WO2019079294A1 - RNAI-BASED AGENTS AND COMPOSITIONS FOR INHIBITING ASIALOGLYCOPROTEIN RECEPTOR 1 RECEPTOR 1 - Google Patents
RNAI-BASED AGENTS AND COMPOSITIONS FOR INHIBITING ASIALOGLYCOPROTEIN RECEPTOR 1 RECEPTOR 1 Download PDFInfo
- Publication number
- WO2019079294A1 WO2019079294A1 PCT/US2018/056077 US2018056077W WO2019079294A1 WO 2019079294 A1 WO2019079294 A1 WO 2019079294A1 US 2018056077 W US2018056077 W US 2018056077W WO 2019079294 A1 WO2019079294 A1 WO 2019079294A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- rnai agent
- nucleotides
- asgrl
- sense strand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
Definitions
- RNA interference (RNAi ) agents e.g., double stranded RNAi agents, for inhibition of asialoglycoprotein receptor 1 (ASGR1 ) gene expression
- ASGR1 asialoglycoprotein receptor 1
- ASGR1 Asialoglycoprotein receptor 1
- ASGR1 Asialoglycoprotein receptor 1
- ASGR1 gene Asialoglycoprotein receptor 1 gene
- ASGRl protein As predicted by -50% reduction of ASGRl levels in del 12 carriers, there was an increase of alkaline phosphatase (ALP or ALKP) and vitamin B12 levels, as both these proteins are substrates for the asialoglycoprotein receptor. Reducing ASGRl protein has thus emerged as a promising target for the treatment of cardiovascular diseases. Therapeutics that are able to target the ASGRl gene and reduce ASGRl protein levels represent a novel way of treating cardiovascular disease, including coronary artery disease.
- RNAi agents also herein termed RNAi agent, RNAi trigger, or trigger
- RNAi agent also herein termed RNAi agent, RNAi trigger, or trigger
- R Ai agents double stranded R Ai agents
- non-HDL-C non-HDL cholesterol
- LDL-C LDL cholesterol
- TG triglyceride
- the present disclosure features novel ASGRl gene-specific RNAi agents, compositions that include the ASGRl gene-specific RNAi agents, and methods for inhibitin expression of an ASGRl gene in vivo and. or in vitro using the ASGRl gene-speci fic RNAi agents and compositions that include ASGRl gene-specific RNAi agents described herein. Further described herein are methods of treatment of diseases or disorders that are mediated at least in part by ASGRl gene expression, the methods including administration to a subject one or more of the ASGRl RNAi agents disclosed herein.
- the ASGRl gene-speci fic RNAi agents described herein are able to selectively and efficiently decrease expression of an ASGRl gene.
- ASGRl RNAi agents are thereby capable of reducing non-HDL cholesterol levels, and. or LDL cholesterol levels, and or total cholesterol levels, and. or triglyceride levels, in a subject, e.g. , a human or animal subject.
- the ASGRl RNAi agents described herein can also impact other endogenous factors associated with atherosclerosis and. or vascular disease.
- the described ASGRl RNAi agents can be used in methods for therapeutic treatment and or prevention of symptoms and diseases associated with abnormal serum lipoprotein levels, includin but not limited to obesity, metabolic syndrome, hyperlipidemia.
- the methods disclosed herein include the administration of one or more ASGR1 RNAi agents to a subject.
- the one or more ASGRl RNAi agents described herein may be administered to a subject by any suitable methods known in the art, such as subcutaneous injection or intravenous administration.
- the disclosure features compositions comprisin one or more ASGRl RNAi agents that are able to selectively and efficiently decrease or inhibit expression of an ASGRl gene.
- the disclosed herein compositions comprising one or more ASGRl RNAi agents are able to reduce the level of ASGR l protein in the subject.
- the disclosed herein compositions comprising one or more ASGRl RNAi agents are able to reduce the level of ASGRl niR A in the subject.
- compositions comprising one or more ASGRl RNAi agents can be administered to a subject, such as a human or animal subject, for the treatment and or prevention of symptoms and diseases associated with elevated non-HDL-C levels, and or elevated LDL-C levels, and/or elevated total cholesterol levels, and or elevated TG levels.
- An ASGRl RNAi agent described herein includes a sense strand (also referred to as a passenger strand), and an antisense strand (also referred to as a guide strand).
- the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
- the length of the R Ai agent sense and antisense strands described herein each can be 16 to 30 nucleotides in length.
- the sense and antisense strands are independently 1 7 to 26 nucleotides in length.
- the sense and antisense strands are independently 2 1 to 26 nucleotides in length.
- the sense and antisense strands are independently 2 1 to 24 nucleotides in length.
- the sense and antisense strands are both 2 1 nucleotides in length. In some embodiments, the sense and or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The sense and antisense strands can be either the same length or different lengths.
- the RNAi agents described herein upon delivers to a cell expressing ASGRl, inhibit the expression of one or more ASGRl genes in vivo or in vitro.
- a sense strand of the ASGRl RNAi agents described herein includes at least 16 consecutive nucleotides that have at least 85% identity to a core stretch sequence (also referred to herein as a " core stretch " or "core sequence " ) of the same number of nucleotides in an ASGRl mRNA.
- the sense strand core stretch having at least 85% identity to a sequence in an ASGRl mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- this sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- this sense strand core stretch is 17 nucleotides in length.
- this sense strand core stretch is 19 nucleotides in length.
- An antisense strand of an ASGRl RNAi agent includes at least 16 consecutive nucleotides that have at least 85% complementarity to a core stretch of the same number of nucleotides in an ASGRl mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand.
- the antisense strand core nucleotide stretch having at least 85% complementarity to a sequence in an ASGRl mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- this antisense strand core stretch is 17 nucleotides in length.
- this antisense strand core stretch is 19 nucleotides in length.
- the ASGRl RNAi agents disclosed herein are designed to target the portion of an ASGRl gene having the sequence of any of the sequences disclosed in Table 1.
- ASGRl RNAi agent sense strands and antisense strands that can be included in the ASGRl RNAi agents disclosed herein are provided in Tables 2, 3. and 4.
- ASGRl RNAi agent duplexes are provided in Table 5.
- 1 -nucleotide core stretch sequences that consist of or are included in the sense strands and antisense strands of ASGRl RNAi agents disclosed herein, are provided in Table 2.
- the disclosure features methods for delivering ASGRl RNAi agents to liver cells in a subject, such as a mammal, in vivo.
- compositions for use in such methods can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art.
- Nucleic acid delivery methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels. cyclodextrins. biodegradable nanocapsules. and bioadhesive microspheres, proteinaceous vectors, or Dynamic Poly conjugatesTM (DPCs) (see.
- an ASGRl RNAi agent is delivered to target cells or tissues by covalently linking or conjugating the RNAi agent to a targeting group.
- the targeting group includes, consists of. or consists essentially of an antibody, such as a monoclonal antibody. ⁇ See, e.g. , International Patent Application Publication No. WO 2018/039647, which is incorporated by reference herein in its entirety).
- the targeting group consists of, consists essentially of, or comprises as an asialoglycoprotein receptor ligand (i.e. , a ligand that includes a compound having affinity for the asialoglycoprotein receptor).
- an asialoglycoprotein receptor ligand includes, consists of, or consists essentially of a galactose or galactose derivative cluster.
- an ASGRl RNAi agent is linked to a targeting ligand comprising the galactose derivative N-acetyl-galactosamine.
- a galactose derivative cluster includes an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, a galactose derivative cluster is an N-acetyl-galactosamine trimer or an N- acetylgalactosamine tetramer.
- the ASGRl RNAi agents that are conjugated to targeting ligands that include N-acetyl-galactosamine are selectively internalized by liver cells, and hepatocytes in particular, either through receptor-mediated endocytosis or by other means. Examples of targeting groups useful for delivering RNAi agents are disclosed, for example, in International Patent Application Publication Nos. WO 2018/044350 and WO 2017/156012 to Arrowhead Pharmaceuticals, Inc., which are incorporated by reference herein in their entirety.
- a targeting group can be linked to the 3' or 5' end of a sense strand or an antisense strand of an ASGRl RNAi agent. In some embodiments, a targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is linked internally to a nucleotide on the sense strand and/or the antisense strand of the RNAi agent. In some embodiments, a targeting group is linked to the 5' end of the sense strand. In some embodiments, a targeting group is linked to the RN Ai agent via a linker.
- a targeting group, with or without a linker can be linked to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Tables 2, 3, and 4.
- a linker, with or without a targeting group can be attached to the 5' or 3' end of any of the sense and or antisense strands disclosed in Tables 2, 3, and 4.
- described herein are compositions that include one or more ASGRl RN Ai agents havin the duplex structures disclosed in Table 5.
- compositions that include one or more described ASGRl R Ai agent(s). optionally combined with one or more additional (i.e., second, third, etc. ) therapeutics.
- An additional therapeutic can be another ASGRl RNAi agent (e.g. , an ASGRl RNAi agent which targets a di fferent sequence within an ASGRl gene).
- An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, peptide, and or aptamer.
- the ASGRl RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.
- the described ASGRl RNAi agent(s) can be optionally combined with one or more additional therapeutics in a single dosage form (i.e. , a cocktail included in a single injection).
