a hematologic malignancy.
  • Such hematologic malignancies include for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • the cancer is selected from: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central nervous system (CNS) cancer.
  • the cancer is lung cancer (e.g., NSCLC or mesothelioma).
  • the cancer is breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma.
  • autoimmune disease as used herein is defined as a disorder that results from an autoimmune response.
  • An autoimmune disease is the result of an inappropriate and excessive response to a self-antigen.
  • autoimmune diseases include but are not limited to, Addison’s disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (Type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarth
  • Inflammation refers to a local response to cellular injury that is marked by capillary dilatation, leukocytic infiltration, redness, heat, and pain that serves as a mechanism initiating the elimination of noxious agents and of damaged tissue.
  • the site of inflammation includes the lungs, the pleura, a tendon, a lymph node or gland, the uvula, the vagina, the brain, the spinal cord, nasal and pharyngeal mucous membranes, a muscle, the skin, bone or bony tissue, a joint, the urinary bladder, the retina, the cervix of the uterus, the canthus, the intestinal tract, the vertebrae, the rectum, the anus, a bursa, a follicle, and the like.
  • Such inflammatory diseases include, but are not limited to, inflammatory bowel disease, rheumatoid diseases (e.g ., rheumatoid arthritis), other arthritic diseases (e.g., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis, neuropathic arthritis, polyarthritis, proliferative arthritis, psoriatic arthritis, venereal arthritis, viral arthritis), fibrositis, pelvic inflammatory disease, acne, psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat rash, Stevens- Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis.
  • rheumatoid diseases e.g ., rheumatoid arthritis
  • other arthritic diseases e.g., acute arthritis, acute gout
  • Inflammatory bowel diseases are chronic inflammatory diseases of the gastrointestinal tract which include, without limitation, Crohn's disease, ulcerative colitis, and indeterminate colitis.
  • Rheumatoid arthritis is a chronic inflammatory disease primarily of the joints, usually polyarticular, marked by inflammatory changes in the synovial membranes and articular structures and by muscle atrophy and rarefaction of the bones.
  • therapeutic agent is used herein to refer to an agent or a derivative or prodrug thereof, that can interact with a hyperproliferative cell such as a cancer cell or an immune cell, thereby reducing the proliferative status of the cell and/or killing the cell.
  • therapeutic agents include, but are not limited to, chemotherapeutic agents, cytotoxic agents, platinum-based agents (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., TAXOL®), etoposide, alkylating agents (e.g., cyclophosphamide, ifosamide), metabolic antagonists (e.g., Antifolate (ANTIFOL), 5- fluorouracil gemcitabine, or derivatives thereof), antitumor antibiotics (e.g., mitomycin, doxorubicin), plant-derived antitumor agents (e.g., vincristine, vindesine, TAXOL®).
  • chemotherapeutic agents e.g., cytotoxic agents, platinum-based agents (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., TAXOL®), etoposide, alkylating
  • Such agents may further include, but are not limited to, the anticancer agent trimetrexate, temozolomide, raltitrexed, S-(4-Nitrobenzyl)-6-thioinosine (NBMPR), 6-benzyguanidine (6-BG), bis-chloronitrosourea (BCNU) and CAMPTOTHECINTM, or a therapeutic derivative of any thereof.
  • NBMPR S-(4-Nitrobenzyl)-6-thioinosine
  • 6-BG 6-benzyguanidine
  • BCNU bis-chloronitrosourea
  • CAMPTOTHECINTM CAMPTOTHECINTM
  • therapeutic agents include, without limitation, anti-restenosis, pro- or anti-proliferative, anti-inflammatory, anti neoplastic, antimitotic, anti-platelet, anticoagulant, antifibrin, antithrombin, cytostatic, antibiotic and other anti-infective agents, anti-enzymatic, anti-metabolic, angiogenic, cytoprotective, angiotensin converting enzyme (ACE) inhibiting, angiotensin II receptor antagonizing and/or cardioprotective agents.
  • “Therapeutic agents” also refer to salts, acids, and free based forms of the above agents.
  • the term“chemotherapeutic agent” when used in relation to cancer therapy refers to any agent that results in the death of cancer cells or inhibits the growth or spread of cancer cells.
  • chemotherapeutic agents include alkylating agents, antibiotics, antimetabolitic agents, plant-derived agents, and hormones.
  • the chemotherapeutic agent is cisplatin.
  • the chemotherapeutic agent is carboplatin.
  • the chemotherapeutic agent is oxaliplatin.
  • the chemotherapeutic agent is gemcitabine.
  • the chemotherapeutic agent is doxorubicin.
  • antimetabolite is used herein to refer to a therapeutic agent that inhibits the utilization of a metabolite or a prodrug thereof.
  • antimetabolites include Antifolate, pemetrexed, 5-fluorouracil, 5-fluorouracil prodrugs such as capecitabine, 5- fluorodeoxyuridine monophosphate, cytarabine, cytarabine prodrugs such as nelarabine, 5- azacytidine, gemcitabine, mercaptopurine, thioguanine, azathioprine, adenosine, pentostatin, erythrohydroxynonyladenine, and cladribine.
  • Anti-metabolites useful for practicing the disclosed methods include nucleoside analogs, including a purine or pyrimidine analogs.
  • the alpha polyglutamated Antifolate compositions are used in combination with an antimetabolite selection from fluoropyrimidine 5-fluorouracil, 5-fluoro-2'- deoxycytidine, cytarabine, gemcitabine, troxacitabine, decitabine, Azacytidine, pseudoisocytidine, Zebularine, Ancitabine, Fazarabine, 6-azacytidine, capecitabine, N4- octadecyl-cytarabine, elaidic acid cytarabine, fludarabine, cladribine, clofarabine, nelarabine, forodesine, and pentostatin, or a derivative thereof.
  • the nucleoside analog is a substrate for a nucleoside deaminase that is adenosine deaminase or cytidine deaminase.
  • the nucleoside analog is selected from among fludarabine, cytarabine, gemcitabine, decitabine and azacytidine or derivatives thereof.
  • the antimetabolite is 5-fluorouracil.
  • a“taxane” is an anti-cancer agent that interferes with or dismpts microtubule stability, formation and/or function.
  • Taxane agents include paclitaxel and docetaxel as well as derivatives thereof, wherein the derivatives function against microtubules by the same mode of action as the taxane from which they are derived.
  • the taxane is paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid, or derivative of paclitaxel or docetaxel.
  • the taxane is paclitaxel (TAXOL®), docetaxel (TAXOTERE®), albumin-bound paclitaxel (nab-paclitaxel; ABRAXANE®), DHA-paclitaxel, or PG-paclitaxel.
  • a “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
  • Pharmaceutically-acceptable carriers can include for example, one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other subject.
  • This disclosure generally relates novel alpha polyglutamated Antifolate (ANTIFOL) compositions and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • ANTIFOL alpha polyglutamated Antifolate
  • the disclosure provides: [1] A composition comprising an alpha polyglutamated Antifolate, wherein at least one glutamyl group has an alpha carboxyl group linkage;
  • raltitrexed, plevitrexed, pemetrexed, lometrexol LMX; 5,10-dideazatetrahydrofolic acid
  • each of the glutamyl groups of the polyglutamated Antifolate other than the glutamyl group of the Antifolate has an alpha carboxyl group linkage
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha carboxyl group linkage;
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups has an alpha carboxyl group linkage
  • (b) is an alpha pentaglutamated Antifolate
  • (c) is an alpha hexaglutamated Antifolate
  • Antifolate comprises 1-10 glutamyl groups having an alpha carboxyl group linkage
  • each of the glutamyl groups of the alpha polyglutamated Antifolate is in the L- form
  • each of the glutamyl groups of the alpha polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form, or
  • a liposomal composition comprising the alpha polyglutamated Antifolate according to any of [l]-[l2] (Lp-aPANTIFOL);
  • the Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10- dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such
  • the Lp-aPANTIFOL composition according to any of [13]-[16], wherein the liposome comprises an alpha polyglutamated Antifolate containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups;
  • polyglutamate is linear or branched
  • each of the glutamyl groups other than the glutamyl group of the Antifolate has an alpha carboxyl group linkage, or
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha carboxyl group linkage, or
  • each of the glutamyl groups other than the C-terminal glutamyl group or groups has an alpha carboxyl group linkage
  • each of the glutamyl groups of the alpha polyglutamated Antifolate is in the L-form
  • each of the glutamyl groups of the alpha polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form, or
  • polyglutamate is linear or branched
  • liposomes comprise at least 1% weight by weight (w/w) of the alpha polyglutamated Antifolate or wherein during the process of preparing the Lp- aPANTIFOL, at least 1% of the starting material of alpha polyglutamated Antifolate is encapsulated (entrapped) in the Lp-aPANTIFOL;
  • the Lp-aPANTIFOL composition according to any of [l3]-[29], wherein the liposome has a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm;
  • components comprise at least one of an anionic lipid and a neutral lipid
  • the Lp-aPANTIFOL composition according to [32] or [33], wherein the liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG- maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol- maleimide;
  • the Lp-aPANTIFOL composition according to any of [32]-[34], wherein the liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG- FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
  • the Lp-aPANTIFOL composition according to any of [32]-[35], wherein one or more liposomal components further comprises a steric stabilizer; [37] the Lp-aPANTIFOL composition according to [36], wherein the steric stabilizer is at least one selected from polyethylene glycol (PEG); poly-L-lysine (PLL);
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PVA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • phosphatidyl polyglycerol poly[N-(2-hydroxypropyl) methacrylamide]
  • amphiphilic poly-N- vinylpyrrolidones L-amino-acid-based polymer
  • oligoglycerol copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol
  • GM1 monosialoganglioside
  • PVP
  • a tonicity agent such as dextrose, mannitol, glycerine, potassium chloride, sodium chloride, at a concentration of greater than 1%;
  • pharmaceutically acceptable carrier comprises 1% to 15 weight of dextrose
  • pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of between 2 to 8;
  • HBS HEPES Buffered Saline
  • pharmaceutically acceptable carrier comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM;
  • the Lp-aPANTIFOL composition according to any of [l3]-[53], wherein the liposome comprises between 10 to 100,000 molecules of the alpha polyglutamated Antifolate, or any range therein between;
  • the targeting moiety comprises a targeting moiety and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest;
  • the Lp-aPANTIFOL composition according to any of [55]-[57], wherein the targeting moiety is an antibody or an antigen binding fragment of an antibody;
  • the Lp-aPANTIFOL composition according to any of [55]-[58], wherein the targeting moiety binds the surface antigen with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10-10 to 10 x 10-6 as determined using BIACORE® analysis;
  • the Lp-aPANTIFOL composition according to any of [55]-[59], wherein the targeting moiety specifically binds one or more folate receptors selected from: folate receptor alpha (FR-a), folate receptor beta (FR-b), and folate receptor delta (FR-d);
  • the Lp-aPANTIFOL composition according to any of [55]-[60], wherein the targeting moiety comprises one or more selected from: an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi- specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody;
  • pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties
  • the Lp-aPANTIFOL composition according to any of [44]-[57], further comprising one or more of an immunostimulatory agent, a detectable marker and a maleimide, wherein the immunostimulatory agent, the detectable marker or the maleimide is attached to said PEG or the exterior of the liposome;
  • immunostimulating agent a chemical immunostimulating agent; a hapten; and an adjuvant;
  • immunostimulatory agent and the detectable marker is the same;
  • cryoprotectant selected from mannitol; trehalose; sorbitol; and sucrose;
  • composition comprising the composition according to any of [l]-[54] and [64]-[69] ;
  • Antifolate composition according to any of [13]-[72];
  • [77] a method for treating or preventing disease in a subject needing such treatment or prevention, the method comprising administering the composition of any of [l]-[75] to the subject;
  • hyperproliferative cell with the composition of any of [ l]-[74] ;
  • mammalian cell and/or a human cell
  • [82] a method for treating cancer that comprises administering an effective amount of the composition of any of [l]-[74] to a subject having or at risk of having cancer;
  • [83] a method for treating cancer that comprises administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [13]-[73] to a subject having or at risk of having cancer;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias.
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbla
  • the cancer is selected from: the cancer is a member selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and Central Nervous System (CNS) lymphoma;
  • NDL Non-Hodgkin's lymphoma
  • ALL acute lymphoblastic leukemia
  • mycosis fungoides cutaneous T-cell lymphoma
  • choriocarcinoma choriocarcinoma
  • chorioadenoma nonleukemic meningeal cancer
  • soft tissue sarcoma desmoid tumors, aggressive fibromatosis
  • bladder cancer and
  • [88] a method for treating cancer that comprises administering an effective amount of the Lp-aPANTIFOL composition of any of [55]-[7l] to a subject having or at risk of having a cancer cell that expresses on its surface a folate receptor bound by the targeting moiety;
  • a maintenance therapy comprising administering an effective amount of the
  • composition of any of [l]-[74] to a subject that is undergoing or has undergone cancer therapy
  • a maintenance therapy comprising administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [l3]-[74] to a subject that is undergoing or has undergone cancer therapy;
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the composition of any of [l]-[74] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., Crohn disease
  • dermatomyositis/ polymyositis e.g., systemic erythematosus
  • Takayasu psoriasis
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [9]-[74] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., dermatomyositis/ polymyositis
  • systemic lupus erythematosus e.g., Takayas
  • an infectious disease that comprises administering an effective amount of the composition according to any of [l]-[74] to a subject having or at risk of having an infectious disease
  • an infectious disease, cardiovascular disease, metabolic disease, or another disease that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having an infectious disease, cardiovascular disease, or another disease, wherein the disease is a member selected from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic disease, and ectopic pregnancy;
  • an autoimmune disease that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having an autoimmune disease;
  • rheumatoid arthritis that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having rheumatoid arthritis;
  • an inflammatory condition that comprises administering an effective amount of the composition according to of any of any of [l]-[74] to a subject having or at risk of having inflammation, optionally wherein the inflammation is acute, chronic, and/or systemic inflammation; or
  • [94] a method for treating an infectious disease that comprises administering an effective amount of the liposomal alpha polyglutamated Antifolate composition of any of [13]- [74] to a subject having or at risk of having an infectious disease;
  • a method of delivering alpha polyglutamated Antifolate to a tumor expressing a folate receptor on its surface comprising: administering the Lp-aPANTIFOL composition of any of [l]-[74] to a subject having the tumor in an amount to deliver a therapeutically effective dose of the alpha polyglutamated Antifolate to the tumor;
  • a method of preparing an alpha polyglutamated Antifolate composition comprising the liposomal alpha polyglutamated Antifolate composition of any of [13]-[74], the method comprising: forming a mixture comprising: liposomal components and alpha polyglutamated antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing alpha polyglutamated Antifolate;
  • [97] a method of preparing an alpha polyglutamated Antifolate composition comprising the liposomal alpha polyglutamated Antifolate composition of any of [13]-[74], the method comprising: forming a mixture comprising: liposomal components and alpha polyglutamated Antifolate in solution; and processing the mixture to form liposomes containing alpha polyglutamated Antifolate;
  • a method of preparing the composition of any of [55]-[74] comprising the steps of: forming a mixture comprising: liposomal components and alpha polyglutamated Antifolate in a solution; homogenizing the mixture to form liposomes in the solution; processing the mixture to form liposomes entrapping and/or encapsulating alpha polyglutamated Antifolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • [100] a method of preparing the composition of any of [55]-[74], comprising the steps of: forming a mixture comprising: liposomal components and alpha polyglutamated Antifolate in a solution; processing the mixture to form liposomes entrapping and/or encapsulating alpha polyglutamated Antifolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • the processing step comprises homogenizing the mixture to form liposomes in the solution; [102] the method according to any of [99] to [101], wherein the processing step includes one or more steps of: thin film hydration, extmsion, in-line mixing, ethanol injection technique, freezing-and-thawing technique, reverse-phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and
  • processing step includes one or more steps of modifying the size of the liposomes by one or more of steps of extmsion, high-pressure microfluidization, and/or sonication;
  • alpha polyglutamated Antifolate is encapsulated or entrapped in the Lp-aPANTIFOL.
  • the disclosure generally relates alpha polyglutamated Antifolate (aPANTIFOL) compositions.
  • the aPANTIFOL compositions comprise at least one glutamyl group having an alpha linkage. These compositions are structurally distinct from the L-gamma polyglutamated forms of Antifolate (LaPANTIFOL) that are produced by the enzyme folylpoly-gamma- glutamate synthetase (FPGS) in cells during Antifolate therapy.
  • LaPANTIFOL L-gamma polyglutamated forms of Antifolate
  • FPGS folylpoly-gamma- glutamate synthetase
  • the aPANTIFOL composition contains 2-20, 2-15, 2-10, 2-5, or more than 5, glutamyl groups (including the glutamyl group of the Antifolate).
  • each of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate has an alpha linkage.
  • each of the glutamyl groups in the aPANTIFOL other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha linkage.
  • each of the glutamyl groups in the aPANTIFOL other than the C-terminal glutamyl group or groups has an alpha linkage. In some embodiments, 2 or more of the glutamyl groups in the aPANTIFOL have a gamma linkage. In some embodiments, at least one glutamyl group of the alpha polyglutamated Antifolate has both an alpha carboxyl group linkage and a gamma carboxyl group linkage. In some embodiments, each of the glutamyl groups in the aPANTIFOL is in the L-form.
  • each of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate is in the D-form.
  • the aPANTIFOL comprises two or more glutamyl groups in the L-form and one or more glutamyl groups in the D-form.
  • the polyglutamate chain of the aPANTIFOL is linear (not branched). In some embodiments, the polyglutamate chain of the aPANTIFOL is branched.
  • the Antifolate is selected from: PMX, MTX, RTX, and LMX, or a stereoisomer thereof.
  • the Antifolate is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2- desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2- desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO-deazaaminopterin; PT523, N alpha -(4- amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol)
  • the Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • LMX 5,10-dideazatetrahydrofolic acid
  • the Antifolate is a 6-substituted pyrrolo[2,3-d]pyrimidine benzoyl antifolate.
  • the Antifolate is selected from: an indoline ring and modified ornithine-bearing methotrexate derivative, an indoline ring and modified glutamic acid-bearing methotrexate derivative, an alkyl- substituted benzene ring C bearing methotrexate derivative, a benzoxazine moiety-bearing methotrexate derivative, a benzothiazine moiety-bearing methotrexate derivative, a 10-deazaminopterin analog, a 5-deazaminopterin methotrexate analog, a 5,l0-dideazaminopterin methotrexate analog, a indoline moiety-bearing methotrexate derivative, a lipophilic amide methotrexate derivative, a L-threo-(2S,4S)-4- fluoro-glutamic acid containing methotrexate analog, a DL-3,3-difluoroglutamic
  • an N delta-acyl- N a-(4-amino-4-deoxypteroyl)-L-ornithine derivative a 8-deaza methotrexate analog, an acivicin methotrexate analog, a polymeric platinol methotrexate derivative, a methotrexate-g- dimyristoylphophatidylethanolamine, a methotrexate polyglutamate analog, a poly-y-glutamyl methotrexate derivative, a deoxyuridylate methotrexate derivative, a iodoacetyl lysine methotrexate analog, a 2,omega.-diaminoalkanoid acid-containing methotrexate analog, a polyglutamate methotrexate derivative, a 5-methyl-5-deaza analog
  • a g-tert-butyl methotrexate ester a fluorinated methotrexate analog, a folate methotrexate analog, a phosphonoglutamic acid analog, a poly (L-lysine) methotrexate conjugate, a dilysine or trilysine methotrexate derivate, a 7- hydroxymethotrexate, a poly-y-glutamyl methotrexate analog, a 3',5'-dichloromethotrexate, a diazoketone or chloromethylketone methotrexate analog, a lO-propargylaminopterin, an alkyl methotrexate homologs, a lectin derivative of methotrexate, a polyglutamate methotrexate derivative, a halogentated
  • the Antifolate has the Formula (IV):
  • the Antifolate has the Formula (V):
  • the Antifolate has the Formula (VI):
  • the Antifolate has the Formula (VII):
  • the Antifolate has the Formula (VIII):
  • A NH, NCH 3 , or CH 2 .
  • the Antifolate has the Formula (IX):
  • the Antifolate is a cyclopenta[g]quinazoline derivative.
  • the cyclopenta[g]quinazoline derivative is N- ⁇ N- ⁇ 4-[N-(2-methyl-4- oxo-3, 4,7, 8-tetrahydro-6H-cyclopenta[g]quinazolin-6-yl)-N-(prop-2- ynyl)amino]benzoyl]-L- g-glutamylJ-D-glutamic acid; or N- ⁇ N- ⁇ 4-[N-(2-hydroxymethyl-4-oxo-3,4,7,8-tetrahydro- 6H-cyclopenta[g]-quinazolin-6-yl)-N-(prop-2-ynyl)amino]benzoyl ⁇ -L-Y-glutamyl ⁇ -D glutamic acid; or a pharmaceutically acceptable salt or ester thereof.
  • the Antifolate has the Formula (X):
  • Rl is H, amino, Cl-4 alkyl, Cl-4 alkoxy, Cl-4 hydroxyalkyl or Cl-4 fluoroalkyl
  • R2 is hydrogen, Cl-4 alkyl, C3-4 alkenyl, C3-4 alkynyl, C2-4 hydroxyalkyl C2-4 halogenoalkyl or Cl-4 cyanoalkyl
  • Ar is phenylene, thiophenediyl, thiazolediyl, pyridinediyl or pyrimidinediyl which may optionally bear one or two substituents selected from halogeno, hydroxy, amino, nitro, cyano, trifluoromethyl, Cl-4 alkyl and Cl-4 alkoxy; and
  • R3 is a group of one of the following formulae: -NHCH(C02H)-Al-Yl-NH-A3-Y3 or R3 is an alpha or gamma carboxyl linked L- or D- glutamyl group.
  • the Antifolate has the Formula (X) wherein, Rl is Cl-4 alkyl or Cl-4 hydroxyalkyl ( e.g a methyl or a hydroxymethyl); R2 is (a) methyl, ethyl, propyl, prop-2-enyl, prop-2-ynyl, 2-hydroxy-ethyl, 2-fluoroethyl, 2-bromoethyl or 2-cyanoethyl, (b) methyl or (c) prop-2-ynyl; and Ar is 1 ,4-phenylene or a 1 ,4-phenylene having one or two substituents selected from chloro and fluoro (e.g.
  • 2-fluoro substituent such as 2-fluoro- 1,4- phenylene or 2,6-difluoro-l,4-phenylene
  • thiophene-2 5-diyl
  • thiazole-2 5-diyl
  • pyridine- 2 5-diyl
  • the Antifolate has the Formula (X) wherein, Rl is methyl or hydroxymethyl; R2 is methyl or prop-2-ynyl; and Ar is l,4-phenylene or 1 ,4-phenylene having a 2-fluoro substituent as in 2,6-difluoro-l,4-phenylene or especially 2-fluoro- 1,4- phenylene or is pyridine 2, 5-diyl.
  • Ar is 1 ,4-phenylene or 2-fluoro- 1,4- phenylene.
  • the alpha polyglutamated Antifolate is a cyclopenta[g]quinazoline disclosed in W02009/115776, WO 2003/020300, WO 2003/020706, WO 2003/020748, Gibbs et al, Cancer Research 65 (15): 11721-11728 (2005), and Bavetsias et al, Tetrahedron 63(7): 1537-1543 (2007), the contents of each of which is herein incorporated by reference in its entirety.
  • the alpha polyglutamated Antifolate is diglutamated. That is, the alpha polyglutamated Antifolate contains 1 additional glutamyl group in addition to the glutamyl group in the Antifolate (aANTIFOL-PGl), and the additional glutamyl group is linked to the glutamyl group in the Antifolate through an alpha linkage.
  • each of the glutamyl groups of the alpha diglutamated Antifolate is in the L-form.
  • the alpha diglutamated Antifolate comprises a glutamyl group in the D-form.
  • the alpha polyglutamated Antifolate is triglutamated. That is, the alpha polyglutamated Antifolate contains 2 additional glutamyl groups in addition to the glutamyl group in the Antifolate (aANTIFOL-PG2). In some embodiments, each of the 2 additional glutamyl groups have an alpha linkage. In other embodiments, one of the 2 additional glutamyl groups have an alpha linkage and the other glutamyl group has a gamma linkage. In some embodiments, one of the 2 additional glutamyl groups has an alpha linkage. In some embodiments, one of the 2 additional glutamyl groups has a gamma linkage.
  • each of the glutamyl groups of the alpha triglutamated Antifolate is in the L-form. In other embodiments, the alpha triglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha triglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the triglutamated Antifolate comprises a glutamyl group in the D- form and two or more glutamyl groups in the L-form.
  • the poly glutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is tetraglutamated and thus contains 3 additional glutamyl groups in addition to the glutamyl group of the Antifolate (aANTIFOL-PG3).
  • each of the 3 additional glutamyl groups have an alpha linkage.
  • 1 or 2 of the 3 additional glutamyl groups have an alpha linkage and the remaining 2 or 1 glutamyl groups, respectively, have a gamma linkage.
  • 2 of the 3 additional glutamyl groups have an alpha linkage.
  • one of the 3 additional glutamyl groups has an alpha linkage and another additional glutamyl group has a gamma linkage.
  • one of the 3 additional glutamyl groups has an alpha linkage and a gamma linkage. In other embodiments, three of the four glutamyl groups have an alpha linkage. In some embodiments, at least one glutamyl group has both an alpha linkage and a gamma linkage.
  • the alpha tetraglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha tetraglutamated Antifolate is in the L- form. In other embodiments, the alpha tetraglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha tetraglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the tetraglutamated Antifolate comprises a glutamyl group in the D- form and two or more glutamyl groups in the L-form.
  • the poly glutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is pentaglutamated (aANTIFOL-PG4) and contains a chain of 4 additional glutamyl groups attached to the glutamyl group in the Antifolate.
  • each of the 4 additional glutamyl groups in the chain have an alpha linkage.
  • each of the 4 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 1, 2, or 3, of the 4 additional glutamyl groups have an alpha linkage and the remaining 3, 2, or 1, glutamyl groups, respectively, are linked to a glutamyl group of the molecule through a gamma linkage.
  • 1 or 2 of the 4 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 5 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 5 glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • the alpha pentaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha pentaglutamated Antifolate is in the L-form. In other embodiments, the alpha pentaglutamated Antifolate comprises a glutamyl group in the D-form. In further embodiments, each of the glutamyl groups of the alpha pentaglutamated Antifolate other than the glutamyl group of the Antifolate, is in the D- form. In additional embodiments, the pentaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is hexaglutamated (aANTIFOL-PG5) and contains a chain of 5 additional glutamyl groups attached to the glutamyl group in the Antifolate.
