WO2019118779A2 - Peptides and other agents for treating pain and increasing pain sensitivity - Google Patents
Peptides and other agents for treating pain and increasing pain sensitivity Download PDFInfo
- Publication number
- WO2019118779A2 WO2019118779A2 PCT/US2018/065545 US2018065545W WO2019118779A2 WO 2019118779 A2 WO2019118779 A2 WO 2019118779A2 US 2018065545 W US2018065545 W US 2018065545W WO 2019118779 A2 WO2019118779 A2 WO 2019118779A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- peptide
- magi
- pain
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P23/00—Anaesthetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/45—Transferases (2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/04—Centrally acting analgesics, e.g. opioids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/04—Phosphotransferases with a phosphate group as acceptor (2.7.4)
- C12Y207/04008—Guanylate kinase (2.7.4.8)
Definitions
- Nociceptive neurons are endowed with a specific subset of voltage-dependent sodium channels (Nav) allowing neurons to uniquely respond to noxious and inflammatory stimuli. Therefore, a current strategy for new analgesic development relies on targeting nociceptor-specific sodium channels.
- the Navl.8 channel (SCN10A) has distinctive biophysical properties permitting nociceptive neurons to repetitively fire action potentials (AP) under compromised conditions associated with tissue damage. This has led to the clinical testing of Navl.8 channel specific blockers for pain relief. Because channels also traffic to the membrane during inflammatory signaling, an alternative approach to affect Navl.8 channel functioning would be to perturb their trafficking. However, the precise molecular mechanisms controlling Navl.8 channel trafficking are not completely understood and therefore, specific agents targeting Navl.8 still remain elusive.
- the present provides peptides, compositions, and methods of using these peptides and/or compositions to treat pain, induce analgesia, or increase pain sensitivity.
- the present disclosure provides methods of treating pain or inducing local analgesia by administering Magi-l (Membrane-Associated Guanylate Kinase 1) targeting shRNA, or Magi-l targeting siRNA.
- the present disclosure further provides peptides for use as research tools. Use of the peptides having the sequence of SEQ ID No. 1-35, Magi-l targeting shRNA, or Magi-l targeting siRNA will diminish or eliminate the need for narcotics to combat pain.
- the present disclosure provides a peptide comprising or consisting of the following sequence:
- X 1 is S, P, or A
- X 2 is T, S, or A
- X 3 is A or T
- X 4 is A, T, I, or S
- X 5 is C, S, or F
- X 6 is P or L
- X 7 is any amino acid residue
- X 8 is E, D, or Y
- X 9 is S or R
- X 10 is T, A, E, or D, and T is optionally phosphorylated
- X 11 is K or R
- X 12 is P, A, or G, and wherein X 1 , X 2 ,
- X 3 , X 9 , X 10 , X 11 , or a combination thereof is acylated (e.g., AA n and n is 4-18, (e.g., 4,
- Lo n is a myristoyl group.
- the present disclosure also provides a pharmaceutical
- composition comprising a pharmaceutically acceptable carrier, a peptide of the present disclosure, optionally, a Magi-l targeting shRNA or Magi-l targeting siRNA and, optionally, one or more analgesic agents (e.g., nonsteroidal anti-inflammatory drugs (NSAIDS)) and/or one or more anesthetic agent.
- analgesic agents or anesthetic agents include bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or a combination thereof.
- analgesics include acetaminophen, aspirin, ibuprofen, naproxen, and the like, and salts thereof.
- the compositions can be formulated as intramuscular, intradermal, intrathecal or nerve injections, topical creams or transdermal patches.
- peptide of the present disclosure or composition thereof is used to alter (e.g., increase or decrease) a subject’s pain sensitivity (e.g., a subject in need of treatment for pain and pain sensitivity).
- a subject e.g., a subject in need of treatment for pain and pain sensitivity.
- a subject e.g., a subject in need of treatment for pain and pain sensitivity.
- a subject e.g., ameliorated
- a subject’s pain sensitivity is increased.
- a peptide of the present disclosure, a composition thereof, Magi-l targeting shRNA, or Magi-l targeting siRNA are used to manage pain (e.g., pain control).
- the present disclosure provides a method of inducing local analgesia in a subject comprising administering composition comprising a peptide having the sequence of any one of SEQ ID NOs. 1-7 or 15-21, Magi-l targeting shRNA, or Magi-l targeting siRNA to the subject in analgesic effective amount (e.g., a therapeutically effective amount).
- the present disclosure further provides a method of increasing pain sensitivity of a subject comprising administering a composition comprising a peptide having the sequence of any one of SEQ ID NOs. 8-14 or 21-35 to the subject at an amount effective to increase pain sensitivity.
- the present disclosure further provides peptides of SEQ ID NO: 1
- NOs:36-70 for use as research tools. As such, they can be administered to research subjects, such as mice and rats.
- the peptides are also useful for in vitro testing.
- Figure 1 shows PDZ binding motif regulates KN 3 channel expression.
- Amino acid alignment of the distil C-termini from orthologous Slack subunits (Xenopus, chicken, rat, and human Slack) and the rat Slick subunit.
- the final four, evolutionarily conserved amino acids (SEQ ID NO: 112) (long and short dashed line on the C- terminus) represent a consensus Type 1 PDZ motif (X-S/T-X-V/L/I).
- FIG. 1 shows Magi-l regulates Slick channels in CHO cells.
- FIG. 4 shows Magi-l knockdown decreases Navl .8 plasma membrane expression.
- A Representative whole cell voltage-clamp current traces of total I Na and TTX- resistant I Na in cultured DRG neurons 3 days after transfection with Magi-l targeting siRNA or non-targeting scrambled siRNA.
- B Current density analysis of a currents with different conditions. Sodium currents in neurons were recorded either in the presence or absence of 25 nM TTX. The total and TTX-resistant I Na was significantly reduced after siRNA mediated- Magi-l knockdown in cultured DRG neurons. A total of 9-12 cells/experimental group were analyzed and values are expressed as mean +/- SEM.
- FIG. 5 shows Magi-l is expressed in DRG neurons, spinal cord, sciatic nerve and at Nodes of Ranvier.
- A Representative immunoblots depicting Magi-l expression from intact DRG (left) and spinal cord (right)
- B Immunolabeling images showing Magi-l expression in cultured DRG neurons (panel 1), DRG sections (panels 2 and 3) and the spinal cord (panels 4 and 5) using a previously validated monoclonal antibody.
- FIG. 6 shows Magi-l complexes Navl.8 channels with Slack KN 3 channels in DRG neurons.
- A Representative whole immunoblots from co-immunoprecipitation (Co- IP) assays demonstrating binding between Magi-l and Navl .8 using intact adult DRG tissue. IP product samples were run in duplicate. The polyclonal Magi-l antibody also recognized a 50 kDa band during blotting thought to be a degradation product (as per manufacturer’s description)
- D ColP showing the interaction between Magi-l and Navl.8 in mouse DRGs. DRG lysate was immunoprecipitated with either anti -Magi-l antibody (left) or anti -Navl.8 antibody (right), and immunoblotted with anti-Navl.8 or anti Magi-l antibody as indicated. This experiment was repeated at least three times.
- FIG. 7 shows in vivo Magi-l knockdown attenuates thermal nociception and acute inflammatory pain behavior.
- A Experimental timeline before and after Magi-l knockdown in vivo.
- B Hargreaves test for thermal nociception showed increased paw withdrawal latency in ipsilateral paw injected with Magi-l targeting shRNA when compared to the contralateral paw. No significant difference was seen in paw withdrawal latency between paws in mice injected with non-targeting shRNA. Behavior was taken from nine (9) different animals (3 females and 6 males) per experimental condition and analyzed. Values are expressed as mean+/-SEM. ***p ⁇ 0.00l vs respective controls.
- Figure 8 shows Navl.8 expression decreases after Magi-l knockdown in vivo.
- Figure 9 shows cell penetrating WW motif peptidomimetics alter neuronal excitability and affect pain behavior.
- A Representative voltage-clamp recordings depicting decreased a (arrow) in cultured DRG neurons after 24 hr pre-treatment with peptide mimetic designated‘PY peptide’ whereas the phospho-PY peptide increased a (top).