- the pharmaceutical compositions that include one or more described ASGRl RNAi agent(s). optionally combined with one or more additional (i.e. , second, third, etc. ) therapeutics can be formulated in a pharmaceutically acceptable carrier or diluent.
- these compositions can be administered to a subject, such as a mammal.
- the mammal is a human.
- the described ASGRl RNAi agenl(s) may be administered separately from one or more optional additional therapeutics.
- the described ASGRl RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutics are administered orally, which together provide for a treatment regimen for diseases and conditions associated with elevated non-H DL-C levels, and or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels.
- the described ASGRl RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutics are administered via a separate subcutaneous injection.
- compositions that include a combination or cocktail of at least two ASGRl RNAi agents having different nucleotide sequences.
- the two or more di fferent ASGRl RNAi agents are each separately and independently linked to targeting groups.
- the two or more different ASGRl RNAi agents are each separately and independently linked to targeting groups that include or consist of targeting ligands that include one or more moieties that target an asialogK coprotein receptor.
- the two or more different ASGR1 RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more galactose derivatives.
- the two or more different ASGR1 RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more N -acety 1 -gal ac tosami nes .
- each of the RNAi agents is independently linked to the same targeting group.
- each of the RNAi agents is independently linked to a different targeting group, such as targeting groups having di fferent chemical structures.
- targeting groups are linked to the ASGRl RNAi agents without the use of an additional linker.
- the targeting group is designed having a linker readily present to facilitate the l inkage to an ASGRl RNAi agent.
- the two or more RNAi agents may be linked to their respective targeting groups using the same linkers.
- the two or more R Ai agents are linked to their respective targeting groups using di fferent linkers.
- the disclosure features methods of treatment (including prevention or preventative treatment) of diseases or symptoms caused by or attributable to elevated non- HDL-C levels, and or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels, wherein the methods include administering an ASGRl RNAi agent having an antisense strand comprising the sequence of any of the sequences in Tables 2 or 3.
- the methods include administering to a cell an ASGRl RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Tables 2 or 3.
- disclosed herein are methods of treatment or prevention of diseases or symptoms caused by elevated non-HDL-C levels, and or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels, wherein the methods include administering an ASGRl RNAi agent having a sense strand comprising the sequence of any of the sequences in Tables 2 or 4.
- methods of inhibiting expression of an ASGR1 gene wherein the methods include administering mASGRl RNAi agent having a sense strand comprising the sequence of any of the sequences in Tables 2 or 4.
- disclosed herein are methods of inhibiting expression of an ASGR1 gene, wherein the methods include administering to a subject a therapeutically effective amount of an ASGR1 RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, and an antisense strand comprising the sequence of any of the sequences in Table 3.
- disclosed herein are methods of inhibiting expression of an ASGR1 gene, wherein the methods include administering m ASGRl RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3.
- the methods include administering mASGRl RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3.
- the methods include administering one or more ASGR1 RNAi agents having the duplex structure of any of the duplexes in Table 5.
- the disclosure features methods of treatment (including preventative or prophylactic treatment) of diseases or symptoms caused by elevated non-HDL-C levels, and/or elevated LDL-C levels, and/or elevated total cholesterol levels, and/or elevated TG levels, wherein the methods include administering mASGRl RNAi agent that has an antisense strand that is at least partially complementary to the portion of m ASGRl mRNA having any one of the sequences listed in Table 1.
- disclosed herein are methods for inhibiting expression of an ASGR1 gene in a cell, wherein the methods include administering an ASGR1 RNAi agent that has an antisense strand that is at least partially complementary to the portion of an ASGRl mRNA having any one of the sequences listed in Table 1.
- disclosed herein are methods of treatment or prevention of diseases or symptoms caused by elevated non-HDL-C levels, and. or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels, wherein the methods include administering anASGRl RNAi agent having an antisense strand that includes the sequence of any of the sequences in Tables 2 or 3, and a sense strand that includes any of the sequences in Tables 2 or 4 that is at least partially complementary to the antisense strand.
- disclosed herein are methods of treatment or prevention of diseases or symptoms caused by elevated non-HDL-C levels, and. or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels, wherein the methods include administering anASGRl RNAi agent having a sense strand that includes any of the sequences in Tables 2 or 4, and an antisense strand that includes the sequence of any of the sequences in Tables 2 or 3 that is at least partially complementary to the sense strand.
- disclosed herein are methods of inhibiting expression of an ASGRl gene, wherein the methods include administering an ASGRl RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Tables 2 or 3, and a sense strand that includes any of the sequences in Tables 2 or 4 that is at least partially complementary to the antisense strand.
- compositions for inhibiting expression of an ASGRl gene include administering anASGRl RNAi agent that includes a sense strand that comprises any of the sequences in Tables 2 or 4, and an antisense strand that includes the sequence of any of the sequences in Tables 2 or 3 that is at least partially complementary to the sense strand.
- compositions for inhibiting expression of an ASGRl gene in a cell the composition comprising any of theASGRl RNAi agents described herein.
- compositions for delivering m ASGRI RNAi agent to a liver cell in vivo wherein the composition includes ASGRl RNAi agent conjugated or linked to a targeting group.
- the targeting group is an asialoglycoprotein receptor ligand.
- compositions for delivering mASGRl RNAi agent to a liver cell in vivo are described, wherein the compositions include an ASGR1 RNAi agent linked to a targeting ligand that comprises N-acetyl-galactosamine.
- one or more of the described ASGR1 RNAi agents are administered to a subject, such as a mammal, in a pharmaceutically acceptable carrier or diluent.
- a subject such as a mammal
- a pharmaceutically acceptable carrier or diluent such as a human.
- ASGRI R Ai agents provide methods for therapeutic and/or prophylactic treatment of diseases/disorders which are associated with elevated non-HDL-C levels, and/or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels, and or enhanced or elevated .
- J. ST /7 ⁇ 7 expression The described ASGR1 RNAi agents can mediate RNA interference to inhibit the expression of one or more genes necessary for production of ASGR I protein.
- ASGRI RN Ai agents can also be used to treat or prevent various diseases or disorders associated with abnormal serum lipoprotein levels, includin but not limited to obesity, metabolic syndrome, hyperlipidemia.
- hypertriglyceridemia hypercholesterolemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, diabetes, cardiovascular disease, coronary artery disease, myocardial infarction, peripheral vascular disease, cerebrovascular disease and other metabolic-related disorders and diseases.
- the described herein . l.ST A'/ R Ai agents may also impact other endogenous factors associated with atherosclerosis and or vascular disease.
- compositions for delivery of ASGRI RNAi agents to liver cells in vivo are described.
- compositions comprisin one or more ASGRI RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be. but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.
- the described ASGRI RNAi agents and/or compositions that include ASGRI RNAi agents can be used in methods for therapeutic treatment of diseases or conditions caused by elevated non- HDL-C levels, and or elevated LDL-C levels, and or elevated total cholesterol levels, and or elevated TG levels.
- Such methods include administration of an ASGR1 RNAi agent as described herein to a subject, e.g., a human or animal subject.
- the ASGR1 RNAi agents described herein can include one or more targeting groups having the structure of (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, each as defined herein in Table 6.
- the ASGR1 RNAi agents described herein include one targeting group at the 5' end of the sense strand having the structure of (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, each as defined herein in Table 6.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3).
- w ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3), wherein all or substantially all of the nucleotides are modified nucleotides.
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3), wherein SEQ ID NO:3 is located at positions 1-21 (5' - 3') of the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO: 2), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' - 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO: 2), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usAfscUfcCfUwAUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:4), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; UUNA represents a 2',3'-seco-uridine (see, e.g.
- s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides (see, e.g., Figs. 1A through 1M showing all internucleoside linkages).
- mASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' 3') usAfscUfcCfUuN A UfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:4), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; UUNA represents a 2',3'-seco-uridine (see, e.g. , Table 6); and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- 5' 3' usA
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6).
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6), wherein SEQ ID NO:6 is located at positions 1-21 (5' - 3') of the antisense strand.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), wherein a, c, g, and u represent 2'-0- methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), wherein a, c, g, and u represent 2'-0- methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8).
- w ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides.
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8), wherein SEQ ID NO: 8 is located at positions 1-21 (5' - 3') of the antisense strand.
- w ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsGfsu (SEQ ID NO:7), wherein a, c, g, and u represent 2'-0- methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' 3') asGfscGfaCfuucauCfuUfuCfuUfcsGfsu (SEQ ID NO:7), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') asGfscsgacuucauCfuUfuCfuUfcGfsu (SEQ ID NO:9), wherein a, c, g, and u represent 2'-0- methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' - 3') asGfscsgacuucauCfuUfuCfuUfcGfsu (SEQ ID NO: 9), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11).
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11), wherein all or substantially all of the nucleotides are modified nucleotides.
- aaASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11), wherein SEQ ID NO: 11 is located at positions 1-21 (5' - 3') of the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc (SEQ ID NO: 10), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' 3') asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc (SEQ ID NO: 10), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UGAAAUAAAUUAAAGGAGAGG (SEQ ID NO:27).
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') UGAAAUAAAUUAAAGGAGAGG (SEQ ID NO: 27), wherein all or substantially all of the nucleotides are modified nucleotides.
