WO2019136147A1 - Inhibiteurs de signalisation de récepteur de type toll - Google Patents

Inhibiteurs de signalisation de récepteur de type toll Download PDF

Info

Publication number
WO2019136147A1
WO2019136147A1 PCT/US2019/012181 US2019012181W WO2019136147A1 WO 2019136147 A1 WO2019136147 A1 WO 2019136147A1 US 2019012181 W US2019012181 W US 2019012181W WO 2019136147 A1 WO2019136147 A1 WO 2019136147A1
Authority
WO
WIPO (PCT)
Prior art keywords
phenyl
pyrazol
alkyl
ethyl
4alkyl
Prior art date
Application number
PCT/US2019/012181
Other languages
English (en)
Inventor
John A. Katzenellenbogen
Julie Pollock
Hans Haecker
Naina Sharma
Original Assignee
The Board Of Trustees Of The University Of Illinois
St. Jude Children's Research Hospital, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Board Of Trustees Of The University Of Illinois, St. Jude Children's Research Hospital, Inc. filed Critical The Board Of Trustees Of The University Of Illinois
Publication of WO2019136147A1 publication Critical patent/WO2019136147A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/12—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
    • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
    • C07D233/64—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with substituted hydrocarbon radicals attached to ring carbon atoms, e.g. histidine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D235/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
    • C07D235/02—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
    • C07D235/04—Benzimidazoles; Hydrogenated benzimidazoles
    • C07D235/18—Benzimidazoles; Hydrogenated benzimidazoles with aryl radicals directly attached in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D261/00—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings
    • C07D261/02—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings
    • C07D261/06—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members
    • C07D261/08—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/30—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D263/32—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D277/24—Radicals substituted by oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
    • C07D307/02—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
    • C07D307/34—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D307/38—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D307/40—Radicals substituted by oxygen atoms
    • C07D307/42—Singly bound oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond

