Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
  • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/76—Viruses; Subviral particles; Bacteriophages
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
  • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
  • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0634—Cells from the blood or the immune system
  • C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
  • C12N5/0662—Stem cells
  • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
  • C12N5/0662—Stem cells
  • C12N5/0665—Blood-borne mesenchymal stem cells, e.g. from umbilical cord blood
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
  • A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
  • C12N2501/60—Transcription factors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2510/00—Genetically modified cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

• HSCT allogeneic hematopoietic stem cell transplantation
• Immune suppressive drugs of many types may suppress some of the complications of inherited or acquired auto-immune/auto-inflammatory diseases, but may be only partially or minimally effective and have significant toxicities.
• Embodiment 1 A recombinant lentiviral vector (LV) comprising:
• an expression cassette comprising a nucleic acid construct comprising a nucleotide sequence encoding a human FoxP3 protein operably linked to an endogenous FoxP3 promoter;
• said LV is a TAT-independent and self-inactivating (SIN) lentiviral vector.
• Embodiment 2 The vector of embodiment 1, wherein said a nucleotide sequence encoding a human FoxP3 protein comprises a FoxP3 cDNA.
• Embodiment 3 The vector according to any one of embodiments 1-2, wherein said nucleotide sequence encoding a human FoxP3 is codon optimized.
• Embodiment 4 The vector according to any one of embodiments 1-3, wherein said nucleotide sequence encoding a human FoxP3 protein is operably linked to one or more FoxP3 enhancer elements.
• Embodiment 5 The vector of embodiment 4, wherein said enhancer elements are selected from the group consisting of Foxp3 conserved non-coding sequence 1 (FoxP3-CNSl), Foxp3 conserved non-coding sequence 2 (FoxP3-CNS2), and Foxp3 conserved non-coding sequence 3 (FoxP3-CNS3).
• said enhancer elements are selected from the group consisting of Foxp3 conserved non-coding sequence 1 (FoxP3-CNSl), Foxp3 conserved non-coding sequence 2 (FoxP3-CNS2), and Foxp3 conserved non-coding sequence 3 (FoxP3-CNS3).
• Embodiment 6 The vector of embodiment 5, wherein said expression cassette comprises FoxP3-CNSl, FoxP3-CNS2, and FoxP3-CNS3.
• Embodiment 7 The vector according to any one of embodiments 1-6, wherein said vector comprises a FoxP3 3'UTR.
• Embodiment 8 The vector according to any one of embodiments 1-7, wherein said vector comprises a ⁇ region vector genome packaging signal.
• Embodiment 9 The vector according to any one of embodiments 1-8, wherein the 5' LTR comprises a CMV enhancer/promoter.
• Embodiment 10 The vector according to any one of embodiments 1-9, wherein said vector comprises a Rev Responsive Element (RRE).
• RRE Rev Responsive Element
• Embodiment 11 The vector according to any one of embodiments 1-10, wherein said vector comprises a central polypurine tract.
• Embodiment 12 The vector according to any one of embodiments 1-11, wherein said vector comprises an insulator element.
• Embodiment 13 The vector of embodiment 12, wherein said vector comprises an A2 insulator.
• Embodiment 14 The vector of embodiment 13, wherein said vector comprises an A2 insulator within a U3 region.
• Embodiment 15 The vector according to any one of embodiments 1-14, wherein said vector is incapable of reconstituting a wild-type lentivirus through
• Embodiment 16 The vector according to any one of embodiments 1-15, wherein said vector comprises a PCCL backbone.
• Embodiment 17 The vector according to any one of embodiments 1-16, wherein cells transfected with said vector recapitulate normal physiologic expression of FoxP3 in the appropriate mature lymphocyte.
• Embodiment 18 The vector of embodiment 1, wherein said vector comprises the nucleic acid of SEQ ID NO: 1.
• Embodiment 19 A packaging cell transfected with a vector according to any one of embodiments 1-18.
• Embodiment 20 A lentiviral particle encoded by a vector according to any one of embodiments 1-18.
• Embodiment 21 A host cell infected with lentiviral particle encoded by a lentiviral vector according to any one of embodiments 1-18.
• Embodiment 22 The host cell of embodiment 21, wherein said cell is a stem cell.
• Embodiment 23 The host cell of embodiment 21, wherein said cell is a stem cell derived from bone marrow.
• Embodiment 24 The host cell of embodiment 21, wherein said cell is a stem cell derived from cord blood.
• Embodiment 25 The host cell of embodiment 21, wherein said cell is a peripheral blood stem cell.
• Embodiment 26 The host cell of embodiment 21, wherein said cell is a human hematopoietic progenitor cell.
• Embodiment 27 The host cell of embodiment 21, wherein said human hematopoietic progenitor cell is a CD34 + cell.
• Embodiment 28 The host cell of embodiment 27, wherein said human hematopoietic progenitor cell is a CD34 + CD38 " cell.
• Embodiment 29 An infectious lentivirus particle comprising a nucleic acid that expresses a human FoxP3 protein.
• Embodiment 30 The lentivirus particle of embodiment 29, wherein said virus particle is produced using a lentiviral vector according to any one of embodiments 1- 18.
• Embodiment 31 A method of restoring regulatory T cell (Treg) function in a mammal with deficient FoxP3 expression, said method comprising:
• Embodiment 32 A method of treating an autoimmune disorder in a subject, said method comprising, said method comprising: transducing a stem cell and/or progenitor cell from said subject with a lentiviral vector according to any one of embodiments 1-18 and/or a virus particle according to any one of embodiments 29-30; and transplanting said transduced cell or cells derived therefrom into said subject where said cells or derivatives therefrom express said human FoxP3 gene and ameliorate one or more symptoms of said autoimmune disorder and/or eliminate said autoimmune disorder.
• Embodiment 33 The method of embodiment 32, wherein said autoimmune disorder comprises a disorder selected from the group consisting of myasthenia gravis, multiple sclerosis, Immune dysregulation, Polyendocrinopathy Enteropathy X-linked (IPEX), and autoimmune arthritis.
• autoimmune disorder comprises a disorder selected from the group consisting of myasthenia gravis, multiple sclerosis, Immune dysregulation, Polyendocrinopathy Enteropathy X-linked (IPEX), and autoimmune arthritis.
• Embodiment 34 The method according to any one of embodiments 30-33, wherein said cells or derivatives therefrom recapitulate normal physiologic expression of FoxP3.
• Embodiment 35 The method according to any one of embodiments 30-34, wherein the cell is a stem cell.
• Embodiment 36 The method according to any one of embodiments 30-34, wherein said cell is a stem cell derived from bone marrow.
• Embodiment 37 The method according to any one of embodiments 30-34, wherein said cell is a stem cell derived from cord blood.
• Embodiment 38 The method according to any one of embodiments 30-34, wherein said cell is peripheral blood stem cell.
• Embodiment 39 The method according to any one of embodiments 30-34, wherein, wherein the cell is a human hematopoietic progenitor cell.
• Embodiment 40 The method of embodiment 39, wherein the human hematopoietic progenitor cell is a CD34 + cell.
• Embodiment 41 The method of embodiment 40, wherein the human hematopoietic progenitor cell is a CD34 +/ CD38 " cell.
• FIG. 1 panels A-B, shows that a FoxP3 reporter vector shows TReg lineage specific expression in human cell lines.
• Panel A Flow cytometry measurement of endogenous FoxP3 protein expression in 3 different cell lines: MT-2 (T-reg like), Jurkat (T- cell), and K562 (Erythroid). Red histogram represents foxP3 expression, gray histogram depicts fluorescence of isotype control stained cells.
• Panel B Expression of mStrawberry reporter protein in MT-2, Jurkat, or K562 cells transduced with a FoxP3-mStrawberry reporter vector.
• Y-axis represents the percentage of cells positive for mStrawberry expression
• x-axis represents the number of vector copies per cell.
• FIG. 2 panels A-B, shows that FoxP3 reporter vector shows TReg lineage specific expression in a murine congenic transplant model.
• Panel B mStrawberry reporter expression was measured in FoxP3- (GFP-) and FoxP3+ (GFP+) donor cells in the bone marrow, spleen, and thymus of engrafted mice.
• Y axis represents the percentage of mStrawberry+ cells in each population.
• Figure 3 panels A-D, shows that that FoxP3 reporter vector shows Treg lineage specific expression in a humanized mouse model.
• hCD45+ cells were analyzed for mStrawberry expression.
• Panel B Lineage specific mStrawberry expression in engrafted hCD45+ cells.
• hCD45+ cells were gated by lineage markers in NSG bone marrow (CD19+ B cells, CD33+ myeloid cells, CD34+ stem and progenitor cells, and CD3+ T cells), thymus (CD4-CD8- double negative [DN], CD4+CD8+ double positive [DP], CD4CD8+ single positive [CD8 SP], CD4+CD8- CD25- [CD4 Tconv cells], and CD4+CD8-CD25+ [Treg], and spleen (CD 8 T cells, CD4+CD25- Tconv cells, and CD4+CD25+ Treg cells).