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UGAAAUAAAUUAAAGGAGAGG (SEQ ID NO:27), wherein SEQ ID NO:27 is located at positions 1-21 (5' - 3') of the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsg (SEQ ID NO:28), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- wASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the nucleotide sequence (5' 3') usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsg (SEQ ID NO:28), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') ACCUAUCAUGACCAAGGAIUA (SEQ ID NO: 12).
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') ACCUAUCAUGACCAAGGAIUA (SEQ ID NO: 12), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') ACCUAUCAUGACCAAGGAGUA (SEQ ID NO: 13).
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') ACCUAUCAUGACCAAGGAGUA (SEQ ID NO: 13), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') ACCUAUCAUGACCAAIGAIUA (SEQ ID NO: 14).
- aa ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') UACUCCUUGGUCAUGAUAGGU (SEQ ID NO:3), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') ACCUAUCAUGACCAAIGAIUA (SEQ ID NO: 14), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and a sense strand that consists of, consists essentially of, or comprises anucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') CGGAAGAAAGAUGAAGUCICU (SEQ ID NO: 15).
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') CGGAAGAAAGAUGAAGUCICU (SEQ ID NO: 15), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') ACGAAGAAAGAUGAAGUCICU (SEQ ID NO: 16).
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') ACGAAGAAAGAUGAAGUCICU (SEQ ID NO: 16), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') AC GAAGAAAGAUGAAGUC GCU (SEQ ID NO: 17).
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCGU (SEQ ID NO:8), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') ACGAAGAAAGAUGAAGUCGCU (SEQ ID NO: 17), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') GCGUGGGAAGAAAGAUGAAGU (SEQ ID NO: 18).
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') GCGUGGGAAGAAAGAUGAAGU (SEQ ID NO: 18), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and a sense strand that consists of, consists essentially of, or comprises anucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') CGGAAGAAAGAUGAAIUCICU (SEQ ID NO:31).
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') CGGAAGAAAGAUGAAIUCICU (SEQ ID NO: 31), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and a sense strand that consists of, consists essentially of, or comprises anucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') CGGAAGAAAGAUGAAGUCGCU (SEQ ID NO:33).
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') CGGAAGAAAGAUGAAGUCGCU (SEQ ID NO:33), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' 3') UGAAAUAAAUUAAAGGAGAGG (SEQ ID NO:27) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') CCUCUCCUUUAAUUUAUUUCA (SEQ ID NO:35).
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') UGAAAUAAAUUAAAGGAGAGG (SEQ ID NO:27), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' 3') CCUCUCCUUUAAUUUAUUUCA (SEQ ID NO:35), wherein all or substantially all of the nucleotides are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfccaaggaiua (SEQ ID NO: 19), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfccaaggaiua (SEQ ID NO: 19), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usAfscUfcCfUwAUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:4), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfccaaggagua (SEQ ID NO:20), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; UU A represents a 2',3
- Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usAfscUfcCfUwAUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:4), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfccaaggagua (SEQ ID NO: 20), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NA
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfcCaaggagua (SEQ ID NO:21), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphoroth
- anASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfcCaaggagua (SEQ ID NO:21), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfcCaaigaiua (SEQ ID NO:22), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfcCaaigaiua (SEQ ID NO:22), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cggaagaaAfGfAfugaagucicu (SEQ ID NO:23), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phospho
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cggaagaaAfGfAfugaagucicu (SEQ ID NO:23), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s, each as
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsGfsu (SEQ ID NO:7), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') acgaagaaAfGfAfugaagucicu (SEQ ID NO:24), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsGfsu (SEQ ID NO:7), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') acgaagaaAfGfAfugaagucicu (SEQ ID NO:24), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscsgacuucauCfuUfuCfuUfcGfsu (SEQ ID NO:9), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') acgaagaaAfGfAfugaagucgcu (SEQ ID NO:25), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscsgacuucauCfuUfuCfuUfcGfsu (SEQ ID NO:9), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') acgaagaaAfGfAfugaagucgcu (SEQ ID NO:25), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s, each
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc (SEQ ID NO: 10), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gcgugggaAfGfAfaagaugaagu (SEQ ID NO:26), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothio
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc (SEQ ID NO: 10), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gcgugggaAfGfAfaagaugaagu (SEQ ID NO: 26), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc (SEQ ID NO: 10), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gscgugggaAfGfAfaagaugaagu (SEQ ID NO:29), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothi
- anASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc (SEQ ID NO: 10), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gscgugggaAfGfAfaagaugaagu (SEQ ID NO:29), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfccaaigaiua (SEQ ID NO:30), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') accuaucaUfGfAfccaaigaiua (SEQ ID NO:30), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cggaagaaAfGfAfugaaiucicu (SEQ ID NO:32), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phospho
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cggaagaaAfGfAfugaaiucicu (SEQ ID NO:32), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s, each as
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cggaagaaAfGfAfugaagucgcu (SEQ ID NO:34), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') asGfscGfaCfuucauCfuUfuCfuUfcsCfsg (SEQ ID NO:5), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cggaagaaAfGfAfugaagucgcu (SEQ ID NO: 34), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s, each
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsg (SEQ ID NO:28), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') ccucuccuUfUfAfauuuauuuca (SEQ ID NO:36), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' 3') usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsg (SEQ ID NO:28), and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') ccucuccuUfUfAfauuuauuuca (SEQ ID NO: 36), and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3'):
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6);
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8);
- ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11); or
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3'):
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6);
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8);
- ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11); or
- ASGRl RNAi agent further includes a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3'):
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6);
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8);
- ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11); or
- ASGRl RNAi agent further includes a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end; and wherein the respective antisense strand sequence is located at positions 1-21 of the antisense strand.
- an ASGRl RNAi agent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise nucleotide sequences that differ by 0 or 1 nucleotides from one of the following nucleotide sequence (5' - 3') pairs:
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and CGGAAGAAAGAUGAAGUCICU (SEQ ID NO: 15), wherein I represents an inosine nucleotide;
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8)
- ACGAAGAAAGAUGAAGUCICU (SEQ ID NO: 16), wherein I represents an inosine nucleotide
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8)
- ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11) and
- AGCGACUUCAUCUUUCUUCCG SEQ ID NO:6
- CGGAAGAAAGAUGAAIUCICU SEQ ID NO:31
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and
- an ASGRl RNAi agent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise nucleotide sequences that differ by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3') pairs:
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8)
- ACGAAGAAAGAUGAAGUCICU (SEQ ID NO: 16), wherein I represents an inosine nucleotide
- AGCGACUUCAUCUUUCUUCGU (SEQ ID NO: 8) and ACGAAGAAAGAUGAAGUCGCU (SEQ ID NO: 17);
- ACUUCAUCUUUCUUCCCACGC (SEQ ID NO: 11) and
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and
- AGCGACUUCAUCUUUCUUCCG (SEQ ID NO:6) and
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3'):
- a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively;
- Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively;
- L represents a 2',3'-seco-uridine (see, e.g., Table 6);
- s represents a phosphorothioate linkage; and wherein the ASGRl RNAi agent further includes the sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
- an ASGRl RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3'):
- the ASGRl RNAi agent further includes the sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides; and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s, each as defined herein in Table 6.
- an ASGRl RNAi agent disclosed herein includes an antisense strand and a sense strand that consists of, consists essentially of, or comprises modified nucleotide sequences that differs by 0 or 1 nucleotides from one of the following nucleotide sequence pairs (5' 3'):
- ccucuccuUfUfAfauuuauuuca (SEQ ID NO:36); wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; L represents a 2',3'-seco-uridine (see, e.g. , Table 6); and s represents a phosphorothioate linkage.
- an ASGRl RNAi agent disclosed herein includes an antisense strand and a sense strand that consists of, consists essentially of. or comprises one of the following nucleotide sequence pairs (5' - 3'):
- ccucuccuUfUfAfauuuauuuca (SEQ ID NO:36); wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; L represents a 2',3'-seco-uridine (see, e.g., Table 6); s represents a phosphorothioate linkage; and wherein the sense strand further includes inverted abasic residues at the 3' terminal end and at the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand that is covalently linked to the 3' and/or 5' terminal end.
- the targeting ligand is selected from (NAG25), (NAG25)s, (NAG37), and (NAG37)s, each as defined herein in Table 6.
- ASGRl RNAi agent disclosed herein includes an antisense strand that includes a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequences selected from the group consisting of (5' - 3'):
- AGCGACUUCAUCUUUCUUC (SEQ ID NO: 141);
- ACUUCAUCUUUCUUCCCAC (SEQ ID NO: 133); or
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that includes a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequences selected from the group consisting of (5' - 3'):
- AGCGACUUCAUCUUUCUUC (SEQ ID NO: 141);
- ACUUCAUCUUUCUUCCCAC (SEQ ID NO: 133); or
- nucleotides are modified nucleotides.