- Bottom representative AP traces from cultured DRG neurons pretreated with PY peptide or phospho- PY peptide for 24 hrs during suprathreshold stimulation (400 pA) for 1000 ms (bottom).
- B Peak iNa (at voltage step -20 mV) with different peptide treatments in DRG neurons.
- FIG 10 shows additional images of scrambled siRNA treated and Magi-l siRNA treated neurons. Transfection of scrambled siRNA (upper panels) and Magi-l siRNA (lower panels) of cultured DRG neurons was generally non-cytotoxic and equivalent numbers of neurons were used for the quantitative analyses of immunofluorescence.
- FIG. 11 shows Magi-l Knockdown DRG neurons alters AP properties.
- FIG. 12 shows Magi-l in vivo knockdown.
- A Time course of inflammatory pain responses after 5% formalin injection taken from the entire cohort (6 males and 3 females). No animals were excluded. Nocifensive behaviors were measured over a period of 60 minutes in mice injected with Magi-l shRNA or control shRNA. Injection with formalin produced the typical biphasic response of this model for inflammatory pain. Mice injected with shRNA showed significant reduction in phase II (10-60 minutes) inflammatory pain.
- Figure 13 shows evolutionarily conserved PY motif in Nav channels. WW binding motifs in Nav channels. Sequence alignment of rat Nav channels that have the consensus WW binding motifs. PPSY (SEQ ID NO:73) is the WW motif. Phosphoproteomic data from PhosphoSitePlus ® on Navl.8 channel indicates that threoninel924 in rat, which is threoninel926 in mice (third residue from the C-terminus) is phosphorylated.
- Figure 14 shows representative whole blots for membrane biotinylation experiments. DRG Neuronal biotinylation; (A) Figure 3E, (B) Figure 4D, and (C) Figure 9C, and CHO cell biotinylation (D) Figure 1E.
- Figure 15 shows representative full blots for Western blots and co- immunoprecipitation assays.
- Figure 16 shows Navl.7 protein expression was diminished during in vivo
- Ranges of values are disclosed herein. The ranges set out a lower limit value and an upper limit value. Unless otherwise stated, the ranges include all values to the magnitude of the smallest value (either lower limit value or upper limit value) and ranges between the values of the stated range.
- treatment refers to reduction in one or more symptoms or features associated with the presence of the particular condition being treated. Treatment does not necessarily mean complete cure or remission, nor does it preclude recurrence or relapses.
- treatment in the present disclosure means reducing pain (e.g., decreasing pain sensitivity) or increasing pain sensitivity.
- the term“therapeutically effective amount” as used herein refers to an amount of an agent sufficient to achieve, in a single or multiple doses, the intended purpose of treatment. Treatment does not have to lead to complete cure, although it may. Treatment can mean alleviation of one or more of the symptoms or markers of the indication. The exact amount desired or required will vary depending on the particular compound or composition used, its mode of administration, patient specifics and the like. Appropriate effective amount can be determined by one of ordinary skill in the art informed by the instant disclosure using only routine experimentation. Treatment can be orientated symptomatically, for example, to suppress symptoms. It can be effected over a short period, over a medium term, or can be a long-term treatment, such as, for example within the context of a maintenance therapy.
- Treatment can be continuous or intermittent.
- nucleic acids are written left to right in 5’ to 3’ orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively.
- Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range.
- Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
- Nucleotides likewise, may be referred to by their commonly accepted single-letter codes.
- Navl .8 channels determine the depolarizing phase of the action potential (AP) in nociceptive neurons.
- Navl .8 channel plasma membrane localization, retention and stability occurs through a direct interaction with the PDZ- and WW-domain containing scaffold protein called Magi-l .
- DRG dorsal root ganglion-specific knockdown of Magi-l attenuated thermal nociception and inflammatory pain and deficits in Navl .8 protein expression.
- the present disclosure describes a competing, cell-penetrating, peptide mimetic derived from Navl .8 WW binding motif.
- a peptide of the present disclosure triggered a decrease in sodium current, an almost complete loss of Navl .8 expression and stunted AP firing in DRG neurons.
- a peptide of the present disclosure can also trigger an increase in sodium current.
- a single intraplantar peptide mimetic injection caused a reduction in nocifensive behaviors.
- Magi-l binds to Slack KN 3 channels through a PDZ interaction, resulting in macro-complexing with Navl .8 channels.
- the present disclosure provides a peptide comprising or consisting of the following sequence:
- X 1 is S, P, or A
- X 2 is T, S, or A
- X 3 is A or T
- X 4 is A, T, I, or S
- X 5 is C, S, or F
- X 6 is P or L
- X 7 is any amino acid residue
- X 8 is E, D, or Y
- X 9 is S or R
- X 10 is T, A, E, or D, and T is optionally phosphorylated
- X 11 is K or R
- X 12 is P, A, or G, and wherein X 1 , X 2 ,
- X 3 , X 9 , X 10 , X 11 , or a combination thereof is acylated (e.g., AT n and n is 4-18, (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 ,17, or 18).
- the acyl group myristoyl group.
- a peptide of the present disclosure is acylated at the N- terminus.
- a peptide of the present disclosure is acylated at a nucleophilic atom of an amino acid residue (e.g., the sidechain oxygen atom of a serine or threonine, the sidechain nitrogen of a lysine, and the like).
- X 1 is S or P and is acylated (e.g., myristoyl ated) at the amine N-terminal amine of X 1 .
- the sequence further comprises -PPX 7 Y- at the -X 6 PX 7 Y- portion of the peptide sequence, where X is any amino acid residue.
- X 7 is S.
- an acylated amino acid residue e.g., n and n is 4-18, (e.g., 4, 5, 6, 7,
- the myristoylated amino acid residue is S, P, or A. In an embodiment for human use, the myristoylated amino acid residue is S or P.
- the at least one intervening amino acid residue comprises T, S, or A, wherein said T, S, or A immediately succeeds (i.e., follows, going from N- to C-terminus) the myristoylated amino acid residue.
- said T, S or A is immediately succeeded by A or T.
- said A or T is
- A, T, S or I immediately succeeded by A, T, S or I.
- said A or T is immediately succeeded by A, T or S.
- said A, T, S or I is immediately succeeded by C, S or F.
- said A, T or S is immediately succeeded by C, S or F.
- said first amino acid sequence comprises PXY, wherein X is any amino acid residue.
- said first amino acid sequence comprises UPXY
- the terminal amino acid sequence comprises A, D,
- amino acid residue capable of being phosphorylated and dephosphorylated is T.
- amino acid residue capable of being phosphorylated and dephosphorylated is phosphorylated.
- amino acid residue capable of being phosphorylated and dephosphorylated is not phosphorylated.
- the terminal amino acid sequence comprises D or E, wherein said D or E immediately succeeds said first amino acid sequence.
- said D or E is immediately succeeded by R or S.
- said R or S is immediately succeeded by V.
- said V is immediately succeeded by said A, D, E, or amino acid residue capable of being phosphorylated and dephosphorylated.
- said A, D, E, or amino acid residue capable of being phosphorylated and dephosphorylate is immediately succeeded by K or R.
- said K or R is immediately succeeded by P, A or G.
- the peptide has any one of the sequences in Tables
- the present disclosure provides a peptide wherein the myristoylated amino acid is S, the at least one intervening amino acid residue is TAAC (SEQ ID:72), the first amino acid sequence is PPSY (SEQ ID NO:73) and the terminal amino acid sequence is DRVTKP (SEQ ID NO:74).
- sequences of Table 1 were derived from the WW binding domains in sodium channels SCN1A, SCN2A, SCN3A, SCN5A, SCN8A, SCN9A, SCN10A and further modified (e.g., acylated).
- the peptides of SEQ ID NOs. 1-14 use threonine as the third last amino acid of the sequence. Threonine is capable of being phosphorylated and
- a peptide of the current disclosure increases or decreases inward sodium current of neurons.
- Sodium current is typically measured at peak.
- a peptide of the present disclosure increases or decrease sodium current of neurons in a local/targeted area (e.g., an area of treatment).
- a peptide of the present disclosure is not an anesthetic agent.
- a peptide of the present disclosure that decreases sodium current does not act as a sodium channel blocker, but rather induces degradation of sodium channels.