• NSG bone marrow CD19+ B cells, CD33+ myeloid cells, CD34+ stem and progenitor cells, and CD3+ T cells
• thymus CD4-CD8-
• Histograms represent mStrawberry expression within each lineage. Dotted line shows cutoff for "mStrawberry high"
• Panel D Co-expression of FoxP3 and mStrawberry in humanized mice. Human CD4+ cells from engrafted NSG-SGM3 mice were sorted based on mStrawberry expression followed by intracellular staining and flow cytometric analysis for FoxP3 expression. Left panel shows sorting of human CD4+ cells by mStrawberry expression, while right panel shows FoxP3 expression within each sorted population.
• FIG. 4 shows that introduction of a lineage specific FoxP3 coding vector into FoxP3 -deficient murine HSC restores functional Treg development.
• Tregs from scurfy mice were compared to natural GFP+ Tregs from WT FoxP3-GFP mice.
• Panel C Thymocytes from WT FoxP3-GFP mice (top) or engrafted CD45.2 corrected donor scurfy cells (bottom).
• Right panel shows expression of Treg surface markers (CD25, GITR, and CTLA4) in each gated CD4 SP thymocyte population (GFP-, GFP+, mStrawberry-, or m Strawberry +).
• FIG. 5 shows that a lineage specific FoxP3 cDNA vector generates functional Tregs capable of rescuing the scurfy mouse (a FoxP3 -deficient mouse model).
• Panel B Splenic CD4 cells from rescued scurfy neonates at 2 Id. :Left plot shows a scurfy mouse that received Sf-Tregs (uncorrected) while right plot shows a scurfy mouse that received cSf-Tregs (corrected). Y-axis shows human FoxP3 expression (encoded by the FoxP3 LV) while x-axis shows murine FoxP3 expression (absent from both scurfy mice). Panel C) Spleen to body weight ratio for rescued scurfy mice or WT littermate controls.
• Panel D Phenotype of splenic CD4 T cells in rescued scurfy neonates at 2 Id. Red box highlights CD44+CD62L- (activated) CD4 T cells while blue box highlights CD44-CD62L+ (naive) CD4 T cells.
• Panel E Photographs of rescued scurfy neonates at 2 Id. White arrows highlight correction of ear malformation
• Figure 6 illustrates the structure of the pCCL-CNSp-FOXP3-3UTR-A2 vector (SEQ ID NO: 1 (sequence from junction marker)).
• Sequences of human genomic origin CNS1 (237 bp) Minimal sequence based (but not identical to sequence described by Tone et al. (2008) Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nature Immunology, 9: 194-202); CNS2 (359 bp) published by Kim and Leonard (2007) CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. JEM, 204: 1543-1551; CNS3 (217 bp) published by Zheng et or/.
• NM_014009 FoxP3 cDNA (1292 bp) based on human genomic NCBI reference sequence file NM_01009; 3'UTR (875 bp) based on human genomic NCBI reference sequence file NM_014009.
• Figure 7 illustrates components of a FoxP3 lentiviral vector.
• Figure 8 panels A-F, shows that constitutive FoxP3 expression impairs
• Panel E Viability and GFP expression in CB CD34+ HSPC transduced with control LV (MNDU3-GFP) or constitutive FoxP3 LV (MNDU3-FoxP3-IRES-GFP) at 3 days post transduction.
• Panel F Peripheral blood engraftment of hCD45+ cells (expressed as a percentage of total hCD45+ + mCD45+) in humanized NSG mice at 6-8 weeks post- transplant.
• Figures 9A and 9B illustrate the design of a Lentiviral Vector for lineage specific FoxP3 expression.
• Figure 9A Endogenous human FOXP3 gene shows location of regulatory regions (Promoter, CNS1, CNS2, CNS3, and 3' UTR) included in vector.
• Figure 9B Vector maps show design of CNS123p-mStrawberry and CNS123p-FoxP3- mStrawberry constructs within the pCCL vector backbone.
• CNS123p-mStrawberry drives expression of mStrawberry.
• CNS123p-FoxP3-mStrawberry drives expression of FoxP3 cDNA P2A-linked to mStrawberry.
• FIG. 10 panels A-E.
• the FoxP3 reporter LV shows Treg lineage specific expression.
• CNS123p-mStrawberry CNS123p-mStrawberry. Histograms in the left panel show endogenous FoxP3 status of each cell line. Histograms in the right panel show mStrawberry expression in each cell line transduced with CNS123p-mStrawberry.
• Panel B) mStrawberry expression in human hematopoietic cell lines over a range of vector copy numbers. Y-axis represents the percentage of cells positive for mStrawberry expression (left) or mean intensity of mStrawberry fluorescence (right), while x-axis represents the number of vector copies per cell, (n 12 per cell line).
• Panel C Experimental design to evaluate in vivo lineage-specific expression of CNS123p-mStrawberry.
• CD45.2 FoxP3-GFP transgenic mice (which co- express FoxP3 and GFP) were used as bone marrow donors.
• Lin- HSPC were isolated from CD45.2 FoxP3-GFP mice and transduced with CNS123p-mStrawberry. Transduced lin- HSPC were transplanted into lethally irradiated congenic CD45.1 recipients.
• CD45.2 donor cells within each hematopoietic lineage were analyzed at 20 weeks post-transplant for mStrawberry reporter vector expression.
• FIG. 11 panels A-F. Lineage-specific FoxP3 expression restores Treg development from scurfy (FoxP3 -deficient) HSC.
• Treg populations from each group were identified as CD4+m Strawberry + cells (Uncorrected scurfy Tregs [Sf-Tregs], corrected scurfy Tregs [cSf-Tregs]) or CD4+GFP+ cells (Wild-type Tregs [WT-Tregs]).
• Panel C Thymic Treg reconstitution. FACS plots show donor CD45.2+CD4SP cells in the thymus of transplant recipients.
• Gates delineate thymic Sf-Tregs, cSf-Tregs, and WT-Tregs.
• Bottom panel shows expression of the Treg surface markers CD25, GITR, and CTLA4 within each putative Treg population.
• Sf-Tregs and cSf-Tregs are defined by cells expressing the top 50% of mStrawberry expression. Histograms depict one representative experiment of 3.
• Panel D Splenic Treg and Tconv sort. Splenic Treg populations (mStrawberry+ or GFP+ gates) were FACS sorted for a Treg suppression assay.
• Tconv populations (mStrawberry- or GFP- gates) were sorted for an iTreg induction assay.
• Panel E In vitro Treg suppression assay. Sorted Tregs (shown in Panel D) were co-cultured with responder T cells (Tresp, congenic WT CD4+ cells labeled with a fluorescent proliferation dye) at a 1 : 1 ratio in the presence of bead-bound CD3/CD28 antibodies. After 3 days in culture, Tresp proliferation was determined by dilution of proliferation dye by flow cytometry. Histograms depict Tresp proliferation in one of three representative experiments. Bar graph shows
• FIG. 12 panels A-E.
• the lineage-specific FoxP3 cDNA vector generates functional Tregs capable of rescuing the scurfy mouse.
• Panel B Photographs of rescued scurfy mice at 2 Id. White arrows highlight correction of ear skin inflammation in Scurfy mouse recipients of cSf-Tregs and WT-Tregs, but not Sf-Tregs.
• Panel D Percentage of activated (CD44+CD62L-) CD4 T cells in the spleens of rescued scurfy mice or WT littermate controls.
• Panel E Serum cytokine levels in rescued scurfy mice or WT littermate controls. Data in panels C-E are presented as mean ⁇ SD. Data in panels C, D, and E were analyzed by Kruskal-Wallis test for overall comparison for all groups, and Mann-Whitney U test was performed for pairwise comparisons. *p ⁇ 0.05, **p ⁇ 0.01, NS, not significant.
• FIG. 13 panels A-F.
• the FoxP3 reporter vector shows Treg lineage specific expression in a humanized mouse model.
• Panel A Experimental set up for humanized mouse models. CD34+ HSPC (from normal human cord blood) were transduced with CNS123p-mStrawberry and transplanted into neonatal NSG mice (Panels B, C, E, F) or NSG-SGM3 mice (Panel D). 12-16 weeks post-transplant, engrafted hCD45+ cells were analyzed for mStrawberry expression.
• Panel B MStrawberry reporter expression in each hematopoietic lineage.
• Lineages analyzed include bone marrow CD34+ stem and progenitor cells, CD19+ B cells, CD33+ myeloid cells, and CD3+ T cells, thymic CD4- CD8- double negative (DN), CD4+CD8+ double positive (DP), CD4-CD8+ single positive (CD 8 SP), CD4+CD8-CD25- (CD4 Tconv cells), and CD4+CD8-CD25+ (Treg) and splenic CD 8 T cells, CD4+CD25- Tconv cells, and CD4+CD25+ Treg cells.
• Panel C Percentage of mStrawberry+ cells in each lineage shown in panel B.
• Panel D Co-expression of FoxP3 and mStrawberry in humanized mice.
• Human CD4+ cells were enriched from 2 pooled spleens of engrafted NSG-SGM3 mice.
