WO2019030542A1 - Agent immunomodulateur - Google Patents

Agent immunomodulateur Download PDF

Info

Publication number
WO2019030542A1
WO2019030542A1 PCT/GB2018/052298 GB2018052298W WO2019030542A1 WO 2019030542 A1 WO2019030542 A1 WO 2019030542A1 GB 2018052298 W GB2018052298 W GB 2018052298W WO 2019030542 A1 WO2019030542 A1 WO 2019030542A1
Authority
WO
WIPO (PCT)
Prior art keywords
hpari
domain
polypeptide
sequence
amino acid
Prior art date
Application number
PCT/GB2018/052298
Other languages
English (en)
Inventor
Richard Michael MAIZELS
Henry John MCSORLEY
Original Assignee
The University Court Of The University Of Edinburgh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Court Of The University Of Edinburgh filed Critical The University Court Of The University Of Edinburgh
Publication of WO2019030542A1 publication Critical patent/WO2019030542A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
    • C07K14/4354—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from nematodes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/56—Materials from animals other than mammals
    • A61K35/62—Leeches; Worms, e.g. cestodes, tapeworms, nematodes, roundworms, earth worms, ascarids, filarias, hookworms, trichinella or taenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/41—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a Myc-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • This invention relates to a composition of matter capable of inhibiting IL-33 activity.
  • the invention relates to polypeptides that inhibit IL- 33 activity and to therapeutic compositions comprising these polypeptides.
  • IL-33 is an "alarmin" cytokine; it is released under conditions of necrosis and tissue damage. IL-33 is stored in the nucleus of epithelial cells bound to DNA, and is released under conditions of epithelial cell necrosis. During necrosis, the cell is lysed, allowing release of the nuclear contents, and entry of proteases which cleave off the DNA-binding region of IL-33, resulting in the release of active, receptor-binding cytokine. Shortly after release (within around 15 min to 4 h) the active IL-33 cytokine is oxidised, forming new disulphide bonds and changing conformation. This oxidation renders the cytokine inactive, and incapable of binding to its receptor. Thus, the activity of IL-33 is constrained to a very short physical and temporal range.
  • IL-33 activation ie release from the nucleus in reduced form free for subsequent binding to available receptors
  • IL-33 and its receptor are both among the 10 loci most strongly linked to allergic sensitization and asthma in genome-wide association studies.
  • IL-33 levels are increased in the lungs of severe asthmatics, correlating negatively with lung function. Respiratory viral infections are implicated in both initiation and exacerbation of asthma, and recent work indicates that this pro-asthmatic activity is also associated with IL-33 release.
  • the IL-33 receptor is expressed by a wide range of cells, most notably T cells, macrophages, endothelial cells, epithelial cells and type 2 innate lymphoid cells (ILC2). Through these interactions, IL-33 drives type 2 immune responses in a range of diseases including asthma, atopic dermatitis, food allergy, COPD, eosinophilic inflammatory bowel disease, eosinophilic oesophagitis and age-related macular degeneration.
  • T cells most notably T cells, macrophages, endothelial cells, epithelial cells and type 2 innate lymphoid cells (ILC2).
  • ILC2 type 2 innate lymphoid cells
  • IL-33 has for some time been considered a target for many attempting to develop a new range of active therapeutics agents for treating allergic disease. For example, there is currently no treatment for steroid-resistant asthma, but IL-33 has been proposed as a steroid-resistant target for intervention. Despite a clear need for agents that target the IL-33 pathway, to-date no such agents have been provided. A number of companies are currently developing anti-IL-33 monoclonal antibodies for use in allergic asthma. These are not yet available, however it is clear that any anti-IL-33 antibody would only be able to block the effects of IL-33, and not its release. Production of large multimeric antibodies is relatively expensive.
  • helminths release a complex set of soluble secreted products that has a range of immunomodulatory activities that are postulated to be capable of suppressing a variety of anti-parasite immune responses and therefore enable the parasite to persist in the host. For instance, the products of the murine parasite
  • Heligmosomoides polygyrus include more than 2000 proteins, an array of carbohydrates, lipids, vesicles and RNAs. It has been demonstrated that IL-33 responses may be modified by application of such a complex product, but as of yet it had not been possible to identify the agent or agents responsible for this effect.
  • H. polygyrus Alarmin Release Inhibitors The three homologous proteins have been designated HpARI-1 , HpARI-2 and HpARI-3, respectively. Further work by the inventors has demonstrated that the HpARIs bind to IL-33, blocking the interaction of IL-33 with the IL-33 receptor. The HpARIs also have a second binding function, binding to nuclear DNA.
  • HpARIs with the potential to inhibit IL-33 activity in two different ways (1) by tethering IL-33 within the nucleus of necrotic cells (the tethering preventing the release of IL-33 after a pro-allergic or damaging stimulus, where IL-33 would normally be liberated from a necrotic cell, and so preventing interaction between IL-33 and its receptors), and (2) by blocking binding of IL-33 to its receptor.
  • HpARI domain 1 Complement Control Protein-like domains
  • HpARI domain 2 Complement Control Protein-like domains
  • HpARI domain 3 Complement Control Protein-like domains
  • the HpARI genes are made up of 7 exons, encoding a 251 -aa protein including a 16 aa signal peptide motif, with a deduced mature molecular weight of 26 kDa.
  • All CCP-like domains contain features of a CCP module such as the four consensus Cysteine residues (Cysl to CyslV, consistent with formation of disulphide bonds in a Cysl-Cyslll and Cysll-CyslV pattern), the Trp/Leu residue between Cyslll and CyslV, all of which are structurally important residues typical of a CCP module.
  • HpARI domains are atypical in part with divergent sequence features, including an absence of conserved Proline residues after Cysl in HpARI domain 1 , and atypical insertions of -20 amino acid residues between Cysl and Cysll in CCP HpARI domain 2 and HpARI domain 3, which are unique compared to previously identified CCP domains.
  • Each CCP domain is encoded by two exons with the second exon boundary in each case falling between adjacent predicted CCP modules (i.e. between CyslV of one module and Cysl of the next) lending further support to the discerned domain boundaries.
  • more than 40 other polypeptides isolated from H. polygyrus were also identified to have CCP-like domains, only those three homologues mentioned above were found to have IL-33 inhibition ability (the remainder had more conventional CCP-like structures and lacked IL-33 inhibitory activity).
  • the invention further provides pharmaceutical compositions comprising said polypeptides and methods for their use in treating such inflammatory disorders.
  • a polypeptide comprising HpARI domain 2 and:- a. a DNA-binding domain, and/or
  • IL-33 the polypeptide having an inhibitory effect on IL-33 activity.
  • the skilled person is well aware of the physiological activity of IL-33.
  • IL-33 induces such activities by binding to its receptors.
  • the inhibitory effect may be
  • the inhibitory effect may be by virtue of binding of IL-33 to DNA. This binding prevents release of IL-33 from their stores in the nucleus of a cell and so prevents IL-33 from coming into close proximity and so binding with its receptors.
  • the polypeptide includes a HpARI domain 3 the inhibitory effect may be the blocking of binding of IL-33 to its receptor.
  • the DNA-binding domain may be any DNA binding domain known to the skilled person that fulfils the function of binding to DNA, thereby tethering the polypeptide to the DNA.
  • the DNA-binding domain can be a small molecule (for example amidine-substituted phenylbenzimidazoles, Hoescht 33258 or RT29) or a peptide (for example SEQ ID No. 49 KRARNTEAARRSRARK - Smith, 2016, Chem Sci, or SEQ ID No, 50 KWKWKKA - Lee, 2016, Nucleic Acids Research).
  • the DNA-binding domain may be a human DNA- binding domain. Additionally, or alternatively, the DNA-binding molecule can be a HpARI domain 1.