  • each of the 5 additional glutamyl groups in the chain have an alpha linkage.
  • each of the 5 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 4 of the 5 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, or 4 of the 5 additional glutamyl groups are linked to a glutamyl group of the molecule through an alpha linkage and the remaining 4, 3, 2, or 1, glutamyl groups, respectively, are linked to a glutamyl group of the molecule through a gamma linkage.
  • 1, 2, 3, or 4 of the 5 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • At least one of the 6 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 6 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 5 of the 6 glutamyl groups have an alpha linkage.
  • the alpha hexaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the alpha hexaglutamated Antifolate is in the L-form.
  • the alpha hexaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha hexaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the hexaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is heptaglutamated (aANTIFOL-PG6) and thus contains a chain of 6 additional glutamyl groups attached to the glutamyl group in the Antifolate.
  • each of the 6 additional glutamyl groups have an alpha linkage.
  • each of the 6 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 5 of the 6 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, or 5, of the 6 additional glutamyl groups have an alpha linkage and the remaining 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, or 5 of the 6 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 7 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 7 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage. In some embodiments, 6 of the 7 glutamyl groups have an alpha linkage. In some embodiments, the alpha heptaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha heptaglutamated Antifolate is in the L-form. In other embodiments, the alpha heptaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha heptaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the heptaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is octaglutamated (aANTIFOL-PG7) and thus contains a chain of 7 additional glutamyl groups attached to the glutamyl group in the Antifolate.
  • each of the 7 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 6 of the 7 additional glutamyl groups in the chain have an alpha linkage.
  • each of the 7 additional glutamyl groups have an alpha linkage.
  • 1, 2, 3, 4, 5, or 6, of the 7 additional glutamyl groups have an alpha linkage and the remaining 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, or 6 of the 7 additional glutamyl groups have an alpha linkage and the remaining non-C -terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 8 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 8 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 7 of the 8 glutamyl groups have an alpha linkage.
  • the alpha octaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha octaglutamated Antifolate is in the L-form. In other embodiments, the alpha octaglutamated Antifolate comprises a glutamyl group in the D-form. In further embodiments, each of the glutamyl groups of the alpha octaglutamated Antifolate other than the glutamyl group of the Antifolate, is in the D-form.
  • the octaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is nonaglutamated (aANTIFOL-PG8) and contains a chain of 8 additional glutamyl groups attached to the glutamyl group in the Antifolate.
  • each of the 8 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 7 of the 8 additional glutamyl groups in the chain have an alpha linkage.
  • each of the 8 additional glutamyl groups have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, or 7, of the 8 additional glutamyl groups have an alpha linkage and the remaining 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, or 7 of the 8 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 9 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 9 glutamyl groups other than the C -terminal glutamyl group or groups have an alpha linkage. In some embodiments, 8 of the 9 glutamyl groups have an alpha linkage.
  • the alpha nonaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha nonaglutamated Antifolate is in the L-form. In other embodiments, the alpha nonaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha nonaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the nonaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is decaglutamated (aANTIFOL-PG9) (i.e., contains a chain of 9 additional glutamyl groups attached to the glutamyl group in the Antifolate).
  • each of the 9 additional glutamyl groups have an alpha linkage.
  • each of the 9 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 8 of the 9 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, or 8, of the 9 additional glutamyl groups have an alpha linkage and the remaining 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, or 8 of the 9 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 10 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 10 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage. In some embodiments, 9 of the 10 glutamyl groups have an alpha linkage.
  • the alpha decaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha decaglutamated Antifolate is in the L-form. In other embodiments, the alpha decaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha decaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the decaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is undecaglutamated (aANTIFOL-PGlO).
  • each of the 10 additional glutamyl groups have an alpha linkage.
  • each of the 10 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 9 of the 10 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, or 9, of the 10 additional glutamyl groups have an alpha linkage and the remaining 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the 10 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 11 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 11 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 10 of the 11 glutamyl groups have an alpha linkage.
  • the alpha undecaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha undecaglutamated Antifolate is in the L-form. In other embodiments, the alpha undecaglutamated Antifolate comprises a D glutamyl group. In further embodiments, each of the glutamyl groups of the alpha undecaglutamated Antifolate other than the glutamyl group of the Antifolate, is in the D-form. In additional embodiments, the undecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is dodecaglutamated (aANTIFOL-PGl 1).
  • each of the 11 additional glutamyl groups have an alpha linkage.
  • each of the 11 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 10 of the 11 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, of the 11, additional glutamyl groups have an alpha linkage and the remaining 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the 11 additional glutamyl groups have an alpha linkage and the remaining non-C -terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 12 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 12 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 11 of the 12 glutamyl groups have an alpha linkage.
  • the alpha dodecaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha dodecaglutamated Antifolate is in the L-form. In other embodiments, the alpha dodecaglutamated Antifolate comprises a glutamyl group in the D- form. In further embodiments, each of the glutamyl groups of the alpha dodecaglutamated Antifolate other than the glutamyl group of the Antifolate, is in the D-form. In additional embodiments, the dodecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is tridecaglutamated (aANTIFOL-PGl2).
  • each of the 12 additional glutamyl groups have an alpha linkage.
  • each of the 12 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 11 of the 12 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, of the 12 additional glutamyl groups have an alpha linkage and the remaining 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 of the 12 additional glutamyl groups have an alpha linkage and the remaining non-C -terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 13 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 13 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 12 of the 13 glutamyl groups have an alpha linkage.
  • the alpha tridecaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha tridecaglutamated Antifolate is in the L-form. In other embodiments, the alpha tridecaglutamated Antifolate comprises a glutamyl group in the D-form. In further embodiments, each of the glutamyl groups of the alpha tridecaglutamated Antifolate other than the glutamyl group of the Antifolate, is in the D-form. In additional embodiments, the tridecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is tetradecaglutamated (aANTIFOL-PGl3).
  • each of the 13 additional glutamyl groups have an alpha linkage.
  • each of the 13 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 12 of the 13 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the 13 additional glutamyl groups have an alpha linkage and the remaining 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the 13 additional glutamyl groups have an alpha linkage and the remaining non-C- terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 14 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 14 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 13 of the 14 glutamyl groups have an alpha linkage.
  • the alpha tetradecaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha tetradecaglutamated Antifolate is in the L-form. In other embodiments, the alpha tetradecaglutamated Antifolate comprises a glutamyl group in the D-form. In further embodiments, each of the glutamyl groups of the alpha tetradecaglutamated Antifolate other than the glutamyl group of the Antifolate, is in the D-form.
  • the tetradecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is pentadecaglutamated (aANTIFOL-PGl4).
  • each of the 14 additional glutamyl groups have an alpha linkage.
  • each of the 14 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 13 of the 14 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, of the 14 additional glutamyl groups have an alpha linkage and the remaining 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 of the 14 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • At least one of the 15 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 15 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 14 of the 15 glutamyl groups have an alpha linkage.
  • the alpha pentadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the alpha pentadecaglutamated Antifolate is in the L-form.
  • the alpha pentadecaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha pentadecaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the pentadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is hexadecaglutamated (aANTIFOL-PGl5).
  • each of the 15 additional glutamyl groups have an alpha linkage.
  • each of the 15 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 14 of the 15 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the 15 additional glutamyl groups have an alpha linkage and the remaining 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the 15 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • At least one of the 16 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 16 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 15 of the 16 glutamyl groups have an alpha linkage.
  • the alpha hexadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the alpha hexadecaglutamated Antifolate is in the L-form.
  • the alpha hexadecaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha hexadecaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the hexadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is heptadecaglutamated (aANTIFOL-PGl6).
  • each of the 16 additional glutamyl groups have an alpha linkage.
  • each of the 16 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 15 of the 16 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, of the 16, additional glutamyl groups have an alpha linkage and the remaining 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the 16 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • At least one of the 17 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 17 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 16 of the 17 glutamyl groups have an alpha linkage.
  • the alpha heptadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the alpha heptadecaglutamated Antifolate is in the L-form.
  • the alpha heptadecaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the alpha heptadecaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the heptadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is octadecaglutamated (aANTIFOL-PGl7).
  • each of the 17 additional glutamyl groups have an alpha linkage.
  • each of the 17 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 16 of the 17 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, of the 17 additional glutamyl groups have an alpha linkage and the remaining 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 of the 17 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • At least one of the 18 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 18 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 17 of the 18 glutamyl groups have an alpha linkage.
  • the alpha octadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the alpha octadecaglutamated Antifolate is in the L-form.
  • the alpha octadecaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha octadecaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the octadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is nonadecaglutamated (aANTIFOL-PGl8).
  • each of the 18 additional glutamyl groups have an alpha linkage.
  • each of the 18 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 17 of the 18 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17, of the 18 additional glutamyl groups have an alpha linkage and the remaining 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 of the 18 additional glutamyl groups have an alpha linkage and the remaining non-C -terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • At least one of the 19 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 19 glutamyl groups other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 18 of the 19 glutamyl groups have an alpha linkage.
  • the alpha nonadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the alpha nonadecaglutamated Antifolate is in the L-form.
  • the alpha nonadecaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the alpha nonadecaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the nonadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is icosaglutamated d(aANTIFOL-PGl9).
  • each of the 19 additional glutamyl groups have an alpha linkage.
  • each of the 19 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 18 of the 19 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18, of the 19 additional glutamyl groups have an alpha linkage and the remaining 18, 17, 16, 15, 14, 13, 12,
  • glutamyl groups respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 of the 19 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 20 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 20 glutamyl groups other than the C- terminal glutamyl group or groups have an alpha linkage. In some embodiments, 19 of the 20 glutamyl groups have an alpha linkage. In some embodiments, the alpha icosaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha icosaglutamated Antifolate is in the L-form. In other embodiments, the alpha icosaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the alpha icosaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the icosaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate is henicosaglutamated (aANTIFOL-PG20).
  • each of the 20 additional glutamyl groups have an alpha linkage.
  • each of the 20 additional glutamyl groups in the chain other than the C-terminal glutamyl group or groups have an alpha linkage.
  • 19 of the 20 additional glutamyl groups in the chain have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, of the 20 additional glutamyl groups have an alpha linkage and the remaining 19, 18, 17, 16, 15, 14, 13,
  • glutamyl groups 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, glutamyl groups, respectively, have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the 20 additional glutamyl groups have an alpha linkage and the remaining non-C-terminal glutamyl groups are linked to a glutamyl group of the molecule through a gamma linkage.
  • at least one additional glutamyl group has both an alpha linkage and a gamma linkage.
  • at least one of the 21 glutamyl groups has both an alpha linkage and a gamma linkage.
  • each of the 21 glutamyl groups other than the C- terminal glutamyl group or groups have an alpha linkage. In some embodiments, 20 of the 21 glutamyl groups have an alpha linkage. In some embodiments, the alpha henicosaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the alpha henicosaglutamated Antifolate is in the L-form. In other embodiments, the alpha henicosaglutamated Antifolate comprises a glutamyl group in the D- form.
  • each of the glutamyl groups of the alpha henicosaglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • the henicosaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • each of the 4-7 attached glutamyl groups is in the L-form.
  • each of the 4-7 attached glutamyl groups is in the D-form. In other embodiments, the 4-7 attached glutamyl groups are in the L-form and the D-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate contains a total of 1-15, 1-10, 2-15, 2-10, 3-15, 3-10, 3-6, 3-5, 4-10, 4-7, or 4-6, glutamyl groups including the glutamyl group of the Antifolate, or any range therein between.
  • each of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate have an alpha linkage.
  • each of the glutamyl groups in the aPANTIFOL other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha linkage.
  • each of the glutamyl groups in the aPANTIFOL other than the C-terminal glutamyl group or groups has an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the aPANTIFOL have an alpha linkage.
  • the aPANTIFOL comprises glutamyl groups in the L-form and the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the aPANTIFOL have an alpha linkage and 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or none, of the glutamyl groups, respectively, has a gamma linkage.
  • each of the glutamyl groups in the polyglutamate structure of the polyglutamated Antifolate is in the L-form.
  • each of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate is in the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, of the glutamyl groups in the aPANTIFOL is in the L-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the aPANTIFOL is in the D-form.
  • the polyglutamate chain is linear. In other embodiments, the polyglutamate chain is branched.
  • the alpha polyglutamated Antifolate contains a total of 2-20, 2-15, 2-10, 2-5, glutamyl groups including the glutamyl group of the Antifolate, or any range therein between.
  • each of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate have an alpha linkage.
  • each of the glutamyl groups in the aPANTIFOL other than the C-terminal glutamyl group or groups and the glutamyl group of the Antifolate has an alpha linkage.
  • each of the glutamyl groups in the aPANTIFOL other than the C-terminal glutamyl group or groups has an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, of the glutamyl groups have an alpha linkage.
  • the aPANTIFOL contains two or more glutamyl groups having a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, of the glutamyl groups have an alpha linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate have an alpha linkage and 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or none, of the glutamyl groups, respectively, have a gamma linkage.
  • each of the glutamyl groups in the aPANTIFOL is in the L-form.
  • each of the glutamyl groups in the aPANTIFOL other than the glutamyl group of the Antifolate is in the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, of the glutamyl groups have an alpha linkage.
  • glutamyl groups in the aPANTIFOL are in the L-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, glutamyl groups in the aPANTIFOL is in the D-form.
  • the alpha polyglutamated Antifolate contains a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, glutamyl groups in addition to the glutamyl group of the Antifolate).
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, of the additional glutamyl groups have an alpha linkage.
  • the glutamyl groups in the alpha polyglutamated Antifolate have a gamma linkage.
  • at least one glutamyl group has both an alpha linkage and a gamma linkage.
  • the glutamyl group in the Antifolate has an alpha linkage.
  • the glutamyl group in the Antifolate has both an alpha linkage and a gamma linkage.
  • a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, glutamyl groups in the alpha polyglutamated Antifolate are in the L-form, the D-form, or in the L-form and the D-form.
  • each of the glutamyl groups of the alpha polyglutamated Antifolate is in the L-form.
  • each of the glutamyl groups of the alpha polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • At least two of the glutamyl groups in the alpha polyglutamated Antifolate are in the L-form and at least one of the glutamyl groups in the alpha polyglutamated Antifolate is in the D-form. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
  • glutamyl groups in the alpha polyglutamated Antifolate are in the L- form. In other embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, glutamyl groups in the alpha polyglutamated Antifolate are in the D-form. [00160] In additional embodiments, the alpha polyglutamated Antifolate contains 20-100, 20-75, 20-50, 20-40, 20-30, 20-25, or more than 100, alpha glutamyl groups, or any range therein between. In some embodiments, each of the glutamyl groups of the alpha polyglutamated Antifolate is in the L-form.
  • each of the glutamyl groups of the alpha polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form.
  • at least two of the glutamyl groups in the alpha polyglutamated Antifolate are in the L-form and at least one of the glutamyl groups in the alpha polyglutamated Antifolate is in the D-form
  • the provided compositions comprise an alpha polyglutamated Antifolate that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups that have alpha linkages.
  • the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups that have alpha linkages.
  • the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups that have alpha linkages.
  • the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups that have alpha linkages.
  • the alpha polyglutamated Antifolate contains 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the D-form. In some embodiments, the alpha polyglutamated Antifolate contains 1,
  • the alpha polyglutamated Antifolate contains at least 1 glutamyl group that has both an alpha linkage and a gamma linkage. In some embodiments, the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or more than 10, glutamyl groups that have both an alpha linkage and a gamma linkage.
  • the alpha-polyglutamated Antifolate contains a least 1 glutamyl group having an alpha linkage and contains comprises 2, 3, 4, 5, 6, 7, 8, 9, 1-10, 1-20, or more, glutamyl groups having a gamma linkage.
  • the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, L-alpha glutamyl group linkages and further contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, L-gamma glutamyl group linkages.
  • the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, L-alpha glutamyl group linkages and further contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, D-gamma glutamyl group linkages. In additional further embodiments, the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, D-alpha glutamyl group linkages and further contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, D-gamma glutamyl group linkages.
  • the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, D-alpha glutamyl group linkages and further contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, D-gamma glutamyl group linkages. In other further embodiments, the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10, D-gamma glutamyl group linkages and further contains 1, 2, 3, 4, 5, 6, or 1-10, L-gamma glutamyl group linkages. In other embodiments, the alpha polyglutamated Antifolate contains at least 1 glutamyl group that has both an alpha linkage and a gamma linkage. In some embodiments, the alpha polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or more than 10, glutamyl groups that have both an alpha linkage and a gamma linkage.
  • the alpha polyglutamated Antifolate composition provided herein is capable of accepting one or more additional glutamyl groups, that is the composition is able to act as a substrate for by FPGS (folylpolyglutamate synthetase).
  • FPGS molecular biological synthetase
  • Reagents and assays and reagents for determining the ability of an alpha polyglutamated Antifolate composition to act as a substrate for FPGS e.g., human FPGS, or rat liver FPGS
  • the rate of uptake of naked alpha PANTIFOL compositions disclosed herein is significantly reduced compared to the uptake rate of the Antifolate under physiologic conditions.
  • the rate of hepatic cell uptake of the naked alpha PANTIFOL composition is less than 30%, 20%, 15%, or 10% compared to the rate of the Antifolate.
  • the rate of the efflux (transport out) of alpha PANTIFOL compositions disclosed herein from hepatic-cells occurs at a rate that is significantly reduced compared to the Antifolate (e.g., less than 30%, 20%, 15%, or 10%) compared to the rate of the Antifolate.
  • an alpha polyglutamated Antifolate composition provided herein is more cytotoxic to hyperproliferative cells than the Antifolate.
  • the hyperproliferative cells are cancer cells.
  • the hyperproliferative cells a colorectal carcinoma cells, colon cancer cells, breast cancer cells, or ovarian cancer cells.
  • the cancer cells are mesothelioma cells or non-small cell lung carcinoma cells.
  • cytotoxicity is measured in an in vitro assay.
  • the alpha polyglutamated Antifolate is a hexaglutamated Antifolate.
  • an alpha polyglutamated Antifolate composition provided herein has lower toxic side effects than the Antifolate. In some embodiments, the alpha polyglutamated Antifolate composition provided herein is less toxic to non-hyperproliferative cells than the Antifolate. In some embodiments, the alpha polyglutamated Antifolate composition provided herein is less toxic to neutrophils, liver cells, or to colon epithelium cells than the Antifolate. In some embodiments, the neutrophils human neutrophils, differentiating human neutrophils, or neutrophils differentiated from CD34+ cells. In some embodiments, the liver cells are AML12 liver cells.
  • the colon epithelium cells are CCD841 colon epithelium cells.
  • the toxicity is measured in an in vitro assay.
  • the alpha polyglutamated Antifolate is a hexaglutamated Antifolate.
  • an alpha polyglutamated Antifolate composition provided herein has lower toxic side effects than the Antifolate. In some embodiments, an alpha polyglutamated Antifolate composition provided herein causes fewer or less severe toxic side effects in a vivo assay than the Antifolate. In some embodiments, the in vivo assay is an in vivo murine model. In some embodiments, an alpha polyglutamated Antifolate composition provided herein causes fewer or less severe hematological or hepatic toxic side effects than the Antifolate. In some embodiments, hematological side effects are assessed by measuring mean neutrophil, mean white blood cell or mean platelet counts.
  • hepatic toxic side effects are assessed by measuring serum aspartate transaminase (AST), semm alanine transaminase (ALT), and/or serum albumin levels.
  • the in vivo assay comprises administering 40 mg/kg or 80 mg/kg of the alpha polyglutamated Antifolate composition once weekly for 4 weeks.
  • the alpha polyglutamated Antifolate is a hexaglutamated Antifolate.
  • treatment with an alpha polyglutamated Antifolate composition provided herein does not induce significant hematological or hepatic toxic side effects in an in vivo murine model.
  • hematological side effects are assessed by measuring mean neutrophil, mean white blood cell or mean platelet counts.
  • hepatic toxic side effects are assessed by measuring serum aspartate transaminase (AST), serum alanine transaminase (ALT), and/or serum albumin levels.
  • AST serum aspartate transaminase
  • ALT serum alanine transaminase
  • an alpha polyglutamated Antifolate composition provided herein does not significantly decrease mean neutrophil, mean white blood cell or mean platelet counts.