- the present disclosure also provides a pharmaceutical
- composition comprising a pharmaceutically acceptable carrier, a peptide of the present disclosure, optionally, a Magi- 1 targeting shRNA or Magi- 1 targeting siRNA and, optionally, one or more analgesic agents (e.g., nonsteroidal anti-inflammatory drugs (NSAIDS)) and/or one or more anesthetic agent.
- analgesic agents or anesthetic agents include bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or a combination thereof.
- analgesics include acetaminophen, aspirin, ibuprofen, naproxen, and the like, and salts thereof.
- the compositions can be formulated as intramuscular, intradermal, intrathecal or nerve injections, topical creams or transdermal patches.
- Non-limiting examples of siRNA include GGA A AG AC AGC C AGA AU AGUU (SEQ ID NO:88), GCCCAAGCUCCAGAUCAAACU (SEQ ID NO: 89), GUGGAUGGGACGCCAGUAAUU (SEQ ID NO: 90);
- GAAGCAUUCUCGAGCUAUAGA SEQ ID NO:9l
- GUUUCCCCUAUUCACCAGUGU SEQ ID NO:92
- GCCUCUCGCACCAUGUGAUUA SEQ ID NO:93
- GAC C A AG AGC GA AGGA AU GUU (SEQ ID NO: 94), GUUCCUCAGAUCCAAUUGUUA (SEQ ID NO: 95), GACCAUCUGAGCCCACUACUA (SEQ ID NO: 96),
- the agent is a siRNA for use in RNA interference (RNAi) mediated silencing or downregulation of MAGI- 1 mRNA.
- RNAi agents are commonly expressed in cells as short hairpin RNAs (shRNA).
- shRNA is a RNA molecule that contains a sense strand, antisense strand, and a short loop sequence between the sense and antisense fragments.
- shRNA is exported into the cytoplasm where it is processed by dicer into short interfering RNA (siRNA).
- siRNA are typically 20-23 nucleotide double-stranded RNA molecules that are recognized by the RNA-induced silencing complex (RISC). Once incorporated into RISC, siRNA facilitate cleavage and degradation of targeted mRNA.
- RISC RNA-induced silencing complex
- the polynucleotide agent can be either a siRNA or a shRNA.
- shRNAs for use in various aspects of the instant disclosure are provided in Example 1.
- shRNA can be expressed from any suitable vector such as a recombinant viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
- any viral vector capable of accepting the coding sequences for the shRNA molecule(s) to be expressed can be used.
- suitable vectors include but are not limited to vectors derived from adenovirus, adeno- associated virus, retroviruses (e.g, lentiviruses), rhabdoviruses, murine leukemia virus, herpes virus, and the like.
- a preferred virus is a lentivirus.
- the tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses.
- chemically stabilized shRNA or siRNAs may also be used administered as the agent in the method of the invention.
- Vectors for expressing shRNA which in turn produces siRNA once introduced into a cell are commercially available.
- shRNAs or siRNAs targeted to virtually every known human gene are also known and are commercially available.
- compositions comprising at least one peptide of the present disclosure.
- compositions include solutions, suspensions, emulsions, solid injectable compositions that are dissolved or suspended in a solvent before use, and the like.
- the injections may be prepared by dissolving, suspending or emulsifying one or more of the active ingredients in a diluent.
- diluents include, but are not limited to distilled water for injection, physiological saline, vegetable oil, alcohol, and a combination thereof.
- the injections may contain stabilizers, solubilizers, suspending agents, emulsifiers, soothing agents, buffers, preservatives, etc.
- the injections may be sterilized in the final formulation step or prepared by sterile procedure.
- the composition of the disclosure may also be formulated into a sterile solid preparation, for example, by freeze-drying, and can be used after sterilized or dissolved in sterile injectable water or other sterile diluent(s) immediately before use.
- compositions may include one or more pharmaceutically acceptable carrier.
- Pharmaceutically-acceptable carriers include, but are not limited to, sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, including sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; is
- peptide of the present disclosure or composition thereof is used to alter (e.g., increase or decrease) a subject’s pain sensitivity (e.g., a subject in need of treatment for pain and/or pain sensitivity).
- a subject e.g., a subject in need of treatment for pain and/or pain sensitivity.
- a subject e.g., a subject in need of treatment for pain and/or pain sensitivity.
- a subject’s pain is decreased (e.g., ameliorated) when the subject’s pain sensitivity is decreased.
- a subject’s pain sensitivity is increased.
- a peptide of the present disclosure, a composition thereof, Magi-l targeting shRNA, or Magi-l targeting siRNA are used to manage pain (e.g., pain control).
- the present disclosure further provides a method of treating a subject afflicted with pain comprising administering a peptide of the present disclosure, a composition comprising a peptide having the sequence of SEQ ID NOs: l-7, 15-21, Magi-l targeting shRNA, or Magi-l targeting siRNA to the subject in an amount effective to treat the pain.
- Treating pain includes, but is not limited to, decreasing the subject’s sensitivity to pain.
- a subject in need of treatment may be a human or non-human mammal.
- Non-limiting examples of non-human mammals include cows, pigs, mice, rats, rabbits, cats, dogs, or other agricultural, pet, or service animals, and the like.
- a subject e.g., pain sensitivity, pain intensity, pain relief in response to an intervention/treatment, patient ratings of improvement and satisfaction with
- pain interference with physical functioning can be determined (e.g., determined at rest, during, or after activity) by description from the subject based on pain assessments using a variety of validated pain measurement tools (e.g., visual analog pain scale (VAS), numeric rating pain (NRS), categorical verbal rating pain scale (VRS), multidimensional scales assessing the sensory components and also cognitive and psychological dimensions of pain, health-related quality- of-life assessment, pain-related functional assessments).
- VAS visual analog pain scale
- NRS numeric rating pain
- VRS categorical verbal rating pain scale
- multidimensional scales assessing the sensory components and also cognitive and psychological dimensions of pain, health-related quality- of-life assessment, pain-related functional assessments.
- Non-limiting examples of pain measurement tools include the VAS, NRS, VRS, the McGill Pain Questionnaire (MPQ) and its Short Form, The Brief Pain Inventory (BPI), Neuropathic Pain Score (NPS), The Pain Self-Efficacy Questionnaire, Patient Global Impression of Change scale, The European Quality of Life Instrument (EQ 5D), Pain Disability Index (PDI), The Oswestry Disability Index (ODI), the Beck Depression Inventory and Profile of Mood States, the Wong-Baker faces pain scale, the FLACC scale (face, legs, activity, cry, and consolability), the CRIES scale (crying, requires O2 for Sa02 ⁇ 95%, increased vital signs (BP and HR), expression, sleepless), the COMFORT scale, Mankoski pain scale, descriptor differential scale of pain intensity, and the like, and combinations thereof.
- the Magi-l targeting shRNA, or Magi-l targeting siRNA may be human Magi-l targeting shRNA or human Magi- 1 targeting siRNA.
- a subject’s pain may be ameliorated when the subject’s pain (e.g., pain sensitivity) decreased.
- a subject’s pain is ameliorated when the subject’s pain (e.g., pain sensitivity) is at a desired level (e.g., the pain is not uncomfortable).
- the subject is in need of said peptide, Magi-l targeting shRNA, or Magi-l targeting siRNA.
- a subject’s pain is nociceptive.
- a subject’s pain is neuropathic.
- a subject’s pain may be a symptom of any disease, condition, or occurrence, such as injury (e.g., spinal cord injury, nerve injury, or burns), chronic disease (e.g., diabetes, Herpes zoster, major depressive disorder, fibromyalgia arthritis, or cancer), chronic inflammation (e.g., chronic inflammation associated with repetitive stress, such as, for example, carpal tunnel syndrome), chemotherapy, radiation, or Morton’s neuroma.
- the pain may also be post-surgical pain.
- a subject is treated preemptively for pain (e.g., prior to anticipated pain, such as pain caused during, for example, surgery, chemotherapy, dental work, radiation treatment, and the like).
- the subject is treated for pain following a procedure that induces pain.
- procedures include, for example, surgery, chemotherapy, radiation treatment, and the like, and combinations thereof.
- the subject has chronic pain and/or acute pain.
- Chronic pain is any pain lasting for more than around 12 weeks.
- chronic pain is pain that extends beyond the expected period of healing.