  • polypeptide may further include a HpARI domain 3. Consequently, the
  • polypeptide of the present invention may comprise HpARI domain 2 and HpARI domain 3, optionally also a DNA-binding domain, the polypeptide having an inhibitory effect on IL-33 activity.
  • HpARI domain 2 and HpARI domain 3 optionally also a DNA-binding domain, the polypeptide having an inhibitory effect on IL-33 activity.
  • the polypeptide would comprise a DNA-binding domain (optionally HpARI domain 1), HpARI domain 2 and HpARI domain 3.
  • a DNA-binding domain may be provided in a position within the polypeptide that is closer to the N-terminal than the position in which the HpARI domain 2 is provided.
  • a DNA-binding domain may be provided in a position within the polypeptide that is closer to the C-terminal than the position in which the HpARI domain 2 is provided.
  • the HpARI domain 3 may be provided in a position that is between that of the DNA- binding domain and the HpARI domain 2.
  • the HpARI domain 2 is provided in a position between the DNA-binding domain and the HpARI domain 3.
  • the DNA-binding domain is provided in a position between the HpARI domain 2 and the HpARI domain 3.
  • the above relative positions optionally apply with respect to the closest neighbour domains within the polypeptide. This optional relative position may apply for at least one copy of the domain, or for all copies of the domain within the polypeptide.
  • HpARI domain 3 may be provided in a position within the polypeptide that is closer to the N-terminal than the position in which the HpARI domain 2 is provided.
  • a HpARI domain 3 may be provided in a position within the polypeptide that is closer to the C-terminal than the position in which the HpARI domain 2 is provided.
  • the above relative positions optionally apply with respect to the closest neighbour domains within the polypeptide. This optional relative position may apply for at least one copy of the domain, or for all copies of the domain within the polypeptide.
  • any one or more of the domains of the polypeptide may bond directly with the
  • HpARI domain 1 may form a direct peptide bond with HpARI domain 2.
  • HpARI domain 3 may form a direct peptide bond with HpARI domain 1.
  • the polypeptides of the present invention may consist only of the recited domains in any of the combinations recited in any of the above paragraphs.
  • the polypeptides of the present invention may optionally further include additional amino acid sequences linking any of the domains to the adjacent domain in the polypeptide.
  • a linker sequence may be provided between the DNA-binding domain, HpARI domain 2, and/or HpARI domain 3.
  • the linker amino acid sequences may be from 1 to 100 amino acids in length, from 1 to 70 amino acids in length, from 1 to 30 amino acids in length, from 1 to 20 amino acids in length, from 1 to 10 amino acids in length, from 1 to 5 amino acids in length, from 1 to 3 amino acids in length, 1 or 2 amino acids in length, from 5 to 20 amino acids in length, or from 10 to 20 amino acids in length.
  • HpARI-1 HpARI-1 comprises 252 amino acids of which the first 16 (SEQ ID No. 5
  • IVIYRLFLVLGFLTFINA are predicted to constitute a signal peptide and encoded by a single exon.
  • the signal peptide is cleaved off after expression and prior to secretion by expressing cells.
  • the remaining 236 amino acids form the mature protein.
  • the mature protein comprises 3 homologous CCP-like domains called HpARI domain 1 , 2 and 3.
  • the signal peptide is linked directly to the HpARI domain 1.
  • HpARI domain 1 is linked directly to HpARI domain 2.
  • HpARI domain 2 is linked directly to HpARI domain 3.
  • the polypeptide terminates with HpARI domain 3
  • amino acid sequence for the full length HpARI-1 is provided in SEQ ID No. 1
  • amino acid sequence for HpARI domain 1 of HpARI-1 is provided in SEQ ID No. 2.
  • amino acid sequence for HpARI domain 2 of HpARI-1 is provided in SEQ ID No. 3.
  • amino acid sequence for HpARI domain 3 of HpARI-1 is provided in SEQ ID No. 4.
  • amino acid sequence for the predicted signal sequence for HpARI-1 is provided in SEQ ID No. 5.
  • HpARI-2 comprises 251 amino acids of which the first 16 (SEQ ID No. 10
  • MYRLFLALGFLTFINA are predicted to constitute a signal peptide and encoded by a single exon.
  • the signal peptide is cleaved off after expression and prior to secretion by expressing cells.
  • the remaining 235 amino acids form the mature protein.
  • the mature protein comprises 3 homologous CCP-like domains called HpARI domain 1 , 2 and 3.
  • the signal peptide is linked directly to the HpARI domain 1.
  • HpARI domain 1 is linked directly to HpARI domain 2.
  • HpARI domain 2 is linked directly to HpARI domain 3.
  • the polypeptide terminates with HpARI domain 3.
  • amino acid sequence for the full length HpARI-2 is provided in SEQ ID No. 6
  • amino acid sequence for HpARI domain 1 of HpARI-2 is provided in SEQ ID No. 7.
  • amino acid sequence for HpARI domain 2 of HpARI-2 is provided in SEQ ID No. 8.
  • amino acid sequence for HpARI domain 3 of HpARI-2 is provided in SEQ ID No. 9.
  • HpARI-3 comprises 248 amino acids of which the first 16 (SEQ ID No. 15
  • MYRIILTLGFLTFINA are a signal peptide and encoded by a single exon.
  • the signal peptide is cleaved off after expression and prior to secretion by expressing cells.
  • the remaining 232 amino acids form the mature protein.
  • the mature protein comprises 3 homologous CCP-like domains called HpARI domain 1 , 2 and 3.
  • the signal peptide is linked directly to the HpARI domain 1.
  • HpARI domain 1 is linked directly to HpARI domain 2.
  • HpARI domain 2 is linked directly to HpARI domain 3.
  • the polypeptide terminates with HpARI domain 3.
  • amino acid sequence for the full length HpARI-3 is provided in SEQ ID No. 11
  • amino acid sequence for HpARI domain 1 of HpARI-3 is provided in SEQ ID NO: 1
  • amino acid sequence for HpARI domain 2 of HpARI-3 is provided in SEQ ID No. 13.
  • amino acid sequence for HpARI domain 3 of HpARI-3 is provided in SEQ ID NO: 1
  • amino acid sequence for the signal sequence of HpARI-3 is provided in SEQ ID No. 15.
  • the inventors have been able to identify a common structure that defines each of the domains that are suitable the present invention.
  • E/A/G is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID No. 16.
  • the polypeptide has an inhibitory effect on IL- 33 activity.
  • the HpAR11 domain 1 may bind to DNA.
  • the HpARI domain 1 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID Nos. 2, 7 or 12, or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 2, 7 or 12, respectively.
  • the HpAR11 domain 1 is provided in the polypeptide of the present invention, the polypeptide has an inhibitory effect on IL- 33 activity.
  • the HpAR11 domain 1 may bind to DNA.
  • the HpARI domain 2 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID Nos. 3, 8 or 13, or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 3, 8 or 13, respectively.
  • the HpARI domain 2 is provided in the polypeptide of the present invention, the polypeptide has an inhibitory effect on IL- 33 activity.
  • the HpARI domain 2 may bind to IL-33.
  • the HpARI domain 2 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID Nos. 19, 20 or 21 , or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 19, 20 or 21 , respectively.
  • the HpARI domain 2 is provided in the polypeptide of the present invention, the polypeptide has an inhibitory effect on IL- 33 activity.
  • the HpARI domain 2 may bind to IL-33.