• CD4+ cells were FACS sorted into mStrawberry+ and mStrawberry- populations followed by intracellular staining for FoxP3 expression. FACS sorting was performed prior FoxP3 analysis due to quenching of mStrawberry fluorescence during the FoxP3 intracellular staining protocol.
• Left panel shows sorting of human CD4+ cells by mStrawberry expression, while right panel shows FoxP3 expression in sorted populations.
• Results are representative of 2 independent experiments.
• Panel F CNS2 methylation analysis of T cell populations from humanized mice.
• Drawing depicts the location of CNS2 within the endogenous FOXP3 gene and CNS2 within the viral genome.
• Red arrows indicate differential primer binding sites for amplification of endogenous or viral CNS2 regions.
• Enlarged area of CNS2 depicts 9 CpG sites analyzed for methylation status by bisulfite sequencing.
• FACS plot shows sorting gates used to define Treg (CD4+CD25+) and Tconv (CD4+CD25-) populations in CD4 enriched cells isolated from the pooled spleens of 3-5 humanized mice.
• Heat map represents the percentage of methylated reads detected at each of the 9 CpG sites within endogenous and viral CNS2.
• Results are representative of 2 independent experiments using pooled NSG cohorts humanized from 2 different CB CD34+ donors (Figure 18).
• Data in panel E represent mean ⁇ SD. Data in panel E were analyzed by Mann-Whitney U test, NS, not significant.
• Figure 14 (Corresponding to Figure 10): Flow cytometric definition of murine hematopoietic lineages Gating is shown for each defined population in the spleen (Grl+, B220+, CD8+, CD4+FoxP3-, CD4+FoxP3+), Bone marrow (cKit+), and Thymus (DN, DP, CD 8 SP, CD4+FoxP3-, CD4+FoxP3+).
• Figure 15 panels A and B. HSC transplant of scurfy neonates. Panel A)
• Results represent pooled data from 9 transplanted litters (containing Scurfy and WT littermates) with 6-16 total mice per treatment group. Non surviving mice are mice that spontaneously died or were euthanized due to a moribund state as determined by a veterinarian blinded to the treatment groups.
• Percentages represent CD45.2+ donor cells as a percentage of total CD45+ (CD45.2 and CD45.1/CD45.2) cells. Symbols marked in red represent engraftment in mice surviving to the end of the study (114 days).
• Panel C Comparison of activated splenic CD4 cells in failed scurfy rescues (cSf-CD4 VCN ⁇ 2) and successful scurfy rescues (cSf-CD4 >3).
• Panel D Characteristics of cSf-CD4 products (with VCN ⁇ 2) which failed to suppress CD4 activation (CD44+CD62L-) in spleens of recipient mice.
• FIG. 17 Panel A and B. Corresponding to figure 13): Flow cytometric characterization of human hematopoietic lineages in humanized NSG mice. Panel A) Gating is shown for each defined population in the spleen (CD8+, CD4+CD25-,
• FIG. 18 Panel A-C. (Corresponding to figure 13): Methylation Analysis of endogenous and Viral CNS2.
• Top row shows the absolute number of methylated reads for endogenous CNS2.
• Middle row shows normalized reads for endogenous CNS2 which accounts for a baseline 50% methylation of 2X chromosomes.
• Bottom row shows percentage of methylated reads in viral CNS2.
• Panel B Assay controls for FoxP3 CNS2 methylation analysis. Plasmid DNA encoding the FoxP3 cDNA LV genome was treated with CpG methyltransferase as a positive control while untreated cDNA LV plasmid was used as a negative control. Samples were analyzed for CpG methylation using
• lentiviral vectors expressing FoxP3 using the endogenous gene elements to regulate physiologic gene expression of FoxP3 are provided herein as well as uses of such vectors.
• lentiviral vectors using the endogenous transcriptional control elements from the human FoxP3 gene per se to express codon-optimized FoxP3 gene or cDNA to treat genetic deficiencies of FoxP3 (e.g., IPEX disease) or to treat other auto-immune and auto-inflammatory conditions (e.g. inflammatory bowel disease, Type 1 diabetes mellitus, SLE, JRA, multiple sclerosis, etc.) are provided.
• These vectors can be used to introduce these sequences into autologous hematopoietic stem cells to recapitulate normal physiologic expression patterns of the FoxP3 gene product in the appropriate mature lymphocytes.
• FOXP3 (forkhead box P3), also known as scurfin, is a protein involved in immune system responses (Brunkow et a/.(2001) Nat. Genet. 27(1): 68-73).
• a member of the FOX protein family, FOXP3 appears to function as a master regulator of the regulatory pathway in the development and function of regulatory T cells (see, e.g., Hon et al. (2003) Science, 299(5609): 1057-1061; Fontenot et or/. (2003) Nat. Immunol, 4(4): 330-336;
• Regulatory T cells generally turn the immune response down.
• a deficiency of regulatory T cell activity can allow other autoimmune cells to attack the body's own tissues (see, e.g., Josefowicz et al.(20 ⁇ 2) Ann. Rev. Immunol. 30: 531-564; Zhang et al. (2007) J. Cell. Physiol. 211(3): 590-597).
• Tregs Regulatory T cells
• Treg adoptive transfer therapy is expected to provide a clinical cure for various immunological disorders (see, e.g.,
• Tregs are mainly generated via two different routes. The first is through direct development from Treg progenitor cells in the thymus by thymic antigen presentation with high affinity. These Tregs are called naturally occurring Tregs (nTregs) or thymic Tregs (tTregs). The second is through differentiation from naive CD4 T cells in the periphery by antigen presentation with transforming growth factor (TGF)-p.
• TGF transforming growth factor
• Tregs are called induced Tregs in vitro (iTregs) or peripherally induced Tregs (pTregs) (see, e.g., Chen et al. (2003) J. Exp. Med. 198(12): 1875-1886; Josefowicz and Rudensky (2009) Immunity, 30(5): 616-625). Both Tregs have similar suppression activity and markedly express Forkhead box P3 (Foxp3), a master transcriptional factor for Tregs. Foxp3 expression is required for the differentiation and maintenance of Treg function by expressing Treg signature genes and suppressing effector T cell (Teff) genes (see, e.g., Bennett et al. (2001) Nat. Genet.
• Tregs induced Tregs in vitro
• pTregs peripherally induced Tregs
• Foxp3 expression is required for the differentiation and maintenance of Treg function by expressing Treg signature genes and suppressing effector T cell (Teff) genes (
• T reg function The most conspicuous deficiency of T reg function is observed in the human autoimmune disease IPEX (Immune dysregulation, Polyendocrinopathy, Enteropathy, X- linked) and the corresponding disease in scurfy mice (see, e.g., Levy-Lahad and Wildin (2001) J. Pediatr. 138: 577-580; Godfrey et al. (1991) Am. J. Pathol. 138: 1379-1387).
• Affected males suffer from fatal, multi-organ, lymphoproliferative disease mediated by CD4 + T cells ⁇ see, e.g., Clark et al. (1999) J. Immunol.
• FoxP3 described herein can be effectively used to restore regulatory T cell (Treg) function in a mammal with deficient FoxP3 expression.
• the lentiviral vectors expressing FoxP3 described herein can be effectively used to treating an autoimmune disorder in a subject.
• the autoimmune disorders are autoimmune disorders characterized by diminished FoxP3 expression and/or FoxP3 mutations.
• Illustrative autoimmune disorders include, but are not limited to myasthenia gravis, multiple sclerosis, IPEX (Immune dysregulation, Polyendocrinopathy, Enteropathy, X-linked), autoimmune arthritis, and the like.
• the methods involve use of the lentiviral vectors described herein comprising a FoxP3 gene or cDNA under the control of an endogenous FoxP3 promoter (and in certain embodiments, FoxP3 enhancers, (e.g. CNSl, and/or CNS2, and/or CNS3), to introduce these sequences into autologous hematopoietic stem cells.
• FoxP3 enhancers e.g. CNSl, and/or CNS2, and/or CNS3
• the transduced cells are re-introduced into the subject where they recapitulate normal physiologic expression patterns of the FoxP3 gene product in the appropriate mature lymphocytes and thereby ameliorate and/or cure the disease.
• lentiviral vector (LV) vectors comprising an expression cassette comprising a nucleic acid construct comprising a nucleotide sequence encoding a human FoxP3 protein operably linked to an endogenous FoxP3 promoter.
• the vectors comprise an expression cassette comprising a nucleic acid construct comprising a nucleotide sequence encoding a human FoxP3 protein operably linked to an endogenous FoxP3 promoter.
• the nucleotide sequence encoding a human FoxP3 protein comprises a FoxP3 cDNA.
• the nucleotide sequence encoding a human FoxP3 protein is operably linked to one or more FoxP3 enhancer elements (e.g., FoxP3-CNSl, and/or FoxP3-CNS2, and/or FoxP3-CNS3).
• FoxP3 enhancer elements e.g., FoxP3-CNSl, and/or FoxP3-CNS2, and/or FoxP3-CNS3
• Figures 6 and 7 the vector comprises the sequence shown in Table 1 (SEQ ID NO: l).
• packaging cells comprising the vectors described herein, and viral particles produced using the vectors described herein.