- an ASGR1 RNAi agent disclosed herein includes an antisense strand that includes a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequences selected from the group consisting of (5' - 3'):
- AGCGACUUCAUCUUUCUUC (SEQ ID NO: 141);
- ACUUCAUCUUUCUUCCCAC (SEQ ID NO: 133); or
- an ASGRl RNAi agent disclosed herein includes an antisense strand and a sense strand that each include a nucleobase sequences that differs by 0 or 1 nucleobases from the nucleotide sequence pairs selected from the group consisting of (5' - 3'):
- AGCGACUUCAUCUUUCUUC (SEQ ID NO: 141) and GAAGAAAGAUGAAGUCICU (SEQ ID NO:316);
- ACUUCAUCUUUCUUCCCAC (SEQ ID NO: 133) and
- GAAGAAAGAUGAAIUCICU SEQ ID NO: 852
- an ASGRl RNAi agent disclosed herein includes an antisense strand and a sense strand that each include a nucleobase sequences that differs by 0 or 1 nucleobases from the nucleotide sequence pairs selected from the group consisting of (5' - 3'):
- ACUUCAUCUUUCUUCCCAC (SEQ ID NO: 133) and
- AGCGACUUCAUCUUUCUUC (SEQ ID NO: 141) and GAAGAAAGAUGAAIUCICU (SEQ ID NO: 852);
- UCUCCUUUAAUUUAUUUCA (SEQ ID NO:414); wherein I represents an inosine nucleotide, and wherein all or substantially all of the nucleotides are modified nucleotides.
- compositions described herein comprising one or more ASGRl RNAi agents are packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials. In some embodiments, the compositions described herein are administered parenterally.
- FIG. 1A Schematic diagram of the modified sense and antisense strands of ASGRl RNAi agent AD05126 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6).
- Fig. 1 A discloses SEQ ID NOs: 10 and 631.
- a, c, g, i, and u are 2'-0- methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; p is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue (see, e.g., Table 6); C is a cytidine ribonucleotide; UU A IS a 2',3'-seco-uridine ⁇ see, e.g. , Table 6); and (NAG37)s and (NAG37)p are the respective tridentate N- acetyl-galactosamine targeting ligands having the structure depicted in Table 6.
- FIG. IB Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05150 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. IB discloses SEQ ID NOs: 10 and 632.
- FIG. 1C Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05183 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. 1C discloses SEQ ID NOs: 2 and 636.
- FIG. ID Schematic diagram of the modified sense and antisense strands ofASGRlKNAi agent AD05186 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. ID discloses SEQ ID NOs: 2 and 639.
- FIG. IE Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05193 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. IE discloses SEQ ID NOs: 5 and 645.
- FIG. IF Schematic diagram of the modified sense and antisense strands oiASGRl RNAi agent AD05195 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. IF discloses SEQ ID NOs: 5 and 647.
- FIG. 1G Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05196 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. 1G discloses SEQ ID NOs: 5 and 648.
- FIG. 1H Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05206 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6).
- Fig. 1H discloses SEQ ID NOs: 28 and 658.
- FIG. II Schematic diagram of the modified sense and antisense strands oiASGRl RNAi agent AD05209 ⁇ see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6).
- Fig. II discloses SEQ ID NOs: 4 and 602.
- FIG. 1 J Schematic diagram of the modified sense and antisense strands of ASGRl RNAi agent AD05256 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6).
- Fig. 1J discloses SEQ ID NOs: 2 and 674.
- FIG. IK Schematic diagram of the modified sense and antisense strands of ASGRl RNAi agent AD05374 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6).
- Fig. IK discloses SEQ ID NOs: 2 and 700.
- FIG. 1L Schematic diagram of the modified sense and antisense strands of ASGRl RNAi agent AD05609 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6).
- Fig. 1L discloses SEQ ID NOs: 7 and 708.
- FIG. 1M Schematic diagram of the modified sense and antisense strands of ASGRl RNAi agent AD05692 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6).
- Fig. 1M discloses SEQ ID NOs: 9 and 721.
- FIG. 2A to 2D Chemical structure representation of ASGRl RNAi agent AD05193, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5' terminal end of the sense strand, shown in a sodium salt form.
- FIG. 3A to 3D Chemical structure representation of ASGRl RNAi agent AD05193, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5' terminal end of the sense strand, shown in a free acid form.
- FIG. 4A to 4D Chemical structure representation of ASGRl RNAi agent AD05209, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5' terminal end of the sense strand, shown in a sodium salt form.
- FIG. 5A to 5D Chemical structure representation of ASGRl RNAi agent AD05209, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s ⁇ see Table 6) at the 5' terminal end of the sense strand, shown in a free acid form.
- RNAi agent also referred to as an "RNAi trigger” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner.
- mRNA messenger RNA
- RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action.
- RNA interference mechanism i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells
- RISC RNA-induced silencing complex
- RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates.
- the antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (i.e. ASGR1 mRNA).
- RNAi agents can include one or more modified nucleotides and/or one or more non-phosphodiester linkages.
- the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.
- sequence and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.
- a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil.
- a nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g. , Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley - VCH, 2008).
- modified nucleobases including phosphoramidite compounds that include modified nucleobases
- first nucleobase or nucleotide sequence e.g., RNAi agent sense strand or targeted mRNA
- second nucleobase or nucleotide sequence e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide
- first nucleobase or nucleotide sequence e.g., RNAi agent sense strand or targeted mRNA
- second nucleobase or nucleotide sequence e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide
- oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helical structure under certain standard conditions with an oligon
- Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.
- perfect complementary or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide.
- the contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
- partially complementary means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide.
- the contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
- substantially complementary means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide.
- the contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
- the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of wASGRl mRNA.
- nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
- the inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.
- the terms “treat,” “treatment,” and the like mean the methods or steps taken to provide relief from or alleviation of the number, severity, and/or frequency of one or more symptoms of a disease in a subject.
- “treat” and “treatment” may include the preventative treatment, management, prophylactic treatment, and/or inhibition or reduction of the number, severity, and/or frequency of one or more symptoms of a disease in a subject.
- the phrase “introducing into a cell,” when referring to an RNAi agent means functionally delivering the RNAi agent into a cell.
- the phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.
- isomers refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a "chiral center.”
- each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms.
- the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.
- the person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed.
- the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated.
- the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art.
- the term “linked” or “conjugated” when referring to the connection between two compounds or molecules means that two compounds or molecules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.
- the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.”
- the term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless the context clearly indicates otherwise.
- RNAi agents for inhibiting expression of an ASGR1 gene referred to herein as ASGRl RNAi agents or ASGR1 RNAi triggers.
- ASGRl RNAi agents for inhibiting expression of an ASGR1 gene
- ASGRl RNAi agents comprises a sense strand and an antisense strand.
- the sense strand and the antisense strand each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands each can be 17 to 26 nucleotides in length.
- the sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 1 7-21 nucleotides in length.
- the sense and antisense strands are each 2 1 -26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 2 1 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 2 1 nucleotides in length. In some embodiments, both the sense and antisense strands are each 2 1 nucleotides in length.
- both the sense and antisense strands are each 26 nucleotides in length.
- a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length.
- a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length.
- the RNAi agent sense and antisense strands are each independently 1 7.
- a double-stranded RNAi agent has a duplex length of about 16, 1 7. 18,
- This region of perfect or substantial complementarity between the sense strand and the antisense strand is typically 15-26 (e.g., 15, 16, 17, 18, 19,
- nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by
- nucleotides that are not perfectly or substantially complementary.
- the sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleobases in length.
- An antisense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the ASGR1 mRNA target.
- a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the ASGR1 mRNA target.
- a sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.
- the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- Examples of sense and antisense strand nucleotide sequences used in forming ASGR1 RNAi agents are provided in Tables 2, 3 and 4.
- Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 3 and 4, are show n in Table 5.
- the ASGR1 RNAi agent sense and antisense strands anneal to form a duplex.
- a sense strand and an antisense strand of an ASGR1 RNAi agent may be partially, substantially, or fully complementary to each other.
- the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence.
- the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 2 1. 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an ASGRl RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired. )
- the antisense strand of an ASGRl RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ASGRl RNAi agent disclosed herein differs by 0, 1 , 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.
- the sense strand and or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core stretch sequences.
- the antisense strand additional nucleotides, if present, may or may not be complementary to the correspondin sequence in an ASGRl niR A.
- the sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in an ASGRl niR A.
- the antisense strand additional nucleotides, if present may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.
- an extension comprises I, 2, 3, 4, 5, or 6 nucleotides at the 5' and/or 3' end of the sense strand core stretch sequence and or antisense strand core stretch sequence.
- the extension nucleotides on a sense strand may or may not be complementary to nucleotides. either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand.
- the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand.
- both the sense strand and the antisense strand of an RNAi agent contain 3' and 5' extensions.
- an ASGRI RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension.
- an ASGRI RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an ASGRI RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding ASGRI mRNA sequence.
- a 3' antisense strand extension includes or consists of one of the following sequences, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5' to 3').
- the 3' end of the antisense strand may include additional abasic residues or sites (Ab).
- An "abasic residue” or “abasic site” is a nucleotide or nucleoside that lacks a nucleobase at the position of the sugar.
- Ab or AbAb may be added to the 3' end of the antisense strand.
- the abasic residue(s) may be added as inverted abasic residue(s) (see Table 6). (See, e.g. , F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16).
- an ASGRI RNAi agent comprises an antisense strand having a 5' extension of 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, an ASGRI RNAi agent comprises an antisense strand having a 5' extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding ASGRI mRNA sequence.
- the 5' antisense strand extension includes or consists of one of the following sequences, but is not limited to, UA, TU, U, T, UU, TT, CUC (each listed 5' to 3').
- An antisense strand may have any of the 3' extensions described above in combination with any of the 5' antisense strand extensions described, if present.