  • x 60 S/G
  • x 61 S/N
  • x 62 LA/
  • x 63 C/D/N
  • x 64 N/T
  • x 65 K/T
  • x 66 E/D
  • x 67 M/P/R
  • x 68 L/E
  • x 69 A/Q
  • x 70 Q/T
  • x 71 N/K
  • x 72 N/D
  • x 73 E/K
  • x 74 E/K
  • x 75 R/G
  • x 76 A/V
  • x 77 R/V
  • x 78 F/L
  • x 79 E/K
  • x 80 S/D/Y
  • x 81 D/E
  • x 82 H/G/N
  • x 83 E/K
  • x 84 E/K
  • x 85 P/S, or is a fragment and/or variant thereof and having at least 20%, at least 20%, at least
  • the polypeptide has an inhibitory effect on IL-33 activity.
  • the HpARI domain 3 may prevent IL-33 bound to the polypeptide from interacting with the IL-33 receptor.
  • the HpARI domain 3 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID Nos. 4, 9 or 14, or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 4, 9 or 14, respectively.
  • the HpARI domain 3 is provided in the polypeptide of the present invention, the polypeptide has an inhibitory effect on IL- 33 activity.
  • the HpARI domain 3 may prevent IL-33 bound to the polypeptide from interacting with the IL-33 receptor.
  • the polypeptide has an inhibitory effect on IL-33 activity.
  • the HpARI domain 3 may prevent IL-33 bound to the polypeptide from interacting with the IL-33 receptor.
  • the HpARI domain 3 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID Nos. 24, 25 or 26, or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 24, 25 or 26, respectively.
  • the HpARI domain 3 is provided in the polypeptide of the present invention, the polypeptide has an inhibitory effect on IL- 33 activity.
  • HpARI domain 1 defined above with reference to SEQ ID No. 7 has a particularly high level of affinity for DNA.
  • the polypeptides of the present invention when including HpARI domain 1 , comprises that domain defined above with reference to SEQ ID No. 7 (i.e. the HpARI domain 1 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID No. 7, or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 7.
  • the HpARI domain 1 is provided in the polypeptide of the present invention, the polypeptide has an inhibitory effect on IL-33 activity.
  • the HpARI domain 1 may bind to DNA.
  • the HpARI domain 2 defined above with reference to SEQ ID No. 13 has a particularly high level of affinity for human IL-33. Consequently, it is a preferred option that the polypeptides of the present invention comprise HpARI domain 1 defined above with reference to SEQ ID No. 13 (ie the HpARI domain 2 may be a polypeptide comprising or consisting of the amino acid sequence provided in SEQ ID Nos.
  • the polypeptide has an inhibitory effect on IL-33 activity.
  • the HpARI domain 2 may bind to IL-33.
  • the polypeptide comprises HpARI domain 1 defined above with reference to SEQ ID No. 7 and HpARI domain 2 defined above with reference to SEQ ID No. 13.
  • This polypeptide may also include a HpARI domain 3.
  • the polypeptide comprises a HpARI domain 3 and a HpARI domain 2 defined above with reference to SEQ ID No. 13.
  • This polypeptide may also include a DNA-binding domain, preferably HpARI domain 1 defined above with reference to SEQ ID No. 7.
  • the polypeptide may comprise or consist of the amino acid sequence provided in SEQ I D Nos. 1 , 6 or 1 1 , or is a fragment and/or variant thereof and having at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identify with Sequence ID Nos. 1 , 6 or 11 ,
  • polypeptide may bind to IL-33, and may also bind to DNA and/or prevent IL-33 from interacting with its receptor.
  • nucleic acid which encodes a polynucleotide according to the first aspect of the present invention.
  • Table 1 provides the nucleic acid sequence for polypeptides of the present invention.
  • the nucleic acid of the present invention may have a sequence identify of at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99% that of the sequence provided in Table 1.
  • the polypeptide expression product of this nucleic acid binds to IL-33, and may also bind to DNA and/or prevent IL-33 from interacting with its receptor.
  • the polypeptide expression product of this nucleic acid may inhibit IL-33 activity.
  • an expression vector comprising one or more nucleic acid sequences according to the second aspect of the present invention.
  • the nucleic acid sequence may be operably linked to a pro motor.
  • a host cell comprising the expression vector according to the third aspect of the present invention, or the nucleic acid according to the second aspect of the present invention.
  • a fifth aspect of the present invention there is provided a method of culturing the host cell under conditions suitable to induce expression of the polypeptide according to the first aspect of the present invention.
  • Polypeptides obtained in this method also form part of the present invention.
  • composition comprising a polypeptide according to the first aspect of the present invention, a nucleic acid according to the second aspect of the present invention, an expression vector according to the third aspect of the present invention or a host cell according to a fourth aspect of the present invention.
  • an allergic disorder may be any disorder that is characterised by a IL-33 response. In particular, those disorders driven by a type 2 immune response.
  • the allergic or inflammatory disorder could be any one or more of asthma, atopic dermatitis, food allergy, COPD, eosinophilic inflammatory bowel disease, eosinophilic esophagitis, age-related macular degeneration, allergic rhinitis, anaphylaxis, viral bronchiolitis, arthritis, acute lung injury, acute respiratory distress syndrome, pneumonia, sepsis and fibrotic diseases (e.g. Idiopathic Pulmonary Fibrosis, skin fibrosis, lung fibrosis), or any combination thereof. Consequently, the allergic or inflammatory disorder may be asthma.
  • the allergic or inflammatory disorder may be acute lung injury, acute respiratory distress syndrome, pneumonia or sepsis.
  • an eighth aspect of the present invention there is provided a method of treating an allergic or inflammatory disorder in a subject, said method comprising administering a polypeptide according to the first aspect of the present invention, a nucleic acid according to the second aspect of the present invention, an expression vector according to the third aspect of the present invention or a host cell according to a fourth aspect of the present invention, to the subject.
  • the polypeptide, nucleic acid, expression vector or host cell are administered in an effective amount for treating the allergic or inflammatory disorder.
  • the subject may, for example, be murine or human.
  • a ninth aspect of the present invention there is provided a use of a polypeptide according to the first aspect of the present invention, a nucleic acid according to the second aspect of the present invention, an expression vector according to the third aspect of the present invention or a host cell according to a fourth aspect of the present invention in the preparation of a medicament to treat an allergic or inflammatory disorder.
  • the first to fourth aspects of the present invention may be used as tool to study the importance of IL-33 in a cellular response. Consequently, in a tenth aspect of the present invention, there is provided an ex vivo method of inhibiting IL-33 activity and/or detecting IL-33 (optionally specifically reduced and so active IL-33) by administration of a polypeptide according to the first aspect of the present invention, a nucleic acid according to the second aspect of the present invention, an expression vector according to the third aspect of the present invention or a host cell according to a fourth aspect of the present invention to a cell or cellular system.
  • This method may use the present invention in an in vitro assay or experiment, or a biochemical assay or experiment.
  • the present invention may therefore also relate to a kit comprising a polypeptide of the present invention suitable for use in the above method.
  • polypeptides, nucleic acids, expression vectors and host cells of the present invention may be isolated polypeptides, nucleic acids, expression vectors and host cells.
  • polypeptide of the present invention may be those excreted and isolated from H. polygyrus, the polypeptides may also relate to forms that do not exist in nature, for example, truncated polypeptides (eg fragments of those defined above), polypeptides with non-natural domain combinations and variants.
  • the polypeptides, nucleic acids, expression vectors and host cells of the present invention may be recombinant polypeptides, nucleic acids, expression vectors and host cells.
  • HpARI Domain 1 , 2 and/or 3, as described above may be inserted into a larger protein structure that provides IL-33 inhibitory function. Further explanations of non-natural polypeptides are provided in more detail below.
  • Figure 1 shows IL-33 suppression by HES size fractions (A) and charge fractions (B).
  • Figure 2 shows the candidate IL-33-suppressive protein selection strategy (A), and the emPAI profiles (compared to IL-33 suppression profile) of the 4 candidate proteins selected, plus one protein not selected (B), in all size and charge fractions.