Definitions

  • the present invention relates to Toll-like receptor signaling inhibitors useful in the treatment of diseases or conditions mediated by Toll-like receptors (e.g., inflammatory diseases or conditions).
  • Toll-like receptors e.g., inflammatory diseases or conditions.
  • BACKGROUND [0003] Toll-like receptors (TLRs), comprising a family of 10 functional receptors in humans, are a critical part of the innate pathogen recognition system (Kawai et al. Nature immunology 11, 373-384 (2010)). TLRs recognize different pathogen- and host-derived molecules and mediate cell activation and inflammation in order to initiate immune responses (Kumar et al.,
  • TLRs are a key means by which mammals recognize and mount an immune response to foreign molecules and also provide a means by which the innate and adaptive immune responses are linked.
  • TLRs are expressed on different cell types, in particular on innate immune cells, which represent a first line host defense.
  • TLR-induced effector mechanisms include a large number of cytotoxic and inflammatory mediators, e.g. nitric oxide, tumor necrosis factor ⁇ (TNF ⁇ ) and interleukin-1. These mediators act on various cell types, including endothelial cells and other immune cells, collectively supporting the ensuing inflammatory immune response (R. Medzhitov, Origin and physiological roles of inflammation. Nature 454, 428-435 (2008)).
  • TLRs have been shown to play a role in the pathogenesis of many diseases, including autoimmunity, infectious diseases, and inflammatory diseases. Exaggerated or prolonged TLR- mediated inflammation can lead to etiologically diverse diseases, including acute diseases, such as bacterial sepsis and ischemia reperfusion injury during stroke, but also chronic diseases, such as systemic lupus erythematosus (SLE) or obesity-related metabolic inflammation (Poltorak et al., Science 282, 2085-2088 (1998); Knapp, Wienertechnischtechnisch 160, 107-111 (2010); Vilahur and Badimon, Frontiers in physiology 5, 496 (2014); Joosten et al., Nature reviews. Rheumatology 12, 344-357 (2016); Tall and Yvan-Charvet, Nature reviews.
  • SLE systemic lupus erythematosus
  • TLRs are located on the cell surface to detect and initiate a response to extracellular pathogens and other TLRs are located in the endosomal compartment of the cell to detect and initiate a response to engulfed pathogens.
  • the table below summarizes the TLRs, their cellular location, and known agonists.
  • TLR3 double stranded RNA viruses
  • TLR7 single stranded RNA viruses
  • TLR8 single stranded RNA viruses
  • TLR9 unmethylated DNA
  • TLR-IL-1R domain TIR-IL-1R domain
  • NLR Nod-like receptors
  • TLR-protein interactions PPI
  • Homotypic protein interactions between the TLR TIR-domain and the TIR-containing intracellular adaptor protein MyD88 transduce signaling Wesche et al., Immunity 7, 837-847 (1997); Muzio et al., Science 278, 1612-1615 (1997); Medzhitov et al., Molecular cell 2, 253- 258 (1998)).
  • TIR-containing protein TIRAP/MAL appears to act as molecular bridge between TLR and MyD88 (Yamamoto et al., Nature 420, 324-329 (2002); Fitzgerald et al., Nature 413, 78-83 (2001); Horng et al., Nature immunology 2, 835-841 (2001)).
  • TLR3 double stranded RNA-receptor TLR3, whose signaling does not depend on MyD88, but is mediated by two other TIR-containing proteins, i.e. TRAM and TRIF (Yamamoto et al., S.
  • This‘TRIF-pathway’ is also used by TLR4, in addition to the MyD88-pathway; however, the MyD88-pathway is still important for inflammation mediated by TLR4, e.g. LPS-induced sepsis, highlighting the pivotal role of the MyD88-pathway as anti- inflammatory TLR/ IL-1R-target (Kawai et al., Immunity 11, 115-122 (1999)).
  • TLR activation induces oligomerization of MyD88, which results in sequential recruitment of IRAK family members via death domain interactions (Wesche et al., Immunity 7, 837-847 (1997); Lin et al., Nature 465, 885-890 (2010)).
  • IRAK family members in turn, bind and oligomerize TRAF6, which transduces and diversifies signal transduction towards downstream signaling pathways, such as the NF-kB and mitogen-activated protein kinase (MAPK) pathways (Hacker et al., Nature 439, 204-207 (2006); Cao et al., Nature 383, 443-446 (1996); Gohda et al., Journal of immunology 173, 2913-2917 (2004)).
  • MAPK mitogen-activated protein kinase
  • mice deficient in key molecules such as MyD88
  • mice deficient in key molecules do not show overt adverse symptoms unless challenged with infectious agents.
  • these mice are protected from inflammation pathology, e.g. during septic shock.
  • MyD88-deficient humans have been identified. Such individuals are more susceptible to bacterial infections during childhood, but largely unaffected as adults, suggesting compensatory mechanisms via other parts of the immune system.
  • the present invention provides compounds or a pharmaceutically acceptable salt thereof and the methods, compositions and kits disclosed herein for treating a disease or condition mediated by Toll-like receptors and other receptors that activate cells through proteins containing TIR domains.
  • the invention provides compounds of formula (I), or a pharmaceutically acceptable salt thereof,
  • G 1 is–NR 1 R 2 ,–OH,–OC 1-4 alkyl, a C 3-8 cycloalkyl, a 4- to 12-membered heterocyclyl containing 1-3 heteroatoms independently selected from N, O, and S, or a 5- to 12-membered heteroaryl containing 1-3 heteroatoms independently selected from N, O, and S, wherein the cycloalkyl, the heterocyclyl, and the heteroaryl are optionally substituted with 1-4 substituents independently selected from halo, C1-4alkyl, C1-4haloalkyl,–OH,–OC1-4alkyl, and oxo;
  • R 1 and R 2 are each independently hydrogen or C1-4alkyl
  • L 1 is , wherein the C1-4alkylene is bonded to G 1 and the imidazole is fused at the meta and para positions on the phenyl relative to G 2 ;
  • G 2 is selected from (i) to (xiii)
  • R 11 and R 31 are each independently selected from hydrogen, C 1-4 alkyl, and phenyl optionally substituted with 1-3 substituents independently selected from halo, C 1-4 alkyl, C 1- d–OC1-4alkyl;
  • R 4c , R 5a , R 6 , R 8 , R 9 , R 10 , R 12 , R 14 , R 15 , R 16 , R 18 , R 20 , R 22 , R 23 , R 24 , R 25 , R 26 , each occurrence, are independently halo, nitro, cyano, C1-4alkyl, C1- 4haloalkyl,–OH,–OC1-4alkyl,–OC1-4haloalkyl,–NH2,–NH(C1-4alkyl),–N(C1-4alkyl)(C1-4alkyl), –NHC(O)C 1-4 alkyl,–N(C 1-4 alkyl)C(O)C 1-4 alkyl,–NHC(O)OC 1-4 alkyl,–N(C 1-4 alkyl)C(O)OC 1- 4 alkyl,–C(O)OC 1-4 alkyl,–C(O)OH,–C(O)NH 2 ,–C(O)NH(
  • n1 and n2 are independently 0, 1, 2, 3, 4, or 5;
  • n3 and n4 are independently 0, 1, 2, or 3.
  • compositions comprising a pharmaceutically acceptable carrier and therapeutically effective amounts of a compound of formula (I), or a pharmaceutically acceptable salt thereof.
  • Another aspect of the invention provides a method of treating a disease or condition mediated by Toll-like receptor activation comprising administering to a subject, in need thereof, a therapeutically effective amount of a compound of formula (I), or a pharmaceutically acceptable salt or a pharmaceutical composition thereof.
  • the invention provides compounds of formula (I), or a
  • the invention provides the use of a compound of formula (I), or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment a disease or condition mediated by Toll-like receptor activation.
  • kits comprising compounds of formula (I). BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG.1A shows a model of the MyD88 signaling pathway activated by different TLR and IL-1R family members.
  • FIG.1B shows Coumermycin (CM)-induced NF-kB activity of HEK293T reporter cells equipped with NF-kB luciferase reporter and indicated GyrB-fusion proteins.
  • FIG.1C shows MyD88 expression in TIRAP-GyrB-expressing HEK293T cells that were infected with lentivirus expressing CAS9 and control sgRNA (ctrl) or sgRNA against MyD88 (MyD) and analyzed by immuno-blotting with antibodies against MyD88 and ⁇ ACTIN.
  • FIG.1D shows NF-kB activity of TIRAP-GyrB-expressing HEK293T cells with loss of MyD88 expression (shown in (C)) that were stimulated with CM, IL-1 ⁇ or TNF ⁇ .
  • FIG.1E shows Calculation of Z’ values reflecting within plate- and between-plate variation of HEK293T reporter cell lines that were treated on HTS robots on independent plates at different time points with CM in the presence of PS1145 and staurosporine, followed by analysis of pathway-specific (luciferase activity) and non-specific activity (Alamar blue conversion).
  • FIG.2A shows a screening paradigm for HTS based on inducible TLR signaling proteins.
  • FIG.2B shows HTS-derived dose response curve of MPP (Methyl Piperidino Pyrazole, a non-steroidal ligand for the estrogen receptor beta) (Stauffer et al., J. Med. Chem. 2000, 43, 4934-4947) for NF-kB activity and AB-based toxicity using indicated reporter cell lines.
  • MPP Metal Piperidino Pyrazole, a non-steroidal ligand for the estrogen receptor beta
  • FIG.2C shows TNF ⁇ release of bone marrow-derived macrophages (BMM) (from C57BL/6 mice) stimulated with TLR agonists for six hours in the presence of different concentrations of MPP.
  • BMM bone marrow-derived macrophages
  • FIG.2D shows Immuno-blot analysis of CpG-DNA-, R848- and Curdlan-induced NF-kB and MAPK activity in BMM in the presence or absence of MPP (10 mM) as reflected by IkB ⁇ degradation and phosphorylation of p38, JNK1/2 and ERK1/2, respectively. Antibodies against total p38 were used as loading control.
  • FIG.2E shows TNF ⁇ release from BMM derived from wildtype (WT) and ER ⁇ - deficient mice that were treated for six hours with CpG-DNA in the presence of different concentrations of MPP.
  • FIG.2F shows Immuno-blot analysis of IkB ⁇ and MAPK-phosphorylation in BMM derived from ER ⁇ -deficient mice that were treated for 20 min with CpG-DNA in the presence or absence of MPP (10 mM). Antibodies against total p38 were used as loading control.
  • FIG.3A shows quantitative MS analysis of proteins co-purifying with MyD88 in non-stimulated and CpG-DNA-stimulated RAW264.7 cells in the absence or presence of 10 mM MPP.
  • the fold-ratio of MyD88-associated proteins purified from CpG-DNA-treated vs. control cells (open bars) and CpG-DNA plus MPP-treated vs. control cells (closed bars) is shown. Numbers in parenthesis indicate the number of unique peptides identified.
  • FIG.3D shows co-IP analyses of different forms of MyD88 in the absence or presence of 10 mM MPP (IP, IP samples; Ly, total lysates).
  • FIG.3E shows CETSA (Cellular Thermal Shift Assay) of endogenous MyD88 in HEK293T cells that were exposed to indicated temperatures at 50 mM TSI-13-57 (TSI refers to Toll-like receptor Signaling Inhibitor).
  • TSI Cellular Thermal Shift Assay
  • FIG.3F shows CETSA of endogenous MyD88 in HEK293T cells that were exposed to indicated temperatures at 50 mM TSI-13-57.
  • FIG.3G shows CETSA of endogenous MyD88 in HEK293T cells that were exposed to various indicated TSI-13-57 concentrations at 43.8 °C.
  • FIG.3H shows CETSA of endogenous MyD88 in HEK293T cells that were exposed to various indicated TSI-13-57 concentrations at 43.8 °C.
  • FIG.4A shows activity of different TSI against TLR- and Curdlan-induced TNF ⁇ release. IC50 values for inhibition of TNF ⁇ release and AB conversion (toxicity) are shown.
  • FIG.4B shows mammalian two-hybrid (M2H) assay based on indicated M2H protein pairs during exposure to TSI-13-48 and TSI-13-57 at indicated concentrations. Inhibition of Gal4/VP16-mediated luciferase activity and AB conversion (toxicity) are shown.100% inhibition corresponds to values obtained in the presence of staurosporine.
  • FIG.5B shows TSI-13-57 plasma concentration of the mice described in FIG.5A.
  • compounds of the invention can optionally be substituted with one or more substituents, such as are illustrated generally above, or as exemplified by particular classes, subclasses, and species of the invention.
  • the variables in formula I encompass specific groups, such as, for example, alkyl and cycloalkyl.
  • combinations of substituents envisioned by this invention are those combinations that result in the formation of stable or chemically feasible compounds.
  • stable refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and preferably their recovery, purification, and use for one or more of the purposes disclosed herein.
  • a stable compound or chemically feasible compound is one that is not substantially altered when kept at a temperature of 40°C or less, in the absence of moisture or other chemically reactive conditions, for at least a week.
  • alkyl as used herein, means a straight or branched chain saturated hydrocarbon.
  • Representative examples of alkyl include, but are not limited to, methyl, ethyl, npropyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n- hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, and n- decyl.
  • alkylene means a divalent group derived from a straight or branched chain saturated hydrocarbon.
  • Representative examples of alkylene include, but are not limited to, -CH 2 -, -CH 2 CH 2 -, -CH 2 CH 2 CH 2 -, -CH 2 CH(CH 3 )CH 2 -, and
  • aryl means phenyl or a bicyclic aryl.
  • the bicyclic aryl is naphthyl, dihydronaphthalenyl, tetrahydronaphthalenyl, indanyl, or indenyl.
  • the phenyl and bicyclic aryls are attached to the parent molecular moiety through any carbon atom contained within the phenyl or bicyclic aryl.
  • halogen means a chlorine, bromine, iodine, or fluorine atom.
  • haloalkyl means an alkyl, as defined herein, in which one, two, three, four, five, six, or seven hydrogen atoms are replaced by halogen.
  • representative examples of haloalkyl include, but are not limited to, 2-fluoroethyl,
  • difluoromethyl trifluoromethyl, 2,2,2-trifluoroethyl, 2,2,2-trifluoro-1, 1-dimethylethyl, and the like.
  • heteroaryl means an aromatic heterocycle, i.e., an aromatic ring that contains at least one heteroatom selected from O, N, or S.
  • a heteroaryl may contain from 5 to 12 ring atoms.
  • a heteroaryl may be a 5- to 6-membered monocyclic heteroaryl or an 8- to 12-membered bicyclic heteroaryl.
  • a 5-membered monocyclic heteroaryl ring contains two double bonds, and one, two, three, or four heteroatoms as ring atoms.
  • 5-membered monocyclic heteroaryls include, but are not limited to, furanyl, imidazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, oxazolyl, pyrazolyl, pyrrolyl, tetrazolyl, thiadiazolyl, thiazolyl, thienyl, and triazolyl.
  • a 6-membered heteroaryl ring contains three double bonds, and one, two, three or four heteroatoms as ring atoms.
  • 6-membered monocyclic heteroaryls include, but are not limited to, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, and triazinyl.
  • the bicyclic heteroaryl is an 8- to 12-membered ring system having a monocyclic heteroaryl fused to an aromatic, saturated, or partially saturated carbocyclic ring, or fused to a second monocyclic heteroaryl ring.