- Acute pain is sharp, and does not typically last longer than around six months.
- Acute pain goes away when there is no longer underlying cause of pain.
- Causes for acute pain include, but are not limited to, surgery, broken bones, dental work, bums, cuts, labor/childbirth, and combinations thereof, and the like.
- the subject does not take opioids, cannot take opioids, suffers from opioid addiction, or is at risk of relapse for opioid addiction.
- the present disclosure provides a method of inducing local analgesia in a subject comprising administering composition comprising a peptide having the sequence of any one of SEQ ID NOs. 1-7 or 15-21, Magi-l targeting shRNA, or Magi-l targeting siRNA to the subject in analgesic effective amount (e.g., a therapeutically effective amount).
- the present disclosure further provides a method of increasing pain sensitivity of a subject comprising administering a composition comprising a peptide having the sequence of any one of SEQ ID NOs. 8-14 or 21-35 to the subject at an amount effective to increase pain sensitivity.
- peptide of the present disclosure a composition thereof,
- Magi-l targeting shRNA, or Magi-l targeting siRNA can be used to alter pain sensitivity locally (e.g., in an area of treatment).
- the subject may be afflicted with a disease or condition having a symptom of pain hyposensitivity.
- diseases or conditions include, but are not limited to, amyotrophic lateral sclerosis, multiple sclerosis, schizophrenia, autism spectrum disorders (e.g., Asperger’s syndrome and the like), congenital hyposensitivity to pain, and diabetes-induced nerve loss.
- one can administer or use one or more peptides of present disclosure e.g., one or more peptide of the present disclosure that are the same or different.
- one or more composition comprising a peptide of the present disclosure e.g., one or more peptide of the present disclosure that are the same or different
- Magi-l targeted shRNA, or Magi-l targeted siRNA may be administered or used in combination with one or more analgesic and/or one or more anesthetic (e.g., lidocaine) agent and/or with an anti-inflammatory agent (e.g., glucorticoid).
- any of the foregoing are used or administered in combination, the use or administration may occur simultaneously or sequentially. Any of the foregoing may be formulated in combined formulation or in separate formulations.
- An exemplary co-administration is the co-administration of i) a peptide having the sequence of any one of SEQ ID NOs: 1-7, 15-21, Magi-l targeting shRNA or Magi-l targeting siRNA and ii) a peptide having the sequence of any one of SEQ ID NOs:8-l4 or 22-35, where i) is administered after ii) or ii) is administered after i). There may be a delay between the administration of i) and ii) or ii) and i). In another example, i) is administered immediately (e.g., without delay) after ii) or ii) is administered immediately (e.g., without delay) after i).
- Co-administration may be used to reverse the first added peptide.
- a subject who has been treated for pain e.g., the subject’s pain sensitivity has been decreased
- a peptide of having the sequence of any one of SEQ ID NOs: 1-7 or 15-21 may administered a peptide having the sequence of any one of SEQ ID NOs: 8-14 or 22-35, such that the subject’s pain sensitivity increases.
- the subject may be administered a peptide having the sequence of any one of SEQ ID NOs:8-l4 or 22-35 to increase pain sensitivity.
- the subject may be administered a peptide having the sequence of any one of SEQ ID NOs: 1-7 or 15-21 to decrease the subject’s pain sensitivity.
- a peptide of the present disclosure in an embodiment, a composition thereof, a
- the peptides of present disclosure, Magi-l targeting shRNA, or Magi-l targeting siRNA may be administered to the subject in a variety of ways. For example, they may be injected into spinal nerves or nerve endings during and/or after surgery.
- the peptides, Magi-l targeting shRNA, or Magi-l targeting siRNA may also be administered intramuscularly or intradermally. Additionally, the peptides may be administered topically. Without intending to be bound by any particular theory, the most effective route or the administration of shRNAs is administration directly into nerves.
- one or more compound and/or one or more composition comprising one or more compound described herein is administered to a subject in need of treatment using any known method and route, including, but not limited to, oral, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intranasal and intracranial injections.
- Parenteral infusions include, but are not limited to intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. Topical and/or transdermal administrations are also encompassed. Further encompassed are methods of application involving needleless injections.
- a subject in need of treatment is administered a
- a dose of a therapeutically effective amount of a peptide of the present disclosure may have a concentration of 10 nM to 10 mM (e.g., 100 mM), including all 0.1 nM values and ranges therebetween.
- a dose of a therapeutically effective amount of a peptide of the present disclosure may have a concentration of 10 nM to 10 mM (e.g., 100 mM), including all 0.1 nM values and ranges therebetween.
- a dose of a therapeutically effective amount of a peptide of the present disclosure may have a
- a subject in need of treatment is administered a peptide of the present disclosure, a composition thereof, a Magi-l targeting shRNA, or a Magi-l targeting siRNA as a single dose (e.g., a single administration step).
- a single dose the subject’s pain is ameliorated or the subject’s pain sensitivity is increased for 1-120 hours (hr(s) or h) (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all second values and ranges therebetween.
- the subject’s pain is ameliorated or the subject’s pain sensitivity is increased in the absence of any other active components (e.g., an additional analgesic agent and/or an anesthetic agent) for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all second values and ranges therebetween.
- active components e.g., an additional analgesic agent and/or an anesthetic agent
- a subject in need of treatment is administered a peptide of the present disclosure, a composition thereof, a Magi-l targeting shRNA, or a Magi-l targeting siRNA in multiple doses dose (e.g., multiple administration steps).
- the subject’s pain is ameliorated or the subject’s pain sensitivity is increased for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all second values and ranges therebetween.
- the subject’s pain is ameliorated or the subject’s pain sensitivity is increased in the absence of any other active components (e.g., an additional analgesic agent and/or an anesthetic agent) for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all second values and ranges therebetween.
- active components e.g., an additional analgesic agent and/or an anesthetic agent
- the disclosure further provides kits.
- kits comprises pharmaceutical preparations containing any one or any combination of compounds of the present disclosure.
- the kit comprises a package (e.g., a closed or sealed package) that contains a pharmaceutical preparation, such as, for example, one or more closed or sealed vials, bottles, blister (bubble) packs, or any other suitable packaging for the sale, distribution, or use of the pharmaceutical compounds and compositions comprising them.
- a package e.g., a closed or sealed package
- a pharmaceutical preparation such as, for example, one or more closed or sealed vials, bottles, blister (bubble) packs, or any other suitable packaging for the sale, distribution, or use of the pharmaceutical compounds and compositions comprising them.
- the printed material includes, but not limited to, printed information.
- the printed information may be provided on a label, or on a paper insert, or printed on the packaging material itself.
- the printed information may include information that, for example, identifies the composition in the package, the amounts and types of other active and/or inactive ingredients, and instructions for taking the composition, such as, for example, the number of doses to take over a given period of time, and/or information directed to a pharmacist and/or another health care provider, such as a physician, or a patient.
- the printed material may include, for example, an indication that the pharmaceutical composition and/or any other agent provided with it is for treatment of a subject having a bacterial infection.
- the product includes a label describing the contents of the container and providing indications and/or instructions regarding use of the contents of the container to treat a subject having any bacterial infection.
- the present disclosure further provides peptides of SEQ ID NO: 1
- NOs:36-70 for use as research tools. As such, they can be administered to research subjects, such as mice and rats.
- the peptides are also useful for in vitro testing.
- X 1 is chosen from S, P, and A;
- X 2 is chosen from T, S, and A;
- X 3 is chosen from A and T;
- X 4 is chosen from A, T, I, and S;
- X 5 is chosen from C, S, and F;
- X 6 is chosen from P and L;
- X 7 is any amino acid residue
- X 8 is chosen from E, D and Y;
- X 9 is chosen from S and R;
- X 10 is chosen from T, A, E, and D, and T is optionally phosphorylated;
- X 11 is chosen from K and R;
- X 12 is chosen from P, A, and G,
- Statement 4 The peptide according to Statement 2, where the peptide has a sequence chosen from SEQ ID NO: 8-14 and 22-35.