  • Figure 3 shows IL-33 levels (ELISA) in supernatants of naive murine lung cells, freeze-thawed in the presence of supernatants of HEK293T cells transfected with four candidate genes.
  • Candidate D is HpARI-2.
  • Figure 4 shows the exon and domain architecture of HpARI, and structural models of the three HpARI domains.
  • Figure 5 shows exon (DNA sequence) and domain (amino acid sequence) structure of HpARI-1 , HpARI-2 and HpARI-3.
  • Figure 6 shows an alignment of domains 1 , 2 and 3 of HpARI-1 , HpARI-2 and HpARI-3, with atypical insertions in domains 2 and 3 indicated.
  • Figure 7 shows surface plasmon resonance of mouse (A) and human (B) IL-33 binding to chip-bound HpARI-2, or human IL-33 binding to HpARI-3 (C) with calculated on-rate (K+), off-rate (K_) and dissociation constants (Kd).
  • Figure 8 shows co-immunoprecipitation of mouse (A) and human (B) IL-33 by HpARI-2. Preferential binding of reduced (active) over oxidised (inactive) IL-33 in shows in both cases.
  • Figure 9 shows HpARI preventing IL-33-IL-33 receptor interactions.
  • HpARI-2 interfers with immunoprecipitation of murine IL-33 by ST2-Fc (IL-33 receptor-lgG
  • Fc region fusion (A), and prevents in vivo IL-5 (B) and IL-13 (C) ILC2 responses to intranasally administered murine IL-33.
  • Figure 10 shows HpARI-2 inhibition of Alternaria allergen-induced IL-33 release in vivo, as measured by mlL-33 ELISA (A) and mlL-33 western blot (B).
  • Figure 11 shows abrogation of IL-33 tethering (i.e. inhibition of release as measured by western blot)(A), but not of IL-33 binding (as measured by ELISA)(B) by DNAse treatment in vivo. DNA binding was further confirmed by DNA immunoprecipitation by HpARI-2 (C) and immunofluorescence in necrotic cell nuclei treated with HpARI-2-mCherry fusion protein (D).
  • Figure 12 shows differences in levels of inhibition of IL-33 ELISA detection (A) and inhibition of IL-33 release (as measured by mlL-33 western blot)(B), by HpARI-1 , HpARI-2 and HpARI-3.
  • Figure 13 shows differences in inhibition of IL-33 release from human lung explants by HpARI-1 , HpARI-2 and HpARI-3, measured by hlL-33 ELISA (A) and western blot (B).
  • Figure 14 shows immunoprecipitation of mouse IL-33 by HpARI-2 truncation mutants.
  • Figure 15 shows a DNA binding by HpARI-2 truncation mutants in a DNA gel shift assay.
  • Figure 16 shows an electrostatic model of HpARI-2 domain 1 to reveal 2 potential
  • Figure 17 shows electrostatic models of both HpARI-2 domain 1 and HpARI-3 domain 1 , to reveal the lack of a potential DNA binding site in HpARI-3.
  • Figure 18 shows inhibition of murine IL-33 release (measured by western blot)(A) and inhibition of IL-33 detection (measured by ELISA)(B) by HpARI-2 truncation mutants.
  • Figure 19 shows surface plasmon resonance measurements of affinity of HpARI truncations (CCP1/2 and CCP2/3) for murine IL-33.
  • Figure 20 shows the amino acid sequences of the 3 domains of HpARI-2 compared to complement factor H CCP10 and complement receptor type 2 CCP 2, to reveal atypical insertions in HpARI domains 2 and 3. Mutants which lacked the atypical loop in domain 2, domain 3, or both, were expressed and tested for murine IL-33 inhibition by IL-33 western blot (B) and ELISA (C).
  • Figure 21 shows IL-5 (A) and IL-13 (B) release from murine bone marrow cell cultures stimulated with IL-2, IL-7 and IL-33, in the presence of 10 ⁇ g/ml HpARI-2 or truncation mutants lacking one or more domains of HpARI-2.
  • Figure 22 shows immunoprecipitation of IL-33 by ST2-Fc, in the presence of HpARI-2 or truncation mutants lacking one or more domains of HpARI-2.
  • Figure 23 shows BAL eosinophil responses (A), and IL-5 (B) and IL-13 (C) production by lung ILC2s 24 h after Alternaria allergen plus HpARI-2 or HES was intranasally administered to BALB/c mice.
  • Figure 24 shows a schematic of the Alternaria-OVA model of asthma, with HpARI-2 given at sensitisation.
  • BAL eosinophils B
  • ILC2 IL-5 C
  • IL-13 D
  • E airway resistance
  • F airway resistance
  • G Haematoxylin and Eosin
  • H Periodic Acid Schiff
  • polypeptide As used herein, "polypeptide”, “peptide” and “protein” can be used interchangeably and mean at least two covalently attached amino acids linked by a peptidyl bond.
  • the term protein encompasses purified natural products, or products which may be produced partially or wholly using recombinant or synthetic techniques.
  • the terms polypeptide, peptide and protein may refer to an aggregate of a protein such as a dimer or other multimer, a fusion protein, a protein variant, or derivative thereof.
  • the term also includes modifications of the protein, for example, protein modified by glycosylation, acetylation, phosphorylation, pegylation, ubiquitination, and so forth.
  • a protein may comprise amino acids not encoded by a nucleic acid codon.
  • Peptides can be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified peptides, and optionally having other desirable properties.
  • carboxylic acid groups of the protein may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified, for example to form a C1-C6 alkyl ester, or converted to an amide, for example of formula CONR1 R2 wherein R1 and R2 are each independently H or C1-C6 alkyl, or combined to form a heterocyclic ring, such as a 5- or 6-membered ring.
  • Amino groups of the peptide may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCI, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified to C1-C6 alkyl or dialkyl amino or further converted to an amide.
  • Hydroxyl groups of the peptide side chains may be converted to alkoxy or ester groups, for example C1-C6 alkoxy or C1-C6 alkyl ester, using well-recognized techniques.
  • Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as F, CI, Br or I, or with C1-C6 alkyl, C1-C6 alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids.
  • Methylene groups of the peptide side chains can be extended to homologous C2-C4 alkylenes.
  • Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups.
  • variant it is meant an amino acid substitution (eg conservative substitution), insertion, and/or deletion in a polypeptide sequence or an alteration to a moiety chemically linked to a protein (for example, a modification may be an altered carbohydrate or PEG structure attached to a protein).
  • the proteins of the invention may include at least one such substitution (eg conservative substitution), insertion, and/or deletion in the recited polypeptide sequences or an alteration to a moiety chemically linked to a protein.
  • immunological activity may be found using computer programs well known in the art.
  • Conservative substitution One or more amino acid substitutions (for example of 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 residues) for amino acid residues having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide.
  • a conservative substitution in a DNA-binding peptide may be an amino acid substitution that does not substantially affect the ability of the peptide to bind to DNA.
  • a conservative substitution in a IL-33-binding peptide may be an amino acid substitution that does not substantially affect the ability of the peptide to bind to IL-33.
  • a conservative substitution in peptide that inhibits IL-33 activity may be an amino acid substitution that does not substantially affect the ability of the peptide to inhibit IL-33 activity.
  • one conservative substitution is included in the peptides of the present invention.
  • 10 or fewer conservative substitutions are included in the peptides, such as five or fewer.
  • a peptide or protein of the invention may therefore include 1 , 2, 3, 4, 5, 6, 7, 8, 9 10 or more conservative substitutions.
  • a polypeptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR.
  • polypeptide can be produced to contain one or more conservative substitutions by using peptide synthesis methods, for example as known in the art.
  • Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place.
  • amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gin or His for Asn; Glu for Asp; Asn for Gin; Asp for Glu; Pro for Gly; Asn or Gin for His; Leu or Val for lie; lie or Val for Leu; Arg or Gin for Lys; Leu or lie for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; and lie or Leu for Val.