  • bicyclic heteroaryl include, but are not limited to, benzofuranyl, benzoxadiazolyl, 1,3- benzothiazolyl, benzimidazolyl, benzothienyl, indolyl, indazolyl, isoquinolinyl, naphthyridinyl, oxazolopyridine, quinolinyl, thienopyridinyl, 5 ,6, 7 ,8-tetrahydroquinolinyl, and 6, 7-dihydro- 5H-cyclopenta[b Jpyridinyl.
  • the heteroaryl groups are connected to the parent molecular moiety through any substitutable carbon atom or any substitutable nitrogen atom contained within the groups.
  • cycloalkyl as used herein, means a monocyclic all-carbon ring containing zero heteroatoms as ring atoms, and zero double bonds.
  • examples of cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
  • the cycloalkyl groups described herein can be appended to the parent molecular moiety through any substitutable carbon atom.
  • heterocycle refer generally to ring systems containing at least one heteroatom as a ring atom where the heteroatom is selected from oxygen, nitrogen, and sulfur. In some embodiments, a nitrogen or sulfur atom of the heterocycle is optionally substituted with oxo.
  • Heterocycles may be a monocyclic heterocycle, a fused bicyclic heterocycle, or a spiro heterocycle.
  • the monocyclic heterocycle is generally a 4, 5, 6, 7, or 8- membered non-aromatic ring containing at least one heteroatom selected from O, N, or S.
  • the 4- membered ring contains one heteroatom and optionally one double bond.
  • the 5-membered ring contains zero or one double bond and one, two or three heteroatoms.
  • the 6, 7, or 8-membered ring contains zero, one, or two double bonds, and one, two, or three heteroatoms.
  • Representative examples of monocyclic heterocycle include, but are not limited to, azetidinyl, azepanyl, diazepanyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-dioxolanyl , 4,5-dihydroisoxazol-5-yl, 3,4- dihydropyranyl, 1,3-dithiolanyl, 1,3-dithianyl, imidazolinyl, imidazolidinyl, isothiazolinyl, isothiazolidinyl, isoxazolinyl, isoxazolidinyl, morpholinyl, oxadiazolinyl, oxadiazolidinyl
  • the fused bicyclic heterocycle is a 7-12-membered ring system having a monocyclic heterocycle fused to a phenyl, to a saturated or partially saturated carbocyclic ring, or to another monocyclic heterocyclic ring, or to a monocyclic heteroaryl ring.
  • fused bicyclic heterocycle include, but are not limited to, 1,3- benzodioxol-4-yl, 1,3-benzodithiolyl, 3-azabicyclo[3.1.0]hexanyl, hexahydro-1H-furo[3,4- c]pyrrolyl, 2,3-dihydro-1,4-benzodioxinyl, 2,3-dihydro-1-benzofuranyl, 2,3-dihydro-1- benzothienyl, 2,3-dihydro-1H-indolyl, 5,6,7,8-tetrahydroimidazo[1,2-a]pyrazinyl, and 1,2,3,4- tetrahydroquinolinyl.
  • Spiro heterocycle means a 4-, 5-, 6-, 7-, or 8-membered monocyclic heterocycle ring wherein two of the substituents on the same carbon atom form a second ring having 3, 4, 5, 6, 7, or 8 members.
  • Examples of a spiro heterocycle include, but are not limited to, 1,4-dioxa-8-azaspiro[4.5]decanyl, 2-oxa-7-azaspiro[3.5]nonanyl, 2-oxa-6- azaspiro[3.3]heptanyl, and 8-azaspiro[4.5]decane.
  • the monocyclic heterocycle groups of the present invention may contain an alkylene bridge of 1, 2, or 3 carbon atoms, linking two nonadjacent atoms of the group.
  • Examples of such a bridged heterocycle include, but are not limited to, 2,5-diazabicyclo[2.2.1]heptanyl, 2-azabicyclo[2.2.1]heptanyl, 2- azabicyclo[2.2.2]octanyl, and oxabicyclo[2.2.1]heptanyl.
  • the monocyclic, fused bicyclic, and spiro heterocycle groups are connected to the parent molecular moiety through any substitutable carbon atom or any substitutable nitrogen atom contained within the group.
  • oxo refers to an oxygen atom bonded to the parent molecular moiety.
  • An oxo may be attached to a carbon atom or a sulfur atom by a double bond.
  • an oxo may be attached to a nitrogen atom by a single bond, i.e., an N-oxide.
  • C 1-4 alkyl is an alkyl group having from 1 to 4 carbon atoms, however arranged (i.e., straight chain or branched).
  • structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric ( or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Thus, included within the scope of the invention are tautomers of compounds of formula I. The structures also include zwitterioinc forms of the compounds or salts of formula I where appropriate. 2.
  • a first aspect of the invention provides compounds of formula (I), or a
  • G 1 , G 2 , and L 1 are as defined herein.
  • the embodiments below include all combinations of the variables G 1 , G 2 , and L 1 and their sub- variables (e.g., R 1 , R 2 , R 3 , etc.).
  • the compounds of formula (I) have formula (IA),
  • G 1 , G 2 , and L 1 are as defined herein.
  • G 1 is–NR 1 R 2 , a 4- to 12-membered heterocyclyl containing 1- 3 heteroatoms independently selected from N, O, and S, or a 5- to 12-membered heteroaryl containing 1-3 heteroatoms independently selected from N, O, and S, wherein the heterocyclyl and the heteroaryl are optionally substituted with 1-4 substituents independently selected from halo, C 1-4 alkyl, C 1-4 haloalkyl,–OH,–OC 1-4 alkyl, and oxo; and L 1 is–C 1-5 alkylene–or–C 1- 4alkylene–O–.
  • R 1 and R 2 are hydrogen. In some embodiments, R 1 and R 2 are C1-4alkyl. In some embodiments, one of R 1 and R 2 is hydrogen and the other is C1-4alkyl.
  • L 1 is–C1-5alkylene–, wherein the–C1-5alkylene– is optionally substituted with 1-2 halogens or one hydroxyl. In some embodiments, L 1 is–C 1-5 alkylene–. In some embodiments, L 1 is–C 2-4 alkylene–.
  • L 1 is–C 1-4 alkylene–O–, wherein the–C 1-4 alkylene–O– is optionally substituted with 1-2 halogens or one hydroxyl.
  • L 1 is–C 1- 4alkylene–O–.
  • L 1 is–C2-3alkylene–O–.
  • L 1 is–C1-4alkylene–O– or –C2-3alkylene–O–, the alkylene portion of the–C1-4alkylene–O– or–C2-3alkylene–O– is bonded to G 1 and the oxygen atom is bonded to the phenyl of formula (I) or (IA), e.g., .
  • L 1 is linked by ring fusion to the phenyl of formula (I) or (IA).
  • L 1 is–C 1-5 alkylene– or–C 1-4 alkylene–O–. In some embodiments, L 1 is–C2-4alkylene–or–C2-3alkylene–O–.
  • G 1 is–NR 1 R 2 ; a 4- to 8-membered monocyclic heterocyclyl containing a first nitrogen atom and optionally an additional heteroatom selected from N, O, and S, the heterocyclyl connecting to L 1 at the first nitrogen atom and optionally containing a C1- 3 alkylene bridge between two non-adjacent ring atoms and/or a double bond, the heterocyclyl being optionally substituted with 1-4 substituents independently selected from halo, C 1-4 alkyl, C 1-4 haloalkyl,–OH,–OC 1-4 alkyl, and oxo; or a 5- to 6-membered monocyclic heteroaryl containing 1-3 nitrogen atoms, the heteroaryl being optionally substituted with 1-4 substituents independently selected from halo, C1-4alkyl, C1-4haloalkyl,–OH, and–OC1-4alkyl; and L 1 is–C2- 4alkylene–or–C2-3
  • G 1 is–N(CH 3 ) 2 ,–N(CH 2 CH 3 ) 2 , pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, azepin-1-yl, pyrazol-1-yl, imidazol-1-yl, or triazol-1-yl.
  • G 2 has formula (i)
  • R 3 , R 4 , and R 5 are as defined herein.
  • G 2 has formula (
  • n2 are as defined herein.
  • G 2 has formula (i) and R 5 is C1-4alkyl.
  • R 4 may
  • R 4a and n1 are as defined herein.
  • halo cyano, C1-4alkyl, C1-4haloalkyl,–OH,–OC1-4alkyl,– OC1-4haloalkyl,–NH2,–NH(C1-4alkyl),–N(C1-4alkyl)(C1-4alkyl),–NHC(O)C1-4alkyl,–N(C1- 4alkyl)C(O)C1-4alkyl,–C(O)OC1-4alkyl,–C(O)NH2,–C(O)NH(C1-4alkyl), or–C(O)N(C1- 4alkyl)(C1-4alkyl), and optionally two R 4a , together with the atoms to which they are attached,
  • G 2 has formula (i)
  • R 3 is hydrogen
  • the compound of formula (I) or (IA) is not 4,4'-(4-ethyl-3-(4-(2-(piperidin-1-yl)ethoxy)phenyl)-1H-pyrazole-1,5-diyl)diphenol.
  • G 2 has formula (ii)
  • R 6 , R 7 , R 8 , n1, and n2 are as defined herein.
  • n1 and n2 are each independently 0, 1, 2, or 3.
  • G 2 has formula (ii)
  • R 7 is as defined herein.
  • G 2 has formula (iii)
  • R 9 , R 10 , R 11 , n1, and n2 are as defined herein.
  • n1 and n2 are each independently 0, 1, 2, or 3. In other embodiments, n1 and n2 are each independently 0 or 1.
  • R 9 and R 10 are independently halo, nitro, cyano, C 1-4 alkyl, C 1-4 haloalkyl,–OC 1-4 alkyl,–OC 1-4 haloalkyl,– NH 2 ,–NH(C 1-4 alkyl),–N(C 1-4 alkyl)(C 1-4 alkyl),–NHC(O)C 1-4 alkyl,–N(C 1-4 alkyl)C(O)C 1-4 alkyl, –NHC(O)OC 1-4 alkyl,–N(C 1-4 alkyl)C(O)OC 1-4 alkyl,–C(O)OC 1-4 alkyl,–C(O)OH,–C(O)NH 2 ,– C(O)NH(C1-4alkyl), or–C(O)N(C1-4alkyl)(C1-4alkyl), and optionally two R 9 or R 10 , at each occurrence, are independently halo, nitro, cyano, C 1-4 alkyl
  • R 9 and R 10 are independently halo, C 1-4 alkyl,–OH, or–OC 1-4 alkyl.
  • R 9 at each occurrence, is independently halo, C 1-4 alkyl, or–OC 1-4 alkyl; and R 10 , at each occurrence, is independently halo, C1-4alkyl,–OH, or–OC1-4alkyl.
  • R 9 and R 10 at each occurrence, are independently halo, C1-4alkyl, or–OC1-4alkyl.
  • G 2 has formula (iii)
  • G 2 has formula (iiia)
  • n1 and n2 are each independently 0 or 1, and R 9 , R 10 , and R 11 are as defined herein.
  • n1 or n2 being 0 refers to compounds wherein the R 9 or R 10 substituent, respectively, is replaced by hydrogen.
  • G 2 has formula (iv)
  • R 12 , R 13 , R 14 , n1, and n2 are as defined herein.
  • n1 and n2 are each independently 0, 1, 2, or 3. In other embodiments, n1 and n2 are each independently 0 or 1.
  • R 12 and R 14 at each occurrence, are independently halo, nitro, cyano, C 1-4 alkyl, C 1-4 haloalkyl,–OC 1-4 alkyl,–OC 1-4 haloalkyl,– NH2,–NH(C1-4alkyl),–N(C1-4alkyl)(C1-4alkyl),–NHC(O)C1-4alkyl,–N(C1-4alkyl)C(O)C1-4alkyl, –NHC(O)OC1-4alkyl,–N(C1-4alkyl)C(O)OC1-4alkyl,–C(O)OC1-4alkyl,–C(O)OH,–C(O)NH2,– C(O)NH(
  • R 12 and R 14 are independently halo,–OH, or–OC1-4alkyl. In still other embodiments, R 12 and R 14 , at each occurrence, are independently halo or–OC 1-4 alkyl.
  • the compound of formula (I) or (IA) is not 1-(2-(4-(4-ethyl-3,5-bis(4-methoxyphenyl)-1H-pyrazol-1- yl)phenoxy)ethyl)piperidine, or a salt thereof.
  • G 2 has formula (iva)
  • n1 and n2 are each independently 0 or 1; and R 12 , R 13 , and R 14 are as defined herein.
  • n1 or n2 being 0 refers to compounds wherein the R 12 or R 14 substituent, respectively, is replaced by hydrogen.
  • n1, n2, and n3 are each independently 0, 1, 2, or 3.
  • n1, n2, and n3 are each independently 0 or 1.
  • R 4a , R 4b , R 4c , R 5a , R 6 , R 8 , R 9 , R 10 , R 12 , R 14 , R 15 , R 16 , R 18 , R 20 , R 22 , R 23 , R 24 , R 25 , R 26 , R 28 , R 30 , and R 32 at each occurrence, may be independently halo, cyano, C1-4alkyl,–OH, or–OC1-4alkyl.
  • G 2 has formula (v)
  • R 15 , R 16 , R 17 , n1, and n2 are as defined herein.
  • G 2 has formula (va)
  • n1 and n2 are each independently 0 or 1; and R 15 , R 16 , and R 17 are as defined herein.
  • n1 or n2 being 0 refers to compounds wherein the R 15 or R 16 substituent, respectively, is replaced by hydrogen.
  • G 2 has formula (vi)
  • R 18 , R 19 , R 20 , n1, and n2 are as defined herein.
  • G 2 has formula (vi)
  • n1 and n2 are each independently 0 or 1; and R 18 , R 19 , and R 20 are as defined herein.
  • n1 or n2 being 0 refers to compounds wherein the R 18 or R 20 substituent, respectively, is replaced by hydrogen.
  • G 2 has formula (vii)
  • R 21 , R 22 , R 23 , n1, and n2 are as defined herein.
  • G 2 has formula (viia)
  • n1 and n2 are each independently 0 or 1; and R 21 , R 22 , and R 23 are as defined herein.
  • n1 or n2 being 0 refers to compounds wherein the R 22 or R 23 substituent, respectively, is replaced by hydrogen.
  • G 2 has formula (viia)
  • R 22 is halo, cyano, C1-4alkyl, or–OC1-4alkyl
  • R 23 is halo, cyano, C1-4alkyl,–OH, or–OC1-4alkyl
  • n1 and n2 are each 1.
  • G 2 has formula (viia)
  • R 22 is halo, cyano, C 1-4 alkyl,–OH, or–OC 1-4 alkyl
  • R 23 is halo, cyano, C 1-4 alkyl, or–OC 1-4 alkyl
  • n1 and n2 are each 1.
  • G 2 has formula (viia)
  • R 22 is halo, cyano, C1-4alkyl, or–OC1-4alkyl
  • R 23 is halo, cyano, C1-4alkyl, or–OC1-4alkyl
  • n1 and n2 are each 1.
  • G 2 has formula (viii)
  • X 1 , R 24 , R 25 , n1, and n2 are as defined herein.
  • G 2 has formula (viiia)
  • n1 and n2 are each independently 0 or 1; and X 1 , R 24 , and R 25 are as defined herein.
  • n1 or n2 being 0 refers to compounds wherein the R 24 or R 25 substituent, respectively, is replaced by hydrogen.
  • G 2 has formula (ix)
  • R 26 , R 27 , and n1 are as defined herein.
  • G 2 has formula (ixa)
  • n1 is 0 or 1; and R 26 and R 27 are as defined herein.
  • n1 being 0 refers to compounds wherein the R 26 substituent is replaced by hydrogen.
  • G 2 has formula (x)
  • R 28 , R 29 , and n1 are as defined herein.
  • G 2 has formula (xiii)
  • R 32 , R 33 , and n3 are as defined herein.
  • G 2 has formula (xa) or (xiiia)
  • n1 and n3 are each independently 0 or 1; and R 28 , R 29 , R 32 , and R 33 are as defined herein.
  • n1 or n3 being 0 refers to compounds wherein the R 28 or R 32 substituent, respectively, is replaced by hydrogen.
  • G 2 has formula (xi)
  • R 30 and n1 are as defined herein.
  • G 2 has formula (xia)
  • n1 is 0 or 1; and R 30 is as defined herein.
  • n1 being 0 refers to compounds wherein the R 30 substituent is replaced by hydrogen.
  • G 2 has formula (xii)
  • R 31 is as defined herein.
  • the compound of formula (I) or (IA) is selected from
  • the compounds include isotope-labelled forms.
  • An isotope- labelled form of a compound is identical to the compound apart from the fact that one or more atoms of the compound have been replaced by an atom or atoms having an atomic mass or mass number which differs from the atomic mass or mass number of the atom which usually occurs in greater natural abundance.
  • isotopes which are readily commercially available and which can be incorporated into a compound by well-known methods include isotopes of hydrogen, carbon, nitrogen, oxygen, fluorine and chlorine, for example 2 H, 3 H, 13 C, 14 C, 15 N, 18 O, 17 O, 18 F and 36 Cl. 3.
  • Diseases or conditions that may be treated with compounds and/or compositions of the invention include sepsis (e.g., bacterial sepsis), autoimmune disease, lupus erythematosus, ischemia-reperfusion injury, stroke, metabolic disease, obesity-related metabolic inflammation, gout, and cancer.
  • sepsis e.g., bacterial sepsis
  • autoimmune disease e.g., lupus erythematosus
  • ischemia-reperfusion injury e.g., stroke, metabolic disease, obesity-related metabolic inflammation, gout, and cancer.
  • compounds/compositions of the invention include periodontal disease, mucositis, acne, cardiovascular disease, chronic obstructive pulmonary disease, arthritis, cystic fibrosis, bacterial- induced infections, viral-induced infections, mycoplasma-associated diseases, post herpetic neuralgia, asthma, brain injury, necrotizing enterocolitis, bed sores, leprosy, atopic dermatitis, psoriasis, trauma, neurodegenerative disease, amphotericin B-induced fever and nephritis, coronary artery bypass grafting, and atherosclerosis.
  • an immune response refers to a response to an appropriate stimulus by a cell of the immune system, a population of cells of the immune system, or by an immune system.