  • an alpha polyglutamated Antifolate composition provided herein does not significantly increase serum aspartate transaminase (AST) and serum alanine tran aminase (ALT) levels. In some embodiments, an alpha polyglutamated Antifolate composition provided herein does not significantly decrease serum albumin levels. In some embodiments, the in vivo assay comprises administering 40 mg/kg or 80 mg/kg of the alpha polyglutamated Antifolate composition once weekly for 4 weeks. In some embodiments, the alpha polyglutamated Antifolate is a hexaglutamated Antifolate.
  • the alpha polyglutamated Antifolate compositions do not contain a fluorine atom. In some embodiments, the alpha polyglutamated Antifolate compositions do not contain a 4-fluoroglutamyl group.
  • a PANTIFOL Alpha polyglutamated Antifolate compositions and their uses are further described in each of Intl. Appl. Nos. PCT/US2017/046666 and PCT/US2017/046667, and U.S. Patent Appl. Nos. 62/630,820, 62/627,716, 62/627,731, 62/630,671, 62/630,825, 62/630,629, 62/630,634, 62/630,728, 62/630,637, 62/630,744, 62/583,432, 62/627,714, 62/627,741, and 62/627,703, the disclosure of each of which is herein incorporated by reference in its entirety.
  • the disclosure also encompasses alpha polyglutamated Antifolate derivatives and analogs.
  • the compositions and methods disclosed herein are envisioned to apply to any and every known derivative or analog of an Antifolate that is polyglutamated.
  • the analog corresponds to a modified form of the Antifolate wherein the glutamyl group of the Antifolate is not linked to the remainder of the Antifolate molecule through a gamma peptide linkage.
  • the analog is a variant form of the Antifolate wherein the glutamyl group in the Antifolate is in the D-form.
  • the polyglutamated form of the Antifolate, or polyglutamated Antifolate analog or derivative is not fluorinated.
  • the Antifolate is selected from: an indoline ring and modified ornithine-bearing methotrexate derivative, an indoline ring and modified glutamic acid-bearing methotrexate derivative, an alkyl- substituted benzene ring C bearing methotrexate derivative, a benzoxazine moiety-bearing methotrexate derivative, a benzothiazine moiety-bearing methotrexate derivative, a 10-deazaminopterin analog, a 5-deazaminopterin methotrexate analog, a 5,l0-dideazaminopterin methotrexate analog, a indoline moiety-bearing methotrexate derivative, a lipophilic amide methotrexate derivative, a L-threo-(2S,4S)-4- fluoro-glutamic acid containing methotrexate analog, a DL-3,3-difluoroglutamic
  • an N delta-acyl- N a-(4-amino-4-deoxypteroyl)-L-ornithine derivative a 8-deaza methotrexate analog, an acivicin methotrexate analog, a polymeric platinol methotrexate derivative, a methotrexate-g- dimyristoylphophatidylethanolamine, a methotrexate polyglutamate analog, a poly-y-glutamyl methotrexate derivative, a deoxyuridylate methotrexate derivative, a iodoacetyl lysine methotrexate analog, a 2,omega.-diaminoalkanoid acid-containing methotrexate analog, a polyglutamate methotrexate derivative, a 5-methyl-5-deaza analog
  • a g-tert-butyl methotrexate ester a fluorinated methotrexate analog, a folate methotrexate analog, a phosphonoglutamic acid analog, a poly (L-lysine) methotrexate conjugate, a dilysine or trilysine methotrexate derivate, a 7- hydroxymethotrexate, a poly-y-glutamyl methotrexate analog, a 3',5'-dichloromethotrexate, a diazoketone or chloromethylketone methotrexate analog, a lO-propargylaminopterin, an alkyl methotrexate homologs, a lectin derivative of methotrexate, a polyglutamate methotrexate derivative, a halogentated
  • the alpha polyglutamated Antifolate derivative or analog has a variant polyglutamate chain.
  • the polyglutamate chain contains one or more natural or synthetic residues other than glutamate.
  • the polyglutamate chain contains one or more glutamyl groups that do not contain an amide linkage.
  • one or more of the glutamyl groups of the polyglutamate chain is derivatized.
  • the Antifolate polyglutamate compositions provided herein may be obtained by following synthetic procedures known in the art. Procedures for synthesizing Antifolate (including different pharmaceutically acceptable salts or acids (e.g., Antifolate disodium) and crystalline and amorphous forms) and intermediates for synthesizing Antifolate include but are not limited to those described in U.S. Patent Nos.
  • the Antifolate polyglutamate compositions provided herein may be obtained by following synthetic procedures using available reagents and synthetic intermediates.
  • the addition of glutamyl residue(s) to the glutamyl residue of the Antifolate can be accomplished using synthetic procedures known in the art.
  • glutamyl residues are added serially to the glutamyl residue of the Antifolate.
  • polyglutamates are added to the glutamyl reside of the Antifolate using“click chemistry” methods or other bioconjugate chemistries known to those in the art.
  • a peptide of glutamyl residues can be generated of the desired length and added to a precursor of the Antifolate which does not have a glutamyl residue.
  • the peptide can be produced using synthetic procedures known in the art.
  • an initial glutamyl residue is bonded to wang resin and additional glutamyl residues are added serially via solid phase peptide synthesis using F-moc chemistry. After the final glutamyl residue is added the Antifolate precursor is coupled to the peptide and the molecule is cleaved from the resin.
  • polyglutamated Antifolates such as polyglutamated pemetrexed are able to form complexes with other compositions including therapeutic agents, including cytotoxic compounds such as platinum-based compounds.
  • the disclosure provides a complex of a aPANTIFOL (e.g., a aPANTIFOL disclosed herein) and a therapeutic agent or a salt or acid thereof.
  • the polyglutamated Antifolate is a aPANTIFOL described in Section II, or a salt or acid thereof.
  • the disclosure provides a complex of a aPANTIFOL according to any of [l]-[l2] of the Detailed Description and a therapeutic agent or a salt or acid thereof.
  • the aPANTIFOL/complex comprise aPANTIFOL and a therapeutic agent.
  • the therapeutic agent is a cytotoxic compound such as a chemotherapeutic agent.
  • the aPANTIFOL/complex contains a platinum-based drug such as platinum-based chemotherapeutic agent (e.g., cisplatin, carboplatin and oxaliplatin).
  • the aPANTIFOL/complex contains a taxane-based chemotherapeutic agent (e.g., paclitaxel and docetaxel). In other embodiments, the aPANTIFOL/complex contains a cyclodextrin. In further embodiments, the aPANTIFOL/complex is encapsulated in a liposome. In some embodiments, the liposome is an Lp-aPANTIFOL according to any of [13] -[72] of the Detailed Description.
  • the aPANTIFOL/therapeutic agent complex comprises one or more aPANTIFOL containing 2-150, 2-100, 2-75, 2-50, 2-24, 2-30, 2-20, 2-19, 2-15, 2- 10, or 2-5, glutamyl groups.
  • the aPANTIFOL/therapeutic agent complex comprises one or more aPANTIFOL containing 3-10, 3-9, 3-8, or 3-7, glutamyl groups, or any range therein between.
  • the aPANTIFOL/therapeutic agent complex comprises one or more aPANTIFOL containing 4-10, 4-9, 4-8, 4-7, 4-6, or 4- 5, glutamyl groups, or any range therein between.
  • the complex comprises one or more aPANTIFOL containing 3-10 glutamyl groups. In further embodiments, the aPANTIFOL/therapeutic agent complex comprises one or more aPANTIFOL containing 3-7 glutamyl groups. In another embodiment, the aPANTIFOL/therapeutic agent complex comprises one or more aPANTIFOL containing 5 glutamyl groups. In another embodiment, the aPANTIFOL/therapeutic agent complex comprises one or more aPANTIFOL containing 6 glutamyl groups. In some embodiments, the therapeutic agent is a cytotoxic compound or a salt or acid thereof. In a further embodiment, the therapeutic agent is a chemotherapeutic agent or a salt or acid thereof.
  • the therapeutic agent is a platinum-based drug. In another embodiment, the therapeutic agent is a taxane-based drug. In additional embodiments, the molar ratio of aPANTIFOL/therapeutic agent in the complex is in the range 1-10: 1. In some embodiments, the molar ratio of aPANTIFOL/therapeutic agent in the complex is 1:1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, or 10:1. In some embodiments, the aPANTIFOL/therapeutic agent complex is encapsulated in a liposome ( e.g ., as described herein or otherwise known in the art).
  • the molar ratio of aPANTIFOL/therapeutic agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the molar ratio of aPANTIFOL/therapeutic agent in the complex is: 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19: 1, 20:1, (21-50): 1, or >50: 1.
  • the aPANTIFOL/therapeutic agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the liposome is an Lp- aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the aPANTIFOL complex comprises aPANTIFOL and cyclodextrin.
  • the aPANTIFOL complex comprises a aPANTIFOL according to any of [l]-[l2] of the Detailed Description.
  • the aPANTIFOL complex comprises an Antifolate described in Section II.
  • the molar ratio of aPANTIFOL (e.g aPANTIFOL salt)/cyclodextrin in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/cyclodextrin in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/cyclodextrin in the complex is in the range 2-8: 1, or any range therein between. In some embodiments, the molar ratio of aPANTIFOL/cyclodextrin in the complex is: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9:1, 10:1, 11: 1, 12: 1, 13: 1, 14:1, 15:1, 16: 1, 17: 1, 18: 1, 19:1, or 20: 1.
  • the molar ratio of aPANTIFOL/cyclodextrin in the complex is: 1:1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7:1, 8: 1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14:1, 15:1, 16:1, 17: 1, 18: 1, 19:1, 20:1, (21-50): 1, or >50: 1.
  • the molar ratio of aPANTIFOL/cyclodextrin in the complex is in the range 1: 1-20, 1: 1-10, or 1:2-8, or any range therein between.
  • the molar ratio of aPANTIFOL/cyclodextrin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1: 12, 1:13, 1:14, 1: 15, 1: 16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/cyclodextrin in the complex is: 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1: 12, 1:13, 1:14, 1: 15, 1: 16, 1: 17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the aPANTIFOL/cyclodextrin complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13]-[72] of the Detailed Description.
  • the disclosure provides a composition comprising a aPANTIFOL/platinum-based chemotherapeutic agent complex.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the platinum-based chemotherapeutic agent is selected from: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the aPANTIFOL/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of aPANTIFOL/platinum-based agent in the complex is in the range 1-20:1, or any range therein between. In some embodiments, the molar ratio of aPANTIFOL/platinum-based agent in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/platinum-based agent in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of aPANTIFOL/platinum-based agent in the complex is 11: 1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17:1, 18: 1, 19: 1, or 20:1.
  • the molar ratio of aPANTIFOL/platinum-based agent in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12: 1, 13: 1, 14:1, 15:1, 16: 1, 17: 1, 18:1, 19:1, 20:1, (21-50): 1, or >50: 1.
  • the molar ratio of aPANTIFOL/ platinum- based chemotherapeutic agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between. In some embodiments, the molar ratio of aPANTIFOL/ platinum- based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1: 12, 1:13, 1: 14, 1: 15, 1: 16, 1:17, 1:18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1: 14, 1:15, 1: 16, 1:17, 1:18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the aPANTIFOL//platinum-based agent complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13]-[72] of the Detailed Description.
  • the aPANTIFOL/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the molar ratio of aPANTIFOL/platinum-based analog in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/platinum-based analog in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/platinum-based agent in the complex is in the range 2-8:1, or any range therein between. In some embodiments, the molar ratio of aPANTIFOL/platinum-based analog in the complex is 11:1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20: 1.
  • the molar ratio of aPANTIFOL/platinum-based analog in the complex is 11 :1, 2:1, 3: 1, 4: 1, 5:1, 6: 1, 7:1, 8:1, 9:1, 10: 1, 11:1, 12: 1, 13:1, 14: 1, 15: 1, 16:1, 17: 1, 18:1, 19: 1, 20:1, (2l-50):l, or >50: 1.
  • the molar ratio of aPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(2l-50), or 1 :>50.
  • the aPANTIFOL//platinum- based analog complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the disclosure provides a complex containing aPANTIFOL and cisplatin or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises an Antifolate described in Section II.
  • the molar ratio of aPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/ cisplatin (or cisplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1: 12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.
  • the molar ratio of aPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7:1, 8:1, 9: 1, 10:1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17:1, 18: 1, 19:1, 20: 1, (2l-50):l, or >50:1.
  • the molar ratio of aPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1:13, 1:14, 1: 15, 1: 16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1: 12, 1:13, 1: 14, 1:15, 1:16, 1:17, 1: 18, 1:19, 1:20, l:(2l-50), or 1:>50.
  • the aPANTIFOL//cisplatin (or cisplatin salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the disclosure provides a complex containing aPANTIFOL and carboplatin or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II, herein.
  • the molar ratio of aPANTIFOL/carboplatin (or carboplatin salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of aPANTIFOL/carboplatin (or carboplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/ carboplatin (or carboplatin salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of aPANTIFOL/ carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12:1, 13:1, 14:1, 15: 1, 16: 1, 17: 1, 18: 1, 19:1, or 20:1.
  • the molar ratio of aPANTIFOL/ carboplatin (or carboplatin salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19:1, 20: 1, (21-50): 1, or >50:1.
  • the molar ratio of aPANTIFOL/carboplatin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/carboplatin in the complex is: 1:2, 1:3, 1 :4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1:13, 1: 14, 1:15, 1: 16, 1:17, 1: 18, 1: 19, 1:20, l:(2l-50), or 1:>50.
  • the aPANTIFOL/carboplatin (or carboplatin salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the disclosure provides a complex containing aPANTIFOL and oxaliplatin, or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [l]-[12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the molar ratio of aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of aPANTIFOL/ oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1: 12, 1:13, 1:14, 1: 15, 1: 16, 1:17, 1:18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11: 1, 12: 1, 13:1, 14: 1, 15: 1, 16:1, 17: 1, 18: 1, 19:1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1: 12, 1: 13, 1: 14, 1: 15, 1: 16, 1: 17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1: 14, 1: 15, 1: 16, 1: 17, 1: 18, 1: 19, 1:20, l:(2l-50), or 1:>50.
  • the aPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp- aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the disclosure provides a complex comprising aPANTIFOL and a platinum-based chemotherapeutic agent (“platinum”) selected from: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • platinum-based chemotherapeutic agent platinum-based chemotherapeutic agent
  • the aPANTIFOL/platinum-based chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof.
  • the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is in the range 1-20: 1, or any range therein between.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is in the range 1-10: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is in the range 2-8:1, or any range therein between. In some embodiments, the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17: 1, 18: 1, 19:1, or 20:1.
  • the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4: 1, 5:1, 6: 1, 7:1, 8:1, 9: 1, 10:1, 11: 1, 12: 1, 13:1, 14: 1, 15:1, 16: 1, 17:1, 18: 1, 19: 1, 20:1, (21-50): 1, or >50: 1.
  • the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1:13, 1: 14, 1:15, 1: 16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/platinum (or platinum salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1: 18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the aPANTIFOL/platinum (or salt or acid or analog thereof) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13]-[72] of the Detailed Description.
  • the disclosure provides a composition comprising a aPANTIFOL/taxane-based chemotherapeutic agent (taxane) complex.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the taxane -based chemotherapeutic agent is selected from: paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX), and cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of aPANTIFOL/taxane-based agent in the complex is in the range 1-20: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/taxane (or taxane salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/taxane (or taxane salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/taxane (or taxane salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10: 1, 11: 1, 12:1, 13: 1, 14:1, 15: 1, 16: 1, 17:1, 18: 1, 19:1, or 20: 1.
  • the molar ratio of aPANTIFOL/taxane (or taxane salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14:1, 15:1, 16: 1, 17:1, 18:1, 19:1, 20: 1, (21-50): 1 , or >50:1.
  • the molar ratio of aPANTIFOL/taxane (or taxane salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1: 14, 1: 15, 1: 16, 1: 17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/taxane (or taxane salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1:14, 1:15, 1:16, 1: 17, 1: 18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the aPANTIFOL/taxane (or taxane salt or acid) agent complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13] -[72] of the Detailed Description.
  • the disclosure provides a complex comprising aPANTIFOL and paclitaxel (PTX), or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the aPANTIFOL/ paclitaxel (or paclitaxel salt or acid) complex comprises an analog of paclitaxel (PTX), or a salt or acid thereof.
  • the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16:1, 17: 1, 18: 1, 19:1, or 20: 1.
  • the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10: 1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17: 1, 18:1, 19: 1, 20: 1, (21-50):l, or >50: 1.
  • the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1:13, 1:14, 1: 15, 1: 16, 1:17, 1: 18, 1:19, or 1:20.
  • the molar ratio of aPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1: 14, 1: 15, 1: 16, 1: 17, 1: 18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the aPANTIFOL/paclitaxel (or paclitaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp- aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the disclosure provides a complex comprising aPANTIFOL and docetaxel (DTX), or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section P.
  • the aPANTIFOL/docetaxel complex comprises an analog of docetaxel (DTX), or a salt or acid thereof.
  • the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between. In some embodiments, the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range 1- 10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is 1:1, 2:1, 3: 1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9: 1, 10:1, 11:1, 12:1, 13:1, 14: 1, 15: 1, 16: 1, 17:1, 18:1, 19:1, or 20:1.
  • the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7:1, 8: 1, 9:1, 10: 1, 11: 1, 12:1, 13:1, 14: 1, 15:1, 16: 1, 17: 1, 18:1, 19:1, 20: 1, (21-50):1, or >50:1.
  • the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1: 18, 1: 19, 1:20, l:(2l-50), or l:>50.
  • the aPANTIFOL/docetaxel (or docetaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13]-[72] of the Detailed Description.
  • the disclosure provides a complex comprising aPANTIFOL and larotaxel (LTX), or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8: 1, 9: 1, 10: 1, 11: 1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20: 1.
  • the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12: 1, 13: 1, 14:1, 15:1, 16:1, 17:1, 18:1, 19: 1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1:13, 1: 14, 1:15, 1: 16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1: 18, 1: 19, 1:20, l:(2l-50), or 1 :>50.
  • the aPANTIFOL/larotaxel (or larotaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13]-[72] of the Detailed Description.
  • the disclosure provides a complex comprising aPANTIFOL and cabazitaxel (CTX), or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17: 1, 18: 1, 19:1, or 20:1.
  • the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12: 1, 13:1, 14:1, 15: 1, 16:1, 17:1, 18:1, 19: 1, 20: 1, (21-50): 1, or >50:1.
  • the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1: 12, 1: 13, 1: 14, 1: 15, 1: 16, 1:17, 1:18, 1:19, or 1:20.
  • the molar ratio of aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1: 18, 1:19, 1:20, l:(21-50), or l:>50.
  • the aPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [13] -[72] of the Detailed Description.
  • the disclosure provides a complex comprising aPANTIFOL and another anti-metabolite, or a salt or acid thereof.
  • the complex comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the aPANTIFOL complex comprises a polyglutamated Antifolate described in Section II.
  • An anti-metabolite is a chemical with a structure that is similar to a metabolite required for normal biochemical reactions, yet different enough to interfere with one or more normal functions of cells, such as cell division.
  • the disclosure provides a complex comprising aPANTIFOL and Antifolate (ANTIFOL), or a salt or acid thereof.
  • the disclosure provides a complex comprising aPANTIFOL and an anti-metabolite selected from, gemcitabine, fluorouracil, capecitabine, an antifolate (e.g ., Antifolate, raltitrexed), tegafur, cytosine arabinoside, thioguanine, 5- azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine, pento statin, fludarabine phosphate, and cladribine, as well as pharmaceutically acceptable salt or acids, acids, or derivatives of any of these.
  • an anti-metabolite selected from, gemcitabine, fluorouracil, capecitabine, an antifolate (e.g ., Antifolate, raltitrexed), tegafur, cytosine arabinoside, thioguanine, 5- azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine
  • the molar ratio of aPANTIFOL/anti- metabolite (or anti-metabolite salt or acid, or prodmg) in the complex is in the range 1-20: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/anti- metabolite (or anti-metabolite salt or acid, or prodmg) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of aPANTIFOL/anti- metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of aPANTIFOL/anti- metabolite (or anti-metabolite salt or acid, or prodmg) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17:1, 18: 1, 19: 1, or 20:1.
  • the molar ratio of aPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10: 1, 11: 1, 12:1, 13:1, 14:1, 15: 1, 16: 1, 17:1, 18: 1, 19: 1, 20:1, (21-50): 1, or >50: 1.
  • the molar ratio of aPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of aPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodmg) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1:14, 1:15, 1:16, 1: 17, 1: 18, 1: 19, 1:20, l:(21-50), or l:>50.
  • the aPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) complex is encapsulated in a liposome.
  • the liposome is an Lp-aPANTIFOL according to any of [l3]-[72] of the Detailed Description.
  • the disclosure provides a complex of aPANTIFOL ⁇ e.g., a aPANTIFOL disclosed herein) and a cyclodextrin.
  • Cyclodextrins are groups of cyclic oligosaccharides which have been shown to improve physicochemical properties of many dmgs through formation of complexes.
  • CDs are cyclic oligosaccharides composed of several D-glucose units linked by a-(l, 4) bonds. This cyclic configuration provides a hydrophobic internal cavity and gives the CDs a truncated cone shape.
  • the complex comprises a aPANTIFOL according to any of [ l]-[ 12] of the Detailed Description.
  • cyclodextrin refer generally to a parent or derivatized cyclic oligosaccharide containing a variable number of (a- l,4)-linked D-glucopyranoside units that is able to form a complex with a Antifolate-PG.
  • Each cyclodextrin glucopyranoside subunit has secondary hydroxyl groups at the 2 and 3 positions and a primary hydroxyl group at the 6-position.
  • cyclodextrin refer to a cyclodextrin containing D-glucopyranoside units having the basic formula C6H12O6 and a glucose structure without any additional chemical substitutions (e.g., a-cyclodextrin consisting of 6 D-glucopyranoside units, a b-cyclodextrin consisting of 7 D- glucopyranoside units, and a g-cyclodextrin cyclodextrin consisting of 8 D-glucopyranoside units).
  • the physical and chemical properties of a parent cyclodextrin can be modified by derivatizing the hydroxyl groups with other functional groups. Any substance located within the cyclodextrin internal phase is said to be "complexed" with the cyclodextrin, or to have formed a complex (inclusion complex) with the cyclodextrin.
  • the cyclodextrin component of the aPANTIFOL/cyclodextrin complexes so long as the cyclodextrins can form complexes with the aPANTIFOL.
  • the cyclodextrins have been derivatized to bear ionizable (e.g., weakly basic and/or weakly acidic) functional groups to facilitate complex formation with aPANTIFOL and/or liposome encapsulation.
  • the cyclodextrin of the aPANTIFOL/cyclodextrin complex has at least 2, 3, 4, 5, 6, 6, 7, 8, 9, or 10, hydroxyl group substituted with an ionizable chemical group.
  • charged cyclodextrin refers to a cyclodextrin having one or more of its hydroxyl groups substituted with a charged moiety. Such a moiety can itself be a charged group or it can comprise an organic moiety (e.g a Ci-C 6 alkyl or Ci-C 6 alkyl ether moiety) substituted with one or more charged moieties.
  • the "ionizable" or “charged” moieties of a CD derivative are weakly ionizable.
  • Weakly ionizable moieties are those that are either weakly basic or weakly acidic.
  • Weakly basic functional groups (W) have a pKa of between about 6.0-9.0, 6.5-8.5, 7.0-8.0, 7.5-8.0, and any range in between inclusive according to CH3-W.
  • weakly acidic functional groups (X) have a log dissociation constant (pKa) of between about 3.0-7.0, 4.0-6.5, 4.5-6.5, 5.0-6.0, 5.0-5.5, and any range in between inclusive according to CH3-X.
  • Representative anionic moieties include, without limitation, carboxylate, carboxymethyl, succinyl, sulfonyl, phosphate, sulfoalkyl ether, sulphate carbonate, thiocarbonate, dithiocarbonate, phosphate, phosphonate, sulfonate, nitrate, and borate groups.
  • Representative cationic moieties include, without limitation, amino, guanidine, and quartemary ammonium groups.
  • the derivatized cyclodextrin is a "polyanion” or "polycation.”
  • a polyanion is a derivatized cyclodextrin having more than one negatively charged group resulting in net a negative ionic charge of more than two units.
  • a polycation is a derivatized cyclodextrin having more than one positively charged group resulting in net positive ionic charger of more than two units.
  • the derivatized cyclodextrin is a "chargeable amphiphile.”
  • chargeable is meant that the amphiphile has a pK in the range pH 4 to pH 8 or 8.5.
  • a chargeable amphiphile may therefore be a weak acid or base.
  • amphoteric herein is meant a derivatized cyclodextrin having a ionizable groups of both anionic and cationic character wherein: (a) at least one, and optionally both, of the cation and anionic amphiphiles is chargeable, having at least one charged group with a pK between 4 and 8 to 8.5, (b) the cationic charge prevails at pH 4, and (c) the anionic charge prevails at pH 8 to 8.5.
  • the "ionizable" or “charged” derivatized cyclodextrin as a whole, whether polyionic, amphiphilic, or otherwise, are weakly ionizable (i.e ., have a pKai of between about 4.0-8.5, 4.5-8.0, 5.0-7.5, 5.5-7.0, 6.0-6.5, and any range in between inclusive).
  • Any one, some, or all hydroxyl groups of any one, some or all a-D-glucopyranoside units of a cyclodextrin can be modified to an ionizable chemical group as described herein.
  • reaction with a modifying moiety can produce an amorphous mixture of positional and optical isomers.
  • certain chemistry can allow for pre-modified a-D-glucopyranoside units to be reacted to form uniform products.
  • the aggregate substitution that occurs for cyclodextrin derivatives in a mixture is described by a term referred to as the degree of substitution.
  • a 6- ethylenediamino- b-cyclodextrin with a degree of substitution of seven would be composed of a distribution of isomers of 6-ethylenediamino-p-cyclodextrin in which the average number of ethylenediamino groups per 6-cthylcncdiamino-p-cyclodcxtrin molecule is seven.