  • substitutions may be among Ala, Val Leu and lie; among Ser and Thr; among Asp and Glu; among Asn and Gin; among Lys and Arg; and/or among Phe and Tyr.
  • fragment it is meant a portion of the recited polypeptide.
  • the fragment may be a fragment of a variant of the polypeptide.
  • Isolated means a biological component (such as a
  • nucleic acid, expression vector or host cell that has been substantially separated or purified away from other biological components in the cell of the organism or the cellular system in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins.
  • Nucleic acids and proteins that have been "isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids, proteins and peptides.
  • isolated refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived.
  • an isolated nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent.
  • an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
  • an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.
  • the term "isolated" as used with reference to nucleic acid also includes any non-naturally-occurring nucleic acid since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome.
  • non-naturally-occurring nucleic acid such as an engineered nucleic acid is considered to be isolated nucleic acid.
  • Engineered nucleic acid can be made using common molecular cloning or chemical nucleic acid synthesis techniques.
  • Isolated non- naturally-occurring nucleic acid can be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote.
  • a non-naturally-occurring nucleic acid can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence. The same teachings for nucleic acids are equally applicable to polypeptides.
  • purified does not require absolute purity; rather, it is intended as a relative term.
  • a purified peptide preparation is one in which the peptide or protein is more enriched than the peptide or protein is in its environment within a cell, such that the peptide is substantially separated from cellular components (nucleic acids, lipids, carbohydrates, and other polypeptides) that may accompany it.
  • a purified peptide preparation is one in which the peptide is substantially-free from contaminants, such as those that might be present following chemical synthesis of the peptide.
  • a peptide of the disclosure is purified when at least 50% by weight of a sample is composed of the IL-33 inhibitor, for example when at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, or 99% or more of a sample is composed of the peptide.
  • methods that can be used to purify a peptide include, but are not limited to the methods disclosed in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 1989, Ch. 17). Protein purity can be determined by, for example, high-pressure liquid chromatography or other conventional methods.
  • Nucleic acids of the present invention include those coding or the polypeptide
  • the nucleic acids may be nucleic acid derivatives.
  • the term "derivative" can mean a biological molecule that has been altered chemically or genetically in a way which does not affects its biological activity.
  • a derivative may be a functional derivative or a biologically effective analogue of the parent biomolecule.
  • the nucleic acid may be a recombinant nucleic acid.
  • Recombinant nucleic acid is one that has a sequence that is not naturally occurring and/or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Recombinant is also used to describe nucleic acid molecules that have been artificially manipulated, but contain the same regulatory sequences and coding regions that are found in the organism from which the nucleic acid was isolated.
  • Sequence Identity The term "sequence identity" would be well understood by the person skilled in the art. For example, the identity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. The percentage identity is calculated over the entire length of the sequence. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity when aligned using standard methods.
  • orthologous proteins or cDNAs are derived from species which are more closely related (e.g., human and mouse sequences), compared to species more distantly related (e.g., human and C. elegans sequences).
  • NCBI National Center for Biological Information
  • blastp blastn
  • blastx blastx
  • tblastn tblastx
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • the options can be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C: ⁇ seq1.txt); j is set to a file containing the second nucleic acid sequence to be compared (e.g., C: ⁇ seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C: ⁇ output.txt); -q is set to -1 ; -r is set to 2; and all other options are left at their default setting.
  • the following command can be used to generate an output file containing a comparison between two sequences: C: ⁇ B12seq-i c: ⁇ seq1.txt-j c: ⁇ seq2.txt-p blastn-o c: ⁇ output.txt-q-1-r2.
  • -i is set to a file containing the first amino acid sequence to be compared (e.g., C: ⁇ seq1.txt);
  • -j is set to a file containing the second amino acid sequence to be compared (e.g., C: ⁇ seq2.txt);
  • -p is set to blastp;
  • -o is set to any desired file name (e.g., C: ⁇ output.txt); and all other options are left at their default setting.
  • the following command can be used to generate an output file containing a comparison between two amino acid sequences: C: ⁇ B12seq-i c:seq1.txt-j c:seq2.txt-p blastp-o c: ⁇ output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.
  • the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences.
  • the percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100.
  • the percent sequence identity value is rounded to the nearest tenth.
  • 75.1 1 , 75.12, 75.13, and 75.14 are rounded down to 75.1
  • 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2.
  • the length value will always be an integer.
  • the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11 , and a per residue gap cost of 1). Homologs are typically characterized by possession of at least 70% sequence identity counted over the full-length alignment with an amino acid sequence using the NCBI Basic Blast 2.0, gapped blastp with databases such as the nr or swissprot database. Queries searched with the blastn program are filtered with DUST
  • nucleic acid sequences can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.
  • homologous nucleic acid sequences can, for example, possess at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity determined by this method.
  • the invention includes nucleic acid sequences having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95% with a nucleic acid of the disclosure, e.g. 96% or more, 97% or more, 98% or more or 99% or more.
  • DNA sequences which code for proteins of the present invention and which hybridize to a DNA of the disclosure will preferably have at least 75% identity, at least 85% identity, at least 90% identity e.g. at least 95% identity with a DNA of the disclosure, e.g. an identity of 96% or more, 97% or more, 98% or more or 99% or more.
  • DNAs which code for proteins of the present invention are also part of this invention.
  • the degeneracy of the genetic code which allows different nucleic acid sequences to code for the same protein or peptide, is well known in the literature.
  • the invention includes proteins and peptides having an identity of at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, at least sequence 75%, at least 80%, at least 85%, at least 90%, at least 95% with a protein or peptide of the disclosure, e.g. 96% or more, 97% or more, 98% or more or 99% or more; such proteins may have the activity of the corresponding protein or peptide of the disclosure.
  • nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
  • DNA-binding It is well within the skill of the ordinary person to determine if any given polypeptide is capable of binding to DNA. Given that DNA presents a negative charge, DNA binding agents will often present a positive charge. To determine if DNA binding has occurred the skilled person can carry out a gel shift assay: linear plasmid DNA (10 ng) is mixed with polypeptide (100 pmol) in 10 mM TrisCI, 1 mM EDTA, incubated at 37°C for 30 min, and the resulting complex run on a 0.7% agarose gel (containing suitable nucleic acid stain, such as ethidium bromide, gelred or SYBRgreen). DNA binding should induce an apparent size change (for example >10% increase in apparent DNA size, measured to DNA size ladder) of complexed DNA compared to uncomplexed DNA.
  • IL-33-binding It is well within the skill of the ordinary person to determine if any given polypeptide is capable of binding to IL-33. To determine if IL-33 binding has occurred the skilled person can carry out surface plasmon resonance, attaching polypeptide to a sensor chip, and running recombinant IL-33 over it, or vice versa. Calculated binding affinities (Kd) of for example ⁇ 10 ⁇ indicate IL-33 binding.
  • IL-33 release is well characterised in the art and so it is well within the skill of the ordinary person to determine if any given polypeptide is capable of inhibiting IL-33 release.
  • the skilled person can carry out an IL-33 release assay, adding polypeptide to live, IL-33 expressing cells (e.g. epithelial cell lines, ex vivo IL-33- expressing cells, ex vivo tissue explants) and culturing under conditions that will cause IL-33 release (either spontaneous IL-33 release, or in response to allergens (e.g. Alternaria allergen), or in response to freeze-thaw mediated necrosis).
  • IL-33 in the supernatant can then be measured by IL-33 western blot, allowing
  • Blocking of binding of IL-33 to its receptor is well within the ordinary skill in the art (ie IL-33 is prevented from interacting with IL-33 receptor).