  • An immune system as used herein refers to an immune system of a subject (e.g., a mammal), specifically including but not limited to an immune system of a human.
  • a cell of an immune system can be any cell that is classified as an immune cell. Such cells include B cells, T cells, natural killer (NK) cells, mast cells, basophils, granulocytes, monocytes, macrophages, bone marrow-derived dendritic cells, and other professional antigen- presenting cells, as well as subcategories and precursors thereof.
  • a cell of the immune system can be an isolated cell of the immune system.
  • a population of cells of the immune system refers to at least two cells, and more typically at least one thousand cells, of the immune system.
  • a population of cells of the immune system can be an isolated population of cells of the immune system.
  • a population of cells of the immune system is an isolated population of PBMC.
  • the method involves contacting a population of immune cells expressing a TLR selected from TLR2, TLR4, TLR7, TLR8, and TLR9, with a compound or composition of the invention.
  • Immune cells expressing TLR 7 can include B cells and dendritic cells, and immune cells expressing TLR8 can include myeloid cells.
  • Immune cells expressing TLR9 can include B cells and pDC.
  • the method involves measuring a reduced immune response compared to a control immune response.
  • a control immune response is an immune response that occurs in the absence of contacting an immune cell, or a population of immune cells, with a compound or composition of the invention.
  • conditions are generally selected such that the number or concentration of TLR-expressing cells, the amount or concentration of the TLR agonist, temperature, and other such variables are identical or at least comparable between treatment and control measurements, so as to isolate the effect of the composition of the invention.
  • Treatment and control measurements can be made in parallel or they can be made independently.
  • the control is a historical control. In one embodiment the control is a concurrent, parallel control.
  • the method relates to a method for reducing an immune response in a subject.
  • a subject refers to a mammal.
  • the subject is a human.
  • the subject is a nonhuman primate.
  • the subject is a mammal other than a primate, including but not limited to a mouse, rat, hamster, guinea pig, rabbit, cat, dog, goat, sheep, pig, horse, or cow.
  • the immune response is an immune response to an antigen.
  • Antigenic substances include, without limitation, peptides, proteins, carbohydrates, lipids, phospholipids, nucleic acids, autacoids, and hormones.
  • Antigens specifically include allergens, autoantigens (i.e., self-antigens), cancer antigens, and microbial antigens.
  • antigens further include both antigens per se and nucleic acids encoding said antigens.
  • An allergen is a substance that can induce an allergic or asthmatic response in a susceptible subject. Allergens include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g., penicillin).
  • Autoantigens include any antigen of host origin, but they specifically include antigens characteristic of an autoimmune disease or condition. Autoantigens characteristic of an autoimmune disease or condition can be associated with, but not necessarily established as causative of, an autoimmune disorder. Specific examples of autoantigens characteristic of an autoimmune disease or condition include but are not limited to insulin, thyroglobulin, glomerular basement membrane, acetylcholine receptor, DNA, and myelin basic protein.
  • a cancer antigen as used herein is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen-presenting cell in the context of a major histocompatibility complex (MHC) molecule.
  • Cancer antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen PA et al. (1994) Cancer Res 54:1055-8, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens.
  • Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion thereof, or a whole tumor or cancer cell. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
  • a microbial antigen can be an antigen that is or is derived from an infectious microbial agent, including a bacterium, a virus, a fungus, or a parasite.
  • an autoimmune condition refers to an autoimmune disease or disorder, i.e., an immunologically mediated acute or chronic process, directed by immune cells of a host subject against a tissue or organ of the host subject, resulting in injury to the tissue or organ.
  • the term encompasses both cellular and antibody-mediated autoimmune phenomena, as well as organ-specific and organ-nonspecific autoimmunity.
  • Autoimmune conditions specifically include insulin-dependent diabetes mellitus, rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis, atherosclerosis, and inflammatory bowel disease.
  • Inflammatory bowel disease includes Crohn's disease and ulcerative colitis.
  • Autoimmune diseases also include, without limitation, ankylosing spondylitis, autoimmune chronic active hepatitis, autoimmune encephalomyelitis, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, autoimmune-associated infertility, Behçet' s syndrome, bullous pemphigoid, Churg-Strauss disease, glomerulonephritis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic Addison's disease, idiopathic thrombocytopenia, insulin resistance, mixed connective tissue disease, myasthenia gravis, pemphigus, pernicious anemia, polyarteritis nodosa,
  • the method of treatment of an autoimmune condition in a subject specifically includes treatment of a human subject.
  • the autoimmune condition is systemic lupus erythematosus.
  • the autoimmune condition is rheumatoid arthritis.
  • the method of treatment of an autoimmune condition in a subject optionally can further include administration of another treatment agent or treatment modality useful in the treatment of the autoimmune condition.
  • the method can include administration of a compound or composition of the invention, either alone or in combination with an agent such as a
  • corticosteroid e.g., prednisone
  • cytokine e.g., IFN- ⁇
  • immunomodulatory agent e.g., prednisone
  • cytokine e.g., IFN- ⁇
  • autoimmune diseases also include certain immune complex-associated diseases.
  • the term "immune complex-associated disease” as used herein refers to any disease characterized by the production and/or tissue deposition of immune complexes, including, but not limited to systemic lupus erythematosus (SLE) and related connective tissue diseases, rheumatoid arthritis, hepatitis C- and hepatitis B-related immune complex disease (e.g., cryoglobulinemia), Behçet's syndrome, autoimmune
  • SLE systemic lupus erythematosus
  • connective tissue diseases e.g., rheumatoid arthritis
  • hepatitis C- and hepatitis B-related immune complex disease e.g., cryoglobulinemia
  • Behçet's syndrome autoimmune erythematosus
  • Non-limiting examples of neurodegenerative disorders include adrenal
  • leukodystrophy leukodystrophy, aging-related disorders and dementias, alcoholism, Alexander's disease, Alper's disease, Alzheimer's disease, amyotrophic lateral sclerosis (Lou Gehrig's Disease), ataxia telangiectasia, Batten disease (also known as Spielmeyer-Vogt-Sjögren-Batten disease), bovine spongiform encephalopathy (BSE), canavan disease, cerebral palsy, Cockayne syndrome, corticobasal degeneration (CBD), Creutzfeldt-Jakob disease, familial fatal insomnia, frontotemporal lobar degeneration, frontal temporal dementias (FTDs), Huntington's disease, HIV-associated dementia, Kennedy's disease, Krabbe's disease, Lewy body disease,
  • neuroborreliosis Machado-Joseph disease (spinocerebellar ataxia type 3), multiple system atrophy, multiple sclerosis, narcolepsy, Niemann Pick disease, Parkinson disease, Pelizaeus- Merzbacher disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy (PSP), psychotic disorders, Refsum's disease, Sandhoff disease, Schilder's disease, schizoaffective disorder, schizophrenia, stroke, subacute combined degeneration of spinal cord secondary to pernicious anemia, spinocerebellar ataxia, spinal muscular atrophy, Steele- Richardson-Olszewski disease, Tabes dorsalis, and toxic encephalopathy.
  • PPP progressive supranuclear palsy
  • the inflammatory disorder may be arthritis including, but not limited to, rheumatoid arthritis, spondyloarthropathies, gouty arthritis, osteoarthritis, systemic lupus erythematosus, or juvenile arthritis.
  • the inflammation may be associated with asthma, allergic rhinitis, sinus diseases, bronchitis, tuberculosis, acute pancreatitis, sepsis, infectious diseases, menstrual cramps, premature labor, tendinitis, bursitis, skin-related conditions such as psoriasis, eczema, atopic dermatitis, urticaria, dermatitis, contact dermatitis, and burns, or from post-operative inflammation including from ophthalmic surgery such as cataract surgery and refractive surgery.
  • the inflammatory disorder may be a gastrointestinal condition such as inflammatory bowel disease, Crohn's disease, gastritis, irritable bowel syndrome, chronic cholecystitis, or ulcerative colitis.
  • the inflammatory disorder may be a gastrointestinal condition such as inflammatory bowel disease, Crohn's disease, gastritis, irritable bowel syndrome, chronic cholecystitis, or ulcerative colitis.
  • the inflammatory disorder may be a gastrointestinal condition such as inflammatory bowel disease, Crohn's disease, gastritis, irritable bowel syndrome, chronic cholecystitis, or ulcerative colitis.
  • inflammation may be associated with diseases such as vascular diseases, migraine headaches, periarteritis nodosa, thyroiditis, aplastic anemia, Hodgkin's disease, sclerodoma, rheumatic fever, type I diabetes, neuromuscular junction disease including myasthenia gravis, white matter disease including multiple sclerosis, sarcoidosis, nephrotic syndrome, Behçet's syndrome, polymyositis, gingivitis, nephritis, hypersensitivity, swelling occurring after injury, myocardial ischemic, allergic rhinitis, respiratory distress syndrome, systemic inflammatory response syndrome (SIRS), cancer-associated inflammation, reduction of tumor-associated angiogenesis, endotoxin shock syndrome, atherosclerosis, and the like.
  • diseases such as vascular diseases, migraine headaches, periarteritis nodosa, thyroiditis, aplastic anemia, Hodgkin's disease, sclerodoma, rhe
  • the inflammatory disorder may be associated with an ophthalmic disease, such as retinitis, retinopathies, uveitis, ocular photophobia, or of acute injury to the eye tissue.
  • the inflammation may be a pulmonary inflammation, such as that associated with viral infections or cystic fibrosis, chronic obstructive pulmonary disease, or acute respiratory distress syndrome.
  • the inflammatory disorder may also be associated with tissue rejection, graft v. host diseases, delayed-type hypersensitivity, as well as immune-mediated and inflammatory elements of CNS diseases such as Alzheimer's, Parkinson's, multiple sclerosis and the like. 4.
  • compositions comprising any of the compounds as described herein, and optionally comprise a pharmaceutically acceptable carrier, adjuvant or vehicle. In certain embodiments, these compositions optionally further comprise one or more additional therapeutic agents.
  • the pharmaceutical composition comprises a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers or vehicles.
  • compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • the term "pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
  • Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describe pharmaceutically acceptable salts in detail in J Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference.
  • Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases.
  • suitable inorganic and organic acids and bases include those derived from suitable inorganic and organic acids and bases.
  • pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate,
  • benzenesulfonate benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate,
  • Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N(C 1-4 alkyl) 4 salts. This invention also envisions the quaternization of any basic nitrogen-containing groups of the compounds disclosed herein. Water or oil-soluble or dispersable products may be obtained by such quaternization.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and aryl (e.g., phenyl/substituted phenyl) sulfonate.
  • counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and aryl (e.g., phenyl/substituted phenyl) sulfonate.
  • the pharmaceutically acceptable compositions of the invention additionally comprise a pharmaceutically acceptable carrier, adjuvant, or vehicle, which, as used herein, includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • a pharmaceutically acceptable carrier, adjuvant, or vehicle which, as used herein, includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • Remington's Pharmaceutical Sciences, Sixteenth Edition, E.W. Martin (Mack Publishing Co., Easton, Pa., 1980) discloses various carriers used in formulating pharmaceutically acceptable compositions and
  • any conventional carrier medium is incompatible with the compounds of the invention, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutically acceptable composition, its use is contemplated to be within the scope of this invention.
  • pharmaceutically acceptable carriers include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, or potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, polyacrylates, waxes,
  • polyethylenepolyoxypropylene-block polymers wool fat, sugars such as lactose, glucose and sucrose; starches such as com starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; com oil and soybean oil; glycols; such a propylene glycol or polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen- free water; isotonic saline; Ringer's solution; ethyl alcohol, and phosphate buffer solutions, as well as other non-toxic compatible lubric
  • compositions of this invention can be administered to humans and other animals orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, or drops), bucally, as an oral or nasal spray, or the like, depending on the severity of the disease being treated.
  • compositions for parenteral injection comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
  • suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), vegetable oils (such as olive oil), injectable organic esters (such as ethyl oleate) and suitable mixtures thereof.
  • Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable
  • composition can be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.
  • the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • the oral compositions can also include
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, cement, putty, and granules.