- peptide has the following sequence:
- peptide has the following sequence:
- SATSFPPSYESVTRG SEQ ID NO:7
- SSTTSPPSYDSVTKP SEQ ID NO: 13
- SATSFPPSYESVTRG SEQ ID NO: 14
- SSTTSPPSYDSVAKP SEQ ID NO:20
- SATSFPPSYESVARG SATSFPPSYESVARG (SEQ ID NO:2l), SSTTSPPSYDSVEKP (SEQ ID NO:27),
- SATSFPPSYESVERG SEQ ID NO:28
- SSTTSPPSYDSVDKP SEQ ID NO:34
- SATSFPPSYESVDRG SEQ ID NO:35
- Statement 8 A composition comprising one or more peptide according to any one of the preceding Statements and a carrier.
- Statement 9 The composition according to Statement 8, comprising at least two peptides according to any one of Statements 1-7, where the at least two peptides are the same or different.
- Statement 10 The composition according to Statements 8 or 9, further comprising one or more analgesic agent and/or one or more anesthetic agent.
- Statement 11 The composition according to Statement 10, where the one or more analgesic and/or one or more anesthetic agent is bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or a combination thereof.
- the one or more analgesic and/or one or more anesthetic agent is bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or a combination thereof.
- Statement 12 The composition according to any one of Statements 8-11, where the carrier is a pharmaceutically acceptable carrier.
- a method of treating pain or increasing pain sensitivity in a subject in need of treatment comprising:
- Statement 14 The method according to Statement 13, where the subject’s pain is chronic pain.
- Statement 15 The method according to Statement 13, where the subject’s pain is acute pain.
- administration step is performed in anticipation of pain
- Statement 17 The method according to any one of Statements 14-16, where the subject in need of treatment has an injury, a chronic disease, a chronic inflammation, Morton’s neuroma, post-operative pain, or a combination thereof.
- Statement 18 The method according to Statement 17, where the injury is a spinal cord injury, a nerve injury, a bum, or a combination thereof.
- Statement 19 The method according to Statement 17, where the chronic disease is diabetes, Herpes zoster, major depressive disorder, fibromyalgia arthritis, amyotrophic lateral sclerosis, multiple sclerosis, schizophrenia, autism spectrum disorders, cancer, or a combination thereof.
- administering step induces an increase or decrease in sodium current.
- Statement 21 The method according to any one of Statements 14-20, where the peptide administered to the subject has a sequence chosen from SEQ ID NOs: l-7, 15-21, and combinations thereof.
- Statement 22 The method according to any one of Statements 14-21, where the subject’s pain is ameliorated (e.g., the subject’s pain sensitivity is decreased).
- Statement 23 The method according to any one of Statements 14-22, where subject’s pain is ameliorated (e.g., the subject’s pain sensitivity is decreased) for 1-120 hours following a single administration step.
- Statement 24 The method according to any one of Statements 14-23, where subject’s pain is ameliorated (e.g., the subject’s pain sensitivity is decreased) for 24-120 hours following a single administration step.
- Statement 25 The method according to any one of Statements 14-20, where the subject’s pain sensitivity is increased.
- Statement 26 The method according to any one of Statements 14-20 or 25, where the peptide administered to the subject has a sequence chosen from SEQ ID NOs:8-l4, 22-35, and combinations thereof.
- Statement 27 The method according to any one of Statements 14-20, 25, or 26, where the subject’s pain sensitivity is increased for 1-120 hours following a single administration step.
- Statement 28 The method according to any one of Statements 14-20 or 25-27, where the subject’s pain sensitivity is increased for 24-120 hours following a single administration step.
- Statement 29 The method according to any one of Statements 14-20 or 25-28, where the subject is administered a peptide having a sequence chosen from SEQ ID NOs: l-7, 15-21, and combinations thereof, followed by a peptide having a sequence chosen from SEQ ID NOs:8-l4, 22-35, and combinations thereof.
- Statement 30 The method according to any one of Statements 14-20 or 25-29, where the subject is administered a peptide having a sequence chosen from SEQ ID NOs:8-l4, 22-35, and combinations thereof, followed by a peptide having a sequence chosen from SEQ ID NOs: l-7, 15-21, and combinations thereof.
- administering step comprises administering one or more of the follow sequences:
- SSTTSPPSYDSVTKP SEQ ID NO:6
- SATSFPPSYESVTRG SEQ ID NO:7
- SSTTSPPSYDSVTKP SEQ ID NO: 13
- SATSFPPSYESVTRG SEQ ID NO: 14
- SSTTSPPSYDSVDKP SEQ ID NO:34
- SATSFPPSYESVDRG SEQ ID NO:35
- KN O channel expression is affected by the PDZ binding motif Slack and Slick channels contain a type 1 PDZ binding motif at their respective distil C-termini (Fig. 1 A). ETsing the PDZ protein interactive predictor (PDZPedlnt, ETniversity of Freiburg), and inputting the Slack amino acid sequence Magi-l was identified as a Slack channel interactor, specifically the second and fifth PDZ domain of Magi-l. Heterologous co-expression of Magi-l and the Slack-B subunit, increased Slack current density (Fig. 1B), however, co- expression of Magi-l with a mutated Slack construct with a truncated PDZ motif did not affect Slack current density (Fig.
- Magi-l knockdown also decreased I and Navi.8 plasma membrane expression in DRG neurons.
- the effects of Magi-l knockdown were examined on the inward sodium current (Ha) in DRG neurons using whole-cell voltage-clamp recordings.
- Magi-l knockdown produced a significant reduction in total Ha (Figs. 4A-C).
- the peak tetrodotoxin (TTX)- sensitive and the TTX-resistant components of IN 3 were both significantly reduced compared to neurons treated with control siRNA accounting for the hypoexcitability phenotype seen in DRG neurons during Magi-l knockdown despite decreased membrane Slack expression.
- Magi-l is expressed in small- and medium- sized DRG neurons, in their axonal tracts and at some Nodes ofRanvier. The expression of Magi-l in intact DRG neurons was verified for indication of its broader physiological function. The Allen Mouse Spinal Cord Atlas and BioGPS support high Magi-l message within DRG neurons.
- Double immunolabeling studies also depicted a co-localization between Magi-l and Navl.8 in cultured and intact DRG neurons and within the spinal cord (Fig. 6B).
- Co-IP experiments using Slack and Navl.8 specific antibodies from intact DRG lysates were performed and successfully co-immunoprecipitated Slack with Nav 1.8 (Fig. 6C) indicating that Navl .8 and Slack KN 3 channels are complexed together in DRG neurons.
- Navl.8 channels also contain PY motifs (PPXY (SEQ ID NO:76)) ( Figure 13) at their distal C-termini and this motif was postulated to regulate the interaction with Nedd4-2 ubiquitin ligase for targeted protein degradation.
- the WW domain of Nedd4-2 shares high sequence homology with the WW domains in Magi-l.
- Magi proteins have been shown to protect Nedd4-2 target proteins from degradation via WW interaction. Therefore, it was opted to compete off WW domain binding of Navl.8, using cell-penetrating PY motif peptide mimetics.
- Fig. 9B We assessed surface expression of Navl.8 channels after treatment with the PY peptide was assessed and a substantial decrease of Navl.8 channels at the plasma membrane was found while there was a significant increase of Navl.8 membrane expression with phospho-PY peptide (Fig. 9C). Moreover, a substantial decrease was observed in total Navl.8 protein after incubation with PY peptide suggesting that Navl.8 protein stability is dependent upon this WW binding motif. These results indicate that the phosphorylation status of the competitor Navl.8 PY motif peptide was essential for the stabilization of Navl.8 channels. Furthermore, these data imply that other sodium channels are potentially regulated by PY motif interactions (Fig. 9A,B).
- mice were given a single i.pl. injection of either PY, phospho-PY, or a scrambled PY peptide (100 mM, 20 pl) to the right hindpaw, 24 hrs before injection with 5% formalin into the same paw.
- Pretreatment with the PY peptide significantly reduced Phase II acute inflammatory pain, and the phospho-PY peptide pretreated mice exhibited a contrasting increase in phase II response when compared to scrambled peptide-treated mice (Fig. 9D).
- Thrl926 is predicted to be either a Casein II kinase or a GSK-3 kinase consensus phosphorylation site. Both kinases are constitutively active kinases suggesting that Thrl926 is likely basally phosphorylated. Without intending to be bound by any particular theory, it is speculated that the phospho-PY peptide competed with phosphorylated Navl.8 channels at ULs, preventing a significant proportion of Navl.8 channels from being ubiquitinylated and retained within the cytosol (Fig. 9E).