  • ST2-Fc fusion protein a commercially-available protein consisting of the IL-33 receptor, ST2, in a fusion with IgG Fc region
  • ST2Fc fusion protein can be attached to protein G-coated beads, and used to immunoprecipitate recombinant IL-33.
  • a polypeptide blocks IL-33-IL-33 receptor interaction, then adding this polypeptide to recombinant IL-33 prior to the immunoprecipitation reaction will prevent IL-33 immunoprecipitation from occurring.
  • functional responses to recombinant IL-33 (in vitro or in vivo) in the presence or absence of polypeptide can be measured, as detailed below.
  • IL-33 activity is well characterised in the art and so it is well within the skill of the ordinary person to determine if any given polypeptide is capable of inhibiting IL-33 activity.
  • IL-33 activity may be characterised by an induction of an IL-33 induced cytokine response, for example induction of IL-5, IL-13 and or IL6, or any combination thereof (eg from mast cells or type 2 innate lymphoid cells, in vivo, ex vivo or from immortalised cell lines).
  • the skilled person would be well aware how to establish if such a response has been inhibited. For example, to determine if IL-33 inhibition has occurred the skilled person can carry out IL-33 activity assays;
  • IL-33 responsive cells e.g. mast cells or type 2 innate lymphoid cells, either in vivo, ex vivo or immortalised cell lines
  • cytokines secreted into the supernatant in response to IL-33 e.g. IL-5, IL-13, IL-6.
  • An inhibitory polypeptide should be capable of suppressing peak response to IL-33 to, for example, ⁇ 80% of the maximum level (ie a >20% reduction).
  • Inhibition of IL- 33 activity may be characterised by the prevention of IL-33-receptor binding, which in turn may be characterised by the binding of IL-33 to DNA (ie via binding of the polypeptide to DNA and the to IL-33) and/or blocking of binding of IL-33 to its receptor.
  • Treatment - The invention concerns amongst other things the treatment of
  • treatment include the following and combinations thereof: (1) inhibiting, e.g. delaying initiation and/or progression of, an event, state, disorder or condition, for example arresting, reducing or delaying the development of the event, state, disorder or condition, or a relapse thereof in case of maintenance treatment or secondary prophylaxis, or of at least one clinical or subclinical symptom thereof; (2) preventing or delaying the appearance of clinical symptoms of an event, state, disorder or condition developing in an animal (e.g.
  • the benefit to a patient to be treated may be either statistically significant or at least perceptible to the patient or to the physician.
  • a medicament will not necessarily produce a clinical effect in each patient to whom it is administered; thus, in any individual patient or even in a particular patient population, a treatment may fail or be successful only in part, and the meanings of the terms “treatment” and “prophylaxis” and of cognate terms are to be understood accordingly.
  • the polypeptides, nucleic acids, expression vectors, host cells, compositions and methods described herein are of use for therapy and/or prophylaxis of the mentioned conditions.
  • prophylaxis includes reference to treatment therapies for the purpose of preserving health or inhibiting or delaying the initiation and/or progression of an event, state, disorder or condition, for example for the purpose of reducing the chance of an event, state, disorder or condition occurring.
  • the outcome of the prophylaxis may be, for example, preservation of health or delaying the initiation and/or progression of an event, state, disorder or condition. It will be recalled that, in any individual patient or even in a particular patient population, a treatment may fail, and this paragraph is to be understood accordingly.
  • the term "inhibit” includes reference to delaying, stopping, reducing the incidence of, reducing the risk of and/or reducing the severity of an event, state, disorder or condition. Inhibiting an event, state, disorder or condition may therefore include delaying or stopping initiation and/or progression of such, and reducing the risk of such occurring.
  • the products of the disclosure may be used to inhibit allergic and inflammatory disorders and other events, disorders and/or conditions which are disclosed herein.
  • Administration - Routes of administration useful in the disclosed methods and uses include but are not limited to oral and parenteral routes, such as intravenous (iv), intraperitoneal (ip), rectal, topical, ophthalmic, nasal, and transdermal.
  • oral and parenteral routes such as intravenous (iv), intraperitoneal (ip), rectal, topical, ophthalmic, nasal, and transdermal.
  • compositions comprising an active of the disclosure formulated for pharmaceutical use (ie a pharmaceutical composition) and optionally further comprising a pharmaceutically acceptable diluent, excipient and/or carrier.
  • pharmaceutical formulations which may include, in addition to active ingredient, a pharmaceutically acceptable diluent, excipient and/or carrier. Such formulations may be used in the methods of the disclosure. Additionally or alternatively, pharmaceutical formulations may include a buffer, stabiliser and/or other material well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material will depend on the route of administration, which may be any suitable route, for example by a parenteral route and particularly by infusion or injection (with or without a needle).
  • the route of administration may be subcutaneous injection.
  • the route of administration may be intravenous injection or infusion.
  • Other routes of administration which may be used include administration by inhalation or intranasal administration.
  • compositions are provided that include one or more of the actives that are disclosed herein in a carrier.
  • the compositions can be prepared in unit dosage form for administration to a subject. The amount and timing of administration are at the discretion of the treating physician to achieve the desired purposes.
  • the active composition may be formulated for systemic or local administration. In one example, the active composition could be formulated for parenteral administration, such as subcutaneous or intravenous administration.
  • the active composition can be formulated as a solution, suspension, emulsion or lyophilized powder in association, or separately provided, with a pharmaceutically acceptable parenteral vehicle.
  • a pharmaceutically acceptable parenteral vehicle examples include water, saline, Ringer's solution, dextrose solution, and 1-10% human serum albumin. Liposomes and nonaqueous vehicles such as fixed oils can also be used.
  • the vehicle or lyophilized powder can contain additives that maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability (e.g., buffers and preservatives).
  • the formulation is sterilised, e.g.
  • Formulations for parenteral administration can contain as common excipients sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes and the like.
  • Aqueous or oily suspensions for injection can be prepared by using an appropriate emulsifier or humidifier and a suspending agent, according to known methods.
  • Vehicles for injection can be a non-toxic diluting agent such as aqueous solution or a sterile injectable liquid.
  • the usable vehicle or solvent water, Ringer's solution, isotonic saline, etc. are allowed; as a solvent or suspending liquid, a sterile non-volatile oil can be used.
  • any kind of non-volatile oil may be used, including natural or synthetic or semisynthetic fatty oils or fatty acids; natural or synthetic or semisynthetic mono- or di- or tri-glycerides.
  • compositions for administration can include a solution of the active dissolved in a pharmaceutically acceptable carrier, such as an aqueous carrier.
  • a pharmaceutically acceptable carrier such as an aqueous carrier.
  • aqueous carriers can be used, e.g., buffered saline. These solutions are sterile and generally free of undesirable matter.
  • These compositions may be sterilised by conventional, well known sterilisation techniques.
  • the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride and/or sodium lactate.
  • concentration of active in these formulations can vary widely, and may be selected based on fluid volumes, viscosities and/or body weight in accordance with the particular mode of administration selected and the subject's needs.
  • a typical pharmaceutical composition for intravenous or subcutaneous injection [00118] A typical pharmaceutical composition for intravenous or subcutaneous injection
  • administration includes about 0.1 to 20 mg of active formulation per Kg of subject per day.
  • Actual methods for preparing administrable compositions, whether for intravenous or subcutaneous administration or otherwise, will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, Pa. (1995).
  • the active formulation may be provided in lyophilised form and rehydrated, e.g. with sterile water or saline, before administration, although active formulations may be provided in sterile solutions of known concentration.
  • the active solution may then be added to an infusion bag containing 0.9% sodium chloride, USP, and typically administered at a dosage of from 0.5 to 15 mg/kg of body weight.
  • Amounts effective for therapeutic use which may be a prophylactic use, will depend upon the severity of the disease and the general state of the patient's health.