• the LVs comprising a nucleic acid encoding a human FoxP3 protein under the control of an endogenous promoter, described herein comprise a TAT-independent, self-inactivating (SIN) configuration.
• SIN TAT-independent, self-inactivating
• Such constructs can be provided that are effectively "self-inactivating" (SIN) which provides a biosafety feature.
• SIN vectors are ones in which the production of full-length vector RNA in transduced cells is greatly reduced or abolished altogether. This feature minimizes the risk that replication- competent recombinants (RCRs) will emerge. Furthermore, it reduces the risk that that cellular coding sequences located adjacent to the vector integration site will be aberrantly expressed.
• SIN LVs can often permit full activity of the internal promoter.
• the SIN design increases the biosafety of the LVs. The majority of the HIV
• the LTR is comprised of the U3 sequences.
• the U3 region contains the enhancer and promoter elements that modulate basal and induced expression of the HIV genome in infected cells and in response to cell activation.
• Several of these promoter elements are essential for viral replication.
• Some of the enhancer elements are highly conserved among viral isolates and have been implicated as critical virulence factors in viral pathogenesis. The enhancer elements may act to influence replication rates in the different cellular target of the virus
• the retrovirus is self-inactivating (SIN) and those vectors are known as SIN transfer vectors.
• self-inactivation is achieved through the introduction of a deletion in the U3 region of the 3' LTR of the vector DNA, i.e., the DNA used to produce the vector RNA. During RT, this deletion is transferred to the 5' LTR of the proviral DNA.
• a deletion in the U3 region of the 3' LTR of the vector DNA i.e., the DNA used to produce the vector RNA.
• this deletion is transferred to the 5' LTR of the proviral DNA.
• the 5' end of the U3 region serves another essential function in vector transfer, being required for integration (terminal dinucleotide+att sequence).
• the terminal dinucleotide and the att sequence may represent the 5' boundary of the U3 sequences which can be deleted.
• some loosely defined regions may influence the activity of the downstream polyadenylation site in the R region. Excessive deletion of U3 sequence from the 3 'LTR may decrease polyadenylation of vector transcripts with adverse consequences both on the titer of the vector in producer cells and the transgene expression in target cells.
• the lentiviral sequences removed from the LTRs are replaced with comparable sequences from a non-lentiviral retrovirus, thereby forming hybrid LTRs.
• the lentiviral R region within the LTR can be replaced in whole or in part by the R region from a non-lentiviral retrovirus.
• the lentiviral TAR sequence a sequence which interacts with TAT protein to enhance viral replication, is removed, preferably in whole, from the R region. The TAR sequence is then replaced with a comparable portion of the R region from a non- lentiviral retrovirus, thereby forming a hybrid R region.
• the SIN configuration provides a retroviral LTR comprising a hybrid lentiviral R region that lacks all or a portion of its TAR sequence, thereby eliminating any possible activation by TAT, wherein the TAR sequence or portion thereof is replaced by a comparable portion of the R region from a non-lentiviral retrovirus, thereby forming a hybrid R region.
• the retroviral LTR comprises a hybrid R region, wherein the hybrid R region comprises a portion of the HIV R region (e.g., a portion comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 10 in US 2003/0039636) lacking the TAR sequence, and a portion of the MoMSV R region (e.g., a portion comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 9 in 2003/0039636) comparable to the TAR sequence lacking from the HIV R region.
• the entire hybrid R region comprises or consists of the nucleotide sequence shown in SEQ ID NO: 1 1 in 2003/0039636.
• Suitable lentiviruses from which the R region can be derived include, for example, HIV (HIV-1 and HIV-2), EIV, SIV and FIV.
• Suitable retroviruses from which non-lentiviral sequences can be derived include, for example, MoMSV, MoMLV, Friend, MSCV, RSV and Spumaviruses.
• the lentivirus is HIV and the non-lentiviral retrovirus is MoMSV.
• the LTR comprising a hybrid R region is a left (5') LTR and further comprises a promoter sequence upstream from the hybrid R region.
• Preferred promoters are non-lentiviral in origin and include, for example, the U3 region from a non-lentiviral retrovirus (e.g., the MoMSV U3 region).
• the U3 region comprises the nucleotide sequence shown in SEQ ID NO: 12 in US 2003/0039636.
• the left (5*) LTR further comprises a lentiviral U5 region downstream from the hybrid R region.
• the U5 region is the HIV U5 region including the HIV att site necessary for genomic integration.
• the U5 region comprises the nucleotide sequence shown in SEQ ID NO: 13 in US 2003/0039636.
• the entire left (5') hybrid LTR comprises the nucleotide sequence shown in SEQ ID NO: 1 in US 2003/0039636.
• the LTR comprising a hybrid R region is a right (3') LTR and further comprises a modified (e.g., truncated) lentiviral U3 region upstream from the hybrid R region.
• the modified lentiviral U3 region can include the att sequence, but lack any sequences having promoter activity, thereby causing the vector to be SIN in that viral transcription cannot go beyond the first round of replication following chromosomal integration.
• the modified lentiviral U3 region upstream from the hybrid R region consists of the 3' end of a lentiviral (e.g., HIV) U3 region up to and including the lentiviral U3 att site.
• the U3 region comprises the nucleotide sequence shown in SEQ ID NO: 15 in US 2003/0039636.
• the right (3') LTR further comprises a polyadenylation sequence downstream from the hybrid R region.
• the polyadenylation sequence comprises the nucleotide sequence shown in SEQ ID NO: 16 in US
• the entire right (5') LTR comprises the nucleotide sequence shown in SEQ ID NO: 2 or 17 of US 2003/0039636.
• the cassette expressing a FoxP3 cDNA operably linked to an endogenous FoxP3 promoter, and optionally FoxP3 regulatory control elements is placed in the pCCL LV backbone, which is a SIN vector with the CMV enhancer/promoter substituted in the 5' LTR.
• the CMV promoter typically provides a high level of non-tissue specific expression.
• Other promoters with similar constitutive activity include, but are not limited to the RSV promoter, and the SV40 promoter.
• Mammalian promoters such as the beta-actin promoter, ubiquitin C promoter, elongation factor lapromoter, tubulin promoter, etc., may also be used.
• the foregoing SIN configurations are illustrative and non-limiting.
• the LTR transcription is reduced by about 95% to about 99%.
• LTR may be rendered at least about 90%, at least about 91%, at least about 92%), at least about 93%, at least about 94%, at least about 95% at least about 96%, at least about 97%, at least about 98%, or at least about 99% transcriptionally inactive.
• the vectors described herein comprise a packaging signal.
• a "packaging signal,” “packaging sequence,” or “psi sequence” is any nucleic acid sequence sufficient to direct packaging of a nucleic acid whose sequence comprises the packaging signal into a retroviral particle.
• the term includes naturally occurring packaging sequences and also engineered variants thereof.
• Packaging signals of a number of different retroviruses, including lentiviruses, are known in the art.
• the LVs described herein comprise a Rev response element (RRE) to enhance nuclear export of unspliced RNA.
• RREs are well known to those of skill in the art.
• Illustrative RREs include, but are not limited to RREs such as that located at positions 7622-8459 in the HIV NL4-3 genome (Genbank accession number AF003887) as well as RREs from other strains of HIV or other retroviruses. Such sequences are readily available from Genbank or from the database with URL hiv-web.lanl.gov/content/index.
• the vectors described herein include a central polypurine tract. Insertion of a fragment containing the central polypurine tract (cPPT) in lentiviral (e.g., HIV-1) vector constructs is known to enhance transduction efficiency drastically, reportedly by facilitating the nuclear import of viral cDNA through a central DNA flap.
• cPPT central polypurine tract
• the LVs described herein may comprise any of a variety of posttranscriptional regulatory elements (PREs) whose presence within a transcript increases expression of the heterologous nucleic acid (e.g., a human FoxP3 cDNA) at the protein level.
• PREs may be particularly useful in certain embodiments, especially those that involve lentiviral constructs with modest promoters.
• PRE One type of PRE is an intron positioned within the expression cassette, which can stimulate gene expression.
• introns can be spliced out during the life cycle events of a lentivirus.
• introns are typically placed in an opposite orientation to the vector genomic transcript.
• Posttranscriptional regulatory elements that do not rely on splicing events offer the advantage of not being removed during the viral life cycle.
• Some examples are the posttranscriptional processing element of herpes simplex virus, the posttranscriptional regulatory element of the hepatitis B virus (HPRE) and the woodchuck hepatitis virus (WPRE). Of these the WPRE is typically preferred as it contains an additional cis-acting element not found in the HPRE.
• This regulatory element is typically positioned within the vector so as to be included in the RNA transcript of the transgene, but outside of stop codon of the transgene translational unit.
• the WPRE is characterized and described in U.S. Pat. No: 6,136,597.
• the WPRE is an RNA export element that mediates efficient transport of RNA from the nucleus to the cytoplasm. It enhances the expression of transgenes by insertion of a czs-acting nucleic acid sequence, such that the element and the transgene are contained within a single transcript. Presence of the WPRE in the sense orientation was shown to increase transgene expression by up to 7 to 10 fold.