- peptidomimetic produced significant analgesia 24 hours after administration (Fig. 9D).
- the PY peptide acted as a local long-lasting analgesic and could have therapeutic value for invasive procedures that require long-lasting analgesia and/or to reduce the need for postsurgical opioids.
- the phospho-PY peptide drove Navl.8 channels to the DRG neuronal membrane and exacerbated nocifensive behavior and therefore has potential value for pain insensitivity-related diseases.
- Myristoylation allows the peptide to partition through the membrane, possibly by a flip-flop mechanism but keeps most of the peptide tethered to the inner surface of the membrane.
- This membrane-delimited feature may enhance the ability of peptides to exert their mimetic effects, especially for membrane-associated proteins.
- myristoylation of peptides and their inherent hydrophobic nature likely ensure that peptides are localized to the site of injection.
- the metabolism of these peptides requires phospholipid membrane turnover possibly contributing to their long-lasting effects in vivo.
- Prior studies using a similar intradermal injection approach of a peptidomimetic for the T-meml00 protein, important for the TRPA1-TRPV1 complex showed an analgesic effect during paclitaxel-induced chronic pain. Therefore, the use of myristoylated cell-penetrating peptides offers a potential therapeutic approach to manipulate nerve-ending activity.
- EXPERIMENTAL PROCEDURES Animals- All animals used in the present study were housed at the ETniversity at Buffalo (UB) Laboratory Animal Facility on a 12/12 light/dark cycle with free access to food and water. All experimental procedures were in accordance with the guidelines in“Guide for the Care and Use of Laboratory Animals” from the National Institute of Health and were approved by the University at Buffalo Institutional Animal Care Use Committee.
- DRG neurons were dissected from the embryos and enzymatically digested with Trypsin (2.5 mg/ml) at 37°C for 45 min, followed by dissociation and plating. DRG neurons were plated onto poly-D-lysine (Sigma; 100 pg/ml) and laminin (Invitrogen; 3 pg/ml) coated coverslips.
- Neurons were maintained at 37°C in a 7% CO2 humidified incubator in serum-free medium, comprised of the trophic factors N2 (Gemini Bio products; 1%), l-Glutamine (Invitrogen; 200 pg/ml), and Nerve Growth Factor (NGF) (Harlan; 100 ng/ml; essential for embryonic neuronal survival) in 50% DMEM and 50% F-12.
- NGF Nerve Growth Factor
- DRG neurons were cultured in C2 media containing the anti-mitotic agent cytosine b-d-arabinofuranoside hydrochloride (Sigma; 3 pM). This was followed by two days of recovery were neurons received regular serum free media before neurons were used for experiments. All subsequent experiments using embryonic cultures were performed on days 5-10 of neuronal culture.
- C2 media containing the anti-mitotic agent cytosine b-d-arabinofuranoside hydrochloride (Sigma; 3 pM).
- CHO cells were plated on l2mm coverslips for immunolabeling experiments, in 35 mm dishes for all electrophysiology experiments, and in six-well culture plates for biochemical experiments. Cells were co-transfected with either 0.5 pg Slick (p TRACER) or 0.5 pg Slack (p TRACER) plus 0.5 pg Magi-l (pcDNA3.
- Magi-l was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). A negative control siRNA composed of a scrambled sequence was obtained from the same vendor. For each experiment, neurons were transfected with Magi-l siRNA or a non -targeting control siRNA. Cultured DRG neurons (described above) were transfected using lipofectamine 2000 (ThermoScientific) following the manufacturer’s protocol. Briefly, we diluted 1.5 pl lipofectamine 2000 in 50 m ⁇ of Opti-mem Medium and allow the mixture to sit at room temperature for 5 minutes.
- lipofectamine 2000 ThermoScientific
- DRG neurons were co-transfected with the GFP containing plasmid pTRACER and siRNA duplexes for positive indication of transfection. Imunofluorescence procedures on cultured neurons were performed as previously described. Investigator was blinded to the transfection condition.
- Identical bath and pipette solutions were used in both the voltage-clamp and current-clamp modes.
- voltage-clamp mode macroscopic currents were recorded at voltages ranging from -120 to +120.
- Cells were clamped at -70 mV and voltage steps of 20 mV applied for 200 millisecond durations.
- the cell capacitance for CHO cells ranged from 10-15 pF and for cultured DRG neurons 20-25 pF recorded under these conditions.
- a current-clamp protocol consisting of depolarizing steps in increments of 10 pA from 10 to 200 pA (20 ms duration) was used to examine action potential firing.
- Firing frequency of individual neurons was assessed by measurement of repetitive discharge upon injecting of a supra-threshold stimulus of 400 pA for 1000 ms.
- the pipette solution contained (in mM): 130 CsCl, 13 CsF, 10
- tetraethylammonium chloride 1 MgCh, 1 EGTA, 2.5 Na2ATP, 10 HEPES, pH was adjusted to 7.2 with CsOH.
- the bath solution contained (in mM) 140 NaCl, 5.4 KC1, 1 CaCh, 1 MgCh, 10 HEPES, and 10 glucose (pH 7.4).
- DRG neurons were recorded in a bath solution containing 250 nM TTX. DRG neurons were recorded at voltages ranging from -60 to +60 mV. Cells were held at -70 mV and a was evoked by incremental 10 mV depolarizing steps for 50 ms duration.
- SN Immunohistochemistry- Sciatic nerve
- SC lumbar spinal cord
- thoracic DRGs were isolated from adult mouse. Briefly, animals were anesthetized with fetal plus, perfused transcardially with iced cold PBS containing heparin (50 pg/ml) and sodium nitrite (5 mg/ml) followed by iced cold 4% paraformaldehyde (PFA). DRGs, SN, and SC were subsequently removed, cleaned of surrounding tissue and post-fixed in 4 % PFA overnight at 4 °C. The following day, SN and DRGs were transferred to 20% sucrose
- mice anti-Navl.8 antibody (1 :250; NeuroMab)
- rabbit anti-Magi-l antibody (1 : 100; Abeam
- mouse anti-Magi-l antibody (1 : 100; Novus Biochemical
- rabbit anti-Caspr (1 :250; Abeam)
- chicken anti-Slack antibody (1 :750).
- secondary antibodies Alexa Fluor 633 goat anti-mouse, Alexa Fluor 488 goat anti -rabbit, and Alexa Fluor 546 goat anti-chicken were added (1 : 1000) overnight.
- Membranes were probed overnight at 4 °C with antibodies against Slack anti-mouse (1 :500; NeuroMab), rabbit anti-b- Actin (1 :500; Millipore), rabbit anti-Magi-l (1 : 100; Abeam), mouse anti-Magi-l (1 : 100; Novus Biochemical), mouse anti-Navl.8 (1 :200; NeuroMab), mouse anti-Navl.7 (1 :200; NeuroMab), mouse anti-Flag (1 :500; Sigma) in 5% milk prepared in IX Tris-buffered saline tween (TBST).
- TST IX Tris-buffered saline tween
- the membrane was washed three times for five minutes in IX TBST before being incubated for 1 hour at room temperature in Anti-mouse or Anti rabbit horseradish peroxidase conjugate (1 :5000; Promega) and 0.1% BSA prepared in IX PBS. The membrane was again washed 3 times for 5 minutes before being developed and imaged. Bands were visualized with enhanced chemiluminescence (Thermo Scientific) and quantified with Image J Software (NIH). Each experiment was repeated at least three times.
- mice were anesthetized using isoflurane (induction: 4% and maintenance: 2%), and placed in a prone position. A 3-cm posterior longitudinal skin incision was made at the lumbar segment of the spine. The ipsilateral paraspinal muscles were carefully separated, using a pair of sterile toothpicks, from their attachments at the L4-S1 levels of the vertebral column.
- RNA Extraction and cDNA Synthesis- RNeasy Micro Kit (Qian) was used for total RNA extraction from mouse lumbar DRG neurons. RNA was reverse transcribed with Superscript III Reverse Transcriptase (Life Technologies). Polymerase chain reaction was performed using this cDNA as the template with previously validated primers against Magi-l and Navl.8. Transcriptional abundance was measured by thermocycler using SYBR Green PCR Master Mix. For quantification, a 50 cycle two step denaturing and annealing protocol was used, with a 15 second absorbance reading on BioRad iQ5 cycler. Each sample was performed in triplicates.