  • the degree of substitution for a cyclodextrin derivative mixture can routinely be determined using mass spectrometry or nuclear magnetic resonance spectroscopy.
  • At least one hydroxyl moieties facing away from the cyclodextrin interior is substituted with an ionizable chemical group.
  • the C2, C3, C6, C2 and C3, C2 and C6, C3 and C6, and all three of C2-C3-C6 hydroxyls of at least one a-D- glucopyranoside unit are substituted with an ionizable chemical group.
  • Any such combination of hydroxyls can similarly be combined with at least two, three, four, five, six, seven, eight, nine, ten, eleven, up to all of the alpha-D-glucopyranoside units in the modified cyclodextrin as well as in combination with any degree of substitution described herein.
  • SAE-CD sulfoalkyl ether cyclodextrin
  • SBE- -CD beta cyclodextrin
  • Additional cyclodextrin derivatives that may be complexed with therapeutic agents in the disclosed liposome compositions include sugammadex or Org-25969, in which the 6- hydroxy groups on g-CD have been replaced by carboxythio acetate ether linkages, and h yd ro x y b u ten y 1 - b -C D .
  • cyclodextrin examples include: 2,6-Di-0-methyl ⁇ -CD (DIMEB), 2-hydroxylpropyl-3-cyclodextrin (HR-b-CD), randomly methylated ⁇ -cyclo- dextrin (RAMEB), sulfobutyl ether b-cyclodextrin (SBE ⁇ -CD).
  • DIMEB 2,6-Di-0-methyl ⁇ -CD
  • HR-b-CD 2-hydroxylpropyl-3-cyclodextrin
  • RAMEB randomly methylated ⁇ -cyclo- dextrin
  • SBE ⁇ -CD sulfobutyl ether b-cyclodextrin
  • sulfobutylether-g- cyclodextrin SBEyCD
  • sulfobutylated beta-cyclodextrin sodium salt (2-Hydroxypropyl)- alpha-cyclodextrin, (2-Hydroxypropyl)-beta-cyclodextrin, (2-Hydroxypropyl)-y-cyclo- dextrin, 2,6-di-0-methyl)-beta-cyclodextrin (DIMEB-50 Heptakis), 2,3,6-tri-0-methyl)-beta- cyclodextrin (TRIMEB Heptakis), methyl-beta-cyclodextrin, octakis (6-dcox y-6- i odoj-g- cyclodexrin, and, octakis (6-deoxy-6-bromo)-gamma-cyclodexrin.
  • the cyclodextrin(s) has a high solubility in water in order to facilitate entrapment of a larger amount of the cyclodextrin in the liposome internal phase.
  • the water solubility of the cyclodextrin is at least 10 mg/mL, 20 mg/mL, 30 mg/mL, 40 mg/mL, 50 mg/mL, 60 mg/mL, 70 mg/mL, 80 mg/mL, 90 mg/mL, 100 mg/mL or higher.
  • the water solubility of the cyclodextrin(s) is within a range of 10-150 mg/mL, 20-100 mg/mL 20-75 mg/mL, and any range in between inclusive.
  • a large association constant between the cyclodextrin and the aPANTILOL and/or other therapeutic agent complexed with cyclodextrin is preferable and can be obtained by selecting the number of glucose units in the cyclodextrin based on the size of the therapeutic agent ⁇ see, for example, Albers et al, Crit. Rev. Therap. Drug Carrier Syst. 12:311-337 (1995); Stella et al, Toxicol. Pathol. 36:30-42 (2008).
  • the association constant depends on pH
  • the cyclodextrin can be selected such that the association constant becomes large at the pH of the liposome internal phase.
  • the solubility (nominal solubility) of the therapeutic agent in the presence of cyclodextrin can be further improved.
  • the association constant of the cyclodextrin with the therapeutic agent is 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, or higher.
  • the association constant of the cyclodextrin with the therapeutic agent is in the range 100-1, 200, 200-1,000, 300-750, and any range therein between.
  • the cyclodextrin of the aPANTILOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is underivatized.
  • the cyclodextrin of the aPANTILOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is derivatized.
  • the cyclodextrin derivative of the complex has the structure of Lormula I:
  • n 4, 5, or 6;
  • Ri, R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , Rs, and R 9 are each, independently, -H, a straight chain or branched Ci-C 8 - alkylene group, or an optionally substituted straight-chain or branched Ci- C 6 group, wherein at least one of Ri, R 2 , R 3 , R 4 , Rs, R 6 , R 7 , R8, and R9, is a straight-chain or branched Ci-Cs- alkylene (e.g., Ci-Cs-(alkylene)-S0 3 group);
  • the cyclodextrin derivative of the aPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex has the structure of Formula II:
  • n 4, 5, or 6;
  • Ri, R 2 , R 3 , R 4 , Rs, R 6 , R 7 , Rs, and R9 are each, independently, -O- or a -O-iCYCV, alkylcncj-SOi- group; wherein at least one of Ri and R 2 is independently a -0-(C 2 -C 6 alkylene)-S0 3 group; and Si, S 2 , S 3 , S 4 , S5, S 6 , S 7 , Ss, and S9 are each, independently, a pharmaceutically acceptable cation.
  • the pharmaceutically acceptable cation is selected from: an alkali metal such as Li + , Na + , or K + ; an alkaline earth metal such as Ca +2 , or Mg +2 and ammonium ions and amine cations such as the cations of (C1-C6)- alkylamines, piperidine, pyrazine, (Cl-C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • an alkali metal such as Li + , Na + , or K +
  • an alkaline earth metal such as Ca +2 , or Mg +2
  • ammonium ions and amine cations such as the cations of (C1-C6)- alkylamines, piperidine, pyrazine, (Cl-C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • At least one of Rl and R2 is independently a -0-(C2-C6 alkylene)-S03- group that is a -0-(CH 2 ) m S03- group, wherein m is 2 to 6, preferably 2 to 4, (e.g., -O-
  • a cyclodextrin derivative of the aPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is a cyclod
  • the cyclodextrin derivative of the aPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is a sulfoalkyl ether cyclodextrin.
  • the cyclodextrin derivative of complex is a sulfobutyl ether-3 - cyclodextrin such as CAPTISOL® (CyDex Pharma. Inc., Lenexa, Kansas). Methods for preparing sulfobutyl ether-3- cyclodextrin and other sulfoalkyl ether cyclodextrins are known in the art.
  • the cyclodextrin derivative in of the aPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is a compound of Formula III:
  • the aPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is encapsulated in a liposome ⁇ e.g., as described herein or otherwise known in the art).
  • aPANTIFOL Delivery Vehicle provides aPANTIFOL delivery systems and their use to deliver a payload of aPANTIFOL to a cell or cells in vitro or in vivo.
  • aPANTIFOL is complexed with or incorporated into a delivery vehicle.
  • Such delivery vehicles include, but are not limited to, liposomes, lipospheres, polymers, peptides, proteins, antibodies (e.g., ADCs such as Antibody- aPANTIFOL conjugates), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), lipoprotein particles, and combinations thereof.
  • the delivery vehicle is a liposome.
  • the delivery vehicle is an antibody or an antigen binding antibody fragment.
  • the aPANTIFOL delivery system comprises a aPANTIFOL according to any of [ 1 ] - [ 12] of the Detailed Description.
  • the disclosure provides liposomal compositions that comprise a liposome encapsulating (i.e., filled with) an alpha polyglutamated Antifolate (e.g., a aPANTIFOL disclosed herein).
  • a liposomal composition comprises a aPANTIFOL according to any of [ l]-[ 12] of the Detailed Description.
  • the liposomal composition comprises a polyglutamated Antifolate described in Section II.
  • a liposome in the liposomal composition comprises a aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups (including the glutamyl group of the Antifolate).
  • the liposomal composition contains a liposome according to any of [l3]-[72] of the Detailed Description.
  • the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises two or more glutamyl groups in the L-form.
  • the alpha polyglutamated Antifolate in the Lp- aPANTIFOL comprises a glutamyl group in the D-form.
  • the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises two or more glutamyl groups that have a gamma carboxyl linkage. In some embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises at least one glutamyl group that has both an alpha carboxyl linkage and a gamma carboxyl linkage.
  • the liposomal composition comprises a liposome comprising and a pentaglutamated Antifolate.
  • the liposome comprises an L-a pentaglutamated Antifolate, a D-a pentaglutamated Antifolate, or an L- and D-a pentaglutamated Antifolate.
  • the liposomal composition comprises a liposome comprising and a hexaglutamated Antifolate (Lp-aPANTIFOL).
  • the liposome comprises an L-a hexaglutamated Antifolate, a D-a hexaglutamated Antifolate, or an L- and D-a hexaglutamated Antifolate.
  • the liposomal composition comprises a liposome that is anionic or neutral.
  • the liposomal composition comprises a liposome that is cationic.
  • the Lp-aPANTIFOL composition is not pegylated.
  • the Lp-aPANTIFOL composition is non-targeted (NTLp-aPANTIFOL).
  • the Lp-aPANTIFOL composition is targeted (TLp-aPANTIFOL).
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 500 nm, or any range therein between. In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 400 nm, or any range therein between. In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 300 nm, or any range therein between. In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 200 nm, or any range therein between.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 150 nm, or any range therein between. In further embodiments, the liposomal composition comprises a liposome having a diameter in the range of 80 nm to 120 nm, or any range therein between. In additional embodiments, 30-70%, 30- 60%, or 30-50% w/w alpha polyglutamated Antifolate, or any range therein between, is encapsulated (entrapped) in the Lp-aPANTIFOL.
  • the provided liposomes further comprise an immunostimulatory agent, a detectable marker, or both disposed on its exterior.
  • the immunostimulatory agent or detectable marker can be ionically bonded or covalently bonded to an exterior of the liposome, including, for example, optionally to a steric stabilizer component of the liposome.
  • immunostimulatory agents also known as“immunostimulants”, and “immuno stimulators”, refer to substances that stimulate an immune (including a preexisting immune response) by inducing activation or increasing activity of any of the components of the immune system.
  • immunostimulatory agents can include one or more of a hapten, an adjuvant, a protein immunostimulating agent, a nucleic acid immuno stimulating agent, and a chemical immunostimulating agent.
  • Many adjuvants contain a substance designed to stimulate immune responses, such as lipid A, Bortadella pertussis or Mycobacterium tuberculosis derived proteins.
  • adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; IFN-gamma, IFN-alpha, FLT3-ligand; and immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3).
  • adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laborator
  • Cytokines such as GM-CSF, interleukin-2, -7, -12, and -15, and other like growth factors, can also be used as adjuvants.
  • the immunostimulant can be at least one selected from fluorescein, DNP, beta glucan, beta-l,3-glucan, beta-l,6-glucan.
  • the immunostimulant is a Toll-like receptor (TLR) modulating agent.
  • TLR Toll-like receptor
  • the Toll-like receptor (TLR) modulating agent is one or more of: an oxidized low-density lipoprotein (e.g., OXPAC, PGPC), an eritoran lipid (e.g., E5564), and a resolvin.
  • the liposomes comprise fluorescein isothiocyanate (FITC) which, based on our experiments, surprisingly serves as both an immunostimulant and a detectable marker.
  • FITC fluorescein isothiocyanate
  • the provided liposomes further comprise an agent, that increase uptake of liposomes into a cellular compartment of interest including the cytosol.
  • the agent provides the liposome contents with the ability to bypass lysosomes (e.g., chloroquine). In some embodiments, the agent improves the update of the liposome contents by mitochondria (e.g., sphingomyelin and a component of mitoport).
  • mitochondria e.g., sphingomyelin and a component of mitoport.
  • the liposomes comprise a detectable marker.
  • a detectable marker may, for example, include, at least, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator, an enzyme, a dye, an ink, a magnetic compound, a biocatalyst or a pigment that is detectable by any suitable means known in the art, e.g., magnetic resonance imaging (MRI), optical imaging, fluorescent/luminescent imaging, or nuclear imaging techniques.
  • MRI magnetic resonance imaging
  • optical imaging fluorescent/luminescent imaging
  • nuclear imaging techniques e.g., nuclear imaging techniques.
  • the immunostimulatory agent and/or detectable marker is attached to the exterior by co-incubating it with the liposome.
  • the immunostimulatory agent and/or detectable marker may be associated with the liposomal membrane by hydrophobic interactions or by an ionic bond such as an avidin/biotin bond or a metal chelation bond (e.g., Ni-NTA).
  • the immunostimulatory agent or detectable marker may be covalently bonded to the exterior of the liposome such as, for example, by being covalently bonded to a liposomal component or to the steric stabilizer which is the PEG.
  • FITC fluorescein isothiocyanate
  • the liposomes further comprise an agent that increases the uptake of liposomes into a cellular compartment of interest including the cytosol.
  • the liposomes comprise a mitochondrial-targeting agent.
  • the liposomes comprise triphenylphosphonium (TPP).
  • TPP triphenylphosphonium
  • Methods and mechanisms for surface functionalizing liposomes with TPP are known in the art (e.g., attaching TPP to the lipid anchor via a peg spacer group and modifying TPP with a stearyl group (stearyl triphenylphosphonium (STPP)).
  • STPP stearyl triphenylphosphonium
  • the liposomes comprise high-density octa-arginine.
  • the liposomes comprise sphingomyelin and/or a sphingomyelin metabolite.
  • Sphingomyelin metabolite used to formulate the liposomes of the present invention can include, for example ceramide, sphingosine or sphingosine l-phosphate.
  • the liposomes comprise Rhodamine 123.
  • the liposomes comprise, a mitochondria penetrating peptide.
  • the liposomes comprise, a mitochondria penetrating agent selected from: a mitofusin peptide, a mitochondrial targeting signal peptide, and Antennapedia helix III homeodomain cell-penetrating peptide (ANT) (e.g ., comprising RQIKIWFQNRRMKWKKRKKRRQR RR (SEQ ID NO: l), RKKRRXRRRGC where X is any natural or non-natural amino acid (SEQ ID NO:2), CCGCCAAGAAGCG (SEQ ID NO:3), GCGTGCACACGCGCGTAGACTTCCCCCGCAAGTCACTCGTTAGCCCGC CAAGAAGCGACCCCTCCGGGGCGAGCTGAGCGGCGTGGCGCGGGGGCGTCAT
  • ANT Antennapedia helix III homeodomain cell-penetrating peptide
  • liposomes in the provided liposome compositions comprise a mitochondria penetrating agent selected from the group: a guanidine-rich peptoid, tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenyl-phosphonium and/or tetraphenylphosphonium).
  • a mitochondria penetrating agent selected from the group: a guanidine-rich peptoid, tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenyl-phosphonium and
  • liposomes in the provided liposome compositions comprise sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes comprise sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes comprise DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-arginine.
  • the liposomes comprise DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-arginine at a molar ratio of 9:2: 1.
  • the liposomes comprise the MP ⁇ -porter® system or a variant thereof.
  • liposomes in the provided liposome compositions comprise an agent such as a cell penetrating agent that that facilitates delivery of the liposome across a cell membrane and provides the liposome with the ability to bypass the endocytic pathway and the harsh environment of lysosomes.
  • Cell penetrating agents are known in the art and can routinely be used and adapted for manufacture and use of the provided liposome compositions.
  • the cell penetrating/lysosome bypassing agent is chloroquine.
  • the cell penetrating agent is a cell penetrating peptide.
  • liposomes in the provided liposome compositions comprise a cell penetrating agent selected from the group: RKKRRQRRR (SEQ ID NO:7), GRKKRRQRRRTPQ (SEQ ID NO:8), Y GRKKRRQRRR (SEQ ID NO:9), AAVAL LPAVLLALLA (SEQ ID NO: 10), MGLGLHLLVLAAALQ (SEQ ID NO: 11), GALFL GFLGAAGSTM (SEQ ID NO: 12), AGYLLGKINLKALAALAKKIL (SEQ ID NO: 13), RVIRVWFQNKRCKDKK (SEQ ID NO: 14), RQIKIWFQNRRMKWKK (SEQ ID NO: 15), GLFEAIAGFIEN GWEGMIDG (SEQ ID NO: 16), GWTLNSAGYLLGKIN (SEQ ID NO:l7), RS QSRSRYYRQRQRS (SEQ ID NO: l8), LAIPEQEY (SEQ ID NO:
  • the liposomes may comprise a steric stabilizer that can increase their longevity in circulation.
  • the steric stabilizer may be at least one member selected from polyethylene glycol (PEG), poly-L-lysine (PLL), monosialoganglioside (GM1), poly(vinyl pyrrolidone) (PVP), poly(acrylamide) (PAA), poly(2-methyl-2-oxazoline), poly(2-ethyl-2-oxazoline), phosphatidyl polyglycerol, poly[N-(2-hydroxypropyl) methacrylamide], amphiphilic poly-N- vinylpyrrolidones, L-amino-acid-based polymer, oligoglycerol, copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol.
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly
  • the steric stabilizer or the population of steric stabilizers is PEG.
  • the steric stabilizer is a PEG.
  • the PEG has a number average molecular weight (Mn) of 200 to 5000 daltons.
  • Mn number average molecular weight
  • the disclosure provides liposomal compositions that comprise a pegylated liposome.
  • the pegylated liposome comprises a aPANTIFOL according to any of [ l]-[l2] of the Detailed Description.
  • the pegylated liposome comprises a polyglutamated Antifolate described in Section II.
  • a pegylated liposome in the liposomal composition comprises a aPANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups.
  • the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises two or more glutamyl groups in the L-form. In other embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the alpha polyglutamated Antifolate in the Lp-aPANTIFOL comprises two or more glutamyl groups that have a gamma linkage.
  • the liposomal composition comprises a pegylated liposome that comprises an a tetraglutamated Antifolate. In further embodiments, the liposome comprises an L-a tetraglutamated Antifolate, a D-a tetraglutamated Antifolate, or an L- and D-a tetraglutamated Antifolate. In some embodiments, the liposomal composition comprises a pegylated liposome that comprises an a pentaglutamated Antifolate.
  • the liposome comprises an L-a pentaglutamated Antifolate, a D-a pentaglutamated Antifolate, or an L- and D-a pentaglutamated Antifolate.
  • the liposomal composition comprises a pegylated liposome that comprises a a hexaglutamated Antifolate.
  • the liposome comprises an L-a hexaglutamated Antifolate, a D-a hexaglutamated Antifolate, or an L- and D-a hexaglutamated Antifolate.
  • the liposomal composition comprises a pegylated liposome according any of [25] , and [27]-[69] of the Detailed Description. In some embodiments, the liposomal composition comprises a pegylated liposome that is anionic or neutral. In some embodiments, the liposomal composition comprises a pegylated liposome that is cationic. In some embodiments, the PLp- aPANTIFOL composition is non-targeted (NTPLp-aPANTIFOL). In other embodiments, the PLp-aPANTIFOL composition is targeted (TPLp-aPANTIFOL).
  • the liposomal composition comprises a pegylated liposome that comprises 30-70%, 30-60%, or 30-50% liposome entrapped alpha polyglutamated Antifolate, or any range therein between. In some embodiments, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha polyglutamated Antifolate is encapsulated (entrapped) in the PLp-aPANTIFOL. In some embodiments, the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 500 nm.
  • the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 200 nm. In further embodiments, the liposomal composition comprises a pegylated liposome having a diameter in the range of 80 nm to 120 nm.
  • greater than 30%, 40%, 50%, 60%, 70%, 80% or 90% of the polyglutamated Antifolate in the composition has 4-10, 4-6, or more than 5, glutamyl groups. In some embodiments, greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the polyglutamated Antifolate in a provided liposomal composition is tetraglutamated. In some embodiments, greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the polyglutamated Antifolate in a provided liposomal composition is pentaglutamated.
  • the polyglutamated Antifolate in a provided liposomal composition is hexaglutamated.
  • the alpha polyglutamated Antifolate compositions e.g ., polyglutamates and delivery vehicles such as liposomes containing the polyglutamates
  • the polyglutamated Antifolate composition is administered in a liposomal composition at between about 0.005 and about 5000 mg/M 2 (meter of body surface area squared), or between about 0.1 and about 1000 mg/M 2 , or any range therein between.
  • the aPANTIFOL composition is administered in a liposomal composition at about 1 mg/kg to about 500 mg/kg, 1 mg/kg to about 250 mg/kg, 1 mg/kg to about 200 mg/kg, 1 mg/kg to about 150 mg/kg, 1 mg/kg to about 100 mg/kg, 1 mg/kg to about 50 mg/kg, about 1 mg/kg to about 25 mg/kg, about 1 mg/kg to about 20 mg/kg, about 1 mg/kg to about 15 mg/kg, about 1 mg/kg to about 10 mg/kg, or about 1 mg/kg to about 5 mg/kg, or any range therein between.
  • the lipids and other components of the liposomes contained in the liposomal compositions can be any lipid, lipid combination and ratio, or combination of lipids and other liposome components and their respective ratios known in the art.
  • liposomal encapsulation of any particular drug such as, and without limitation, the alpha polyglutamated Antifolate discussed herein, may involve substantial routine experimentation to achieve a useful and functional liposomal formulation.
  • the provided liposomes may have any liposome structure, e.g., structures having an inner space sequestered from the outer medium by one or more lipid bilayers, or any microcapsule that has a semi-permeable membrane with a lipophilic central part where the membrane sequesters an interior.
  • the lipid bilayer can be any arrangement of amphiphilic molecules characterized by a hydrophilic part (hydrophilic moiety) and a hydrophobic part (hydrophobic moiety).
  • amphiphilic molecules in a bilayer are arranged into two dimensional sheets in which hydrophobic moieties are oriented inward the sheet while hydrophilic moieties are oriented outward.
  • Amphiphilic molecules forming the provided liposomes can be any known or later discovered amphiphilic molecules, e.g., lipids of synthetic or natural origin or biocompatible lipids.
  • the liposomes can also be formed by amphiphilic polymers and surfactants, e.g., polymerosomes and niosomes.
  • these liposome-forming materials also are referred to as "lipids".
  • the liposome composition formulations provided herein can be in liquid or dry form such as a dry powder or dry cake.
  • the dry powder or dry cake may have undergone primary drying under, for example, lyophilization conditions or optionally, the dry cake or dry powder may have undergone both primary drying only or both primary drying and secondary drying.
  • the powder or cake may, for example, have between 1 % to 6% moisture, for example, such as between 2% to 5% moisture or between 2% to 4% moisture.
  • lyophilization also called freeze-drying, or cryodessication.
  • compositions and methods of the disclosure may include liposomes, lyophilized liposomes or liposomes reconstituted from lyophilized liposomes.
  • the disclosed compositions and methods include one or more lyoprotectants or cryoprotectants. These protectants are typically polyhydroxy compounds such as sugars (mono-, di-, and polysaccharides), polyalcohols, and their derivatives, glycerol, or polyethyleneglycol, trehalose, maltose, sucrose, glucose, lactose, dextran, glycerol, or aminoglycosides.
  • the lyoprotectants or cryoprotectants comprise up to 10% or up to 20% of a solution outside the liposome, inside the liposome, or both outside and inside the liposome.
  • the liposomes include a steric stabilizer that increases their longevity in circulation.
  • a steric stabilizer such as a hydrophilic polymer (Polyethylene glycol (PEG)), a glycolipid (monosialoganglioside (GM1)) or others occupies the space immediately adjacent to the liposome surface and excludes other macromolecules from this space. Consequently, access and binding of blood plasma opsonins to the liposome surface are hindered, and thus interactions of macrophages with such liposomes, or any other clearing mechanism, are inhibited and longevity of the liposome in circulation is enhanced.
  • PEG Polyethylene glycol
  • GM1 glycolipid
  • the steric stabilizer or the population of steric stabilizers is a PEG or a combination comprising PEG.
  • the steric stabilizer is a PEG or a combination comprising PEG with a number average molecular weight (Mn) of 200 to 5000 daltons.
  • Mn number average molecular weight
  • These PEG(s) can be of any structure such as linear, branched, star or comb structure and are commercially available.
  • the diameter of the disclosed liposomes is not particularly limited.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 500 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [ l]-[ 12] of the Detailed Description and has a diameter in the range of 20 nm to 500 nm.
  • the liposome is a liposome composition according to any of [13] -[72] of the Detailed Description and has a diameter in the range of 20 nm to 500 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 400 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [ l]-[ 12] of the Detailed Description and has a diameter in the range of 20 nm to 400 nm.
  • the liposome is a liposome composition according to any of [13] -[72] of the Detailed Description and has a diameter in the range of 20 nm to 400 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 300 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [l3]-[72] of the Detailed Description and has a diameter in the range of 20 nm to 300 nm.
  • the liposome is a liposome composition according to any of [13] -[72] of the Detailed Description and has a diameter in the range of 20 nm to 300 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 200 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [l]-[l2] of the Detailed Description and has a diameter in the range of 20 nm to 200 nm.
  • the liposome is a liposome composition according to any of [13] -[72] of the Detailed Description and has a diameter in the range of 20 nm to 200 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 150 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [l]-[l2] of the Detailed Description and has a diameter in the range of 20 nm to 150 nm.
  • the liposome is a liposome composition according to any of [l3]-[72] of the Detailed Description and has a diameter in the range of 20 nm to 150 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 30 nm to 150 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [l]-[l2] of the Detailed Description and has a diameter in the range of 30 nm to 150 nm.
  • the liposome is a liposome composition according to any of [l3]-[72] of the Detailed Description and has a diameter in the range of 30 nm to 150 nm, or any range therein between.
  • the liposomal composition comprises a liposome having a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a aPANTIFOL according to any of [ l]-[ 12] of the Detailed Description and has a diameter in the range of 80 nm to 120 nm.
  • the liposome is a liposome composition according to any of [13]-[72] of the Detailed Description and has a diameter in the range of 80 nm to 120 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 40 nm to 70 nm, or any range therein between.
  • liposomes comprise a aPANTIFOL according to any of [1]-[12] of the Detailed Description and have a diameter in the range of 40nm-70 nm.
  • the liposome is a liposome composition according to any of [13]-[72] of the Detailed Description and has a diameter in the range of 40nm-70 nm.
  • the properties of liposomes are influenced by the nature of lipids used to make the liposomes.
  • lipids have been used to make liposomes. These include cationic, anionic and neutral lipids.
  • the liposomes comprising the alpha polyglutamated Antifolate are anionic or neutral.
  • the provided liposomes are cationic.
  • the determination of the charge e.g ., anionic, neutral or cationic
  • the determination of the charge can routinely be determined by measuring the zeta potential of the liposome.
  • the zeta potential of the liposome can be positive, zero or negative.
  • the zeta potential of the liposome is less than or equal to zero.
  • the zeta potential of the liposome is in a range of 0 to -150 mV. In another embodiment, the zeta potential of the liposome is in the range of -30 to -50 mV.
  • cationic lipids are used to make cationic liposomes which are commonly used as gene transfection agents.
  • the positive charge on cationic liposomes enables interaction with the negative charge on cell surfaces. Following binding of the cationic liposomes to the cell, the liposome is transported inside the cell through endocytosis.
  • a neutral to anionic liposome is used.
  • an anionic liposome is used.
  • neutral lipids such as HSPC
  • anionic lipids such as PEG-DSPE results in the formation of anionic liposomes which are less likely to non-specifically bind to normal cells.