• Retroviral vectors transfer sequences in the form of cDNAs instead of complete intron-containing genes as introns are generally spliced out during the sequence of events leading to the formation of the retroviral particle.
• Introns mediate the interaction of primary transcripts with the splicing machinery. Because the processing of RNAs by the splicing machinery facilitates their cytoplasmic export, due to a coupling between the splicing and transport machineries, cDNAs are often inefficiently expressed. Thus, the inclusion of the WPRE in a vector results in enhanced expression of transgenes.
• insulators can be inserted into the LV described herein.
• Insulators are DNA sequence elements present throughout the genome. They bind proteins that modify chromatin and alter regional gene expression.
• the placement of insulators in the vectors described herein offer various potential benefits including, inter alia: 1) Shielding of the vector from positional effect variegation of expression by flanking chromosomes (i.e., barrier activity); and 2) Shielding flanking chromosomes from insertional tram'-activation of gene expression by the vector (enhancer blocking).
• insulators can help to preserve the independent function of genes or transcription units embedded in a genome or genetic context in which their expression may otherwise be influenced by regulatory signals within the genome or genetic context (see, e.g., Burgess-Beusse et al. (2002) Proc. Natl. Acad. Sci. USA, 99: 16433; and Zhan et al. (2001) Hum. Genet., 109: 471).
• insulators may contribute to protecting lentivirus-expressed sequences from integration site effects, which may be mediated by czs-acting elements present in genomic DNA and lead to deregulated expression of transferred sequences.
• LVs are provided in which an insulator sequence is inserted into one or both LTRs or elsewhere in the region of the vector that integrates into the cellular genome.
• the first and best characterized vertebrate chromatin insulator is located within the chicken ⁇ -globin locus control region.
• This element which contains a DNase-I hypersensitive site-4 (cHS4), appears to constitute the 5' boundary of the chicken ⁇ -globin locus (Prioleau et al. (1999) EMBO J. 18: 4035-4048).
• cHS4 DNase-I hypersensitive site-4
• a 1.2-kb fragment containing the cHS4 element displays classic insulator activities, including the ability to block the interaction of globin gene promoters and enhancers in cell lines (Chung et al. (1993) Cell, 74: 505-514), and the ability to protect expression cassettes in Drosophila ⁇ Id.), transformed cell lines (Pikaart et al.
• FB FII/BEAD-A
• BEAD-I human T-cell receptor alpha/delta blocking element alpha/delta I
• Suitable insulators may be used including, for example, the full length chicken beta-globin HS4 or insulator sub-fragments thereof, the ankyrin gene insulator, and other synthetic insulator elements.
• the recombinant LV and resulting virus described herein are capable of transferring a nucleic acid (e.g., a nucleic acid encoding a human FoxP3 protein) sequence into a mammalian cell.
• vectors of the present invention are preferably used in conjunction with a suitable packaging cell line or co-transfected into cells in vitro along with other vector plasmids containing the necessary retroviral genes ⁇ e.g., gag and pol) to form replication incompetent virions capable of packaging the vectors of the present invention and infecting cells.
• the recombinant LVs and resulting virus described herein are capable of transferring a nucleic acid sequence ⁇ e.g., a nucleic acid encoding a human FoxP3 protein) into a mammalian cell.
• vectors of the present invention are typically used in conjunction with a suitable packaging cell line or co-transfected into cells in vitro along with other vector plasmids containing the necessary retroviral genes ⁇ e.g., gag and pol) to form replication incompetent virions capable of packaging the vectors of the present invention and infecting cells.
• the vectors are introduced via transfection into the packaging cell line.
• the packaging cell line produces viral particles that contain the vector genome.
• the packaging constructs can be introduced into human cell lines by calcium phosphate transfection, lipofection or electroporation, generally together with a dominant selectable marker, such as neomycin, DFIFR, Glutamine synthetase, followed by selection in the presence of the appropriate drug and isolation of clones.
• a dominant selectable marker such as neomycin, DFIFR, Glutamine synthetase
• the selectable marker gene can be linked physically to the packaging genes in the construct.
• Stable cell lines wherein the packaging functions are configured to be expressed by a suitable packaging cell are known ⁇ see, e.g., U.S. Patent No. 5,686,279, which describes packaging cells).
• a suitable packaging cell for the production of virus particles, one may employ any cell that is compatible with the expression of lentiviral Gag and Pol genes, or any cell that can be engineered to support such expression.
• producer cells such as 293T cells and HT1080 cells may be used.
• the packaging cells with a lentiviral vector incorporated in them form producer cells.
• Producer cells are thus cells or cell-lines that can produce or release packaged infectious viral particles carrying the therapeutic gene of interest (e.g., human FoxP3 gene or cDNA). These cells can further be anchorage dependent which means that these cells will grow, survive, or maintain function optimally when attached to a surface such as glass or plastic.
• Some examples of anchorage dependent cell lines used as lentiviral vector packaging cell lines when the vector is replication competent are HeLa or 293 cells and PERC.6 cells.
• methods are provided of delivering a gene to a cell which is then integrated into the genome of the cell, comprising contacting the cell with a virion containing a lentiviral vector described herein.
• the cell e.g., in the form of tissue or an organ
• a subject e.g., a mammal, animal or human
• the gene e.g., FoxP3 gene or cDNA
• the cell can be autologous to the subject (i.e., from the subject) or it can be non-autologous (i.e., allogeneic or xenogenic) to the subject.
• the cells can be from a wide variety including, for example, bone marrow cells, mesenchymal stem cells (e.g., obtained from adipose tissue), and other primary cells derived from human and animal sources.
• the virion can be directly administered in vivo to a subject or a localized area of a subject (e.g., bone marrow).
• the lentivectors described herein will be particularly useful in the transduction of human hematopoietic progenitor cells or a hematopoietic stem cells, obtained either from the bone marrow, the peripheral blood or the umbilical cord blood, as well as in the transduction of a CD4 + T cell, a peripheral blood B or T lymphocyte cell, and the like.
• particularly preferred targets are CD34 cells.
• particularly preferred targets are CD347CD38 " cells.
• the present invention is directed to a method for transducing a human hematopoietic stem cell comprising contacting a population of human cells that include hematopoietic stem cells with one of the foregoing lentivectors under conditions to effect the transduction of a human hematopoietic progenitor cell in said population by the vector.
• the stem cells may be transduced in vivo or in vitro, depending on the ultimate application. Even in the context of human gene therapy, such as gene therapy of human stem cells, one may transduce the stem cell in vivo or, alternatively, transduce in vitro followed by infusion of the transduced stem cell into a human subject.
• the human stem cell can be removed from a human, e.g., a human patient, using methods well known to those of skill in the art and transduced as noted above.
• the transduced stem cells are then reintroduced into the same or a different human.
• the lentivectors described herein are particularly useful for the transduction of human hematopoietic progenitor cells or hematopoietic stem cells (HSCs), obtained either from the bone marrow, the peripheral blood or umbilical cord blood, as well as in the transduction of a CD4 + T cell, a peripheral blood B or T lymphocyte cell, and the like.
• HSCs hematopoietic progenitor cells
• particularly preferred targets are CD34 cells.
• the preferred targets are CD347CD38 " cells.
• the virus particles are incubated with the cells using a dose generally in the order of between 1 to 50 multiplicities of infection (MOI) which also corresponds to 1 x 10 5 to 50 x 10 5 transducing units of the viral vector per 10 5 cells.
• MOI multiplicities of infection
• This can include amounts of vector corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, and 50 MOI.
• the amount of vector may be expressed in terms of HT-29 transducing units (TU).
• cell-based therapies involve providing stem cells and/or hematopoietic precursors, transduce the cells with the lentivirus encoding a nucleic acid that expresses FoxP3 protein and then introduce the transduced cells into a subject in need thereof ⁇ e.g., a subject with a FoxP3 deficiency and/or mutation, e.g., a subject with an autoimmune disorder).
• the methods involve isolating population of cells, e.g., stem cells from a subject, optionally expand the cells in tissue culture, and administer the lentiviral vector whose presence within a cell results in production of FoxP3 in vitro.
• the cells are then returned to the subject, where, for example, they may provide a population of white blood cells that produce FoxP3 and thereby correct a FoxP3 deficiency and/or mutation.
• endogenous enhancers e.g., FoxP3 conserved non- coding sequence 1 (FoxP3-CNSl), and/or FoxP3 conserved non-coding sequence 2 (FoxP3- CNS2), and/or FoxP3 conserved non-coding sequence 3 (FoxP3-CNS3)
• FoxP3 expression recapitulates normal physiologic expression of FoxP3.
• a population of cells which may be cells from a cell line or from an individual other than the subject, can be used.
• Methods of isolating stem cells, immune system cells, etc., from a subject and returning them to the subject are well known in the art. Such methods are used, e.g., for bone marrow transplant, peripheral blood stem cell transplant, etc., in patients undergoing chemotherapy.
• stem cells are to be used, it will be recognized that such cells can be derived from a number of sources including bone marrow (BM), cord blood (CB), mobilized peripheral blood stem cells (mPBSC), and the like.