- peptidomimetic NPETRDETQL (SEQ ID NO:79) based upon the C-terminal sequence of the rat Slack channel.
- This peptide and the scrambled variant peptide, QPNTRLDETE (SEQ ID NO:80), were synthesized by GenScript.
- the PY peptide SATSFPPSYDSVTRG (SEQ ID NO:77) and the phospho-PY peptide SATSFPPSYDSV(pT)RG (SEQ ID NO:77, where T is phosphorylated) were designed based upon the WW binding domain in rat Navl.8 channels.
- peptides and the scrambled peptide SDRPVTSYSFSAPG were also synthesized by GenScript. Peptides were initially dissolved in DMSO and diluted to final working concentration in saline. Peptide concentration of 10 mM was used on primary neurons as previously described; final DMSO concentration was 0.05%. Intraplantar dosing was chosen based on a prior study demonstrating the analgesic effects of hindpaw intradermal injections of a different myristoylated peptide.
- threonine is protected by trityl ethers
- N-myristoyltransferase the enzyme that catalyzes protein N- myristoylation (at the N-terminus).
- Statistics- Clampfit (Molecular Devices) and Origin 8.0 (Origin Lab) software were used for all electrophysiology data analysis. Densitometry analyses of Western blots were done using Image J (NIH) software. Statistical analysis was done using GraphPad Prism 4 (GraphPad, San Diego, CA). Single between group comparisons were made using Student's t-test. Multiple comparisons were investigated using one-way or two-way ANOVA followed by Bonferroni’s test to detect pair wise between-group differences. Data are presented as mean +/- SEM.
- RNA Extraction and cDNA Synthesis for Real Time PCR RNeasy Micro Kit
- Plasmid DNA encoding MAGI-l shRNAs for humans To make a therapeutic shRNA for pain treatment, we would screen the human Magi-l mRNA sequence for 3 unique interfering RNA sequences, and then each one of those sequences (in DNA form) would be inserted into a plasmid containing the minimal promoter for the human Navl.8 channel, thus creating 3 plasmids. Expression of the shRNA driven under the minimal Navl .8 channel promoter would ensure that that Magi-l targeted shRNAs are only expressed in pain sensing neurons.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Engineering & Computer Science (AREA)
- Pain & Pain Management (AREA)
- Epidemiology (AREA)
- Rheumatology (AREA)
- Anesthesiology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18887737.7A EP3723781B1 (en) | 2017-12-13 | 2018-12-13 | Peptides and other agents for treating pain and increasing pain sensitivity |
| US16/771,204 US11535649B2 (en) | 2017-12-13 | 2018-12-13 | Peptides and other agents for treating pain and increasing pain sensitivity |
| CA3085576A CA3085576A1 (en) | 2017-12-13 | 2018-12-13 | Peptides and other agents for treating pain and increasing pain sensitivity |
| JP2020532629A JP2021506794A (ja) | 2017-12-13 | 2018-12-13 | 疼痛を治療し、疼痛感受性を増大させるためのペプチド及び他の薬剤 |
| CN201880089341.7A CN111712252A (zh) | 2017-12-13 | 2018-12-13 | 用于治疗疼痛和提高疼痛敏感性的肽和其它药剂 |
| AU2018383669A AU2018383669B2 (en) | 2017-12-13 | 2018-12-13 | Peptides and other agents for treating pain and increasing pain sensitivity |
| IL275340A IL275340A (en) | 2017-12-13 | 2020-06-14 | Peptides and other active compounds to treat pain and increase pain sensitivity |
| US17/956,031 US12077610B2 (en) | 2017-12-13 | 2022-09-29 | Peptides and other agents for treating pain and increasing pain sensitivity |
| JP2023195583A JP2024026109A (ja) | 2017-12-13 | 2023-11-17 | 疼痛を治療し、疼痛感受性を増大させるためのペプチド及び他の薬剤 |
| US18/818,129 US20250154199A1 (en) | 2017-12-13 | 2024-08-28 | Peptides for treating pain or reducing pain sensitivity |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762598067P | 2017-12-13 | 2017-12-13 | |
| US62/598,067 | 2017-12-13 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/771,204 A-371-Of-International US11535649B2 (en) | 2017-12-13 | 2018-12-13 | Peptides and other agents for treating pain and increasing pain sensitivity |
| US17/956,031 Division US12077610B2 (en) | 2017-12-13 | 2022-09-29 | Peptides and other agents for treating pain and increasing pain sensitivity |
| US17/956,031 Continuation US12077610B2 (en) | 2017-12-13 | 2022-09-29 | Peptides and other agents for treating pain and increasing pain sensitivity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2019118779A2 true WO2019118779A2 (en) | 2019-06-20 |
| WO2019118779A3 WO2019118779A3 (en) | 2019-07-25 |
Family
ID=66820711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/065545 Ceased WO2019118779A2 (en) | 2017-12-13 | 2018-12-13 | Peptides and other agents for treating pain and increasing pain sensitivity |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US11535649B2 (https=) |
| EP (1) | EP3723781B1 (https=) |
| JP (2) | JP2021506794A (https=) |
| CN (1) | CN111712252A (https=) |
| AU (1) | AU2018383669B2 (https=) |
| CA (1) | CA3085576A1 (https=) |
| IL (1) | IL275340A (https=) |
| WO (1) | WO2019118779A2 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021072392A1 (en) * | 2019-10-10 | 2021-04-15 | The Research Foundation For The State University Of New York | Analgesic and anesthetic peptides and other agents |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111712252A (zh) * | 2017-12-13 | 2020-09-25 | 纽约州立大学研究基金会 | 用于治疗疼痛和提高疼痛敏感性的肽和其它药剂 |
| WO2022193185A1 (en) * | 2021-03-17 | 2022-09-22 | Jiangyin Usun Pharmaceutical Co., Ltd. | New conjugates |
| WO2025102083A1 (en) * | 2023-11-12 | 2025-05-15 | The Research Foundation For The State University Of New York | Compositions and methods for treating pain or for increasing pain sensitivity |
| WO2025123001A1 (en) * | 2023-12-08 | 2025-06-12 | Washington University | Targeted protein degradation compositions and methods of use thereof for pain control |
Family Cites Families (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6187533B1 (en) * | 1996-09-10 | 2001-02-13 | Arch Development Corporation | Mutations in the diabetes susceptibility genes hepatocyte nuclear factor (HNF) 1 alpha (α), HNF1β and HNF4α |
| HUP0200575A3 (en) * | 1999-03-25 | 2004-11-29 | Abbott Gmbh & Co Kg | Human antibodies that bind human il-12 and methods for producing |
| DE1252330T1 (de) | 1999-11-26 | 2003-11-27 | Mcgill University, Montreal | Loci der idiopathischen epilepsie, mutationen derselben und verfahren zu deren verwendung zur feststellung, prognose und behandlung von epilepsie |
| US20030216310A1 (en) | 2001-05-25 | 2003-11-20 | Thornton Michael B. | Transporters and ion channels |
| US20090087436A1 (en) | 2001-07-13 | 2009-04-02 | Myriad Genetics, Incorporated | Compositions and methods for treating diseases |
| WO2004045535A2 (en) | 2002-11-14 | 2004-06-03 | Arbor Vita Corporation | Molecular interactions in neurons |
| CA2462732A1 (en) * | 2001-10-01 | 2003-04-10 | Buck Institute | Target assisted iterative screening (tais) : a novel screening format for large molecular repertoires |
| US20040101874A1 (en) | 2002-04-12 | 2004-05-27 | Mitokor Inc. | Targets for therapeutic intervention identified in the mitochondrial proteome |