  • Specific binding to tumor cells can be achieved by using a tumor targeting antibody such as, for example, a folate receptor antibody, including, for example, folate receptor alpha antibody, folate receptor beta antibody and/or folate receptor delta antibody.
  • At least one (or some) of the lipids is/are amphipathic lipids, defined as having a hydrophilic and a hydrophobic portions (typically a hydrophilic head and a hydrophobic tail).
  • the hydrophobic portion typically orients into a hydrophobic phase (e.g., within the bilayer), while the hydrophilic portion typically orients toward the aqueous phase (e.g., outside the bilayer).
  • the hydrophilic portion can comprise polar or charged groups such as carbohydrates, phosphate, carboxylic, sulfato, amino, sulfhydryl, nitro, hydroxyl and other like groups.
  • the hydrophobic portion can comprise apolar groups that include without limitation long chain saturated and unsaturated aliphatic hydrocarbon groups and groups substituted by one or more aromatic, cyclo-aliphatic or heterocyclic group(s).
  • amphipathic compounds include, but are not limited to, phospholipids, aminolipids and sphingolipids.
  • the lipids are phospholipids.
  • Phospholipids include without limitation phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, and the like. It is to be understood that other lipid membrane components, such as cholesterol, sphingomyelin, and cardiolipin, can be used.
  • the lipids comprising the liposomes provided herein can be anionic and neutral (including zwitterionic and polar) lipids including anionic and neutral phospholipids. Neutral lipids exist in an uncharged or neutral zwitterionic form at a selected pH.
  • such lipids include, for example, dioleoylphosphatidylglycerol (DOPG), diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides and diacylglycerols.
  • DOPG dioleoylphosphatidylglycerol
  • DMPC dimyristoylphos- phatidylcholine
  • DOPS dioleoylphosphatidylserine
  • Anionic lipids are negatively charged at physiological pH.
  • lipids include without limitation phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N- dode- canoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphos- phatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.
  • POPG palmitoyloleyolphos- phatidylglycerol
  • anionic and neutral lipids are referred to herein as non-cationic lipids.
  • Such lipids may contain phosphorus but they are not so limited.
  • non-cationic lipids include lecithin, lysolecithin, phosphatidylethanolamine, lysophosphatidylethan- olamine, dioleoylphosphatidylethanolamine (DOPE), dipalmitoyl phosphatidyl ethanol- amine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidy l-ethan- olamine (DSPE), palmitoyloleoyl-phosphatidylethanolamine (POPE) palmitoyl- oleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatid
  • the liposomes may be assembled using any liposomal assembly method using liposomal components (also referred to as liposome components) known in the art.
  • Liposomal components include, for example, lipids such as DSPE, HSPC, cholesterol and derivatives of these components.
  • Other suitable lipids are commercially available for example, by Avanti Polar Lipids, Inc. (Alabaster, Alabama, USA).
  • a partial listing of available negatively or neutrally charged lipids suitable for making anionic liposomes can be, for example, at least one of the following: DLPC, DMPC, DPPC, DSPC, DOPC, DMPE, DPPE, DOPE, DMPA*Na, DPPA-Na, DOPA*Na, DMPG*Na, DPPG'Na, DOPG'Na, DMPS*Na, DPPS*Na, DOPS*Na, DOPE-Glutaryl*(Na)2, Tetramyristoyl Cardiolipin *(Na)2, DSPE-mPEG- 2000*Na, DS P E - m P E G - 5000 ⁇ N a . and DSPE-Maleimide PEG-2000Na.
  • the aPANTIFOL compositions provided herein are formulated in a liposome comprising a cationic lipid.
  • the cationic lipid is selected from, but not limited to, a cationic lipid described in Inti. Appl. Publ. Nos. WO2012/040184, WO2011/153120, WO2011/149733, WO2011/090965, WO2011/043913, WO2011/ 022460, W 02012/061259, WO2012/054365, WO2012/044638, W02010/080724, W02010/21865 and W 02008/103276, U.S. Pat. Nos.
  • the cationic lipid may be selected from, but not limited to, Formula A described in Intl. Appl. Publ. Nos. WO2012/040184, WO2011/153120, WO201/1149733, WO2011/090965, WO2011/ 043913, WO2011/022460, WO2012/061259, WO2012/054365 and WO2012/044638; each of which is herein incorporated by reference in their entirety.
  • the cationic lipid may be selected from, but not limited to, Formula CLI-CLXXIX of International Publication No. W02008103276, Formula CLI-CLXXIX of U.S. Pat. No. 7,893,302, Formula CLI- CLXXXXII of U.S. Pat. No. 7,404,969 and Formula I-VI of US Patent Publication No. US20100036115; each of which is herein incorporated by reference in their entirety.
  • the cationic lipid may be selected from (20Z,23Z)-N,N- dimethylnonacosa- 20, 23-dien- 10-amine, (l7Z,20Z)-N,N-dimemyl-hexacosa-l7,20-dien-9- amine, (lZ,l9Z)-N5N-dimethylpentacosa-l6, l9-dien-8-amine, (13Z, 16Z)-N,N- dimethyldocosa-13,l6-dien-5-amine, (12Z,15Z)-N,N-dimethyl henicosa-12,l5-dien-4- amine, (l4Z,l7Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z, 18Z)-N, N- dimethyltetracosa- 15, 18-dien-7-amine, ( 18Z,2 lZ)-N,N-di
  • the lipid may be a cleavable lipid such as those described in in Intl. Publ. No. WO2012/170889, which is herein incorporated by reference in its entirety
  • the cationic lipid can routinely be synthesized using methods known in the art and/or as described in Intl. Publ. Nos. W02012/040184, W02011/153120, WO2011/149733, WO2011/090965, W0201/1043913, WO2011/022460, WO2012/061259, WO2012/054365, WO2012/044638, W02010/080724 and W02010/21865; each of which is herein incorporated by reference in its entirety.
  • Lipid derivatives can include, for example, at least, the bonding (preferably covalent bonding) of one or more steric stabilizers and/or functional groups to the liposomal component after which the steric stabilizers and/or functional groups should be considered part of the liposomal components.
  • Functional groups comprises groups that can be used to attach a liposomal component to another moiety such as a protein. Such functional groups include, at least, maleimide.
  • steric stabilizers include at least one from polyethylene glycol (PEG); poly-L-lysine (PLL); monosialoganglioside (GM1); poly(vinyl pyrrolidone) (PVP); poly(acrylamide) (PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidyl polyglycerol; poly[N-(2-hydroxy-propyl) methacrylamide]; amphiphilic poly- N-vinylpyrrolidones; L-amino-acid-based polymer; and polyvinyl alcohol.
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • poly(2-ethyl-2-oxazoline) poly(2-e
  • the aPANTIFOL compositions are formulated in a lipid- polycation complex.
  • the formation of the lipid-polycation complex may be accomplished using methods known in the art and/or as described in U.S. Pub. No. 20120178702, herein incorporated by reference in its entirety.
  • the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and/or polyarginine and the cationic peptides described in International Pub. No. WO2012/013326; herein incorporated by reference in its entirety.
  • the aPANTIFOL is formulated in a lipid-polycation complex which further includes a neutral lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • the components of a liposome can include any molecule(s) (i.e., chemical/reagent/protein) that is bound to it
  • the components of the provided liposomes include, at least, a member selected from the group DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG; and cholesterol-maleimide.
  • the components of the provided liposomes include DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG; and cholesterol-maleimide.
  • the liposomal components that make up the liposome comprises DSPE; DSPE-FITC; DSPE- maleimide; cholesterol; and HSPC.
  • the liposomes of the liposome compositions provided herein comprise oxidized phospholipids.
  • the liposomes comprise an oxidize phospholipid of a member selected from phosphatidylserines, phosphatidylinositols, phosphatidylethanolamines, phosphatidylcholines and l-palmytoyl-2-arachidonoyl-sn- glycero-2-phosphate.
  • the phospholipids have unsaturated bonds.
  • the phospholipids are arachidonic acid containing phospholipids.
  • the phospholipids are sn-2-oxygenated.
  • the phospholipids are not fragmented.
  • the liposomes of the disclosed liposome compositions comprise oxidized l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (OxPAPC).
  • OxPAPC oxidized l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine
  • oxPAPC refers to lipids generated by the oxidation of 1-palmitoyl- 2-arachidonyl-sn-glycero-3-phosphorylcholine (PAPC), which results in a mixture of oxidized phospholipids containing either fragmented or full length oxygenated sn-2 residues.
  • Well-characterized oxidatively fragmented species contain a five- carbon sn-2 residue bearing omega-aldehyde or omega-carboxyl groups.
  • Oxidation of arachidonic acid residue also produces phospholipids containing esterified isoprostanes.
  • the oxPAPC includes HOdiA-PC, KOdiA-PC, HOOA-PC and KOOA-PC species, among other oxidized products present in oxPAPC.
  • the oxPAPCs are epoxyisoprostane-containing phospholipids.
  • the oxPAPC is 1- palmitoyl-2-(5,6-epoxyisoprostane E2)-sn-glycero-3-phosphocholine (5,6-PEIPC), 1- palmitoyl-2-(epoxy-cyclo-pentenone)-sn-glycero-3-phosphorylcholine (PECPC) and/or 1- palmitoyl-2-(epoxy-isoprostane E2)-sn-glycero-4-phosphocholine (PEIPC).
  • the phospholipids have unsaturated bonds.
  • the phospholipids are arachidonic acid containing phospholipids.
  • the phospholipids are sn-2-oxygenated.
  • the phospholipids are not fragmented.
  • the liposomal alpha polyglutamated Antifolate composition is pegylated (i.e., a pegylated liposomal alpha polyglutamated (e.g., pentaglutamated or hexaglutamated) antifolate (PLp-aPANTIFOL or PLp-aPANTIFOL).
  • PLp-aPANTIFOL or PLp-aPANTIFOL is water soluble. That is, the PLp-aPANTIFOL or PLp-aPANTIFOL is in the form an aqueous solution.
  • the liposomes of the disclosed liposome compositions comprise a lipid selected from: l-palmitoyl-2-glutaroyl-sn-glycero-3-phosphocholine (PGPC); l-palmitoyl-2-(9'oxo-nonanoyl)-sn-glycero-3-phosphocholine; l-palmitoyl-2- arachinodoyl-sn-glycero-3-phosphocholine; l-palmitoyl-2-myristoyl-sn-glycero-3-phospho- choline; l-palmitoyl-2-hexadecyl-sn-glycero-3-phosphocholine; l-palmitoyl-2-azelaoyl-sn- glycero-3-phosphocholine; and l-palmitoyl-2-acetoyl-sn-glycero-3-phospho-choline.
  • PGPC l-palmit
  • the pH of solutions comprising the liposome composition is from pH 2 to 8, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 5 to 8 or from pH 2 to 6, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 5 to 8, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 6 to 7, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • At least one component of the liposome lipid bilayer is functionalized (or reactive).
  • a functionalized component is a component that comprises a reactive group that can be used to crosslink reagents and moieties to the lipid. If the lipid is functionalized, any liposome that it forms is also functionalized.
  • the reactive group is one that will react with a crosslinker (or other moiety) to form crosslinks.
  • the reactive group in the liposome lipid bilayer is located anywhere on the lipid that allows it to contact a crosslinker and be crosslinked to another moiety (e.g., a steric stabilizer or targeting moiety).
  • the reactive group is in the head group of the lipid, including for example a phospholipid.
  • the reactive group is a maleimide group.
  • Maleimide groups can be crosslinked to each other in the presence of dithiol crosslinkers including but not limited to dithiolthrietol (DTT).
  • contemplated reactive groups include but are not limited to other thiol reactive groups, amino groups such as primary and secondary amines, carboxyl groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups, carbonyls, halo acetyl (e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters, sulfhydryl groups, and pyridyl disulfide groups.
  • thiol reactive groups amino groups such as primary and secondary amines, carboxyl groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups, carbonyls, halo acetyl (e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters, sulfhydryl groups, and pyridyl disulfide groups.
  • the provided liposomes enclose an interior space.
  • the interior space comprises, but is not limited to, an aqueous solution.
  • the interior space comprises an alpha polyglutamated Antifolate as provided herein.
  • the interior space of the liposome comprises a tonicity agent.
  • the concentration (weight percent) of the tonicity agent is 0.1-20%, 1-20%, 0.5-15%, 1-15%, or 1-50%, or any range therein between.
  • the interior space of the liposome includes a sugar (e.g., trehalose, maltose, sucrose, lactose, mannose, mannitol, glycerol, dextrose, fmctose, etc.).
  • the concentration (weight percent) of the sugar is 0.1-20%, 1-20%, 0.5-15%, 1%-15%, or 1-50%, or any range therein between.
  • the pH of the interior space of the liposome is from pH 2 to 8, or any range therein between.
  • the pH of solutions comprising the liposome composition is from pH 5 to 8, or any range therein between.
  • the pH of solutions comprising the liposome composition is from pH 6 to 7, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer a buffer selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is HEPES. In some embodiments, the buffer is citrate. In some embodiments, the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the interior space of the liposome includes glutamine, glutamate, and/or polyglutamate (e.g ., diglutamate, triglutamate, tetraglutamate, and/or pentaglutamate, containing one or more gamma glutamyl group linkages or 1 or more alpha glutamyl linkages).
  • the concentration weight percent of the glutamine, glutamate, and/or polyglutamate is 0.1-20%, 1-20%, 0.5-15%, 1%- 15%, 5-20%, or 1-50%, or any range therein between.
  • the interior space of the liposome includes glutamine.
  • the interior space of the liposome includes glutamate.
  • the interior space of the liposome includes polyglutamate.
  • the concentration (weight percent) of glutamine, glutamate, and/or polyglutamate is 1-15%, or any range therein between.
  • the glutamine, glutamate, and/or polyglutamate is present at about 5% to 20% weight percent of trehalose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the interior space comprises buffer.
  • the buffer is HEPES buffer or citrate buffer.
  • the citrate buffer is at a concentration of between 5 to 200 mM.
  • the interior space has a pH of between 2.8 to 6.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between.
  • the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM.
  • the interior space of the liposome includes glutamine.
  • the concentration weight percent of the glutamine is 0.1-20%, 1-20%, 0.5-15%, 1%-15%, 5-20%, or 1-50%, or any range therein between.
  • the concentration (weight percent) of glutamine is 1-15%, or any range therein between.
  • the glutamine is present at about 5% to 20% weight percent of glutamine or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the interior space comprises buffer.
  • the buffer is HEPES buffer or citrate buffer.
  • the citrate buffer is at a concentration of between 5 to 200 mM.
  • the interior space has a pH of between 2.8 to 6.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM.
  • the interior space of the liposome includes trehalose.
  • the concentration weight percent of trehalose is 0.1-20%, 1-20%, 0.5-15%, 1%- 15%, 5-20%, or 1-50%, or any range therein between.
  • the concentration (weight percent) of trehalose is 1-15%, or any range therein between.
  • the trehalose is present at about 5% to 20% weight percent of trehalose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the interior space comprises buffer.
  • the buffer is HEPES buffer or citrate buffer.
  • the citrate buffer is at a concentration of between 5 to 200 mM.
  • the interior space has a pH of between 2.8 to 6.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM.
  • the interior space of the liposome includes dextrose.
  • the concentration weight percent of dextrose is 0.1-20%, 1-20%, 0.5-15%, 1- 15%, 5-20%, or 1-50%, or any range therein between.
  • the concentration (weight percent) of dextrose is 1-15%, or any range therein between.
  • the dextrose is present at about 5% to 20% weight percent of dextrose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between.
  • the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the disclosure provides liposomal compositions that comprise a liposome encapsulating (i.e., filled with) an alpha polyglutamated Antifolate e.g., a aPANTIFOL disclosed herein).
  • the liposomal composition comprises a aPANTIFOL according to any of [ l]-[ 12] of the Detailed Description.
  • the liposomal composition comprises a polyglutamated Antifolate described in Section II.
  • a liposome in the liposomal composition comprises an ANTIFOL containing 4, 5, 6, 2-10, 4-6, or more than 5, glutamyl groups (including the glutamyl group of the Antifolate).
  • the alpha polyglutamated Antifolate in the Lp-aR ANTIFOL comprises two or more glutamyl groups in the L-form. In other embodiments, the alpha polyglutamated Antifolate in the Lp-aR ANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the alpha polyglutamated Antifolate in the Lp-aR ANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the alpha polyglutamated Antifolate in the Lp-aR ANTIFOL comprises two or more glutamyl groups that have a gamma carboxyl linkage.
  • the liposomal composition comprises a liposome comprising a a pentaglutamated Antifolate.
  • the liposome comprises an L-a pentaglutamated Antifolate, a D-a pentaglutamated Antifolate, or an L- and D-a pentaglutamated Antifolate.
  • the liposomal composition comprises a liposome comprising a a hexaglutamated Antifolate (Lp-aPANTIFOL).
  • the liposome comprises an L-a hexaglutamated Antifolate, a D-a hexaglutamated Antifolate, or an L- and D-a hexaglutamated Antifolate.
  • the liposomal composition is a liposomal composition according to any of [13]- [72] of the Detailed Description.
  • the disclosure provides a liposomal composition comprising a targeted and pegylated liposome that comprises an alpha polyglutamated Antifolate (TPLp- aPANTIFOL).
  • the liposomal composition comprises a aPANTIFOL according to any of [l]-[l2] of the Detailed Description.
  • the liposomal composition comprises a polyglutamated Antifolate described in Section II.
  • the liposomal composition is a targeted pegylated liposomal composition according to any of [55]-[74] of the Detailed Description.
  • the targeted pegylated liposomal alpha polyglutamated (e.g., pentaglutamated or hexaglutamated) Antifolate comprises a medium comprising a liposome including an interior space; an aqueous alpha polyglutamated Antifolate disposed within the interior space; and a targeting moiety comprising a protein with specific affinity for at least one folate receptor, and wherein the targeting moiety disposed at the exterior of the liposome.
  • the medium is an aqueous solution.
  • the interior space, the exterior space (e.g., the medium), or both the interior space and the medium contains one or more lyoprotectants or cryoprotectants which are listed above.
  • the cryoprotectant is mannitol, trehalose, sorbitol, or sucrose.
  • the liposome encapsulating alpha polyglutamated Antifolate (e.g., Lp-aPANTIFOL, including PLp- aPANTIFOL, TPLp-aPANTIFOL, TLp- aPANTIFOL, and NTLp-aPANTIFOL) has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between. In some embodiments, the liposome interior space contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between.
  • Lp-aPANTIFOL including PLp- aPANTIFOL, TPLp-aPANTIFOL, TLp- aPANTIFOL, and NTLp-aPANTIFOL
  • the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between. In further embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp- aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between.
  • the liposome does not comprise a targeting moiety, is not pegylated, (NTLp-aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate, or any range therein between.
  • the liposome encapsulates an alpha polyglutamated Antifolate that contains 2-10 glutamyl groups (i. e ., Lp-aPANTIFOL, including PLp-aPANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • Lp-aPANTIFOL including PLp-aPANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL
  • the liposome interior space contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl
  • the liposome interior space contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups. In some embodiments, the liposome is a liposomal composition according to any of [l3]-[72] of the Detailed Description.
  • the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between. In further embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between. In some embodiments, the liposome comprises a targeting moiety, is not pegylated (TLp- aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups.
  • Tp- aPANTIFOL is not pegylated
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is non-targeted and unpegylated (aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome encapsulates alpha tetraglutamated Antifolate (i.e., Lp-aPANTIFOL, including PLp- aP ANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aR ANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha tetraglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • alpha tetraglutamated Antifolate i.e., Lp-aPANTIFOL, including PLp- aP ANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aR ANTIFOL
  • the liposome interior space contains between 10,000 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha tetraglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha tetraglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp-aR ANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha tetraglutamated Antifolate.
  • the liposome does not contain a targeting moiety and is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • the liposome is non- targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha tetraglutamated Antifolate, or any range therein between.
  • the liposome encapsulates alpha pentaglutamated Antifolate ( .e., Lp-aPANTIFOL, including PLp- aP ANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aR ANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha pentaglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between.
  • alpha pentaglutamated Antifolate .e., Lp-aPANTIFOL, including PLp- aP ANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aR ANTIFOL
  • the liposome interior space contains between 10 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between.
  • the liposome interior space contains between 10,000 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha pentaglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between. In further embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha pentaglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp-aR ANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha pentaglutamated Antifolate. In some embodiments, the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between. In further embodiments, the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha pentaglutamated Antifolate, or any range therein between.
  • the liposome encapsulates alpha hexaglutamated Antifolate (i.e., Lp-aPANTIFOL, including PLp-aPANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha hexaglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • alpha hexaglutamated Antifolate i.e., Lp-aPANTIFOL, including PLp-aPANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL
  • the liposome interior space contains between 10,000 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha hexaglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-aPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha hexaglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp-aPANIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of alpha hexaglutamated Antifolate.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of alpha hexaglutamated Antifolate, or any range therein between.
  • the disclosure provides a liposomal alpha polyglutamated Antifolate composition wherein the liposome encapsulates alpha polyglutamated Antifolate or a salt or acid thereof, and one or more aqueous pharmaceutically acceptable carriers.
  • the liposomal alpha polyglutamated Antifolate composition is a aPANTIFOL according to any of [l]-[l2] of the Detailed Description.
  • the liposome comprises a polyglutamated Antifolate described in Section II.
  • the liposome interior space contains trehalose.
  • the liposome interior space contains 1% to 50% weight of trehalose.
  • the liposome interior space contains HBS at a concentration of between 1 to 200 mM and a pH of between 2 to 8. In some embodiments, liposome interior space has a pH 5-8, or any range therein between. In some embodiments, liposome interior space has a pH 6-7, or any range therein between. In some embodiments, the liposome interior space has a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM, or any range therein between.
  • the liposome alpha polyglutamated Antifolate i.e ., Lp- aPANTIFOL, including PLp-aPANTIFOL, TPLp-aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL
  • compositions comprise alpha polyglutamated Antifolate (e.g., an aPANTIFOL disclosed 2] of the Detailed Descriptionherein) and one or more non- polyglutamated, polyglutamatable antifolate compositions.
  • the Lp-aPANTIFOL (e.g., PLp-aPANTIFOL, TPLp- aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL) comprises an alpha polyglutamated Antifolate (e.g., a aPANTIFOL disclosed herein) and the Antifolate (ANTIFOL).
  • the Lp-aPANTIFOL comprises a aPANTIFOL according to any of [l]-[l2] of the Detailed Description.
  • the liposome comprises a polyglutamated Antifolate described in Section II.
  • the Lp- aPANTIFOL is a liposomal composition according to any of [l3]-[72] of the Detailed Description.
  • the Lp-aPANTIFOL i.e., liposome alpha polyglutamated
  • Antifolate comprises alpha polyglutamated Antifolate and a polyglutamatable antifolate selected from the group consisting of: methotrexate (MTX), pemetrexed (PMX), lometrexol (LMX), raltitrexed (RTX), pralatrexate, AG2034, GW1843, aminopterin, and LY309887.
  • the Lp-aPANTIFOL comprises alpha polyglutamated Antifolate and lometrexol.
  • the Lp-aPANTIFOL comprises alpha polyglutamated Antifolate and pemetrexed.
  • the Lp-aPANTIFOL comprises alpha polyglutamated Antifolate and leucovorin. In some embodiments, the Lp-aPANTIFOL comprises alpha polyglutamated Antifolate and a triazine antifolate derivative (e.g., a sulphonyl fluoride triazine such as NSC 127755). In some embodiments, the Lp-aPANTIFOL comprises alpha polyglutamated Antifolate and a serine hydroxymethyltransferase (SHMT2) inhibitor. In some embodiments, the SHMT2 inhibitor is an antifolate (e.g., a polyglutamatable or nonpolyglutamatable antifolate). In some embodiments, the SHMT2 inhibitor is an antifolate.
  • SHMT2 inhibitor is an antifolate.
  • the Lp-aPANTIFOL (e.g., PLp-aPANTIFOL, TPLp- aPANTIFOL, TLp-aPANTIFOL, and NTLp-aPANTIFOL) comprises an alpha polyglutamated Antifolate (e.g., a aPANTIFOL disclosed herein) and a so-called“non polyglutamatable” antifolate.
  • the liposome comprises a aPANTIFOL according to any of [l]-[l2] of the Detailed Description.
  • the liposome comprises a polyglutamated Antifolate described in Section P.
  • the liposome comprises an alpha polyglutamated Antifolate and a non-polyglutamatable antifolate that inhibits one or more enzymes in the folate cycle metabolic pathway.
  • the non-polyglutamatable antifolate inhibits one or more enzymes selected from: thymidylate synthase (TS), dihydrofolate reductase (DHFR), glycinamide ribonucleotide (GAR) transformylase, and aminoimidazole carboxamide ribonucleotide (AICAR) transformylase.
  • TS thymidylate synthase
  • DHFR dihydrofolate reductase
  • GAR glycinamide ribonucleotide
  • AICAR aminoimidazole carboxamide ribonucleotide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Dispersion Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Molecular Biology (AREA)
  • Inorganic Chemistry (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2019/017002 2018-02-07 2019-02-07 Alpha polyglutamated antifolates and uses thereof Ceased WO2019157146A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US16/967,213 US12076402B2 (en) 2018-02-07 2019-02-07 Alpha polyglutamated antifolates and uses thereof
EP19750590.2A EP3749313A4 (en) 2018-02-07 2019-02-07 ALPHA-POLYGLUTAMATE ANTIFOLATES AND ASSOCIATED USES
CN201980017190.9A CN111867593A (zh) 2018-02-07 2019-02-07 α聚谷氨酸化抗叶酸剂及其用途
JP2020542626A JP7487107B2 (ja) 2018-02-07 2019-02-07 アルファポリグルタミン酸化葉酸代謝拮抗薬およびその使用
CA3090500A CA3090500A1 (en) 2018-02-07 2019-02-07 Alpha polyglutamated antifolates and uses thereof
JP2024075984A JP7679114B2 (ja) 2018-02-07 2024-05-08 アルファポリグルタミン酸化葉酸代謝拮抗薬およびその使用
US18/755,082 US20250161455A1 (en) 2018-02-07 2024-06-26 Alpha polyglutamated antifolates and uses thereof
US19/022,038 US20250319188A1 (en) 2018-02-07 2025-01-15 Alpha polyglutamated antifolates and uses thereof
JP2025072834A JP2025107218A (ja) 2018-02-07 2025-04-25 アルファポリグルタミン酸化葉酸代謝拮抗薬およびその使用