• BM bone marrow
• CB cord blood
• mPBSC mobilized peripheral blood stem cells
• IPCs induced pluripotent stem cells
• HSCs hematopoietic stem cells
• lentiviral vector described herein see, e.g., Figures
• SEQ ID NO: 1 is used in stem cell gene therapy for conditions characterized by deficient or defective FoxP3 expression, by introducing the nucleic acid encoding FoxP3 protein into the bone marrow stem cells of patients with, for example an autoimmune disease as described herein, followed by autologous transplantation.
• lentiviral compositions may be formulated for delivery by any available route including, but not limited to parenteral (e.g., intravenous), intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, rectal, and vaginal. Commonly used routes of delivery include inhalation, parenteral, and transmucosal.
• compositions can include an LV in combination with a pharmaceutically acceptable carrier.
• pharmaceutically acceptable carrier includes solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
• active agents i.e., a lentiviral vector, a viral particle, etc., described herein and/or other agents to be administered together the vector
• carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
• Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such compositions will be apparent to those skilled in the art. Suitable materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomes can also be used as pharmaceutically acceptable carriers.
• compositions are targeted to particular cell types or to cells that are infected by a virus.
• compositions can be targeted using monoclonal antibodies to cell surface markers, e.g., endogenous markers or viral antigens expressed on the surface of infected cells.
• Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit comprising a predetermined quantity of a LV calculated to produce the desired therapeutic effect in association with a pharmaceutical carrier.
• a unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time.
• Unit dose of the LV described herein may conveniently be described in terms of transducing units (T.U.) of lenti vector, as defined by titering the vector on a cell line such as HeLa or 293.
• unit doses can range from 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 T.U. and higher.
• compositions can be administered at various intervals and over different periods of time as required, e.g., one time per week for between about 1 to about 10 weeks; between about 2 to about 8 weeks; between about 3 to about 7 weeks; about 4 weeks; about 5 weeks; about 6 weeks, etc. It may be necessary to administer the therapeutic composition on an indefinite basis.
• the skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
• Treatment of a subject with a LV can include a single treatment or, in many cases, can include a series of treatments.
• Exemplary doses for administration of gene therapy vectors and methods for determining suitable doses are known in the art. It is furthermore understood that appropriate doses of a LV may depend upon the particular recipient and the mode of administration. The appropriate dose level for any particular subject may depend upon a variety of factors including the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate: of excretion, other administered therapeutic agents, and the like.
• lentiviral gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration, or by stereotactic injection (see, e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA, 91 : 3054).
• vectors may be delivered orally or inhalationally and may be encapsulated or otherwise manipulated to protect them from degradation, enhance uptake into tissues or cells, etc.
• Pharmaceutical preparations can include a LV in an acceptable diluent, or can comprise a slow release matrix in which a LV is imbedded.
• a pharmaceutical preparation can include one or more cells which produce vectors.
• Pharmaceutical compositions comprising a LV described herein can be included in a container, pack, or dispenser, optionally together with instructions for administration.
• compositions, methods and uses are intended to be illustrative and not limiting. Using the teachings provided herein other variations on the compositions, methods and uses will be readily available to one of skill in the art.
• Figures 6 and 7 illustrate the structure of a lentiviral vector that encodes FoxP3 under control of the endogenous FoxP3 promoter and enhancers (CNSl, CNS2, and CNS3).
• Figure 6 illustrates the structure of the pCCL-CNSp-FOXP3-3UTR-A2 vector (SEQ ID NO: l (sequence from junction marker) also shown in Table 1, below).
• Sequences of human genomic origin include: CNSl (237 bp) which is a minimal sequence based on, but not identical to, a sequence described by Tone et al. (2008) Nat. Immunol. 9: 194-202, CNS2 (359 bp) which is described by Kim and Leonard (2007) J. Exp.
• a FoxP3 reporter vector shows based on the construct described above shows TReg lineage specific expression in human cell lines.
• panel A shows a flow cytometry measurement of endogenous FoxP3 protein expression in 3 different cell lines: MT-2 (T-reg like), Jurkat (T-cell), and K562 (Erythroid).
• Panel B shows expression of mStrawberry reporter protein in MT-2, Jurkat, or K562 cells transduced with a FoxP3-mStrawberry reporter vector.
• the Y-axis represents the percentage of cells positive for mStrawberry expression, while the x-axis represents the number of vector copies per cell.
• FIG. 2 shows that the FoxP3 reporter vector shows TReg lineage specific expression in a murine congenic transplant model.
• CD45.2 FoxP3-GFP transgenic mice (which co-express FoxP3 and GFP) were used as bone marrow donors.
• Lin- cells were isolated from CD45.2 FoxP3-GFP mice and transduced with a FoxP3 -mStrawberry reporter vector.
• Transduced lin- cells were transplanted into lethally irradiated congenic CD45.1 recipients.
• CD45.2 donor cells were analyzed at 10 weeks post-transplant for mStrawberry reporter vector expression in the Treg lineage (marked by FoxP3-GFP).
• mStrawberry reporter expression was measured in FoxP3- (GFP-) and FoxP3+ (GFP+) donor cells in the bone marrow, spleen, and thymus of engrafted mice.
• the Y axis represents the percentage of mStrawberry+ cells in each population.
• Figure 3 shows that the FoxP3 reporter vector shows Treg lineage specific expression in a humanized mouse model.
• CD34+ cells isolated from human cord blood were transduced with a FoxP3mStrawberry reporter vector and transplanted into neonatal immune-deficient NSG mice. 12 weeks post-transplant, engrafted hCD45+ cells were analyzed for mStrawberry expression.
• panel B lineage specific mStrawberry expression in engrafted hCD45+ cells.
• hCD45+ cells were gated by lineage markers in NSG bone marrow (CD19+ B cells, CD33+ myeloid cells, CD34+ stem and progenitor cells, and CD3+ T cells), thymus (CD4-CD8- double negative [DN], CD4+CD8+ double positive [DP], CD4CD8+ single positive [CD8 SP], CD4+CD8-CD25- [CD4 Tconv cells], and CD4+CD8-CD25+ [Treg], and spleen (CD 8 T cells, CD4+CD25- Tconv cells, and CD4+CD25+ Treg cells).
• the histograms represent mStrawberry expression within each lineage.
• NSGSGM3 mice were sorted based on mStrawberry expression followed by intracellular staining and flow cytometric analysis for FoxP3 expression.
• the left panel shows sorting of human CD4+ cells by mStrawberry expression, while the right panel shows FoxP3 expression within each sorted population.
• Figure 4 shows that introduction of a lineage specific FoxP3 coding vector into FoxP3 -deficient murine HSC restores functional Treg development.
• Panel A shows the experimental set-up. Lin- cells were isolated from a FoxP3 deficient (scurfy) donor mouse and transduced with a FoxP3 coding vector expressing both FoxP3 cDNA and the reporter mStrawberry. Transduced lin- cells were transplanted in lethally irradiated WT CD45.1 congenic recipients. After 12 weeks, mStrawberry+ cells ("corrected Tregs") were evaluated for Treg suppressive capacity (panel B) and Treg surface marker expression (panel C).
• Tregs from scurfy mice were compared to natural GFP+ Tregs from WT FoxP3-GFP mice.
• Tregs were cultured with Tresp cells in a 1 : 1 ratio. After 4 days in culture, Treg suppression was determined by calculating the division index of labeled responder cells in each group. Data represent mean +/- SEM from 1-2 replicate wells.
• Panel C Thymocytes from WT FoxP3-GFP mice (top) or engrafted CD45.2 corrected donor scurfy cells (bottom).
• Right panel shows expression of Treg surface markers (CD25, GITR, and CTLA4) in each gated CD4 SP thymocyte population (GFP-, GFP+,
• FIG. 1 shows that a lineage specific FoxP3 cDNA vector generates functional Tregs capable of rescuing the scurfy mouse (a FoxP3 -deficient mouse model).
• Panel B Splenic CD4 cells from rescued scurfy neonates at 2 Id. :Left plot shows a scurfy mouse that received Sf-Tregs (uncorrected) while right plot shows a scurfy mouse that received cSf-Tregs (corrected). Y-axis shows human FoxP3 expression (encoded by the FoxP3 LV) while x-axis shows murine FoxP3 expression (absent from both scurfy mice). Panel C) Spleen to body weight ratio for rescued scurfy mice or WT littermate controls.
• Panel D Phenotype of splenic CD4 T cells in rescued scurfy neonates at 2 Id. Red box highlights CD44+CD62L- (activated) CD4 T cells while blue box highlights CD44-CD62L+ (naive) CD4 T cells.
• Panel E Photographs of rescued scurfy neonates at 2 Id. White arrows highlight correction of ear malformation.
• Immune dysregulation, Polyendocrinopathy, Enteropathy, X-linked (IPEX) syndrome is a devastating autoimmune disease caused by mutations in FOXP3, a lineage- determining transcription factor required for the development and function of regulatory T cells (Tregs). Tregs are critical for suppressing autoreactive T cell responses, thus their dysfunction in IPEX patients leads to severe autoimmunity. Allogeneic hematopoietic stem cell (HSC) transplant can be curative, but suitable donors are often unavailable.