- ASGRl RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length.
- one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides which correspond to nucleotides in the ASGR1 mRNA sequence.
- the 3' sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').
- the 3' end of the sense strand may include additional abasic residues.
- UUAb, UAb, or Ab may be added to the 3' end of the sense strand.
- the one or more abasic residues added to the 3 ' end of the sense strand may be inverted (invAb).
- one or more inverted abasic residues may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent.
- the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.
- m ASGRl RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length.
- one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides which correspond to nucleotides in the ASGR1 mRNA sequence.
- the sense strand 5' extension can be one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5' to 3').
- a sense strand may have a 3' extension and/or a 5' extension.
- the 5' end of the sense strand may include one or more additional abasic residues (e.g., (Ab) or (AbAb)).
- the one or more abasic residues added to the 5' end of the sense strand may be inverted (e.g., invAb).
- one or more inverted abasic residues may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent.
- the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.
- the 3' end of the sense strand core stretch sequence, or the 3' end of the sense strand sequence may include an inverted abasic residue (invAb (see Table 6)).
- the 5' end of the sense core stretch, or the 5' end of the sense strand sequence may include an inverted abasic site or residue.
- both the 3' and 5' ends of the sense strand core stretch sequence may include an inverted abasic residue.
- both the 3' and 5' ends of the sense strand sequence may include an inverted abasic residue.
- the 3' end of the antisense strand core stretch sequence, or the 3' end of the antisense strand sequence may include an inverted abasic residue (invAb (see Table 6)).
- the 5' end of the antisense core stretch, or the 5' end of the antisense strand sequence may include an inverted abasic site or residue.
- both the 3' and 5' ends of the antisense strand core stretch sequence may include an inverted abasic residue.
- both the 3' and 5' ends of the antisense strand sequence may include an inverted abasic residue.
- an ASGR1 R Ai agent antisense strand includes a sequence of any of the sequences in Tables 2 or 3.
- an ASCI R I RNAi agent antisense strand includes the sequence of nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1 -19, 2-19, 1-20, 2-
- an ASGRI RNAi agent antisense strand comprises or consists of a modified sequence of an one of the modified sequences in Table 3.
- an ASGRI RNAi agent sense strand includes the sequence of any of the sequences in Tables 2 or 4.
- an ASGRI R Ai agent sense strand includes the sequence of nucleotides 1-18, 1-19, 1 -20, 1 -21 . 1 -22. 1 -23, 1 -24. 1 -25. 1 -26, 2-19, 2-20. 2-
- an ASGRI RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.
- the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).
- the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end.
- a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e. do not form an overhang) but are not complementary (i.e. form a non-complementary pair).
- an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent.
- the unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs.
- the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends.
- a nucleotide base is a heterocyclic pyrimidine or purine compound which is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U).
- nucleotide can include a modified nucleotide (such as, for example, a nucleotide mimic, abasic site or residue (Ab), or a surrogate replacement moiety).
- Modified nucleotides when used in various polynucleotide or oligonucleotide constructs, may preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.
- an ASGRl RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid.
- an ASGRl RNAi agent is prepared as a sodium salt. Such forms are within the scope of the inventions disclosed herein.
- an ASGRl RNAi agent contains one or more modified nucleotides.
- a "modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide).
- at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides.
- modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'- modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdN, invN, invn, invAb), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NU A or NUNA), locked nucleotides (represented herein as NLNA or NLNA), 3'-0-methoxy (2' internucleoside linked) nucleotides (represented herein as 3'- OMen), 2'-F-Arabino nucleotides (represented herein as NfANA or WANA), 5'--
- 2'-modified nucleotides include, but are not limited to, 2'-0-methyl nucleotides (represented herein as a lower case letter 'n' in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-0-2-methoxylethyl) nucleotides (represented herein as NM or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides.
- 2'-0-methyl nucleotides represented herein as a lower case letter 'n' in a nucleotide sequence
- 2'-deoxy-2'-fluoro nucleotides represented herein as Nf, also represented herein as 2'-fluoro nucleotide
- ASGRl RNAi agent sense strands and antisense strands may be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
- Modified nucleobases include synthetic and natural nucleobases. such as 5-substituted pyrimidines, 6-azapyrirmdines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-ami nopropy 1 aden i ne, 5-propynyluracil, or 5-propynylcytosine), 5-niethylcytosine (5-me-C), 5-hydroxy methyl cytosine, inosine, xanthine, hypoxanthine. 2-aminoadenine.
- 5-substituted pyrimidines such as 5-substituted pyrimidines, 6-azapyrirmdines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-ami nopropy 1 aden i ne, 5-propynyluracil, or 5-propynylcytosine), 5-niethylcytosine (5-me-C),
- 6-alkyl e.g., 6- methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl
- 2-alkyl e.g., 2- methyl. 2-ethyl. 2-isopropyl, or 2-n-butyl
- 2-thiouracil 2-lhiothymine.
- 2-thiocytosine 5-halouracil, cytosine.
- 5 -halo e.g., 5-bronio
- 5-trifluoromethyl and other 5-substituted uracils and cytosines.
- all or substantially all of the nucleotides of an R Ai agent are modi fied nucleotides.
- an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an R Ai agent havin four or fewer (i.e.. 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides.
- a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides.
- an antisense sense strand w herein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides.
- one or more nucleotides of an RNAi agent is a ribonucleotide.
- one or more nucleotides of an ASGR1 RNAi agent are linked by non- standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones).
- Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-amino phosphoramidate, arninoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotri esters, morph
- a modified intemucleoside linkage or backbone lacks a phosphorus atom.
- Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter- sugar linkages.
- modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.
- a sense strand of an ASGR1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages
- an antisense strand of aaASGRl RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages
- both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages.
- a sense strand of ASGRl RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages
- an antisense strand of mASGRl RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages
- both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.
- an ASGR1 RNAi agent sense strand contains at least two phosphorothioate intemucleoside linkages.
- the at least two phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand.
- the at least two phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand.
- one phosphorothioate intemucleoside linkage is at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, two phosphorothioate intemucleoside linkage are located at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand.
- the sense strand does not include any phosphorothioate intemucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5' and 3' ends and the optionally present inverted abasic residue terminal caps.
- the targeting ligand is linked to the sense strand via a phosphorothioate linkage.
- an ASGRl RNAi agent antisense strand contains four phosphorothioate internucleoside linkages.
- the four phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end.
- an ASGRl RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.
- an ASGRl RNAi agent antisense strand contains four phosphorothioate internucleoside linkages.
- the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end.
- three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand.
- an ASGRl RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.
- an ASGRl RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with modified internucleoside linkage.
- the ASGRl RNAi agents disclosed herein target an ASGRl gene at or near the positions of the ASGRl gene shown in Table I .
- the antisense strand of an ASGRl RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target ASGRl 19-mer sequence disclosed in Table 1.
- Table 1. ASGRl 19-mer mRNA Target Sequences (taken from human ASGRl (transcript variant 1) cDNA, GenBank NM_001671.4 (SEQ ID NO: l)).
- an ASGR1 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5'- 3') is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1.
- m ASGRl RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5 ' -> 3 ) is capable of formin a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.
- an ASGR1 RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5' -> 3') is capable of forming a base pair with position 18 of the 19- mer target sequence disclosed in Table 1.
- an ASGR1 RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5' -> 3') are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
- the nucleotide at position 1 of the antisense strand can be perfectly complementary to the ASGR1 gene, or can be non- complementary to the ASGR1 gene.
- the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) is a U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) forms an A:U or U:A base pair with the sense strand.
- an ASGR1 RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3.
- an ASGR1 RNAi sense strand comprises the sequence of nucleotides (from 5' end 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4.
- an ASGRI RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5' end - 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end - 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4.
- the ASGRI RNAi agents include core 19-mer nucleotide sequences in the sense strand, antisense strand, or both the sense and antisense strands, shown in the following Table 2.
- NCAUCUUUCUUCCCACAUN 302 NAUGUGGGAAGAAAGAUGN 689-707
- the ASGRl RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides.
- the ASGRl RNAi agents having the sense and antisense strand sequences that comprise or consist of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.
- the antisense strand of an ASGRl RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an ASGRl RNAi agent disclosed herein differs by 0, 1 , 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
- each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (includin those found on both modified and unmodified nucleotides).
- an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand.
- an N nucleolide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the correspondin position on the other strand.
- an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.
- ASGRl RNAi agent sense and antisense strands are provided in Table 3 and Table 4.
- Certain modified ASGRl RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3.
- Certain modi fied ASGRl RNAi agent sense strands, as well as their underlying unmodified sequences, are provided in Table 4.
- each of the nucleotides in each of the unmodi fied sequences listed in Tables 3 and 4. as well as in Table 2. above, can be a modified nucleotide.
- the ASGRl RNAi agents described herein are formed by annealing an antisense strand with a sense strand.
- a sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
- an ASGRl RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.
- mASGRI RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, or Table 4.
- antisense strands containing modified nucleotides are provided in Table 3.
- sense strands containing modified nucleotides are provided in Table 4.