  • the active compound can be mixed with at least one inert, pharmaceutically acceptable excipient or carrier, such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol and silicic acid; b) binders such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; c) humectants such as glycerol; d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate; e) solution retarding agents such as paraffin; f) absorption accelerators such as quaternary ammonium compounds; g) wetting agents such as cetyl alcohol and g
  • Solid compositions of a similar type may also be employed as fillers in soft and hardfilled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
  • the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
  • the active compounds can also be in microencapsulated form with one or more excipients as noted above.
  • the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art.
  • the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch.
  • Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose.
  • the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner.
  • embedding compositions examples include polymeric substances and waxes.
  • compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds of this invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.
  • suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.
  • Dosage forms for topical or trans dermal administration of a compound of this invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches.
  • the active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required.
  • Ophthalmic formulation, eardrops, and eye drops are also contemplated as being within the scope of this invention.
  • the invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body.
  • Such dosage forms are prepared by dissolving or dispensing the compound in the proper medium.
  • Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
  • Compounds described herein can be administered as a pharmaceutical composition comprising the compounds of interest in combination with one or more pharmaceutically acceptable carriers.
  • the phrase "therapeutically effective amount" of the present compounds means sufficient amounts of the compounds to treat disorders, at a reasonable benefit/risk ratio applicable to any medical treatment. It is understood, however, that the total daily dosage of the compounds and compositions can be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular patient can depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed; the age, body weight, general health and prior medical history, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well-known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
  • Actual dosage levels of active ingredients in the pharmaceutical compositions can be varied so as to obtain an amount of the active compound(s) that is effective to achieve the desired therapeutic response for a particular patient and a particular mode of administration.
  • repeated or chronic administration of compounds can be required to achieve the desired therapeutic response.
  • “Repeated or chronic administration” refers to the administration of compounds daily (i.e., every day) or intermittently (i.e., not every day) over a period of days, weeks, months, or longer.
  • Combination therapy includes administration of a single pharmaceutical dosage formulation containing one or more of the compounds described herein and one or more additional pharmaceutical agents, as well as administration of the compounds and each additional pharmaceutical agent, in its own separate pharmaceutical dosage formulation.
  • a compound described herein and one or more additional pharmaceutical agents can be administered to the patient together, in a single oral dosage composition having a fixed ratio of each active ingredient, such as a tablet or capsule; or each agent can be administered in separate oral dosage formulations.
  • the present compounds and one or more additional pharmaceutical agents can be administered at essentially the same time (e.g., concurrently) or at separately staggered times (e.g., sequentially).
  • the doses are generally from about 0.01 to about 100 mg/kg, desirably about 0.1 to about 1 mg/kg body weight per day by inhalation, from about 0.01 to about 100 mg/kg, desirably 0.1 to 70 mg/kg, more desirably 0.5 to 10 mg/kg body weight per day by oral administration, and from about 0.01 to about 50 mg/kg, desirably 0.1 to 1 mg/kg body weight per day by intravenous administration.
  • kits comprising the compound, or a pharmaceutically acceptable salt, a pharmaceutical composition, or both; and information, instructions, or both that use of the kit will provide treatment for medical conditions in mammals (particularly humans).
  • the information and instructions may be in the form of words, pictures, or both, and the like.
  • the kit may include the medicament, a composition, or both; and information, instructions, or both, regarding methods of application of medicament, or of composition, preferably with the benefit of treating or preventing medical conditions in mammals (e.g., humans). 5.
  • BMIM-PF 6 1-butyl-3-methylimidazolium hexafluorophosphate
  • TBAB tetrabutyl ammonium bromide
  • STEP 1 To a solution of p-hydroxyacetophenone (7.34 mmol) and the appropriate benzaldehyde (8.81 mmol) in methanol (70 mL), KOH (29.38 mmol) and catalytic
  • TBAB tetrabutylammonium bromide
  • STEP 3 & 4 A mixture of substituted chalcone (0.55 mmol) and appropriate phenylhydrazine hydrochloride (0.82 mmol) in 5 mL of dimethylformamide are heated under a N 2 atmosphere at 85 °C for 4-10 hours. The reaction solution is concentrated under vacuum and partitioned between ethyl acetate and water twice. The organic layers are combined, washed with brine, dried (Na2SO4) and concentrated under vacuum. The residue is then subjected to oxidation using MnO2 (7.15 mmol) in benzene (15 mL) under reflux for 5-10 hours.
  • the cool solution is acidified to a pH ⁇ 2 with 12N HCl. If a precipitate forms, it is collected by vacuum filtration, and for those that do not have a lot of precipitate form, the organic product is extracted with 3x20 mL of diethyl ether, washed with 2x20 mL H 2 O, 1x20 mL brine, dried with magnesium sulfate, and concentrated.
  • the reaction mixture was irradiated for 10 second intervals for about 5-7 minutes with cooling of the mixture in between.
  • the progress of the reaction was monitored by thin-layer chromatography. Following the completion of the reaction, it was then cooled to room temperature added onto 30 mL of ice-cold deionized water.
  • the cool solution was acidified to a pH ⁇ 2 with 12N HCl. A precipitate formed, and it was collected by vacuum filtration.
  • the organic product is extracted using 3x10 mL diethyl ether. Then the phenol compound is extracted into an aqueous layer using 2x10 mL of 2M NaOH. The pH of this aqueous layer containing the phenol compound is adjusted to around 2 using 12N HCl, which is added dropwise. From this solution, the organic product is extracted using 2x10 mL of diethyl ether, washed with brine and dried with magnesium sulfate.
  • the organic product is extracted with 3x10 mL of diethyl ether, washed with 1x5 mL 10%NaOH, 3x10 mL H 2 O, 1x10 mL brine, dried with magnesium sulfate, and concentrated.
  • 3b 4-(3-(naphthalen-2-yl)isoxazol-5-yl)phenol.
  • TSI-14-16 was prepared using procedures analogous to those used to prepare the thiazole TSI-14-17, except in place of 4-hydroxy thiobenzamide , 4-hydroxy benzamide was used to obtain the product in 70 % yield.
  • 4-hydroxy benzamide was used to obtain the product in 70 % yield.
  • TSI-14- 16 4,5-bis(4-methoxyphenyl)-2-(4-(2-(piperidin-1-yl)ethoxy)phenyl)oxazole
  • TLR-mediated cell activation can be mimicked by chemically induced dimerization of the TLR signaling proteins MyD88 and TRAF6 (Hacker et al., Nature 439, 204-207 (2006); Zhou et al., Proceedings of the National Academy of Sciences of the United States of America 108, E998-1006 (2011)).
  • MyD88 and TRAF6 were fused to the protein Gyrase B (GyrB), which inducibly dimerizes upon exposure to the bivalent antibiotic coumermycin (CM) (Farrar et al., Nature 383, 178-181 (1996)).
  • TIRAP acts upstream of MyD88, providing a molecular bridge that transduces activation (oligomerization) of TLR2 and TLR4 to MyD88 (Yamamoto et al., Nature 420, 324-329 (2002); Fitzgerald et al., Nature 413, 78-83 (2001); Horng et al., Nature 420, 329-333 (2002)).
  • GyrB-TIRAP fusion proteins showed robust CM-inducible activity when expressed in HEK293T cells, similar to fusion proteins of GyrB and MyD88/ TRAF6 (Fig.1B).
  • MyD88 was deleted in GyrB-TIRAP cells by sgRNA-/ CAS9-mediated deletion, which resulted in complete loss of TIRAP-mediated NF-kB activation (Fig.1C,D).
  • Fig.1C,D Consistent with the essential, yet selective function of MyD88 in the TLR/IL-1R pathway, IL-1 ⁇ -mediated NF-kB activity was also abolished, while TNF ⁇ was not affected (Fig. 1D).
  • GyrB-TIRAP can be used to activate the TLR-pathway upstream of MyD88, recapitulating TLR2- and TLR4-mediated signal transduction.
  • HTS high throughput screening
  • the three inducible cell lines (TIRAP-GyrB, MyD88-GyrB, TRAF6-GyrB) were systematically optimized for large- scale high throughput screening (HTS), first based on manual experiments by 96-well (bench- top) format, followed by 384-well format on HTS robots.
  • PS1145 As pathway-specific reference compound PS1145 was used, a selective inhibitor of the IkB ⁇ -kinase complex (IKK), which is required for NF-kB activation downstream of TRAF6. As non-specific reference compound staurosporine was used, a kinase inhibitor with largely non-selective toxicity. PS1145 and staurosporine concentrations were titrated to establish PS1145 at 30 mM and Staurosporine at 40 mM, which resulted in 100% specific and non-specific pathway inhibition in the presence of 100 nM CM, respectively. Assay validation, including analysis of within-plate and between-plate variation, was performed on the HTS platform, resulting consistently in Z’-factors of > 0.5, demonstrating the robustness of this phenotypic screening platform (Fig.1E).
  • TIRAP-GyrB cells are used first to identify compounds with NF-kB-specific inhibitory activity 350% and non-specific activity (toxicity) £20% (primary screen, all compounds at 12 mM, Fig.2A). Identified hits are moved forward to dose-response experiments based on all three cell lines (secondary screen). Results from these cell lines are interpreted primarily based on selectivity, identifying compounds with preferential activity against individual adaptor proteins. Compounds that inhibit TRAF6 are eliminated as TLR-‘non-specific’.
  • TIRAP-GyrB, MyD88-GyrB and TRAF6-GyrB cell lines were maintained in growth medium containing Phenol red (DMEM (Invitrogen), supplemented with 10% (v/v) FCS (Hyclone), 50 mM 2-mercaptoethanol, antibiotics (penicillin G (100 IU/mL) and streptomycin sulfate (100 IU/mL)) and pyruvate (1 mM)), which was replaced by growth medium without Phenol red during HTS assays.
  • DMEM Invitrogen
  • FCS Hyclone
  • antibiotics penicillin G (100 IU/mL) and streptomycin sulfate (100 IU/mL)
  • pyruvate 1 mM
  • TIRAP-GyrB cells 10,000 cells in 25 mL assay medium
  • TIRAP-GyrB cells were seeded in white 384-well solid bottom tissue culture-treated plates (PerkinElmer) with a WellMate dispenser (Thermo Scientific Matrix) and plates were incubated in an automated tissue culture incubator (Liconic Instruments). After 24 hour incubation, DMSO stock solutions of test chemicals (the St.
  • each plate was treated with 5 mL/well DPBS (Fisher Scientific) diluted (1-to-12 dilution) AlamarBlue (Invitrogen). After brief centrifugation, the plate was incubated at 37 °C for 1 hour and cooled down at room temperature for 15 minutes before the fluorescence signal from each well was determined with an Envision HTS microplate reader (PerkinElmer, Waltham, MA) with excitation wavelength of 492 nm and emission wavelength of 590 nm. Next, SteadyLite HTS luminescence assay reagent (25 mL/well, PerkinElmer) was dispensed into each well followed by 20 minute room temperature incubation. The luminescence signals for individual wells were then measured with the Envision plate reader. In the
  • AlamarBlue cell toxicity assay the 40 mM staurosporine with 100 nM coumermycin A1 group and the 100 nM coumermycin A1 alone group were assigned as the positive (100% inhibition) and negative (0% inhibition) controls, respectively.
  • the 30 mM PS- 1145 with 100 nM coumermycin A1 group and the 100 nM coumermycin A1 alone group were assigned as the corresponding positive (100% inhibition) and negative (0% inhibition) controls.
  • Test compound activity was normalized to those of positive and negative controls in the individual assays.213 unique chemicals with luminescence inhibitory activity 3 50% as well as with AlamarBlue cytotoxic inhibitory activity £ 20% were selected for further dose response confirmation testing.
  • the controls and data normalized for the AlamarBlue and luminescence assays in the MyD88-GyrB- and TRAF6- GyrB cell-based tests were the same as the TIRAP-GyrB cell-based test.
  • the activity data for individual chemicals were fit into sigmoidal dose-response curves if applicable to derive IC 50 values with GraphPad Prism 7.00 (GraphPad Software).
  • ⁇ + is the standard deviation of the negative control group (negative control groups in the luciferase reporter assay and AlamarBlue cytotoxicity assay for each cell line as defined above)
  • ⁇ - is the standard deviation of the positive control group (positive control groups in the luciferase reporter assay and AlamarBlue cytotoxicity assay for each cell line as defined above)
  • Mean + is the mean of the negative control group
  • Mean- is the mean of the positive control group.
  • Bioactive compound library screening for TLR-inhibitory compounds A total of 4364 unique compounds were contained in the bioactive compound library used (a total of 8,904 compounds including replicates), which was acquired from various sources and included 913 FDA (US Food and Drug Administration)-approved drugs or clinical candidates. Based on activity at 12 mM concentration, 213 unique hits were identified that inhibited TIRAP-mediated NF-kB activity more than 50% (with cytotoxicity £ 20%). These 213 hits were further analyzed in a dose-response experiment (2.8 nM– 56 mM) using all three cell lines. Only 8 compounds exhibited preferential activity against TIRAP or TIRAP/MyD88 over TRAF6 (ratio IC50 > 5- fold).
  • MPP inhibited TIRAP- and MyD88-mediated NF-kB activity comparably at low mM concentrations, suggesting general (‘Pan’)-TLR-inhibitory activity (Fig.2B). Consistent with this interpretation, MPP interfered with TNF ⁇ release from primary macrophages that were stimulated with CpG-DNA (TLR9), Resiquimod (R848; TLR7), Pam3Cys (TLR2) or LPS (TLR4)(Fig.2C). In contrast, MPP did not significantly reduce TNF ⁇ release induced by Curdlan. As such, MPP interferes selectively with TLR-induced cell activation, specifically at the TLR-restricted signaling level‘between’ MyD88 and TRAF6.