• HSC hematopoietic stem cell
• LV lentiviral vector
• LV-modified cells were transplanted into mice, circulating CD45.1+ (donor) GFP+ cells were readily detected in peripheral blood at 7 days post-transplant ( Figure 8, panel B), suggesting that cells were capable of early engraftment.
• This construct was cloned into a VSV-G-pseudotyped, 3rd-generation, self-inactivating (SIN) LV (Dull et al. 1998) with the addition of a previously described enhancer blocking insulator element ("A2") in the viral 3' LTR regions potentially to improve safety and decrease positional variegation of expression (Liu et al. 2015).
• Two LV were designed using this construct to drive the expression of the fluorescent reporter mStrawberry only (hereby referred to as "CNS123p- mStrawberry"), or the FOXP3 cDNA and mStrawberry through a 2A element linkage ("CNS123p-FoxP3-mStrawbeny").
• the endogenously regulated LV CNS123p-mStrawberry shows high specificity for the Treg lineage
• thymocyte specific promoter can drastically alter thymopoiesis (Khattri et al. 2001), thus we first assessed if the lineage-specific CNS123p-FoxP3-mStrawberry LV altered thymocyte differentiation.
• lineage distribution within reconstituted donor thymocytes did not differ among recipient mice transplanted with WT, scurfy, or corrected scurfy HSC ( Figure 11, panel B) suggesting that lineage specific restoration of FoxP3 cDNA does not alter thymocyte lineage distribution.
• FoxP3 In addition to thymically-derived Tregs (nTregs), FoxP3 also plays an important role in the generation of peripheral Tregs (pTregs) which develop when Tconv receive a strong TCR signal in a tolerogenic context (Curotto de Lafaille et al. 2004). This process can be simulated in vitro through TCR stimulation of FoxP3- Tconv cells in the presence of TGFp to generate FoxP3+ induced Tregs (iTregs) with suppressive function (Chen et al. 2003).
• pTregs peripheral Tregs
• iTregs FoxP3+ induced Tregs
• cSf Tconv CD4+mStrawberry- cells or WT Tconv (CD4+GFP-) cells were FACS sorted and activated using CD3/CD28 beads in the presence of TGFp.
• cSf Tconv showed robust induction of mStrawberry ( Figure 11, panel F) demonstrating that corrected Sf-Tconv cells are capable of de novo FoxP3 induction.
• Treg function is the ability to reverse clinical disease signs in neonatal scurfy mice through in vivo suppression of autoimmunity.
• TBI 500 Rad total body irradiation
• Sf HSPC uncorrected Sf HSPC
• corrected Sf HSPC Long-term survival was poor in all arms despite detectable (albeit low) engraftment of donor cells, suggesting low efficacy of purified HSPC transplant in the scurfy model ( Figure 15).
• donor CD45.2+CD4+ cells were purified from spleens of transplant recipient to obtain three groups of bulk CD4+ cells containing putative Tregs: uncorrected scurfy CD4+ (Sf-CD4+), corrected scurfy CD4+ (cSf-CD4+), or wild-type CD4+ (WT-CD4+) ( Figure 12, panel A).
• FACS analysis of purified CD45.2+CD4+ cells prior to transfer showed -95% CD4+ purity with no detectable contaminating recipient CD45.1 cells ( Figure 16).
• mice were intraperitoneally injected into scurfy neonates.
• scurfy mice were analyzed for correction of the autoimmune phenotype.
• 21d old untreated (sham PBS injection) scurfy neonates showed typical phenotypic signs of disease progression including scaly skin, small thickened ears ( Figure 12, panel B), and splenomegaly ( Figure 12, panel C).
• Untreated mice also exhibited an inflammatory immune phenotype including a high percentage of activated CD62L-CD44+ CD4 T cells ( Figure 12, panel D) and elevated levels of inflammatory serum cytokines ( Figure 12, panel E) compared to age-matched WT controls.
• the CNS123p-mStrawberry LV shows high levels of lineage specific expression without toxicity in a humanized mouse model
• Human CD45+ cells engrafted in the BM exhibited a lineage distribution typical of this model system (59% CD 19+ B cells, 10% CD33+ myeloid cells, 2.5% CD34+ HSPC, 3.3% CD3+ T cells, Figure 17) indicating the absence of subclinical graft versus host disease and potential artifacts from T cell activation.
• mStrawberry expression was restricted to CD3+ T cells, with no detectable expression in CD33+ myeloid, CD19+ B cells, or CD34+ HSPC lineages.
• mStrawberry expression was selective for CD4+CD25+ Tregs (mean 36% mStrawberry+) with minimal expression in the DN, DP, CD4SP, or CD8SP stages.
• CD25 is a useful surface marker that identifies FoxP3+ Tregs
• CD25 is also expressed on activated T cells and is not specific for FoxP3+ Tregs. Therefore, we more stringently determined the Treg lineage specificity of CNS123p-mStrawberry with intracellular FoxP3 staining.
• NSG-SGM3 mice which generate enhanced numbers of FoxP3+ Tregs compared to traditional NSG models (Billerbeck et al. 2011).
• Human cord blood CD34+ HSPC were transduced with CNS123p-mStrawberry and transplanted into NSG-SGM3 neonates.
• CD34+ "test cells” were transduced with either CNS123p-mStrawberry or CNS 123p-FoxP3-mStrawberry, combined with an equal number of fluorescently labeled (UBC-mCitrine transduced) competitor cells, and transplanted into neonatal NSG mice ( Figure 13, panel E). At 12 weeks post-transplant, the relative contribution of fluorescently labeled competitor cells was evaluated within the CD34+ lineage. Here, we observed no difference in the relative proportions of competitor cells between groups. This suggests that unlike constitutive FoxP3 expression from CNS123p-FoxP3-mStrawberry (which does not express in HSPC) allows for efficient HSC engraftment in a competitive transplant model.
• CD34+ "test cells” were transduced with either CNS123p-mStrawberry or CNS 123p-FoxP3-mStrawberry, combined with an equal number of fluorescently labeled (UBC-mCitrine transduced) competitor cells
• Demethylated CNS2 maintains stable high levels of FoxP3 expression through its enhancer function on the FoxP3 promoter (Zheng et al. 2010; Li et al. 2014a), thus we were interested in evaluating CpG methylation patterns within the viral CNS2 element contained within CNS123p-FoxP3-mStrawberry.
• spleens from NSG mice reconstituted with LV-transduced CD34+ CB cells and sorted pooled splenocytes for Tconv cells (CD4+CD25-) and Tregs (CD4+CD25+) (Figure 13, panel F).
• Genomic DNA from Tconv and Treg subsets was analyzed for methylation of 9 regulated CpG sites present in endogenous and viral CNS2 utilizing pyrosequencing primers specific for each sequence.
• CpG sites within the endogenous FOXP3 CNS2 were methylated in sorted Tconv cells and demethylated in sorted Tregs.
• viral CNS2 remained fully demethylated in both populations, suggesting that viral CNS2 is not regulated in the same manner as endogenous CNS2 during Treg differentiation from HSC.
• FoxP3 is a transcription factor which plays a key role in cell fate decisions, thus we speculated that inappropriate FoxP3 expression throughout the hematopoietic system could be detrimental to normal hematopoietic development and long-term engraftment. Indeed, we observed that constitutive FoxP3 expression driven by the constitutive MNDU3 promoter resulted in impaired long-term engraftment in human and murine HSPC transplant models. This observation is consistent with prior work showing that high levels of FoxP3 expression under strong thymic promoters results in abnormal thymopoiesis and increased apoptosis in developing thymocytes (Khattri et al. 2001; Tai et al. 2013).
• CNS1 is considered to be a TGFP responsive element with a number of Smad binding sites, and is critical for the induction of pTregs.
• CNS2 is responsible for maintaining stable FoxP3 expression in committed Tregs (Li et al. 2014). Recent evidence has suggested that demethylation of CNS2 is an active process initiated by Tet enzymes during thymic Treg development which allows the CNS2 enhancer region to drive high levels of FoxP3 expression in committed Tregs (Toker et al. 2013; Yue et al. 2016).
• LV expression remains highly selective for the Treg lineage suggesting that demethylated CNS2 alone does not drive FoxP3 expression and that CNS1, CNS3, and the FoxP3 promoter may be confer additional specificity.
• hypermethylation of CNS2 is associated with reduced FoxP3 expression (Li et al. 2014) and impaired Treg function in patients with autoimmune disorders (Guo et al. 2016)
• nTregs peripheral FoxP3- Tconv in response to a tolerance-inducing signals
• p Tregs tolerance-inducing signals
• LV which successfully restores Treg development from FoxP3 -deficient HSC. Corrected Tregs closely resemble WT Tregs in phenotype and function, and importantly, are capable of reversing the autoimmune phenotype of the scurfy mouse. Furthermore, humanized mouse models reveal efficient gene modification of LT-HSC and high levels of lineage- specific expression, suggesting favorable translation of this therapy for IPEX patients. More broadly, this work shows the first demonstration of reprogramming the immune system at the HSC level to restore immunologic tolerance. While IPEX is a rare disease, its severity and lack of suitable treatment make it an excellent gateway disease to provide biologic insight into the development of new HSC-based therapies which modulate immunologic tolerance. These findings pave the way for the treatment of IPEX patients by autologous HSCT and may provide valuable insights into new treatments for patients with autoimmune disorders of different origin.