- A adenosine-3 '-phosphate
- G guanosine-3 '-phosphate
- n any 2'-0-methyl modified nucleotide
- Nf any 2'-fluoro modified nucleotide
- Tfs 2'-fluoro-5'-methyluridine-3'-phosphorothioate
- dN any 2'-deoxyribonucleotide
- dAs 2'-deoxyadenosine-3'-phosphorothioate
- NUNA 2',3'-seco nucleotide mimics (unlocked nucleobase analogs)-3'- Phosphate
- NUNAS 2',3'-seco nucleotide mimics (unlocked nucleobase analogs)-3'- phosphorothioate
- AUNAS 2',3'-seco-adenosine-3'-phosphorothioate
- CUNA 2',3'-seco-cytidine-3'-phosphate
- CUNAS 2',3'-seco-cytidine-3'-phosphorothioate
- GUNA 2',3'-seco-guanosine-3'-phosphate
- GUNAS 2',3'-seco-guanosine-3'-phosphorothioate
- UUNA 2',3'-seco-uridine-3'-phosphate
- UUNAS 2',3'-seco-uridine-3'-phosphorothioate
- NLNA locked nucleotide
- NfANA 2'-F-Arabino nucleotide 2'-0-methoxy ethyl nucleotide
- nucleotide monomers when present in an oligonucleotide, are mutually linked by 5'-3'- phosphodiester bonds.
- a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides (see, e.g., Figs. 1A through 1M showing all internucleoside linkages).
- the terminal nucleotide at the 3' end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3' position of the given monomer instead of a phosphate moiety ex vivo.
- the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom
- the inventions disclosed herein encompass all phosphorothioate tautomers and/or diastereomers (e.g. , where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the ASGRl RNAi agents and compositions ofASGRl RNAi agents disclosed herein.
- targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 6: (NAG 13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s,
- AM05761-AS 418 usAfsgsAfaCfcAfgUfaGfcAfgCfuGfcusu 723 UAGAACCAGUAGCAGCUGCUU
- AM06016-AS 424 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsg 727 UACUCCUUGGUCAUGAUAGGG
- AM06017-AS 425 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsgsu 3 UACUCCUUGGUCAUGAUAGGU
- AM06023-AS 428 usUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusg 731 UUAAAGGAGAGGUGGCUCCUG
- AM06026-AS 429 usGfsuAfgCfaGfcUfgCfgCfuCfgUfgscsu 732 UGUAGCAGCUGCGCUCGUGCU
- AM06027-AS 430 usGfsuAfgCfaGfcUfgCfgCfuCfgUfgsusu 733 UGUAGCAGCUGCGCUCGUGUU
- AM06029-AS 431 usGfsuGfcUfcGfcUfgUfgAfaGfuUfgscsu 734 UGUGCUCGCUGUGAAGUUGCU
- AM06033-AS 433 usUfsgAfuGfgUfgGfuCfaCfuCfuCfcsusc 736 UUGAUGGUGGUCACUCUCCUC
- AM06172-AS 434 usUfsgAfuGfgUfgGfuCfaCfuCfuCfcsusu 737 UUGAUGGUGGUCACUCUCCUU
- AM06179-AS 437 usAfsgCfuGfaUfgGfuGfgUfcAfcUfcsusc 740 UAGCUGAUGGUGGUCACUCUC
- AM06180-AS 438 usAfsgCfuGfaUfgGfuGfgUfcAfcUfcusu 741 UAGCUGAUGGUGGUCACUCUU
- AM06183-AS 439 usGfsasGfcCfaUfuGfcCfcUfgGfaGfcusu 742 UGAGCCAUUGCCCUGGAGCUU
- AM06185-AS 440 usAfscGfuGfaCfcAfcCfaCfcAfgGfuusu 743 UACGUGACCACCACCAGGUUU
- AM06186-AS 441 usAfscGfuGfaCfcAfcCfaCfcAfgGfusgsc 744 UACGUGACCACCACCAGGUGC
- AM06189-AS 442 usCfsuGfcUfuCfaCfgUfgGfaGfcAfgsusu 745 UCUGCUUCACGUGGAGCAGUU
- AM06248-AS 447 usAfscUfcCfuUfgGfuCfaUfgAfuAfggsusu 747 UACUCCUUGGUCAUGAUAGGUU
- AM06249-AS 448 usAfscUfcCfuUfgGfuCfaUfgAfuAfsgsg 748 UACUCCUUGGUCAUGAUAGG
- AM06250-AS 449 usAfscUfcCfuUfgGfuCfaUfgAfusasg 749 UACUCCUUGGUCAUGAUAG
- AM06251-AS 450 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsusu 750 UACUCCUUGGUCAUGAUAGUU
- AM06252-AS 451 usAfscUfcCfuUfgGfuCfaUfgAfuAfggsgsc 751 UACUCCUUGGUCAUGAUAGGGC
- AM06254-AS 453 cP ⁇ dUsAfscUfcCfuUfgGfuCfaUfgAfuAfgsgsu 3 UACUCCUUGGUCAUGAUAGGU
- AM06442-AS 454 usUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU
- AM06443-AS 455 cP ⁇ dUsUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU
- AM06444-AS 456 cP ⁇ usUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU
- AM06446-AS 458 usUfsaaaggAfgAfgGfuGfgcuccsusu 752 UUAAAGGAGAGGUGGCUCCUU
- AM06447-AS 459 usUf s aAf aGfg AfgAfgGfuGfgCfus esc 753 UUAAAGGAGAGGUGGCUCC
- AM06448-AS 460 usUfsaAfaGfgAfgAfgGfuGfgCfuCfcusgsg 754 UUAAAGGAGAGGUGGCUCCUGG
- AM06578-AS 462 usGfsaCfgUfcGfuCfgUfuCfcAfgCfgsusu 738 UGACGUCGUCGUUCCAGCGUU
- AM06598-AS 468 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsg 727 UACUCCUUGGUCAUGAUAGGG
- AM06601-AS 2 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM06639-AS 470 usAfscsUfcCfuugguCfaUfgAfuAfgsGfsg 727 UACUCCUUGGUCAUGAUAGGG
- AM06641-AS 471 usAfscsUfcCfuUfgGfuCfaUfgAfuAfgsusu 750 UACUCCUUGGUCAUGAUAGUU
- AM06643-AS 472 usAfscsUfcCfuugguCfaUfgAfuAfgGfsgs(invAb) 727 UACUCCUUGGUCAUGAUAGGG
- AM06651-AS 476 asAfscsCfaGfuagcaGfcUfgCfgCfuCfsg 760 AACCAGUAGCAGCUGCGCUCG
- AM06653-AS 477 asAfscsCfaGfuagcaGfcUfgCfgCfuusu 761 AACCAGUAGCAGCUGCGCUUU
- AM06655-AS 478 usGfscAfgUfaguugUfcGfgCfgUfcsAfsg 762 UGCAGUAGUUGUCGGCGUCAG
- AM06657-AS 479 usAfsgsGfaCfgugacCfaCfcAfcCfaGfsg 763 UAGGACGUGACCACCACCAGG
- AM06661-AS 481 usUf s cs GfuAfguccgUf cCf cGfuCf c Af sc 765 UUCGUAGUCCGUCCCGUCCAC
- AM06663-AS 482 usUfscsUfcGfuagucCfgUfcCfcGfuCfsu 766 UUCUCGUAGUCCGUCCCGUCU
- AM06665-AS 483 usGfsusAfcCfagucgUfcCfgGfcUfgusu 767 UGUACCAGUCGUCCGGCUGUU
- AM06671-AS 486 usUfscsUfuCfccacaUfuGfcCfuCfcCfsu 769 UUCUUCCCACAUUGCCUCCCU
- AM06679-AS 490 usUfsuAfaAfgGfaGfaGfgUfgGfcUfcsCfsu 773 UUUAAAGGAGAGGUGGCUCCU
- AM06687-AS 494 usAfsaCfcAfguagcAfgCfuGfcGfcsUfsc 776 UAACCAGUAGCAGCUGCGCUC
- AM06689-AS 495 usAfsgCfuCfugucuCfgCfaGfaCfcsCfsa 777 UAGCUCUGUCUCGCAGACCCA
- AM06799-AS 502 usAfscsUfcCfuugguCfaUfgAfuAfgGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM06806-AS 503 usAfscUfcCfuugguCfaUfgAfuAfgsGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM06822-AS 507 usAfsusCfuUfuCfuUfcCfcAfcAfuUfgCfsc 787 UAUCUUUCUUCCCACAUUGCC
- AM06836-AS 514 usCfsaUfcUfuUfcUfuCfcCfaCfaUfusGfsc 794 UCAUCUUUCUUCCCACAUUGC
- AM06838-AS 28 usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsg 27 UGAAAUAAAUUAAAGGAGAGG
- AM06851-AS 4 usAfscUfcCfUwAUfgGfuCfaUfgAfuAfgsGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM06859-AS 520 usAfsusAfcUfccuugGfuCfaUfgAfuCfsc 800 UAUACUCCUUGGUCAUGAUCC
- AM06861-AS 521 usAfsusAfcUfccuugGfuCfaUfgAfuAfsc 801 UAUACUCCUUGGUCAUGAUAC
- AM06911-AS 522 usAfscsUfcCfuugguCfaUfgAfuAfgGfsg 727 UACUCCUUGGUCAUGAUAGGG
- AM06918-AS 526 usUfsusAfaAfGfGfaGfaGfgUfgGfcUfcusu 803 UUUAAAGGAGAGGUGGCUCUU
- AM07073-AS 528 usUfsgAfuAfcUfcCfuUfgGfuCfaUfgsGfsu 805 UUGAUACUCCUUGGUCAUGGU
- AM07075-AS 529 usUfsgAfuAfcUfcCfuUfgGfuCfaUfgsAfsg 806 UUGAUACUCCUUGGUCAUGAG
- AM07077-AS 530 usUfsg AfuAfcuccuUfgGfuCfaUfgs Gfs c 807 UUGAUACUCCUUGGUCAUGGC
- AM07079-AS 531 usAfsusCfuUfucuucCfcAfcAfuUfgCfsg 808 UAUCUUUCUUCCCACAUUGCG
- AM07487-AS 549 usAfscsuccuugguCfaUfgAfuAfgGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM07488-AS 550 usAfscsuccUu AUgguCfaUfgAfuAfgGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM07576-AS 554 usAfscuccuugguCfaUfgAfuAfgsGfsu 3 UACUCCUUGGUCAUGAUAGGU
- AM07577-AS 555 usAfscuccUuNAugguCfaUfgAfuAfgsGfsu 3 UACUCCUUGGUCAUGAUAGGU
- the ASGRl RNAi agents described herein are formed by annealin an antisense strand with a sense strand.