  • a therapeutically effective amount of the active agent is that which provides either subjective relief of a symptom(s) or an objectively identifiable improvement as noted by the clinician or other qualified observer.
  • An active agent of the disclosure may be administered in conjunction with another active agent, whether simultaneously, separately or sequentially.
  • the other active agent may be a second active agent of the invention or an active agent falling outside the invention.
  • the composition should provide a sufficient quantity of at least one of the active agents disclosed herein to effectively treat the patient, bearing in mind though that it may not be possible to achieve effective treatment in every instance.
  • the dosage can be administered once but may be applied periodically until either a therapeutic result is achieved or until side effects warrant discontinuation of treatment.
  • the dose may be sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the patient.
  • Controlled release parenteral formulations can be made as implants, oily
  • Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles.
  • Microcapsules contain the therapeutic protein as a core. In microspheres the therapeutic is dispersed throughout the particle. Particles, microspheres, and microcapsules smaller than about 1 ⁇ are generally referred to as nanoparticles, nanospheres, and nanocapsules, respectively.
  • Capillaries have a diameter of approximately 5 ⁇ so that only nanoparticles are administered intravenously. Microparticles are typically around 100 . ⁇ in diameter and are administered subcutaneously or intramuscularly. See, e.g., Kreuter, J., Colloidal Drug Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New York, N.Y., pp. 219-342 (1994); and Tice & Tabibi, Treatise on Controlled Drug Delivery, A.
  • Polymers can be used for ion-controlled release of the active agents disclosed herein.
  • Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer, Accounts Chem. Res.
  • the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has been shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al., Pharm. Res. 9:425-434, 1992; and Pec et al., J. Parent. Sci. Tech. 44(2):58-65, 1990). Alternatively, hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al., Int. J. Pharm. 112:215-224, 1994).
  • liposomes are used for controlled release as well as drug targeting of the lipid- capsulated drug (Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, Pa. (1993)).
  • Numerous additional systems for controlled delivery of therapeutic proteins are known (see U.S. Pat. No. 5,055,303; U.S. Pat. No. 5,188,837; U.S. Pat. No. 4,235,871 ; U.S. Pat. No. 4,501 ,728; U.S. Pat. No. 4,837,028; U.S. Pat. No. 4,957,735; U.S. Pat. No. 5,019,369; U.S. Pat. No.
  • the active formulation may be administered orally.
  • An active formulation may be administered orally in a liquid dosage form or a solid dosage form.
  • solid dosage forms are tablets, capsules, granules, powders, beads and
  • An active agent of the disclosure, with or without at least one additional therapeutic agents, that is administered in a solid dosage may be formulated with or without those carriers customarily used in the compounding of solid dosage forms such as tablets and capsules.
  • a solid oral dosage form may be designed to release the active portion of the formulation at the point in the gastrointestinal tract where bioavailability is maximized and pre-systemic degradation is minimized.
  • At least one additional agent may be included to facilitate absorption of an active of the disclosure and/or any additional therapeutic agents.
  • the active compound is typically mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as lactose, sodium citrate or dicalcium phosphate and/or one or more: a) fillers or extenders for example starches, lactose, sucrose, glucose, mannitol and silicic acid; b) binders for example carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; c) humectants for example glycerol; d) disintegrating agents for example agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate; e) solution retarding agents for example paraffin; f) absorption accelerators for example quaternary ammonium compounds; g) wetting agents for example cetyl alcohol and glycerol monostearate; h) absorbents for example kaolin and bentonite clay and
  • mice BALB/cOlaHsd, C57BL/6JOIaHsd, mice, male or female (single sex within an experiment), 6-10 weeks old, were bred in-house at the University of Edinburgh. All mice were accommodated, and procedures performed under UK Home Office licenses with institutional oversight performed by qualified veterinarians.
  • Bioresource (15/ES/0094) and tissue was donated with the informed consent of patients.
  • Alternaria alternata extract (Greer XPM 1 D3A25) was resuspended in PBS, filter sterilized and concentration assessed by BCA assay (Pierce).
  • CMT-64 cells (ECACC 10032301) and HEK293T cells (ATCC CRL-3216) were maintained by serial passage in DM EM medium containing 10% fetal bovine serum, 2 mM L- glutamine and 1 ⁇ g ml "1 penicillin/streptomycin.
  • Human and murine IL-33 were purchased from BioLegend.
  • HES human immunosensitized human IL-33 release assay
  • candidate proteins or HpARI were cultured with total murine lung cells prepared by Liberase/DNAse digestion of naive mouse lungs or CMT-64 cells for 1 h at 37°C, 5% C0 2 , with Alternaria allergen (200 ⁇ g ml " 1 ), or were frozen on dry ice, and thawed at 37°C.
  • Digested tissue was macerated through a 70 ⁇ cell strainer (BD Biosciences), treated with red blood cells lysis buffer (Sigma), and live cells counted on a haemocytometer, excluding dead cells by trypan blue staining.
  • human and murine IL-33 by ELISA, while western blotting was carried out using polyclonal goat anti-mouse IL-33, or goat anti-human IL-33 (R&D Systems) with a rabbit anti-goat IgG HRP secondary antibody (Thermo Fisher), and detected using WesternSure Premium reagent (Licor).
  • HES Fractionation and mass spectrometry: HES was separated into 1 ml fractions by size exclusion chromatography using a Superdex 200 10/300 GL column, or by anion exchange chromatography using a MonoQ 5/50 GL column (GE Healthcare) in a 40 column volume gradient from 20 mM TrisHCI pH 8 (start buffer) to a maximum of 30 % 20 mM TrisHCI + 1 M NaCI pH 8 (elution buffer).
  • Candidate genes were selected by comparison of emPAI and IL-33-suppression profiles in all fractions
  • Hp_l46029_IG37973_L313 and Hp_l08176_IG02172_L1157 transcripts were codon optimised for Homo sapiens and gene synthesised (GeneArt, Thermo Fisher) with 5' Ascl and 3' Notl restriction enzyme sites. Subsequently, homology searching of the H. polygyrus genome_was used to identify HpARI-1 and HpARI-3, which were also codon optimised and gene synthesised.
  • HpARI-2 atypical loop mutant was constructed by deletion of the atypical loops in HpARI-2 CCP2 (SEQ ID No. 20 GILEMLFDMPKEERPSPMYDSVTYDPT) and HpARI-2 CCP3 (SEQ ID No.
  • HpARI-2 CCP1/2 amino acids 17-165
  • HpARI-2 CCP2/3 amino acids 80-251
  • HpARI-2 CCP3 amino acids 166-251 constructs were created using PCR of codon-optimised HpARI-2, and primers which added a Notl site 3' of the CCP2 module (SEQ ID No. 51
  • HpARI-2 CCP3 5 GCGCGCCGGCTGCAAGGGCATCCTG3', primes GCKGIL amino acid sequence, for HpARI-2 CCP2/3 construct), or an Ascl site 5' of the HpARI-2 CCP3 module ( SEQ ID No. 53 5'GGCGCGCCATGTGCAGCATCGGCAG3', primes MCSIG amino acid sequence, for HpARI-2 CCP3 construct) combined with vector- specific T7 (5' of insert) and BGH (3' of insert) primers.
  • the HpARI-2_mCherry fusion protein was created by cloning in a codon-optimised gene-synthesised mCherry sequence (AN045948.1) at the C-terminus of the HpARI-2 protein, using an mCherry 5' Notl site and a 3' Apal site. These constructs were sub-cloned into the pSecTAG2A expression vector (Thermo Fisher), using Ascl, Notl-HF and Apa-1 restriction enzyme digestion (New England Biolabs), followed by T4 DNA ligation (Thermo Fisher).