| US20040180848A1 (en) | 2003-03-10 | 2004-09-16 | Fesik Stephen W. | Method of killing cancer cells |
| BRPI0417531A (pt) | 2003-12-12 | 2007-03-20 | Wyeth Corp | canal de sódio |
| EP1709084A4 (en) | 2003-12-23 | 2008-05-28 | Nono Inc | POLYPEPTIDES FOR MODULATING BINDING OF TRP-CHANNEL PROTEINS AND TRP-ASSOCIATED PROTEINS |
| WO2005118614A1 (en) * | 2004-04-08 | 2005-12-15 | Avigen, Inc. | Methods and compositions for treating neuropathic pain |
| US7485468B2 (en) | 2004-10-15 | 2009-02-03 | Galapagos Bv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases |
| EP1904630A4 (en) | 2005-06-16 | 2009-10-21 | Bionomics Ltd | METHODS OF TREATING AND DIAGNOSING EPILEPSY BY DETECTING MUTATIONS OF THE SCN1A GENE |
| AU2008261951A1 (en) | 2007-06-08 | 2008-12-18 | Asuragen, Inc. | miR-34 regulated genes and pathways as targets for therapeutic intervention |
| WO2009006555A2 (en) | 2007-07-02 | 2009-01-08 | Yu, Ming | Methods, composition, targets for combinational cancer treatments |
| US20090118301A1 (en) | 2007-11-02 | 2009-05-07 | Arbor Vita Corporation | Compositions and Methods for Treating Cancer |
| CN102088990A (zh) | 2008-05-16 | 2011-06-08 | 阿尔伯维塔公司 | 癫痫的治疗 |
| EP2334379A2 (en) | 2008-09-26 | 2011-06-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Host cell kinases as targets for antiviral therapies against hcv infection |
| EP2275545A1 (en) | 2009-07-16 | 2011-01-19 | Julius-Maximilians-Universität Würzburg | Use of microRNA-24 and/or its targets for the treatment and prevention of ischemia and induction of angiogenesis |
| US8575112B2 (en) * | 2009-09-18 | 2013-11-05 | University Of Houston System | Small peptide modulators of potassium channel trafficking |
| US9279003B2 (en) * | 2010-07-07 | 2016-03-08 | Purdue Pharma L.P. | Analogs of sodium channel peptide toxin |
| JP5998131B2 (ja) | 2010-07-14 | 2016-09-28 | カッパーアールエヌエー,インコーポレイテッド | Discslargehomolog(dlg)dlg1への天然アンチセンス転写物の阻害によるdlg関連疾患の治療 |
| ES2655112T3 (es) | 2010-08-12 | 2018-02-16 | Nono Inc. | Tratamiento de una lesión penetrante en el cerebro |
| US9765115B2 (en) | 2011-04-01 | 2017-09-19 | Board of Supervisors of Louisiana State University acting on behalf of the University of Louisiana at Monroe | Inhibitors of metastasis, methods of generating such inhibitors and their therapeutic applications |
| EP2773366B1 (en) * | 2011-11-04 | 2017-03-01 | Lipotec, S.A. | Peptides which inhibit activated receptors and their use in cosmetic or pharmaceutical compositions |
| US9241970B2 (en) | 2011-12-13 | 2016-01-26 | Nono Inc. | Therapy for subarachnoid hemorrhage and ischemia |
| EP3419621A4 (en) * | 2016-02-26 | 2019-10-30 | The Johns Hopkins University | PHARMACOLOGICAL MODULATORS OF NAV1.1 VOLTAGE-CONTROLLED SODIUM CHANNELS ASSOCIATED WITH MECHANICAL PAIN |
| CN111712252A (zh) * | 2017-12-13 | 2020-09-25 | 纽约州立大学研究基金会 | 用于治疗疼痛和提高疼痛敏感性的肽和其它药剂 |
-
2018
- 2018-12-13 CN CN201880089341.7A patent/CN111712252A/zh active Pending
- 2018-12-13 AU AU2018383669A patent/AU2018383669B2/en active Active
- 2018-12-13 WO PCT/US2018/065545 patent/WO2019118779A2/en not_active Ceased
- 2018-12-13 JP JP2020532629A patent/JP2021506794A/ja active Pending
- 2018-12-13 EP EP18887737.7A patent/EP3723781B1/en active Active
- 2018-12-13 US US16/771,204 patent/US11535649B2/en active Active
- 2018-12-13 CA CA3085576A patent/CA3085576A1/en active Pending
-
2020
- 2020-06-14 IL IL275340A patent/IL275340A/en unknown
-
2022
- 2022-09-29 US US17/956,031 patent/US12077610B2/en active Active
-
2023
- 2023-11-17 JP JP2023195583A patent/JP2024026109A/ja active Pending
-
2024
- 2024-08-28 US US18/818,129 patent/US20250154199A1/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| "Remington: The Science and Practice of Pharmacy", 2005, PA. LIPPINCOTT WILLIAMS & WILKINS |
| See also references of EP3723781A4 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021072392A1 (en) * | 2019-10-10 | 2021-04-15 | The Research Foundation For The State University Of New York | Analgesic and anesthetic peptides and other agents |
| JP2022551467A (ja) * | 2019-10-10 | 2022-12-09 | ザ リサーチ ファウンデイション フォー ザ ステイト ユニバーシティー オブ ニューヨーク | 鎮痛性及び麻酔性ペプチド及び他の薬剤 |
| EP4051690A4 (en) * | 2019-10-10 | 2024-01-17 | The Research Foundation for The State University of New York | Analgesic and anesthetic peptides and other agents |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2024026109A (ja) | 2024-02-28 |
| JP2021506794A (ja) | 2021-02-22 |
| US20230046305A1 (en) | 2023-02-16 |
| AU2018383669A1 (en) | 2020-07-02 |
| US20250154199A1 (en) | 2025-05-15 |
| WO2019118779A3 (en) | 2019-07-25 |
| US11535649B2 (en) | 2022-12-27 |
| AU2018383669B2 (en) | 2023-05-18 |
| EP3723781B1 (en) | 2024-12-11 |
| EP3723781A4 (en) | 2021-07-21 |
| US20200369726A1 (en) | 2020-11-26 |
| EP3723781A2 (en) | 2020-10-21 |
| CA3085576A1 (en) | 2019-06-20 |
| US12077610B2 (en) | 2024-09-03 |
| IL275340A (en) | 2020-07-30 |
| CN111712252A (zh) | 2020-09-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12077610B2 (en) | Peptides and other agents for treating pain and increasing pain sensitivity | |
| US20250215052A1 (en) | Inhibitors of pick1 and uses thereof | |
| US10036016B2 (en) | Methods for inducing glucose uptake | |
| Pryce et al. | Magi-1 scaffolds NaV1. 8 and Slack KNa channels in dorsal root ganglion neurons regulating excitability and pain | |
| JP2019522989A (ja) | TATκ−CDKL5融合タンパク質、組成物、製剤、及びそれらの使用 | |
| DK2904009T3 (en) | RELATIONSHIPS FOR TREATING THE REMYELINIZATION BLOCK IN DISEASES RELATED TO THE EXPRESSION OF HERV-W COAT PROTEIN | |
| JP6306768B2 (ja) | 疼痛抑制物質のスクリーニング方法および疼痛の予防または治療用医薬組成物 | |
| US11407826B2 (en) | Screening method for pain suppressor and pharmaceutical composition for prevention or treatment of pain | |
| KR102772298B1 (ko) | 미엘린 장애의 치료를 위한 조성물 및 방법 | |
| HK40037093A (en) | Peptides and other agents for treating pain and increasing pain sensitivity | |
| HK40037093B (en) | Peptides and other agents for treating pain and increasing pain sensitivity | |
| US20240294571A1 (en) | Analgesic and anesthetic peptides and other agents | |
| WO2026056985A1 (zh) | 抑郁症的治疗方法和药物组合物 | |
| CA3069179A1 (en) | Targeting the hdac2-sp3 complex to enhance synaptic function | |
| Pryce | Functional Regulation of Ion Channels in Dorsal Root Ganglion Neurons by Magi-1: Implications in Pain Signaling | |
| NZ749459A (en) | TATĸ-CDKL5 FUSION PROTEINS, COMPOSITIONS, FORMULATIONS, AND USE THEREOF | |
| HK1226745A1 (en) | Tatk-cdkl5 fusion proteins, compositions, formulations, and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18887737 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 3085576 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2018383669 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2020532629 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018383669 Country of ref document: AU Date of ref document: 20181213 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018887737 Country of ref document: EP Effective date: 20200713 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18887737 Country of ref document: EP Kind code of ref document: A2 |