Applications Claiming Priority (40)

Application Number Priority Date Filing Date Title
US201862627703P 2018-02-07 2018-02-07
US201862627731P 2018-02-07 2018-02-07
US201862627714P 2018-02-07 2018-02-07
US201862627716P 2018-02-07 2018-02-07
US201862627741P 2018-02-07 2018-02-07
US62/627,703 2018-02-07
US62/627,714 2018-02-07
US62/627,741 2018-02-07
US62/627,716 2018-02-07
US62/627,731 2018-02-07
US201862630728P 2018-02-14 2018-02-14
US201862630820P 2018-02-14 2018-02-14
US201862630671P 2018-02-14 2018-02-14
US201862630744P 2018-02-14 2018-02-14
US201862630637P 2018-02-14 2018-02-14
US201862630825P 2018-02-14 2018-02-14
US201862630634P 2018-02-14 2018-02-14
US201862630629P 2018-02-14 2018-02-14
US201862630713P 2018-02-14 2018-02-14
US62/630,744 2018-02-14
US62/630,629 2018-02-14
US62/630,820 2018-02-14
US62/630,671 2018-02-14
US62/630,713 2018-02-14
US62/630,825 2018-02-14
US62/630,634 2018-02-14
US62/630,637 2018-02-14
US62/630,728 2018-02-14
US201862636294P 2018-02-28 2018-02-28
US62/636,294 2018-02-28
US201862662374P 2018-04-25 2018-04-25
US62/662,374 2018-04-25
US201862702561P 2018-07-24 2018-07-24
US201862702732P 2018-07-24 2018-07-24
US62/702,732 2018-07-24
US62/702,561 2018-07-24
US201862764943P 2018-08-17 2018-08-17
US201862764955P 2018-08-17 2018-08-17
US62/764,955 2018-08-17
US62/764,943 2018-08-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/967,213 A-371-Of-International US12076402B2 (en) 2018-02-07 2019-02-07 Alpha polyglutamated antifolates and uses thereof
US18/755,082 Continuation US20250161455A1 (en) 2018-02-07 2024-06-26 Alpha polyglutamated antifolates and uses thereof