  • TLR signaling is diversified at the level of TRAF6 towards various well-defined pathways, including the NF-kB and mitogen-activated protein kinase (MAPK) pathways (Fig.1A).
  • MPP mitogen-activated protein kinase
  • MPP was developed as ER ⁇ inhibitor, we tested whether this activity was related to its TLR-inhibitory activity using macrophages derived from ER ⁇ -deficient mice. As shown in Fig.2E and F, MPP inhibited TLR9-induced TNF ⁇ release and activation of signaling pathways comparably in both wildtype and ER ⁇ -deficient bone marrow-derived macrophages (BMM), strongly suggesting TLR- and ER ⁇ inhibition are independent events.
  • BMM bone marrow-derived macrophages
  • MPP interference with dimerization of the MyD88 TIR domain involves the step-wise assembly of the MyD88-marshalled signaling complex composed of members of the IRAK family, TRAF6 and other, at least partially characterized signaling proteins (Fig.1A).
  • Fig.1A signaling proteins
  • the currently favored model of MyD88 activation involves TLR-induced, TIR- domain-mediated dimerization of MyD88 as the first step of signal induction, followed by a spiral assembly of further MyD88 molecules (Lin et al., Nature 465, 885-890 (2010)). Assembly of this higher-order complex, which at least in part involves homotypic death domain
  • MPP While both domains co-purified with full length MyD88, as expected, MPP strongly reduced co-IP of the TIR-domain, but not the DD-domain (Fig.3D). Together, these data suggest that MPP inhibits directly homotypic TIR-domain interaction of MyD88, thereby preventing assembly of a higher order MyD88 complex, which is required for consecutive recruitment and activation of IRAK4.
  • cellular thermal shift assays CETSA
  • TSI-13-57 was employed, which exhibited similar activity in the low micromolar range, but reduced toxicity in comparison to MPP.
  • TIR-specific activity of MPP analogs as molecular basis for TLR-selective inhibitory activity.
  • MyD88 MyD88
  • TIR TLR9
  • TIR TIR- MyD88
  • TIRAP TIRAP - MyD88
  • TSI-13-57 Two of the compounds with characteristic phenotypes were chosen for more detailed analysis, (i) the MPP-like TSI-13-57, which showed Pan-TLR inhibitory activity accompanied by stabilization of MyD88 in CETSA (Fig.3E-H) and (ii) TSI-13-48, which displayed TLR9-selective activity (Fig. 4A). Consistent with previous data, TSI-13-57 inhibited homodimerization of the TIR-domain of MyD88, but showed little activity against interaction between TLR9 and MyD88, and no activity against interaction between TIRAP and MyD88 (Fig.4B).
  • TSI-13-48 did not show measurable activity against homodimerization of MyD88 TIR (or interaction between TIRAP and MyD88), but inhibited interaction between TLR9 (TIR) and MyD88 (Fig.4B).
  • the IC 50 values obtained in this M2H system matched closely those obtained during physiological TLR activation of macrophages, both with respect to inhibition of MyD88- dimerization by TSI-13-57 and inhibition of TLR9 (TIR) - MyD88 interaction by TSI-13-48 (Fig.4A, B).
  • modifications of the MPP scaffold can be used to generate selectivity against different TLRs, which is most likely explained by the property of the compounds to block specific, yet different TIR-domain interactions.
  • CpG-DNA refers to the phosphothioate backbone containing oligonucleotide 1668 (TCCATGACGTTCCTGATGCT) (TIB Molbiol).
  • Other agonists used were LPS (Escherichia coli 0127:B8) (Sigma-Aldrich), coumermycin A1 (Sigma- Aldrich), R848 (GLSynthesis), tripalmitoyl cysteinyl lipopeptide (Pam3Cys) (EMC
  • Antibodies were sourced as follows: anti-FLAG (M2 [soluble and bead immobilized] and anti- ⁇ ACTIN were from Sigma-Aldrich, anti-MyD88, anti-IkB ⁇ , anti-P-p38, anti-P-JNK, anti-P-ERK, anti-p38 and anti-Myc-Tag were from Cell Signaling Technology, anti-HA was from Roche, secondary antibodies conjugated to horseradish peroxidase were from GE Healthcare Life Sciences. Chemiluminescent substrate was from Thermo Scientific. ELISA kits were from eBiosciences (TNF- ⁇ ). Luciferase assay system was from Promega.
  • Expression plasmids were established by conventional molecular biology techniques and verified by DNA sequencing.
  • Epitope tags used consisted in tandem triple tags (HA, FLAG) or single tag (Myc) which were fused N-terminal to the cDNA of full length MyD88, the MyD88 death domain (aa 2-109) or the MyD88 TIR-domain (aa 157-296).
  • FLAG-tagged TIRAP-Gyrase B was expressed as fusion protein consisting in triple-FLAG-tagged, full-length TIRAP and a C- terminal Gyrase B moiety using a lentiviral vector containing a PGK1-promoter.
  • FLAG-tagged MyD88-GyrB was expressed as fusion protein consisting in triple-FLAG-tagged, full-length MyD88 and a C-terminal Gyrase B moiety using a MSCV-based retroviral vector (MSCV-puro (Clontech)).
  • FLAG-tagged TRAF6-GyrB was expressed as fusion protein consisting in a triple- FLAG-tagged, N-terminal part of TRAF6 (aa 2-351) and a C-terminal Gyrase B moiety using a pcDNA3-based vector with EF1 ⁇ promoter.
  • Plasmids used for M2H assays were based on the Checkmate mammalian two-hybrid system (Promega).
  • the TIR domain of MyD88 (aa 158-296) was cloned into the Gal4-vector (pBIND) and VP16-vector (pACT), full length MyD88 was cloned into pACT, the TIR domain of TLR9 (aa 867-1032) was cloned into pBind, and TIRAP (aa 1-241) was cloned into pBind.
  • Reporter cell lines To establish NF-kB-responsive luciferase reporter cells lines, HEK293T cells were transduced with a lentiviral vector containing a luciferase reporter gene under control of three NF-kB-binding sites. Single cell clones of transduced cells were established by limiting dilution, and inducible NF-kB activity was confirmed by transfection with various TLR adaptor proteins. Stable reporter cell lines expressing GyrB-fusion proteins were established by viral transduction (MyD88-GyrB, TIRAP-GyrB) or lipofectamine transfection (TRAF6-GyrB), followed by antibiotic selection. Stably growing cells were cloned by limiting dilution, and clones that showed CM-mediated NF-kB activation were selected for further experiments.
  • HEK293T cells were maintained in growth medium containing Phenol red (DMEM (Life Technologies), supplemented with 10% (v/v) FCS (Hyclone), 50 mM 2-mercaptoethanol, antibiotics (penicillin G (100 IU/mL) and streptomycin sulfate (100 IU/mL)) and pyruvate (1 mM)).
  • DMEM Phenol red
  • FCS Hyclone
  • antibiotics penicillin G (100 IU/mL) and streptomycin sulfate (100 IU/mL)
  • pyruvate 1 mM
  • RAW264.7 cells were cultured in RPMI 1640 (Life Technologies), supplemented with 10% (v/v) FCS (Hyclone), 50 mM 2-mercaptoethanol and antibiotics (penicillin G (100 IU/mL) and streptomycin sulfate (100 IU/mL)), as described (Hacker et al., Nature 439, 204-207 (2006);hacker et al., The EMBO journal 18, 6973-6982 (1999)).
  • Bone marrow (BM)-derived macrophages were generated by cultivating unfractionated BM cells (obtained from female C57BL/6 mice or ER ⁇ -deficient mice (Esr1 tm1Ksk ) , The Jackson Laboratories) and corresponding wildtype control mice, as indicated in the figure descriptions) for 6 days in DMEM (Invitrogen), supplemented with 10% (v/v) FCS (Hyclone), 50 mM 2-mercaptoethanol, antibiotics (penicillin G (100 IU/mL) and streptomycin sulfate (100 IU/mL); Invitrogen) and 30% L-cell–conditioned medium as described (Redecke et al., Nature methods 10, 795-803 (2013)).
  • RAW264.7 cells were seeded in complete RPMI 1640 (without phenol red) medium in 96 well plates at cell a density of 50,000 per well at least 12 hours before stimulation.
  • Cells were treated with compounds or DMSO for 30 minutes followed by stimulation with various physiological TLR agonists (CpG DNA (1 PM), R848 (300 nM), Pam3Cys (100 ng/mL), LPS (10 ng/mL)) or Curdlan (100 Pg/mL).
  • TLR agonists CpG DNA (1 PM), R848 (300 nM), Pam3Cys (100 ng/mL), LPS (10 ng/mL)) or Curdlan (100 Pg/mL).
  • TNFD levels were determined in cell culture supernatants 6 hours post stimulation by ELISA, and cell viability was analyzed by the Alamar blue assay system (Invitrogen).
  • Replication-deficient lentivirus and murine stem cell virus was generated based on Lipofectamine 2000 (Invitrogen)-based transient transfection of HEK293T cells using a four-plasmid system that was generously provided by Dr. Inder Verma (for lentivirus), or an ecotropic, MSCV-based two-plasmid system.
  • Cas9-mediated deletion of MyD88 was done by lentiviral delivery of MyD88-specific sgRNA (genomic target sequence:
  • GTTCTTGAACGTGCGGACAC lentiviral vector LentiCrisprV2 provided through Addgene (Sanjana et al., Nature methods 11, 783-784 (2014)).
  • Transduced cells were selected with puromycin (10 mg/mL) and used as polyclonal cell population.
  • Estrogen Receptor Binding Assay Competitive radiometric binding assays were performed on 96-well microtiter filter plates (Millipore), using full length human estrogen receptor ⁇ and ⁇ , with tritiated estradiol as tracer, as previously described (Carlson et al., Biochemistry 36, 14897-14905 (1997)). After incubation on ice for 18-24 hours, ER ⁇ -bound tracer was absorbed onto hydroxyapatite (BioRad), washed with buffer, and measured by scintillation counting. The affinities are expressed as relative binding affinity (RBA) values, where the RBA of estradiol is 100. RBA values are the average ⁇ SD of 2-3 determinations.
  • RBA relative binding affinity
  • BJ human foreskin fibroblasts
  • HEK293 human embryonic kidney cells
  • HepG2 human hepatocellular carcinoma cells
  • Raji human lymphoblast cells (Burkitt’s lymphoma)
  • mice Female C57BL/6J mice (Jackson Laboratory) were treated i.p. with TSI-13-57 formulated in 5% NMP, 5% Solutol HS 15, 90% normal saline or vehicle control.60 minutes later, the mice were i.p. administered with 2500 ng/kg body weight LPS in PBS.90 minutes later, mice were bled and plasma TNF ⁇ levels were analyzed by ELISA (eBioscience).
  • mice were treated with two doses of TSI-13-57 (100 mg/kg and 200 mg/kg bodyweight), followed by LPS administration and analysis of TNF ⁇ levels in the serum 90 min after challenge. While 100 mg/kg led to significant reduction, 200 mg/kg almost completely blocked LPS-induced TNF ⁇ release (Fig.5A).
  • Fig.5A In vivo inhibitory activity correlated well with plasma levels of TSI-13-57 and its known in vitro IC50 of 6.73 mM for LPS-induced TNF ⁇ release from macrophages (Fig.4A).
  • the data provide proof of principle that MPP analogs with TLR-inhibitory activity can be used to counteract TLR-induced effector functions in vivo.
  • the storage plate was sealed and incubated at RT for 18 hours.
  • the suspension was then filtered through a 96-well filter plate (pION Inc.).75 PL of filtrate were mixed with 75 PL 1-propanol to make the sample plate, and the UV spectrum of the sample plate was read. Calculations were carried out with PSOL
  • PAMPA membrane permeability assay
  • the aqueous boundary layer was set to 40 Pm for stirring.
  • the UV spectrum (250-500 nm) of the donor and the acceptor were read.
  • the permeability coefficient was calculated using PAMPA Evolution 96 Command software based on the AUC of the reference plate, the donor plate, and the acceptor plate. All compounds were tested in triplicate.
  • Mouse liver microsomes (0.73 mL) were mixed with EDTA solution (0.06 mL, 0.5M in water) and potassium phosphate buffer (22.31 mL, 0.1M, pH 7.4, 37°C) to make 23.1 mL of liver microsome solution (20 mg/mL liver microsome protein).
  • 10 mM stocks of compound in DMSO were diluted with DMSO and acetonitrile to three different intermediate concentrations: high (2 mM), medium (0.4 mM) and low (0.08 mM) concentration in DMSO:acetonitrile (1:4, v:v).10 mM stocks of controls in DMSO (diphenhydramine HCl, verapamil HCl, and
  • Ketoprofen are diluted to 0.4 mM concentration in DMSO:acetonitrile (1:4, v:v). Each diluted compound stock (37.83 mL) was added to an aliquot of the liver microsomal solution (3 ml) and vortexed. The resulting solution was added to each of 3 wells of a master assay plate (pION Inc., MA, #110323). Each plate holds triplicate samples of two controls (0.4 mM) and two
  • concentrations respectively: 0.5 mg/mL, high (20 PM), medium (4 PM), and low (0.08 PM).
  • the plates are sealed, and all plates except the 0-hr plate were incubated at 37 oC, shaken at a speed of 60 rpm.
  • a single assay plate was tested at each time point: 0.5 hr, 1 hr, 2 hr, and 4 hr. At each time point, 437.5 mL of pre-cooled internal standard was added each well of the plate to quench the reaction.
  • the quenched plate was then centrifuged (model 5810R, Eppendorf, Westbury, NY) at 4000 rpm for 15 minutes.150 mL supernatant was transferred to a 96-well plate and analyzed by UPLC-MS (Waters Inc., Milford, MA).
  • the compounds and internal standard were detected by selected ion recording (SIR).
  • SIR selected ion recording
  • the amount of material was measured as a ratio of peak area to the internal standard and graphed. Using the slope from the most linear portion of this curve, the degradation rate constant is calculated. The rate constant was then used to calculate the compounds half-life is in plasma.
  • mice Female C57BL/6 mice with average weight of 19 grams were purchased from Charles River Laboratories (Wilmington). Food and water were provided ad libitum.15 mice were divided into three dosage groups: 0, 10 and 20 mg/kg. For each mouse, 0.1 mL of compound suspension in formulation (0.5% CMC, 0.4% Tween 80) was given by intra-peritoneal (i.p.) injection.0.1 mL blood was collected retro-orbitally from a different mouse within each dosage group at 5 minutes, 15 minutes, 30 minutes, 1 hour, 4 hours, and 24 hours. Animals were euthanized via cardiac puncture at 48 hours post injection.
  • compound suspension in formulation (0.5% CMC, 0.4% Tween 80
  • 0.1 mL blood was collected retro-orbitally from a different mouse within each dosage group at 5 minutes, 15 minutes, 30 minutes, 1 hour, 4 hours, and 24 hours. Animals were euthanized via cardiac puncture at 48 hours post injection.
  • Plasma samples were treated with 10 mL of EDTA sodium solution to prevent coagulation. Blood was kept on ice and centrifuged for 3 minutes at 13,000 rpm in a desktop centrifuge to collect plasma. 25 mL plasma samples were combined with 75 mL internal standard (2 mM warfarin) in acetonitrile in a 96 well plate and centrifuged at 4000 rpm for 20 minutes at 4 °C. The supernatant (40 mL) was collected and mixed with 2 part of Milli-Q water (EMD Millipore) and centrifuged again at 3000 rpm for 20 minutes at 4 °C. Plasma concentration was determined with partially validated LC/MS-MS assay with MRM detection (AB Sciex). The assay limit of quantification (LLOQ) was 1.5 nM in plasma.
  • LLOQ assay limit of quantification
  • NCA non- compartmental analysis
  • Plasma 200-202
  • LLOQ Lower Limit of Quantification