- a sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
- the antisense strand of an ASGRl RN Ai agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3.
- the sense strand of an ASGRl RNAi agent disclosed herein differs by 0, 1 , 2, or 3 nucl eotides from any of the sense strand sequences in Table 4.
- an ASGRl RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.
- an ASGRl RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end - 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2- 24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 2 or Table 3.
- an AS Rl RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
- an ASGRl RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4.
- an ASGRl RNAi agent sense strand comprises the sequence of nucleotides (from 5' end - 3' end) 1- 17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4- 24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 of any of the sequences in Table 2 or Table 4.
- an ASGRl RNAi agent sense strand comprises or consists of a modified sequence of any one of the modifi ed sequences in Table 4.
- the nucleotide at position 1 of the antisense strand can be perfectly complementary to an ASGRl gene, or can be non-complementary to an ASGRl gene.
- the nucleotide at position 1 of the antisense strand is a U, A, or dT (or a modified version thereof).
- the nucleotide at position 1 of the antisense strand forms an A:U or U:A base pair with the sense strand.
- an ASGRl RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end - 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3.
- an ASGRl RNAi sense strand comprises the sequence of nucleotides (from 5' end - 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
- an ASGRl RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5' end - 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end - 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
- a sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to an antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 2 1 nucleotide sequence.
- the ASGRl R Ai agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. Representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5.
- an ASGRl RNAi agent comprises any of the duplexes represented by any of the Duplex ID Nos.
- an ASGRl RNAi agent consists of any of the duplexes represented by any of the Duplex ID Nos. presented herein.
- an ASGRl RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein.
- an ASGRl RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked (i.e.
- an ASGRl RNAi agent comprises a sense strand and an antisense strand having the modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein.
- an ASGRl RNAi agent comprises a sense strand and an antisense strand having the modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.
- an ASGRl RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group.
- an ASGRl RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.
- an ASGRl RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)
- an ASGRl RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5.
- an ASGRl RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5, and comprises an asialoglycoprotein receptor ligand targeting group.
- an ASGRl RNAi agent comprises any of the duplexes of Table 2 or Table 5.
- an ASGRl RNAi agent comprises a duplex selected from the group consisting of AD05126, AD05150, AD05183, AD05186, AD05193, AD05195, AD05196, AD05206, AD05209, AD05256, AD05374, AD05609, and AD05692 or a salt thereof.
- an ASGRl RNAi agent consists of any of the duplexes of Table 2 or Table 5.
- an ASGRl RNAi agent consists of a duplex selected from the group consisting of AD05126, AD05150, AD05183, AD05186, AD05193, AD05195, AD05196, AD05206, AD05209, AD05256, AD05374, AD05609, and AD05692 or a salt thereof.
- mASGRl RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid.
- the RNAi agents described herein upon delivery to a cell expressing an ASGRl gene, inhibit or knockdown expression of one or more ASGRl genes in vivo. Targeting Groups, Linking Groups, and Delivery Vehicles
- mASGRl RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to a targeting group, linking group, delivery polymer, or a delivery vehicle.
- the non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6.
- the non-nucleotide group can be covalently linked to the 3' and/or 5' end of either the sense strand and/or the antisense strand.
- an ASGRl RNAi agent contains a non-nucleotide group linked to the 3' and/or 5' end of the sense strand.
- a non-nucleotide group is linked to the 5' end of mASGRl RNAi agent sense strand.
- a non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker/linking group.
- a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
- a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.
- Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent.
- a targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed.
- Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules.
- a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which can in some instances serve as linkers.
- a targeting group comprises a galactose- derivative cluster.
- the ASGR1 RNAi agents described herein may be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5 '-terminus and/or the 3'- terminus.
- a reactive group such as an amino group (also referred to herein as an amine), at the 5 '-terminus and/or the 3'- terminus.
- the reactive group may be used to subsequently attach a targeting group using methods typical in the art.
- a targeting group comprises an asialoglycoprotein receptor ligand.
- an asialoglycoprotein receptor ligand is a ligand that contains a compound having affinity for the asialoglycoprotein receptor. As noted herein, the asialoglycoprotein receptor is highly expressed on hepatocytes.
- an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose.
- Galactose derivatives include, but are not limited to: galactose, galactosamine, N- formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoylgalactos-amine (see for example: S.T. Iobst and K. Drickamer, J.B.C., 1996, 271, 6686).
- Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611- 620; Connolly et al, 1982, J. Biol. Chem, 257, 939-945).
- Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes.
- Asialoglycoprotein receptor ligands can be monomelic (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives).
- the galactose derivative or galactose derivative cluster may be attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent using methods known in the art.
- the preparation of targeting groups, such as galactose derivative clusters is described in, for example, International Patent Application Publication No. WO 2018/044350 to Arrowhead Pharmaceuticals, Inc., and International Patent Application Publication No. WO 2017/156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated by reference herein in their entirety.
- a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon.
- the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative).
- the galactose derivative cluster comprises N-acetyl- galactosamines.
- the galactose derivative cluster comprises three N- acetyl-galactosamines.
- the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative).
- the galactose derivative cluster comprises four N-acetyl-galactosamines.
- a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point.
- a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point.
- the galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides.
- the galactose derivatives are linked to the branch point via linkers or spacers.
- the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U. S. Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol.
- the PEG spacer is a PEG3 spacer.
- the branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent.
- An example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer.
- the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer.
- the linker comprises a rigid linker, such as a cyclic group.
- a galactose derivative comprises or consists of N-acetyl-galactosamine.
- the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.
- embodiments of the present disclosure include pharmaceutical compositions for delivering wASGRl RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, w ASGRl RNAi agent conjugated to a galactose derivative cluster.
- the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.
- a galactose derivative trimer which can be, for example, an N-acetyl-galactosamine trimer
- galactose derivative tetramer which can be, for example, an N-acetyl-galactosamine tetramer.
- Targeting groups include, but are not limited to, (PAZ), (NAG 13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s, as defined in Table 6.
- Other targeting groups including galactose cluster targeting ligands
- a linking group is conjugated to the RNAi agent.
- the linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle.
- the linking group can be linked to the 3' or the 5' end of the RNAi agent sense strand or antisense strand.
- the linking group is linked to the RNAi agent sense strand.
- the linking group is conjugated to the 5' or 3' end of an RNAi agent sense strand.
- a linking group is conjugated to the 5' end of an RNAi agent sense strand.
- linking groups include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and/or PEG groups.
- a linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds.
- a labile linkage contains a labile bond.
- a linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and/or length to the linkage.
- Spacers may include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.
- any of the ASGRl RNAi agent nucleotide sequences listed in Tables 2, 3 or 4, whether modified or unmodified, may contain 3 Or 5' targeting groups or linking groups. Any of the ASGRl RNAi agent sequences listed in Tables 3 or 4 which contain a 3 Or 5' targeting group or linking group, may alternatively contain no 3' or 5' targeting group or linking group, or may contain a different 3' or 5' targeting group or linking group including, but not limited to, those depicted in Table 6.