Publications (1)

Publication Number Publication Date
WO2019157146A1 true WO2019157146A1 (en) 2019-08-15

Family

ID=67549609

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/017002 Ceased WO2019157146A1 (en) 2018-02-07 2019-02-07 Alpha polyglutamated antifolates and uses thereof

Country Status (6)

Country Link
US (2) US12076402B2 (enExample)
EP (1) EP3749313A4 (enExample)
JP (3) JP7487107B2 (enExample)
CN (1) CN111867593A (enExample)
CA (1) CA3090500A1 (enExample)
WO (1) WO2019157146A1 (enExample)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021248109A1 (en) * 2020-06-05 2021-12-09 The Board of Trustees of the Leland Stanford Junior University Office of the General Counsel Dynamically crosslinked injectable hydrogels with chemically stabilized multilamellar vesicles
EP3752158A4 (en) * 2018-02-14 2022-03-09 L.E.A.F Holdings Group LLC GAMMA-POLYGLUTAMATED AMINOPTERINE AND USES THEREOF
EP3749320A4 (en) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC ALPHA-POLYGLUTAMATED AMINOPTERIN AND ITS USES
EP3749321A4 (en) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Gamma polyglutamated antifolates and uses thereof
EP3749313A4 (en) * 2018-02-07 2022-03-16 L.E.A.F Holdings Group LLC ALPHA-POLYGLUTAMATE ANTIFOLATES AND ASSOCIATED USES
US11344628B2 (en) 2016-08-12 2022-05-31 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US11534498B2 (en) 2016-08-12 2022-12-27 L.E.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
US11730738B2 (en) 2018-02-07 2023-08-22 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
US11771700B2 (en) 2018-02-14 2023-10-03 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
US11779584B2 (en) 2018-02-07 2023-10-10 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12048766B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
US12048767B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof
US12128046B2 (en) 2018-02-07 2024-10-29 L.E.A.F. Holdings Group Llc Alpha polyglutamated methotrexate and uses thereof
US12220431B2 (en) 2018-02-07 2025-02-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated antifolates and uses thereof
US12239734B2 (en) 2018-02-07 2025-03-04 L.E.A.F. Holdings Group Llc Gamma polyglutamated raltitrexed and uses thereof
US12246015B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
US12246019B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated lometrexol and uses thereof
US12246018B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
US12290518B2 (en) 2018-02-14 2025-05-06 L.E.A.F. Holdings Group Llc Gamma polyglutamated methotrexate and uses thereof
US12336994B2 (en) 2018-02-07 2025-06-24 L.E.A.F. Holdings Group Llc Alpha polyglutamated tetrahydrofolates and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080260812A1 (en) * 2004-04-26 2008-10-23 Takami Matsuyama C/O Kagoshima University Therapeutic Medicine Containing Monoclonal Antibody Against Folate Receptor Beta (Fr-Beta)
US7446120B2 (en) * 2000-01-24 2008-11-04 Adherex Technologies, Inc. Peptidomimetic modulators of cell adhesion
US20120077784A1 (en) * 2009-06-03 2012-03-29 Ex-Tex Llc Skin treatment compositions
US20180236098A1 (en) * 2016-08-12 2018-08-23 L.E.A.F. Holdings Group Llc Alpha and gamma-d polyglutamated antifolates and uses thereof