  • the Area Under the Concentration-Time Curve (AUC) was calculated with the linear trapezoidal, linear interpolation rule using mean concentrations and nominal times.
  • the terminal elimination rate (Lambda_z) and half-life (HL_Lambda_z) was determined using the default“Best Fit” method.
  • the predicted AUC from the last time point to infinity (AUCINF_pred) was calculated as AUClast plus Clast(pred)/Lambda_z.
  • PK In vivo pharmacokinetics (PK) experiments were performed for TSI-13-57.
  • the maximum serum concentration (C max ) showed a dose-dependent increase from 669 to 1260 nM for 10 and 20 mg/kg of intra-peritoneally (i.p.) administered compound, respectively.
  • the plasma half-life was 9.8 hours (10 mg/kg) and 9.0 hours (20 mg/kg) (Table 22).
  • the area under the curve (AUC) within 24 hours displayed a dose-dependent, non-linear mode, where 43.2 mM*hr was achieved at 20 mg/kg (Table 22).
  • RAW264.7 cells expressing stably a FLAG- tagged form of MyD88-GyrB were cultured in arginine- and lysine-free RPMI (Invitrogen) supplemented with 10% dialyzed FBS (Invitrogen), penicillin-streptomycin, and either L- arginine and L-lysine (light), L-arginine-HCl (13C6; CLM-2265 [R6]) and L-lysine-2HCl (4,4,5,5 D4; DLM-2640 [K4]) (medium) or L-arginine-HCl (13C6, 15N4; CLM-539 [R10]) and L-lysine-2HCl (13C6, 15N2; DLM-291 [K8]) (heavy) (Cambridge Isotope Labs)(73).
  • cells were passaged three times in SILAC medium over a period of 5 days.
  • the labeled cells were treated with 10 mM MPP for 20 minutes (heavy), followed by stimulation with 1 mM CpG-DNA for 60 minutes (medium and heavy).
  • the medium was replaced by ice-cold PBS and cells were collected by cell scraping and
  • lysis buffer 20 mM Hepes/NaOH (pH 7.5), 1.5 mM MgCl2, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 10 mM ⁇ -glycerophosphate, 5 mM 4-nitrophenyl-phosphate, 10 mM sodium fluoride, complete protease inhibitors (Roche)) supplemented with 0.5 % NP-40 for 20 min. Samples were cleared by centrifugation and loaded five times over anti-FLAG-bead-containing columns.
  • Unbound proteins were removed by washing column with LB plus 0.1% NP-40, and proteins were eluted at pH 3.5 in water supplemented with 100 mM glycine, 50 mM NaCl, 0.1% NP-40, and Roche complete protease inhibitors. The proteins were concentrated by trichloroacetic acid precipitation and dissolved in SDS PAGE loading buffer (Bio-Rad). The dissolved proteins were combined, followed by separation on a 10 % Bis-Tris gel (Bio-Rad) and staining with SYPRO Ruby protein stain (Invitrogen).
  • LC- MS/MS LC-tandem MS
  • nanoAcquity UPLC Waters
  • Orbitrap ELITE high resolution mass spectrometer Thermo Fisher
  • Tryptic peptides were gradient eluted over a gradient (0 to 70% B for 60 minutes and 70 to 100% B for 10 minutes, where B was 70% [vol/vol] acetonitrile, 0.2% formic acid) using a flow rate of 250 nL/minute into the high resolution Orbitrap ELITE through a noncoated spray needle with voltage applied to the liquid junction.
  • MS/MS analysis with LTQ XL (Thermo Fisher) and database analysis.
  • Data-dependent scanning was incorporated to select the 20 most abundant ions (one microscan per spectrum; precursor isolation width, 2.0 Da; 35% collision energy; 10-ms ion activation; 15-s dynamic exclusion duration; 5-s repeat duration; and a repeat count of 1 from a full-scan mass spectrum at 60,000 resolution for fragmentation by collision-activated dissociation).
  • Database searches were performed using RAW files in combination with Andromeda search engine that is part of the MaxQuant software (version 1.1.1.32) developed at the Max Planck Institute (Cox et al., Nature biotechnology 26, 1367-1372 (2008)).
  • the SwissProt 2012_08 ((537,505 sequences; 190,795,142 residues); Taxonomy: Mus musculus (16,605 sequences)) database was used for peptide and protein identification. MaxQuant was also used to quantitate peptides and proteins and to provide ratios generated in Excel format. Protein assignments were made on the basis of both MS and MS/MS spectra, whereas peptide quantitation was based solely on MS data.
  • IP Immuno-precipitation
  • HEK293T cells that were transfected using Lipofectamine (Life Technlogies) with epitope- tagged forms of MyD88.
  • MPP or DMSO was added 7 hours after transfection.20 hours after transfection, cells were lyzed for 20 minutes at 4 °C in lysis buffer (20 mM Hepes/NaOH (pH 7.5), 1.5 mM MgCl2, 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40 and 10% glycerol) supplemented with complete protease inhibitors (Roche Applied Science).
  • IP samples and total cell lysates were analyzed by immuno-blotting.
  • CETSA Cellular thermal shift assay
  • the cell suspension (0.8 million in 100 mL volume) was transferred to multiple tubes in a real-time PCR plate (Applied Biosystems).
  • the PCR plate was loaded to the heating block of a PTC-200 Gradient Thermocycler (MJ Research) at 25°C. Samples were heated to their desired temperatures in parallel by applying a temperature gradient covering a range between 40°C and 64°C. The respective temperatures were maintained for 3 min before the samples were cooled and maintained at 25°C for 3 minutes. Next, the tubes were immediately shock-frozen in liquid nitrogen.
  • M2H assay Mammalian two-hybrid assay.
  • HEK293T cells were transiently transfected with bait- and prey plasmids in 96 well format using Lipofectamine (2000), along with a Gal4-driven firefly luciferase reporter plasmid (pGL5-luc, Promega) and Renilla luciferase control vector (Promega).
  • DMSO or compound was added to cells 7 hours post transfection. Cells were harvested 13 hours later, and luciferase activity was determined using the dual luciferase kit (Promega). Firefly luciferase activity values were normalized to Renilla luciferase activity.
  • G 1 is–NR 1 R 2 ,–OH,–OC 1-4 alkyl, a C 3-8 cycloalkyl, a 4- to 12-membered heterocyclyl containing 1-3 heteroatoms independently selected from N, O, and S, or a 5- to 12-membered heteroaryl containing 1-3 heteroatoms independently selected from N, O, and S, wherein the cycloalkyl, the heterocyclyl, and the heteroaryl are optionally substituted with 1-4 substituents independently selected from halo, C1-4alkyl, C1-4haloalkyl,–OH,–OC1-4alkyl, and oxo;
  • R 1 and R 2 are each independently hydrogen or C 1-4 alkyl
  • G 2 is selected from (i) to (xiii)
  • X 1 is O or S
  • X 2 is O, S, NH, or NC1-4alkyl
  • R 5 is C1-4alkyl or
  • R 3 , R 7 , R 13 , R 17 , R 19 , R 21 , R 27 , R 29 , and R 33 are each independently selected from hydrogen and C1-4alkyl;
  • R 11 and R 31 are each independently selected from hydrogen, C1-4alkyl, and phenyl optionally substituted with 1-3 substituents independently selected from halo, C 1-4 alkyl, C 1-4 haloalkyl,– OH, and–OC 1-4 alkyl;
  • R 4a , R 4b , R 4c , R 5a , R 6 , R 8 , R 9 , R 10 , R 12 , R 14 , R 15 , R 16 , R 18 , R 20 , R 22 , R 23 , R 24 , R 25 , R 26 , R 28 , R 30 , and R 32 at each occurrence, are independently halo, nitro, cyano, C 1-4 alkyl, C 1-4 haloalkyl,–OH,– OC1-4alkyl,–OC1-4haloalkyl,–NH2,–NH(C1-4alkyl),–N(C1-4alkyl)(C1-4alkyl),–NHC(O)C1- 4alkyl,–N(C1-4alkyl)C(O)C1-4alkyl,–NHC(O)OC1-4alkyl,–N(C1-4alkyl)C(O)OC1-4alkyl,– C(O)OC1-4alkyl,–C(O)
  • n1 and n2 are independently 0, 1, 2, 3, 4, or 5;
  • n3 and n4 are independently 0, 1, 2, or 3.
  • Clause 2 The compound of clause 1, or a pharmaceutically acceptable salt thereof, wherein the compound of formula (I) has formula (IA) .
  • G 1 is–NR 1 R 2 , a 4- to 12-membered heterocyclyl containing 1-3 heteroatoms independently
  • heterocyclyl and the heteroaryl are optionally substituted with 1-4 substituents independently selected from halo, C 1-4 alkyl, C 1- 4haloalkyl,–OH,–OC1-4alkyl, and oxo; and
  • L 1 is–C1-5alkylene–or–C1-4alkylene–O—.
  • G 1 is –NR 1 R 2 ;
  • a 4- to 8-membered monocyclic heterocyclyl containing a first nitrogen atom and optionally an additional heteroatom selected from N, O, and S, the heterocyclyl connecting to L 1 at the first nitrogen atom and optionally containing a C 1-3 alkylene bridge between two non-adjacent ring atoms and/or a double bond, the heterocyclyl being optionally substituted with 1-4 substituents independently selected from halo, C1-4alkyl, C1-4haloalkyl,–OH,–OC1-4alkyl, and oxo; or
  • L 1 is–C 2-4 alkylene– or–C 2-3 alkylene–O–.
  • G 1 is–N(CH3)2,–N(CH2CH3)2, pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, azepin-1-yl,
  • Clause 7 The compound of clause 6, or a pharmaceutically acceptable salt thereof, wherein .
  • R 5 is C1-4alkyl.
  • R 4a is independently halo, cyano, C1-4alkyl, C1-4haloalkyl,–OH,–OC1-4alkyl, –OC1-4haloalkyl,–NH2,–NH(C1-4alkyl),–N(C1-4alkyl)(C1-4alkyl),–NHC(O)C1-4alkyl,–N(C1- 4alkyl)C(O)C 1-4 alkyl,–C(O)OC 1-4 alkyl,–C(O)NH 2 ,–C(O)NH(C 1-4 alkyl), or–C(O)N(C 1- 4 alkyl)(C 1-4 alkyl), and optionally two R 4a , together with the atoms to which they are attached,
  • R 5a is halo, nitro, cyano, C 1-4 alkyl, C 1-4 haloalkyl,–OH,–OC 1-4 alkyl,–OC 1-4 haloalkyl,–NH 2 ,– NH(C1-4alkyl),–N(C1-4alkyl)(C1-4alkyl),–NHC(O)C1-4alkyl,–N(C1-4alkyl)C(O)C1-4alkyl,– NHC(O)OC1-4alkyl, or–N(C1-4alkyl)C(O)OC1-4alkyl;
  • n1 0, 1, 2, or 3;
  • n2 is 0 or 1.
  • Clause 13 The compound of any of clauses 6-11, or pharmaceutically acceptable salt thereof, provided that the compound is not 4,4'-(4-ethyl-3-(4-(2-(piperidin-1-yl)ethoxy)phenyl)- 1H-pyrazole-1,5-diyl)diphenol, or a salt thereof.
  • Clause 15 The compound of clause 14, or a pharmaceutically acceptable salt thereof, wherein n1 and n2 are each independently 0, 1, 2, or 3.
  • Clause 18 The compound of clause 17, or a pharmaceutically acceptable salt thereof, wherein n1 and n2 are each independently 0, 1, 2, or 3.
  • Clause 19 The compound of clause 18, or a pharmaceutically acceptable salt thereof, wherein n1 and n2 are each independently 0 or 1.
  • Clause 20 The compound of any of clauses 17-19, or a pharmaceutically acceptable salt thereof, wherein
  • R 9 and R 10 are independently halo, nitro, cyano, C 1-4 alkyl, C 1-4 haloalkyl,– OC 1-4 alkyl,–OC 1-4 haloalkyl,–NH 2 ,–NH(C 1-4 alkyl),–N(C 1-4 alkyl)(C 1-4 alkyl),–NHC(O)C 1-
  • Clause 21 The compound of any of clauses 17-19, or a pharmaceutically acceptable salt thereof, wherein
  • R 9 and R 10 are independently halo, C1-4alkyl,–OH, or–OC1-4alkyl.
  • R 9 at each occurrence, is independently halo, C1-4alkyl, or–OC1-4alkyl
  • R 10 at each occurrence, is independently halo, C 1-4 alkyl,–OH, or–OC 1-4 alkyl.
  • Clause 23 The compound of clause 22, or a pharmaceutically acceptable salt thereof, wherein R 10 , at each occurrence, is independently halo, C 1-4 alkyl, or–OC 1-4 alkyl.
  • Clause 25 The compound of any of clauses 17-24, or a pharmaceutically acceptable salt thereof, wherein R 11 is hydrogen.
  • Clause 27 The compound of clause 26, or a pharmaceutically acceptable salt thereof, wherein n1 and n2 are each independently 0, 1, 2, or 3.
  • Clause 28 The compound of clause 27, or a pharmaceutically acceptable salt thereof, wherein n1 and n2 are each independently 0 or 1.
  • R 12 and R 14 are independently halo, nitro, cyano, C 1-4 alkyl, C 1-4 haloalkyl,– OC 1-4 alkyl,–OC 1-4 haloalkyl,–NH 2 ,–NH(C 1-4 alkyl),–N(C 1-4 alkyl)(C 1-4 alkyl),–NHC(O)C 1- 4 alkyl,–N(C 1-4 alkyl)C(O)C 1-4 alkyl,–NHC(O)OC 1-4 alkyl,–N(C 1-4 alkyl)C(O)OC 1-4 alkyl,– C(O)OC1-4alkyl,–C(O)OH,–C(O)NH2,–C(O)NH(C1-4alkyl), or–C(O)N(C1-4alkyl)(C1-4alkyl), and optionally two R 12 or R 14 , together with the atoms to which they are attached form a fused
  • the compound is not 1-(2-(4-(4-ethyl-3,5-bis(4-methoxyphenyl)-1H-pyrazol-1- yl)phenoxy)ethyl)piperidine, or a salt thereof.
  • Clause 30 The compound of any of clauses 26-28, or a pharmaceutically acceptable salt thereof, wherein R 12 and R 14 , at each occurrence, are independently halo,–OH, or–OC 1-4 alkyl.
  • Clause 31 The compound of clause 30, or a pharmaceutically acceptable salt thereof, wherein R 12 and R 14 , at each occurrence, are independently halo or–OC1-4alkyl.
  • Clause 32 The compound of clause 30 or 31, or a pharmaceutically acceptable salt thereof, wherein the compound is not 1-(2-(4-(4-ethyl-3,5-bis(4-methoxyphenyl)-1H-pyrazol-1- yl)phenoxy)ethyl)piperidine, or a salt thereof.
  • n1 and n2 are each independently 0 or 1.
  • Clause 35 The compound of any of clauses 1-34, or a pharmaceutically acceptable salt thereof, wherein
  • R 4a , R 4b , R 4c , R 5a , R 6 , R 8 , R 9 , R 10 , R 12 , R 14 , R 15 , R 16 , R 18 , R 20 , R 22 , R 23 , R 24 , R 25 , R 26 , R 28 , R 30 , and R 32 at each occurrence, are independently halo, cyano, C1-4alkyl,–OH, or–OC1-4alkyl.
  • Clause 36 The compound of clause 35, or a pharmaceutically acceptable salt thereof, wherein n1, n2, and n3 are each independently 0 or 1.
  • Clause 37 The compound of any of clauses 34-36, or a pharmaceutically acceptable salt thereof, wherein G 2 is (via)
  • R 22 is halo, cyano, C1-4alkyl, or–OC1-4alkyl
  • R 23 is halo, cyano, C1-4alkyl,–OH, or–OC1-4alkyl
  • n1 and n2 are each 1.
  • R 22 is halo, cyano, C1-4alkyl,–OH, or–OC1-4alkyl;
  • R 23 is halo, cyano, C1-4alkyl, or–OC1-4alkyl
  • n1 and n2 are each 1.
  • R 22 is halo, cyano, C 1-4 alkyl, or–OC 1-4 alkyl
  • R 23 is halo, cyano, C 1-4 alkyl, or–OC 1-4 alkyl
  • n1 and n2 are each 1.
  • Clause 44 The compound of any of clauses 34-36, or a pharmaceutically acceptable salt thereof, wherein G 2 is (va), (viiia), or (xia)
  • Clause 46 A pharmaceutical composition comprising a compound of any of clauses 1-45, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
  • Clause 47 A method of treating a disease or condition mediated by Toll-like receptor activation comprising administering to a subject, in need thereof, a therapeutically effective amount of a compound of any of clauses 1-45, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of clause 46.
  • Clause 48 The method of clause 47, wherein the disease or condition is an inflammatory disease or condition.
  • Clause 49 The method of clause 47, wherein the disease or condition is selected from bacterial sepsis, autoimmune disease, lupus erythematosus, ischemia-reperfusion injury, stroke, metabolic disease, obesity-related metabolic inflammation, gout, and cancer.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des composés hétéroaromatiques substitués par un di- et un triaryle qui présentent une activité inhibitrice de récepteur de type Toll, notamment des TLR2, TLR4, TLR7 et/ou TLR9. Les composés et compositions peuvent être appliqués dans le traitement de maladies et d'états médiés par des récepteurs de type Toll et des récepteurs apparentés, tels qu'une sepsie bactérienne, une maladie auto-immune, un lupus érythémateux, une lésion d'ischémie-reperfusion, un accident vasculaire cérébral, une maladie métabolique, une inflammation métabolique liée à l'obésité, la goutte et le cancer.
PCT/US2019/012181 2018-01-03 2019-01-03 Inhibiteurs de signalisation de récepteur de type toll WO2019136147A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862613137P 2018-01-03 2018-01-03
US62/613,137 2018-01-03