- any of the ASGRl RNAi agent duplexes listed in Table 2 or Table 5, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 6, and the targeting group or linking group may be attached to the 3' or 5' terminus of either the sense strand or the antisense strand of the ASGRl RNAi agent duplex. Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides several embodiments of ASGRl RNAi agent sense strands having a targeting group or linking group linked to the 5' or 3' end.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Dermatology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3079413A CA3079413A1 (en) | 2017-10-17 | 2018-10-16 | Rnai agents and compositions for inhibiting expression of asialoglycoprotein receptor 1 |
| CN201880066319.0A CN111212909A (zh) | 2017-10-17 | 2018-10-16 | 用于抑制去唾液酸糖蛋白受体1的表达的RNAi试剂和组合物 |
| JP2020521451A JP7473472B2 (ja) | 2017-10-17 | 2018-10-16 | アシアロ糖タンパク質受容体1の発現を阻害するためのRNAi剤および組成物 |
| US16/756,440 US11492624B2 (en) | 2017-10-17 | 2018-10-16 | RNAi agents and compositions for inhibiting expression of Asialoglycoprotein receptor 1 |
| EP18868368.4A EP3697909A4 (en) | 2017-10-17 | 2018-10-16 | RNAI-BASED AGENTS AND COMPOSITIONS INTENDED TO INHIBIT ASIALOGLYCOPROTEIN RECEPTOR 1 EXPRESSION |
| AU2018352379A AU2018352379A1 (en) | 2017-10-17 | 2018-10-16 | RNAi agents and compositions for inhibiting expression of Asialoglycoprotein receptor 1 |
| JP2024064086A JP2024086876A (ja) | 2017-10-17 | 2024-04-11 | アシアロ糖タンパク質受容体1の発現を阻害するためのRNAi剤および組成物 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762573206P | 2017-10-17 | 2017-10-17 | |
| US62/573,206 | 2017-10-17 | ||
| US201762608606P | 2017-12-21 | 2017-12-21 | |
| US62/608,606 | 2017-12-21 | ||
| US201862635277P | 2018-02-26 | 2018-02-26 | |
| US62/635,277 | 2018-02-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019079294A1 true WO2019079294A1 (en) | 2019-04-25 |
Family
ID=66173364
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/056077 Ceased WO2019079294A1 (en) | 2017-10-17 | 2018-10-16 | RNAI-BASED AGENTS AND COMPOSITIONS FOR INHIBITING ASIALOGLYCOPROTEIN RECEPTOR 1 RECEPTOR 1 |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US11492624B2 (https=) |
| EP (1) | EP3697909A4 (https=) |
| JP (2) | JP7473472B2 (https=) |
| CN (1) | CN111212909A (https=) |
| AU (1) | AU2018352379A1 (https=) |
| CA (1) | CA3079413A1 (https=) |
| TW (1) | TW201918555A (https=) |
| UY (1) | UY37936A (https=) |
| WO (1) | WO2019079294A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2023548295A (ja) * | 2020-11-06 | 2023-11-16 | アルブータス・バイオファーマー・コーポレイション | 修飾されたsiRNAを含む標的化コンジュゲート |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG11201901841TA (en) * | 2016-09-02 | 2019-03-28 | Arrowhead Pharmaceuticals Inc | Targeting ligands |
| CN116617390A (zh) * | 2022-02-11 | 2023-08-22 | 武汉大学 | Asgr1抑制剂在促进胆固醇外排和治疗非酒精性脂肪性肝病中的应用 |
| CN117645995A (zh) * | 2022-09-02 | 2024-03-05 | 北京福元医药股份有限公司 | 抑制去唾液酸糖蛋白受体基因表达的siRNA、其缀合物和药物组合物及用途 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1587408A (zh) * | 2004-08-23 | 2005-03-02 | 中国人民解放军军事医学科学院放射医学研究所 | 靶向去唾液酸糖蛋白受体的抗乙型肝炎病毒反义寡核苷酸的结构和用途 |
| US20170088620A1 (en) * | 2015-09-29 | 2017-03-30 | Amgen Inc. | Asgr inhibitors |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| NL9201440A (nl) | 1992-08-11 | 1994-03-01 | Univ Leiden | Triantennaire clusterglycosiden, hun bereiding en toepassing. |
| DE60040274D1 (de) | 1999-03-10 | 2008-10-30 | Phogen Ltd | Verabreichung von nukleinsäuren und proteinen an zellen |
| CN101500548A (zh) | 2006-08-18 | 2009-08-05 | 弗·哈夫曼-拉罗切有限公司 | 用于体内递送多核苷酸的多缀合物 |
| JP2010505897A (ja) * | 2006-10-11 | 2010-02-25 | マックス−プランク−ゲゼルシャフト・ツア・フェルデルング・デア・ヴィッセンシャフテン・エー・ファオ | インフルエンザターゲット |
| EP2295543A1 (en) * | 2009-09-11 | 2011-03-16 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for the preparation of an influenza virus |
| SI2539451T1 (sl) | 2010-02-24 | 2016-04-29 | Arrowhead Research Corporation | Sestavki za ciljano dostavo sirna |
| US8501930B2 (en) | 2010-12-17 | 2013-08-06 | Arrowhead Madison Inc. | Peptide-based in vivo siRNA delivery system |
| WO2013032829A1 (en) | 2011-08-26 | 2013-03-07 | Arrowhead Research Corporation | Poly(vinyl ester) polymers for in vivo nucleic acid delivery |
| CA2842041A1 (en) | 2012-04-18 | 2013-10-24 | Arrowhead Research Corporation | Poly(acrylate) polymers for in vivo nucleic acid delivery |
| JOP20160211B1 (ar) * | 2015-10-01 | 2021-08-17 | Arrowhead Pharmaceuticals Inc | تراكيب وأساليب لتثبيط تعبير جيني للـ lpa |
| CA3011946A1 (en) | 2016-03-07 | 2017-09-14 | Arrowhead Pharmaceuticals, Inc. | Targeting ligands for therapeutic compounds |
| UY37376A (es) | 2016-08-26 | 2018-03-23 | Amgen Inc | Construcciones de arni para inhibir expresión de asgr1 y métodos para su uso |
| SG11201901841TA (en) | 2016-09-02 | 2019-03-28 | Arrowhead Pharmaceuticals Inc | Targeting ligands |
-
2018
- 2018-10-16 JP JP2020521451A patent/JP7473472B2/ja active Active
- 2018-10-16 WO PCT/US2018/056077 patent/WO2019079294A1/en not_active Ceased
- 2018-10-16 EP EP18868368.4A patent/EP3697909A4/en active Pending
- 2018-10-16 AU AU2018352379A patent/AU2018352379A1/en not_active Abandoned
- 2018-10-16 CA CA3079413A patent/CA3079413A1/en active Pending
- 2018-10-16 US US16/756,440 patent/US11492624B2/en active Active
- 2018-10-16 CN CN201880066319.0A patent/CN111212909A/zh active Pending
- 2018-10-17 TW TW107136576A patent/TW201918555A/zh unknown
- 2018-10-17 UY UY0001037936A patent/UY37936A/es not_active Application Discontinuation
-
2024
- 2024-04-11 JP JP2024064086A patent/JP2024086876A/ja active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1587408A (zh) * | 2004-08-23 | 2005-03-02 | 中国人民解放军军事医学科学院放射医学研究所 | 靶向去唾液酸糖蛋白受体的抗乙型肝炎病毒反义寡核苷酸的结构和用途 |
| US20170088620A1 (en) * | 2015-09-29 | 2017-03-30 | Amgen Inc. | Asgr inhibitors |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP3697909A4 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2023548295A (ja) * | 2020-11-06 | 2023-11-16 | アルブータス・バイオファーマー・コーポレイション | 修飾されたsiRNAを含む標的化コンジュゲート |
Also Published As
| Publication number | Publication date |
|---|---|
| UY37936A (es) | 2019-05-31 |
| US20200283777A1 (en) | 2020-09-10 |
| JP2020537653A (ja) | 2020-12-24 |
| TW201918555A (zh) | 2019-05-16 |
| JP2024086876A (ja) | 2024-06-28 |
| US11492624B2 (en) | 2022-11-08 |
| AU2018352379A1 (en) | 2020-06-04 |
| EP3697909A1 (en) | 2020-08-26 |
| CN111212909A (zh) | 2020-05-29 |
| CA3079413A1 (en) | 2019-04-25 |
| JP7473472B2 (ja) | 2024-04-23 |
| EP3697909A4 (en) | 2021-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7741927B2 (ja) | 17β-HSD13型(HSD17B13)の発現を阻害するためのRNAi剤、その組成物、および使用方法 | |
| CN111107853B (zh) | 用于抑制载脂蛋白C-III (APOC3)的表达的RNAi试剂和组合物 | |
| CN111343994B (zh) | 用于抑制血管生成素-样3 (ANGPTL3)的表达的RNAi剂和组合物以及使用方法 | |
| JP2024086876A (ja) | アシアロ糖タンパク質受容体1の発現を阻害するためのRNAi剤および組成物 | |
| WO2024192379A1 (en) | Rnai agents for inhibiting expression of mitochondrial amidoxime reducing component 1 (marc1), pharmaceutical compositions thereof, and methods of use | |
| OA19513A (en) | RNAI agents and compositions for inhibiting expression of apolipoprotein C-lll (APOC3). | |
| HK40059365A (en) | Rnai agents for inhibiting expression of 17beta-hsd type 13- (hsd17b13), compositions thereof, and methods of use | |
| EA047975B1 (ru) | РНКи АГЕНТЫ ДЛЯ ИНГИБИРОВАНИЯ ЭКСПРЕССИИ 17β-HSD ТИПА 13 (HSD17B13), ИХ КОМПОЗИЦИИ И СПОСОБЫ ПРИМЕНЕНИЯ | |
| OA19517A (en) | RNAI agents and compositions for inhibiting expression of Angiopoietin-like 3 (ANGPTL3), and methods of use. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18868368 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2020521451 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 3079413 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018868368 Country of ref document: EP Effective date: 20200518 |
|
| ENP | Entry into the national phase |
Ref document number: 2018352379 Country of ref document: AU Date of ref document: 20181016 Kind code of ref document: A |