Family Cites Families (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4584375A (en) 1984-08-21 1986-04-22 Rensselaer Polytechnic Institute Fluorine-containing antifolates incapable of polyglutamate formation
CA2057635A1 (en) 1990-12-14 1992-06-15 Hiroshi Akimoto Condensed heterocyclic compounds, their production and use
US5646253A (en) 1994-03-08 1997-07-08 Memorial Sloan-Kettering Cancer Center Recombinant human anti-LK26 antibodies
US6569432B1 (en) 1995-02-24 2003-05-27 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof
WO1997027764A1 (en) 1996-01-31 1997-08-07 South Alabama Medical Science Foundation Food and vitamin preparations containing the natural isomer of reduced folates
US5912251A (en) 1998-01-17 1999-06-15 Nair; Madhavan G. Metabolically inert anti-inflammatory and anti-tumor antifolates
US20050031679A1 (en) 1998-03-27 2005-02-10 Clemens Unger Method for producing liposomal formulations of active ingredients
CN1239545C (zh) 1998-07-09 2006-02-01 罗狄亚化学公司 水溶性或水可分散性接枝共聚物
WO2001005405A1 (en) 1999-07-16 2001-01-25 The General Hospital Corporation Folylpolyglutamyl synthetase gene transfer to enhance antifolate drug sensitivity
CN1095472C (zh) 2000-04-17 2002-12-04 上海复康医药科技发展有限公司 叶酸-多聚糖复合物,其制备方法和以该复合物为活性成分的药物组合物
EP1286661A2 (en) 2000-06-09 2003-03-05 OSI Pharmaceuticals, Inc. Liposomal benzoquinazoline thymidylate synthase inhibitor formulations
JP5102928B2 (ja) 2000-06-30 2012-12-19 イーライ リリー アンド カンパニー 新規な葉酸代謝拮抗薬の組み合わせ療法
AU2003211103A1 (en) 2002-02-13 2003-09-04 Northeastern University Intracellular delivery of therapeutic agents
CH696628A5 (de) 2002-02-26 2007-08-31 Eprova Ag Verwendung von Folaten zur Herstellung einer Zubereitung geeignet zur Vorbeugung und Behandlung von Entzündungen und entzündungsassoziierter Krankheiten, im Speziellen zur Beeinflussung der
US7563590B2 (en) 2002-08-30 2009-07-21 Cypress Bioscience Inc. Methods of quantifying methotrexate metabolites
US6921667B2 (en) 2003-03-07 2005-07-26 Prometheus Laboratories, Inc. Methods for direct detection of individual methotrexate metabolites
US20040265368A1 (en) 2003-04-02 2004-12-30 Lawrence Mayer Combination compositions of camptothecins and fluoropyrimidines
AU2005206163B2 (en) 2004-01-14 2011-06-30 Gilead Sciences, Inc. Lipid-based dispersions useful for drug delivery
EP3101034A1 (en) 2004-02-12 2016-12-07 Morphotek, Inc. Monoclonal antibodies that specifically bind to folate receptor alpha
US7612071B2 (en) 2004-03-12 2009-11-03 Syntrix Biosystems, Inc. Compositions and methods employing aminopterin
LT3173073T (lt) 2004-05-03 2025-01-10 Ipsen Biopharm Ltd. Liposomos, skirtos vaistų pristatymui
US7695908B2 (en) 2004-06-15 2010-04-13 Prometheus Laboratories Inc. Methods for predicting methotrexate polyglutamate levels using pharmacogenetics
JP2008512490A (ja) 2004-09-08 2008-04-24 チェルシー・セラピューティクス,インコーポレイテッド 異常細胞増殖および炎症の障害を治療するための代謝的に不活性な葉酸拮抗剤
JPWO2006035876A1 (ja) 2004-09-29 2008-05-15 興和株式会社 関節リウマチの予防及び/又は治療薬
US8126089B2 (en) 2004-09-30 2012-02-28 Alcatel Lucent Method and apparatus for providing frame synchronization in a digital communication system that supports multiple modulation formats
US20100266709A1 (en) 2004-12-16 2010-10-21 Hicks Terry Lee Compositions and Methods for Treating Burns
WO2006074416A1 (en) 2005-01-07 2006-07-13 Health Research Inc. 5-amino-4-imidazolecarboxamide riboside and its nucleobase as potentiators of antifolate transport and metabolism
JP2006248978A (ja) 2005-03-10 2006-09-21 Mebiopharm Co Ltd 新規なリポソーム製剤
GB2424837B (en) 2005-04-06 2010-10-06 Cilag Ag Int Injection device
AU2005335876A1 (en) 2005-08-24 2007-03-01 Protherics Medicines Development Limited Cleavage of antifolate compounds
EP1962796A2 (en) 2005-12-08 2008-09-03 Yissum Research Development Company Of The Hebrew University Of Jerusalem Methods for affecting liposome composition by ultrasound irradiation
WO2007098089A2 (en) 2006-02-17 2007-08-30 Novacea, Inc. Treatment of hyperproliferative diseases with methotrexate n-oxide and analogs
US9265746B2 (en) 2006-05-31 2016-02-23 Merck & Cie Method for cell-specific targeting
WO2008030818A2 (en) 2006-09-05 2008-03-13 Mebiopharm Co., Ltd. Novel liposome compositions
RU2423114C2 (ru) 2006-12-29 2011-07-10 Тракон Фармасьютикалз, Инк. Комбинации антифолатного агента в лечении рака
JP2010516694A (ja) 2007-01-19 2010-05-20 チェルシー・セラピューティクス,インコーポレイテッド 新規な伝統的葉酸拮抗剤
CN101977620B (zh) 2008-03-18 2014-05-07 英国技术集团国际有限公司 用于治疗类风湿性关节炎或急性骨髓性白血病的环戊二烯并[g]喹唑啉衍生物
GB0811360D0 (en) 2008-06-20 2008-07-30 Imp Innovations Ltd Methods
TW201118098A (en) 2009-08-13 2011-06-01 Reddy S Lab Liimited Dr Processes for preparing pemetrexed
TWI622402B (zh) 2010-02-24 2018-05-01 免疫遺傳股份有限公司 葉酸受體1抗體類和免疫共軛物類及彼等之用途
CN102917690B (zh) 2010-03-19 2016-08-24 麻省理工学院 脂质囊泡组合物和使用方法
US9770414B2 (en) * 2010-05-13 2017-09-26 Pacira Pharmaceuticals, Inc. Sustained release formulation of methotrexate as a disease-modifying antirheumatic drug (DMARD) and an anti-cancer agent
EP2394640A1 (en) 2010-05-21 2011-12-14 MediGene AG Improved liposomal formulations of lipophilic compounds
CA2800693A1 (en) 2010-05-28 2011-12-01 Purdue Research Foundation Delivery of therapeutic agents to inflamed tissues using folate-targeted agents
WO2012033987A2 (en) 2010-09-09 2012-03-15 Purdue Research Foundation Anti-human folate receptor beta antibodies and methods of use
WO2012037068A1 (en) 2010-09-13 2012-03-22 De Novo Diagnostics, Inc. Methods for monitoring methotrexate therapy
WO2012061469A2 (en) 2010-11-02 2012-05-10 Sicor Inc. Crystalline forms of pralatrexate
MX343607B (es) 2010-11-05 2016-11-11 Morphotek Inc Receptor alfa de folato como marcador de diagnóstico y pronóstico para cánceres que expresan receptor alfa de folato.
WO2012078708A1 (en) * 2010-12-07 2012-06-14 Chelsea Therapeutics, Inc. Combination comprising methotrexate and an antifolate compound
WO2012118806A2 (en) 2011-02-28 2012-09-07 The Regents Of The University Of California Compositions and methods for detecting and treating cancer
PL226015B1 (pl) 2011-03-03 2017-06-30 Wrocławskie Centrum Badań Eit + Spółka Z Ograniczoną Liposomowy preparat zawierajacy przeciwnowotworowa substancje aktywna, sposob jego wytwarzania i zawierajaca go kompozycja farmaceutyczna
WO2012121682A2 (en) 2011-03-10 2012-09-13 National Science And Technology Development Agency Anti-folate antimalarials with dual-binding modes and their preparation
US8673914B2 (en) 2011-03-28 2014-03-18 St. John's University Use of phosphodiesterase inhibitors for treating multidrug resistance
EP2508894A1 (en) 2011-04-05 2012-10-10 Receptomon LLC Method for monitoring gene expression of translation and Integral/Secretory protein synthesis by magnetic resonance spectroscopy (MRS)
US8183227B1 (en) 2011-07-07 2012-05-22 Chemo S. A. France Compositions, kits and methods for nutrition supplementation
RS61235B1 (sr) 2011-07-13 2021-01-29 Yissum Res Dev Co Of Hebrew Univ Jerusalem Ltd Lipozomi koji ko-inkapsuliraju bisfosfonat i amfipatički agens
SI2731972T1 (en) 2011-07-15 2018-04-30 Eisai R&D Management Co., Ltd. Anti-folate receptor alpha antibodies and uses thereof
US20130122096A1 (en) 2011-11-14 2013-05-16 Silenseed Ltd. Compositions for drug delivery and methods of manufacturing and using same
JPWO2014003137A1 (ja) 2012-06-27 2016-06-02 旭化成メディカル株式会社 高アフィニティー抗体、及びその製造方法
WO2014016740A2 (en) 2012-07-23 2014-01-30 Fresenius Kabi Oncology Ltd. Improved process for the preparation of pralatrexate
WO2014046630A1 (en) 2012-09-19 2014-03-27 Keskin, Dilek Tumor targeted liposomal drug delivery system
US20140120157A1 (en) 2012-09-19 2014-05-01 Georgetown University Targeted liposomes
US9207238B2 (en) 2012-12-07 2015-12-08 Kyowa Hakko Kirin Co., Ltd. Anti-FOLR1 antibody
CN103040748B (zh) 2012-12-18 2014-07-02 海南圣欣医药科技有限公司 一种培美曲塞二钠脂质体注射剂
US9192609B2 (en) 2013-04-17 2015-11-24 Hedgepath Pharmaceuticals, Inc. Treatment and prognostic monitoring of proliferation disorders using hedgehog pathway inhibitors
SG11201509043RA (en) 2013-05-14 2015-12-30 Immunogen Inc Anti-folr1 immunoconjugate dosing regimens
MA40428A (fr) * 2014-08-14 2016-02-18 L E A F Holdings Group Llc Médicament à affinité encapsulé dans un liposome
WO2017189961A1 (en) 2016-04-29 2017-11-02 Memorial Sloan Kettering Cancer Center Compositions and methods for targeted particle penetration, distribution, and response in malignant brain tumors
CN121177507A (zh) 2016-08-12 2025-12-23 L.E.A.F.控股集团公司 α和γ-D聚谷氨酸化抗叶酸剂及其用途
WO2018031980A1 (en) 2016-08-12 2018-02-15 L.E.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
ES3062820T3 (en) 2017-11-08 2026-04-14 L E A F Holdings Group Llc Platinum complexes and uses thereof
CN111867593A (zh) 2018-02-07 2020-10-30 L.E.A.F.控股集团公司 α聚谷氨酸化抗叶酸剂及其用途
EP3749319A4 (en) 2018-02-07 2022-06-22 L.E.A.F Holdings Group LLC TETRAHYDROFOLATES ALPHA POLYGLUTAMATE AND THEIR USES
JP7491572B2 (ja) * 2018-02-07 2024-05-28 エル.イー.エー.エフ. ホールディングス グループ エルエルシー アルファポリグルタミン酸化ペメトレキセドおよびその使用
WO2019157121A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated lometrexol and uses thereof
US12310966B2 (en) 2018-02-07 2025-05-27 L.E.A.F. Holdings Group Llc Alpha polyglutamated aminopterin and uses thereof
EP3749314A4 (en) 2018-02-07 2022-02-23 L.E.A.F Holdings Group LLC ALPHA-POLYGLUTAMATE METHOTREXATE AND ITS USES
WO2019157129A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
EP3749321A4 (en) 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Gamma polyglutamated antifolates and uses thereof
CA3090389A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
EP3749318A4 (en) 2018-02-07 2022-07-06 L.E.A.F Holdings Group LLC GAMMA-POLYGLUTAMATED RALTITREXED AND ITS USES
WO2019157145A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
WO2019160734A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
JP7462950B2 (ja) 2018-02-14 2024-04-08 エル.イー.エー.エフ. ホールディングス グループ エルエルシー ガンマポリグルタミン酸化メトトレキセートおよびその使用
CA3090753A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof
US12350271B2 (en) 2018-02-14 2025-07-08 L.E.A.F. Holdings Group Llc Gamma polyglutamated aminopterin and uses thereof
WO2019160735A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
US20230000997A1 (en) 2019-08-06 2023-01-05 L.E.A.F. Holdings Group Llc Processes of preparing polyglutamated antifolates and uses of their compositions

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7446120B2 (en) * 2000-01-24 2008-11-04 Adherex Technologies, Inc. Peptidomimetic modulators of cell adhesion
US20080260812A1 (en) * 2004-04-26 2008-10-23 Takami Matsuyama C/O Kagoshima University Therapeutic Medicine Containing Monoclonal Antibody Against Folate Receptor Beta (Fr-Beta)
US20120077784A1 (en) * 2009-06-03 2012-03-29 Ex-Tex Llc Skin treatment compositions
US20180236098A1 (en) * 2016-08-12 2018-08-23 L.E.A.F. Holdings Group Llc Alpha and gamma-d polyglutamated antifolates and uses thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE Pubmed U.S. National Library of Medicine; 1 December 2012 (2012-12-01), Database accession no. 70107370 *
MATHERLY ET AL.: "Enhanced Polyglutamylation of Aminopterin Relative to Methotrexate in the Ehrlich Ascites Tumor Cell in Vitro", CANCER RESEARCH, vol. 45, March 1985 (1985-03-01), pages 1073 - 1078, XP055629118 *
PIPER ET AL.: "Syntheses of a- and r-substituted amides, peptides, and esters of methotrexate and their evaluation as inhibitors of folate metabolism", JOURNAL OF MEDICINAL CHEMISTRY, vol. 25, February 1982 (1982-02-01), pages 182 - 187, XP002413066, doi:10.1021/jm00344a018 *
See also references of EP3749313A4 *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11701432B2 (en) 2016-08-12 2023-07-18 Le.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
US12296022B2 (en) 2016-08-12 2025-05-13 L.E.A.F. Holdings Group Llc D glutamate polyglutamated antifolates and uses thereof
US12201695B2 (en) 2016-08-12 2025-01-21 L.E.A.F. Holdings Group Llc Polyglutamated pemetrexed and uses thereof
US12178882B2 (en) 2016-08-12 2024-12-31 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12178883B2 (en) 2016-08-12 2024-12-31 L.E.A.F. Holdings Group Llc Alpha and gamma-D polyglutamated pemetrexed antifolates and uses thereof
US11344628B2 (en) 2016-08-12 2022-05-31 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US11534498B2 (en) 2016-08-12 2022-12-27 L.E.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
US12128046B2 (en) 2018-02-07 2024-10-29 L.E.A.F. Holdings Group Llc Alpha polyglutamated methotrexate and uses thereof
US12213981B2 (en) 2018-02-07 2025-02-04 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
US12433893B2 (en) 2018-02-07 2025-10-07 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US11779584B2 (en) 2018-02-07 2023-10-10 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12336994B2 (en) 2018-02-07 2025-06-24 L.E.A.F. Holdings Group Llc Alpha polyglutamated tetrahydrofolates and uses thereof
US12310966B2 (en) 2018-02-07 2025-05-27 L.E.A.F. Holdings Group Llc Alpha polyglutamated aminopterin and uses thereof
US12076402B2 (en) 2018-02-07 2024-09-03 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US12246018B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
EP3749313A4 (en) * 2018-02-07 2022-03-16 L.E.A.F Holdings Group LLC ALPHA-POLYGLUTAMATE ANTIFOLATES AND ASSOCIATED USES
EP3749321A4 (en) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Gamma polyglutamated antifolates and uses thereof
EP3749320A4 (en) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC ALPHA-POLYGLUTAMATED AMINOPTERIN AND ITS USES
US11730738B2 (en) 2018-02-07 2023-08-22 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
US12220431B2 (en) 2018-02-07 2025-02-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated antifolates and uses thereof
US12239734B2 (en) 2018-02-07 2025-03-04 L.E.A.F. Holdings Group Llc Gamma polyglutamated raltitrexed and uses thereof
US12246015B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
US12246019B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated lometrexol and uses thereof
US12290518B2 (en) 2018-02-14 2025-05-06 L.E.A.F. Holdings Group Llc Gamma polyglutamated methotrexate and uses thereof
EP3752158A4 (en) * 2018-02-14 2022-03-09 L.E.A.F Holdings Group LLC GAMMA-POLYGLUTAMATED AMINOPTERINE AND USES THEREOF
US12048767B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof
US12048766B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
US12350271B2 (en) 2018-02-14 2025-07-08 L.E.A.F. Holdings Group Llc Gamma polyglutamated aminopterin and uses thereof
US11771700B2 (en) 2018-02-14 2023-10-03 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
WO2021248109A1 (en) * 2020-06-05 2021-12-09 The Board of Trustees of the Leland Stanford Junior University Office of the General Counsel Dynamically crosslinked injectable hydrogels with chemically stabilized multilamellar vesicles
US20250295584A1 (en) * 2020-06-05 2025-09-25 The Board Of Trustees Of The Leland Stanford Junior University Dynamically crosslinked injectable hydrogels with chemically stabilized multilamellar vesicles

Also Published As

Publication number Publication date
JP7679114B2 (ja) 2025-05-19
JP7487107B2 (ja) 2024-05-20
EP3749313A1 (en) 2020-12-16
CN111867593A (zh) 2020-10-30
JP2025107218A (ja) 2025-07-17
US20210038719A1 (en) 2021-02-11
JP2024097901A (ja) 2024-07-19
CA3090500A1 (en) 2019-08-15
US20250161455A1 (en) 2025-05-22
EP3749313A4 (en) 2022-03-16
JP2021513529A (ja) 2021-05-27
US12076402B2 (en) 2024-09-03

Similar Documents

Publication Publication Date Title
US20250161455A1 (en) Alpha polyglutamated antifolates and uses thereof
US12433893B2 (en) Alpha polyglutamated pemetrexed and uses thereof
US20260053807A1 (en) Alpha polyglutamated aminopterin and uses thereof
US20250082639A1 (en) Alpha polyglutamated methotrexate and uses thereof
EP3749321A1 (en) Gamma polyglutamated antifolates and uses thereof
EP3749311A1 (en) Gamma polyglutamated pemetrexed and uses thereof
EP3752155A1 (en) Gamma polyglutamated methotrexate and uses thereof
EP3749312A1 (en) Alpha polyglutamated lometrexol and uses thereof
EP3749315A1 (en) Alpha polyglutamated raltitrexed and uses thereof
EP3749318A1 (en) Gamma polyglutamated raltitrexed and uses thereof
EP3749316A1 (en) Alpha polyglutamated pralatrexate and uses thereof
WO2019157120A1 (en) Alpha polyglutamated tetrahydrofolates and uses thereof
EP3755335A1 (en) Gamma polyglutamated tetrahydrofolates and uses thereof
US20250319188A1 (en) Alpha polyglutamated antifolates and uses thereof
US20250319123A1 (en) Gamma polyglutamated antifolates and uses thereof
US12220431B2 (en) Gamma polyglutamated antifolates and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19750590

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3090500

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020542626

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019750590

Country of ref document: EP

Effective date: 20200907