Publications (1)

Publication Number Publication Date
WO2019136147A1 true WO2019136147A1 (fr) 2019-07-11

Family

ID=67143998

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/012181 WO2019136147A1 (fr) 2018-01-03 2019-01-03 Inhibiteurs de signalisation de récepteur de type toll

Country Status (1)

Country Link
WO (1) WO2019136147A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111205236A (zh) * 2020-02-10 2020-05-29 贵州医科大学 一种萘环-异噁唑型化合物及其制备方法与应用
CN111233766A (zh) * 2020-02-10 2020-06-05 贵州医科大学 一种萘环-吡唑型化合物及其制备方法与应用
WO2021087181A1 (fr) * 2019-11-01 2021-05-06 Bristol-Myers Squibb Company Composés de pyrazole substitués utilisés en tant qu'inhibiteurs du récepteur toll
WO2021120890A1 (fr) * 2019-12-20 2021-06-24 Novartis Ag Dérivés pyrazolyle utiles en tant qu'agents anticancéreux
WO2021249376A1 (fr) * 2020-06-10 2021-12-16 南方医科大学珠江医院 Utilisation d'un inhibiteur et/ou d'un antagoniste de la voie tlr4 dans la préparation d'un médicament
WO2022133731A1 (fr) * 2020-12-22 2022-06-30 Novartis Ag Combinaisons pharmaceutiques comprenant un inhibiteur de kras g12c et utilisations d'un inhibiteur de kras g12c et pour le traitement de cancers
WO2022173750A1 (fr) * 2021-02-09 2022-08-18 Oregon State University Dérivés de xanthohumol et procédés de fabrication et méthodes d'utilisation associés
CN115385902A (zh) * 2022-08-09 2022-11-25 徐州医科大学 一种苯并咪唑类化合物及其制备方法和应用
EP4006013A4 (fr) * 2019-07-26 2023-06-28 Ajou University Industry-Academic Cooperation Foundation Nouveau composé à petites molécules inhibant la voie de transmission du signal de tlr7 et tlr9 et son utilisation

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000019994A1 (fr) * 1998-10-02 2000-04-13 Board Of Trustees Of The University Of Illinois Ligands se liant aux recepteurs d'oestrogenes
US20110312925A1 (en) * 2010-06-16 2011-12-22 Endorecherche, Inc. Methods of treating or preventing estrogen-related diseases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000019994A1 (fr) * 1998-10-02 2000-04-13 Board Of Trustees Of The University Of Illinois Ligands se liant aux recepteurs d'oestrogenes
US20110312925A1 (en) * 2010-06-16 2011-12-22 Endorecherche, Inc. Methods of treating or preventing estrogen-related diseases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DASGUPTA, S ET AL.: "Estrogen receptor-alpha mediates Toll-like receptor-2 agonist-induced monocyte chemoattractant protein-1 production in mesangial cells", RESULTS IN IMMUNOLOGY, vol. 2, 2012, pages 196 - 203, XP055621488 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4006013A4 (fr) * 2019-07-26 2023-06-28 Ajou University Industry-Academic Cooperation Foundation Nouveau composé à petites molécules inhibant la voie de transmission du signal de tlr7 et tlr9 et son utilisation
WO2021087181A1 (fr) * 2019-11-01 2021-05-06 Bristol-Myers Squibb Company Composés de pyrazole substitués utilisés en tant qu'inhibiteurs du récepteur toll
US11702409B2 (en) 2019-12-20 2023-07-18 Novartis Ag Pyrazolyl derivatives useful as anti-cancer agents
WO2021120890A1 (fr) * 2019-12-20 2021-06-24 Novartis Ag Dérivés pyrazolyle utiles en tant qu'agents anticancéreux
CN111233766B (zh) * 2020-02-10 2022-07-01 贵州医科大学 一种萘环-吡唑型化合物及其制备方法与应用
CN111205236A (zh) * 2020-02-10 2020-05-29 贵州医科大学 一种萘环-异噁唑型化合物及其制备方法与应用
CN111205236B (zh) * 2020-02-10 2022-07-01 贵州医科大学 一种萘环-异噁唑型化合物及其制备方法与应用
CN111233766A (zh) * 2020-02-10 2020-06-05 贵州医科大学 一种萘环-吡唑型化合物及其制备方法与应用
WO2021249376A1 (fr) * 2020-06-10 2021-12-16 南方医科大学珠江医院 Utilisation d'un inhibiteur et/ou d'un antagoniste de la voie tlr4 dans la préparation d'un médicament
WO2022133731A1 (fr) * 2020-12-22 2022-06-30 Novartis Ag Combinaisons pharmaceutiques comprenant un inhibiteur de kras g12c et utilisations d'un inhibiteur de kras g12c et pour le traitement de cancers
WO2022173750A1 (fr) * 2021-02-09 2022-08-18 Oregon State University Dérivés de xanthohumol et procédés de fabrication et méthodes d'utilisation associés
CN115385902A (zh) * 2022-08-09 2022-11-25 徐州医科大学 一种苯并咪唑类化合物及其制备方法和应用
CN115385902B (zh) * 2022-08-09 2024-03-29 徐州医科大学 一种苯并咪唑类化合物及其制备方法和应用

Similar Documents

Publication Publication Date Title
WO2019136147A1 (fr) Inhibiteurs de signalisation de récepteur de type toll
NL1031626C2 (nl) Verbindingen die bruikbaar zijn in therapie.
TWI638815B (zh) 作為激酶抑制劑之雜環醯胺類（一）
TWI469979B (zh) 脂肪酸醯胺水解酶(faah)抑制劑、以及其藥學組成物與用途
EP3022202B1 (fr) Inhibiteurs de l'autotaxine comprennant un motif anneau hétéroaromatique-benzyle-amide-cycle
TWI491608B (zh) 作為γ分泌酶調節劑之新穎經取代三唑衍生物
US20020111374A1 (en) Estrogen receptor modulators
RU2752173C2 (ru) Пиразоловые соединения в качестве модуляторов fshr и пути их применения
JP2011502148A (ja) 疼痛の治療用としてのｐ２ｘ３受容体アンタゴニスト
CN112218857B (zh) P300/cbp hat抑制剂及其使用方法
TW200922568A (en) N-(2(hetaryl)aryl)arylsulfonamides and N-(2(hetaryl)hetaryl)arylsulfonamides
CA2798763A1 (fr) Composes utiles comme inhibiteurs de la kinase atr
JP2007534740A (ja) バソプレッシンＶ１ａ受容体の阻害剤としての３−ヘテロシクリル−４−フェニル−トリアゾール誘導体
EP2922847A1 (fr) Composés utiles comme inhibiteurs de l'indoléamine 2,3-dioxygénase
JP2009507034A (ja) ５−ＨＴ２Ｃ受容体アゴニストとしての６−アリールアルキルアミノ−２，３，４，５−テトラヒドロ−１Ｈ−ベンゾ［ｄ］アゼピン
CZ410397A3 (cs) Deriváty 4-fenylaminothiazolu, způsob jejich přípravy a farmaceutické přípravky, které je obsahují
KR20050109583A (ko) 나트륨 채널 차단제로서의 바이아릴 치환된 트리아졸
JP6851825B2 (ja) 非アポトーシス性の制御された細胞死の阻害剤としてのスピロキノキサリン誘導体
SK283833B6 (sk) Deriváty benzoxadiazolu, benzotiadiazolu, benzotriazolu a chinoxalínu, spôsob ich prípravy, farmaceutická kompozícia, ktorá ich obsahuje, a ich použitie
JP2020524660A (ja) Ｒｏｒ−ガンマモジュレーターとして有用な２，３−ジヒドロイソインドール−１−カルボキサミド
JP2016538250A (ja) ジアリールアルキルアミンｒｅｖ−ｅｒｂアンタゴニストおよびそれらの医薬品としての使用
CA3129851A1 (fr) Composes amide substitues utiles en tant que modulateurs du recepteur farnesoide x
WO2019096089A1 (fr) Dérivés d'indolizine et son application en médecine
CA3151932A1 (fr) Composes et methodes de traitement de maladies liees a l'oxalate
EP3568133B1 (fr) Composés protecteurs de cellules et leur utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19735991

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19735991

Country of ref document: EP

Kind code of ref document: A1