• MNDU3-FoxP3-IRES-GFP was a kind gift from Dr. Gay Crooks.
• the CNS123p-mStrawberry and CNS123p-FoxP3-mStrawberry lentiviral vectors were cloned into an empty CCL backbone (Dull et al. 1998). Fragments were synthesized as gBlocks (R) (Integrated DNA Technologies) with compatible ends to be cloned using NEBuilder(R) HiFi DNA Assembly Kit (New England Biolabs) Lentiviral vectors were packaged with a VSV-G pseudotype, concentrated and titered as described (Cooper et al. 2011).
• MT2 cells were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: MT-2 Cells from Dr. Douglas Richman (Haertle et al. 1988;
• Jurkat and K562 cells were obtained from ATCC. Cells were maintained in RIO (RPMI [Gibco]/10% FBS [Gibco]/lx Penicillin/Streptomycin/Glutamine [PSG, Gemini Bio Products]). Cells were plated at 1E6 cells/mL and transduced with CNS123p-mStrawberry at a range of concentrations (1E5 TU/mL -1E8 TU/mL, MOI 0.1-100) followed by a change to fresh R10 the following day. After 10 days of culture, cells were analyzed by flow cytometry for mStrawberry expression and genomic DNA was isolated for vector copy number analysis.
• CD45.2 B6-scurfy mice
• NSG and NSG-SGM3 mice were purchased from Jackson labs colonies were maintained at UCLA.
• the following breeding strategy was used for scurfy mice.
• Heterozygous female scurfy mice (CD45.2, X/XSf, phenotypically normal) were mated with wild-type B6 (CD45.2) or B6.SJL (CD45.1) males to produce sub-colonies of CD45.2, CD45.1, and CD45.1/CD45.2 scurfy mice.
• Scurfy male neonates (Xsf/Y) were rescued by intraperitoneal injection of 60 x 10 6 WT splenocytes and re-mated to
• Bone marrow cells were obtained by crushing aseptically isolated femurs, tibias, pelvises, spines, and humeri in a mortar and pestle. Lin- cells were obtained using a lineage depletion kit (Miltenyi Biotec) according to manufacturer's instructions. Lin- cells were resuspended in murine transduction media (Stem Span SFEM [Stem Cell
• B6.SJL 10 week old B6.SJL (CD45.1) or B6 (CD45.2) recipients were irradiated with 1200 Rad (Dose rate -100 Rad/min) using a split dose of 600 + 600 Rad with 3-4 hours between doses. Cells were injected via retro-orbital injection 1-4 hours after the last radiation dose. Transplanted cell doses ranged from 5E5-1E6 lin- cells per mouse.
• Genomic DNA was extracted from samples using the PureLink genomic
• the concentration of specific amplified portions was quantified using the QX200 Droplet Reader/Quantasoft VI .7 (Bio-Rad) and normalized using primers to the autosomal human gene SDC4 gene, or uc378 gene for murine samples. Primer/probe sequences are listed in Table 2.
• Murine splenocytes were obtained by aseptic removal and gentle crushing of spleens through a 70 ⁇ mesh filter. RBC lysis was performed using a pre-prepared ammonium chloride based lysing buffer (BD Biosciences). Splenocytes were enriched for CD4+ cells using a CD4 isolation kit (Miltenyi Biotec). Briefly, splenocytes were labeled with a cocktail of biotinylated antibodies labeling CD4- cells, followed by labeling with anti-biotin magnetic beads. CD4- cells were separated on an LS column (Miltenyi Biotec) while CD4+ cells were collected in the flow through. In experiments utilizing adoptive transfer of CD45.2+CD4+ cells to scurfy neonates, an anti-CD45.1 biotinylated antibody was added in the initial incubation step to deplete any remaining recipient CD45.1 cells.
• CD4-enriched splenocytes were labeled with CD4-APC (Clone RM4-5, BD) and ghost 780 viability dye (Tonbo Biosciences) prior to FACS sorting. Viable
• CD4+GFP+ WT Tregs
• CD4+m Strawberry + Scurfy Tregs
• Tresp cells WT B6 CD4+ cells
• 5 ⁇ Cell Trace violet proliferation dye Thermo Fisher
• Experiments ranged from 2.5E4- 5E4 Tresp cells/well of a 96 well U bottom plate.
• Mouse CD3/CD28 T Activator
• Dynabeads (ThermoFisher) were added to cultures at a ratio of 1 bead: 1 Tresp cell. Cells were cultured for 3 days followed by FACS analysis for dilution of proliferation dye.
• Proliferation index was calculated using FlowJo V7.6.5 (TreeStar).
• Cytokines were analyzed by the UCLA Immune Assessment Core using the Luminex platform.
• MNCs were isolated using Ficoll-Paque PLUS (GE Healthcare) density centrifugation within 48 hours of collection followed by CD34 enrichment according to manufacturer's instruction (Miltenyi Biotec). CD34+ cells from single cords were frozen in cryovials in 90% FBS (Gibco)/10% DMSO (Sigma Aldrich) and stored for later use.
• CD34+ cells Upon thawing, CD34+ cells were resuspended in human transduction medium (X-vivo-15 [Lonza], lx PSG [Gemini Bio Products], 50 ng/mL SCF, 50 ng/mL TPO, 50 ng/mL Flt3L [Peprotech]). Cells were cultured in transduction medium for 24 hours, followed by incubation with LV for another 24 hours. After transduction, CD34+ cells were collected, washed in PBS, and incubated with OKT3 (Tonbo Biosciences, ⁇ g/100 ⁇ ) for 30 min on ice to prevent GVHD from contaminating T cells present in the CD34+ graft (Wunderlich et al. 2014). Immediately prior to transplant, 1-3 day old neonatal NSG mice were irradiated at a dose of 125 Rad with a 137Cs source and dose rate of 100
• CD45-APC CD45-FITC
• CD33-BV421 CD19-PE-Cy7, CD34-FITC, CD34-PE-Cy7, CD4-FITC, CD4-PE-Cy7, CD8-APC, CD25- V450, CD25-PerCPCy5.5.
• CD45.1-FITC CD45.1-V450
• CD45.1-APC CD45.2-FITC
• CD45.2-V450 CD4-PECy7
• CD4-APC CD8-PE-Cy7
• Grl-APC B220-PerCp
• CD3-PerCp CD3-PerCp
• cKit-APC CD44- PerCpCy5.5
• CD62L-PE-Cy7 GITR-APC
• CD25-APC CTLA4-APC.
• Genomic DNA was extracted from sorted Treg (CD4+CD25+) and Tconv
• CD4+CD25- subsets using the Purelink Genomic DNA mini kit (Invitrogen).
• CpG dinucleotide methylation analysis of CNS2 of the human FoxP3 gene was performed by EpigenDx and determined by bisulfite treatment of RNase-treated genomic DNA, followed by PCR amplification and pyrosequencing (EpigenDx assay ADS783-FS2).
• EpigenDx assay ADS783-FS2 A custom assay was performed by EpigenDx for methylation analysis of FoxP3 CNS2 from integrated LV DNA using the following primers which uniquely recognize viral CNS2: FoxP3 CNS2 Viral F: TGGAGTTAGATTGTTTGGGA (SEQ ID NO: 11); FoxP3 CNS2 Viral R:
• CD4+CD25- Naive T Cells to CD4+CD25+ Regulatory T Cells by TGF-Beta Induction of Transcription Factor Foxp3 J. Exp. Med. 198(12): 1875-1886.
• junction marker pCCL-CNSp-FOXP3-3UTR-A2. Sequence from junction marker:

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• Biochemistry (AREA)
• Developmental Biology & Embryology (AREA)
• Virology (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Hematology (AREA)
• Cell Biology (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Physics & Mathematics (AREA)
• Rheumatology (AREA)
• Plant Pathology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Gastroenterology & Hepatology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Physical Education & Sports Medicine (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Marine Sciences & Fisheries (AREA)
• Mycology (AREA)

Priority Applications (5)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (1)

Family

ID=65439627

Family Applications (1)

Country Status (5)

Cited By (6)

Families Citing this family (4)

Citations (5)

Family Cites Families (4)

• 2018
  • 2018-08-22 EP EP18848409.1A patent/EP3672617A4/en active Pending
  • 2018-08-22 KR KR1020207008314A patent/KR102780121B1/ko active Active
  • 2018-08-22 US US16/640,306 patent/US12060566B2/en active Active
  • 2018-08-22 JP JP2020511428A patent/JP7290288B2/ja active Active
  • 2018-08-22 WO PCT/US2018/047586 patent/WO2019040655A1/en not_active Ceased
• 2024
  • 2024-06-26 US US18/754,883 patent/US20240336935A1/en active Pending

Patent Citations (6)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events