  • JM109 cells were transformed with ligated constructs and plasmids were midiprepped using the PureLink HiPure midiprep kit (Thermo Fisher) according to manufacturer's instructions, and Sanger sequenced. Plasmid constructs were transfected into HEK293T cells using the calcium phosphate technique (Jordan et al., 1996), using 15 ⁇ g plasmid DNA per 100 mm tissue culture dish of HEK293T cells at 20% confluency. Stable cell lines were maintained using Zeocin (Thermo Fisher) selection in DMEM medium containing 10% fetal bovine serum, 2 mM Lglutamine and 1 ⁇ g ml "1 Penicillin/Streptomycin.
  • Resulting expressed proteins secreted to the medium contained C-terminal myc and 6-His tags.
  • transfected cells were transferred to 293 SFM II media (Thermo Fisher) and protein purified from supernatant by nickel affinity chromatography using HiTrap chelating HP or HisTRAP excel columns (GE Healthcare), eluting bound proteins using an imidazole gradient.
  • Fractions containing pure expressed protein were pooled, dialysed into PBS, sterile-filtered and concentration assessed by absorbance at 280 nm, corrected by calculated extinction coefficient.
  • Purified proteins had an endotoxin content of below 0.5 U LPS per ⁇ g protein, as measured by the Limulus Amoebocyte Lysate assay (Lonza).
  • HpARI-2 CCP1 was modeled based upon CR2-CCP2 (PDB ID: 1 LY2) (Prota et al., 2002) (after a manual switch of Leu69 with Trp69 955 to help identify this CCP module using HHPred; note Leu/Trp substitutions exist in other experimentally- determined CCP module structures such as complement Factor H CCP10 and CCP20 (Makou et al., 2012; Morgan et al., 2012); HpARI-2 CCP2 on CSMD1- CCP3 (PDB ID: 2EHF) (RIKEN Structural Genomics/Proteomics Initiative); HpARI- 2 CCP3 on GABABR1a-CCP2 (PDB ID: 1SRZ) (Blein et al., 2004).
  • CR2-CCP2 PDB ID: 1 LY2
  • Leu/Trp substitutions exist in other experimentally- determined CCP module structures such as complement Factor H CCP10 and CCP20 (
  • the target- template alignment in each case was based upon the initial HHPred alignment, then extended to include the first Cysteine residue in each domain, realigned using ClustalX (Thompson et al., 1997), and finally subjected to manual editing to optimally position known consensus residues, secondary structure elements and gaps (Soares et al., 2005).
  • ClustalX Thimpson et al., 1997)
  • manual editing to optimally position known consensus residues, secondary structure elements and gaps
  • Alternaria models Alternaria models, lung cell preparation, flow cytometry and lung histology were carried out as previously described (McSorley et al., 2014). Alternaria allergen (25 ⁇ g) was administered intranasally with 20 ⁇ g OVA protein (Sigma) and HpARI (10 ⁇ g). In some experiments, the OVA-specific response was recalled by daily intranasal administration of 20 ⁇ g OVA protein on days 14, 15 and 16. Mice were culled 15 min, 1 h, 24 h or 17 days after the initial administration, as indicated.
  • Bronchoalveloar lavage was collected (4 lavages with 0.5 ml ice-cold PBS), followed by lung dissection for tissue digestion and single cell preparation (see below), or lungs were inflated with 10% neutral buffered formalin for histology. Formalin-fixed lungs were transferred into 70% ethanol 24 h after collection, paraffin, embedded and sectioned (5 ⁇ ), prior to staining with haemotoxylin and eosin (H&E) or Periodic Acid Schiff (PAS).
  • H&E haemotoxylin and eosin
  • PAS Periodic Acid Schiff
  • mice were anaesthetised with intraperitoneal ketamine 200 mg/kg and pentobarbitone (50 mg/kg), tracheotomised and mechanically ventillated. Lung resistance and compliance were measured in response to nebulised methacholine (Sigma).
  • human or mouse lung homogenates were prepared by homogenizing (Tissuelyser II, QIAGEN) one lung lobe (mouse) in 1 ml PBS, or 400 mg human lung tissue in 1 ml PBS.
  • Lung homogenates 100 ul or 100 ng human or murine recombinant IL-33 (Biolegend) were then mixed with 1 ⁇ g HpARI in PBS containing 100 ⁇ g/ml OVA protein, and incubated for 30 min at 37°C. Complexes were then added to coated dynabeads, incubated for 10 min at room temperature, and unbound material collected.
  • Bound material on beads was washed 3 times in PBS+0.02% PBS on a DynaMag-2 magnet, before transferring to a fresh tube and eluting bound complexes using 50 mM glycine pH 2.8 (non-denaturing), before neutralising in 1 M Tris buffer, pH 8. Eluted proteins and unbound supernatants were ran on 4-12% SDS-PAGE gels (Thermo Fisher) under non-reducing conditions, and transferred to nitrocellulose membranes for western blotting.
  • SPR Surface Plasmon Resonance
  • NTA Ni 2+ -nitrilotriacetic acid
  • HpARI-1 , HpARI-2, HpARI-3, or HpARI-2 CCP1/2 or HpARI-2 CCP2/3 truncation constructs were immobilised on an NTA sensor surface to 400 RU.
  • the on- (k+) and off-rate (k-) constants and the equilibrium dissociation constant (Kd) were calculated by global fitting all three surfaces simultaneously to a 1 :1 interaction model, with mass transport considerations, to the double reference corrected sensorgrams, using analysis software (v.2.01 , GE Healthcare) provided with the BIAcore T200 instrument.
  • Human lung explant culture Approximately 5 g of lung tissue was washed 3 times in PBS and -0.5 mm 2 tissue explants prepared using sterilized scissors. Explants were incubated in 400 ⁇ PBS+0.1 % BSA +/- 10 ⁇ g/ml HpARH , HpARI-2, or HpARI-3 in wells of a 48-well tissue culture plate (Costar) for 1 h, at 37°C, 5% CO2. Each condition was performed with 8 replicates for IL-33 measurement by ELISA, and pairs of supernatants were pooled (to make 4 replicates) for IL-33 western blot. After culture, tissue pieces were weighed, and IL-33 levels calculated relative to tissue weight.
  • Bone marrow culture A single cell suspension of bone marrow cells was
  • Bone marrow cells were cultured for 3 days at 37°C, 5% CO2, at 1x10 6 cells per well of a 96 well plate, in IL-2, IL-7 and IL-33 (all at 10 ng/ml) with HpARI2, or HpARI-2 mutants at 10 ⁇ g/ml. Levels of IL-5 and IL-13 in supernatants were then assessed by IL-5 and IL-13 ELISA (eBioscience).
  • mice infected with H. polygyrus are protected from pathology in mouse models of asthma (Wlson, 2005, J Exp Med), and that this suppression could be replicated by administration of H. polygyrus
  • HES is prepared by culturing live parasites (taken from the intestines of infected mice) in vitro and collecting all the products released (Johnston, 2015, J Vis Exp) - this preparation is a mixture of >2000 identifiable proteins (Hewitson, 2011 , J Proteomics, and our own analysis), as well as a complex array of carbohydrates (Hewitson, 2016, Int J Parasitol), lipids, vesicles and RNAs (Buck, 2015, Nat Comm).
  • HpARI-1 was the first to be fully characterised and is the subject of a an article to be published after the filing of the present application.
  • the mature secreted HpARI proteins have calculated molecular weights as
  • HpARI-1 26.3 kDa
  • HpARI-2 25.6 kDa
  • HpARI-3 25.2 kDa.
  • CCP domains are a structural scaffold used in a variety of proteins with a range of functions, from activity in the complement system, to cytokine receptors, and nerve signalling. They are defined by 4 conserved cysteine residues, as well as a Tryptophan/Leucine residue between the third and fourth cysteines.
  • each CCP module is encoded by two exons with the second exon boundary in each case falling between adjacent predicted CCP modules (i.e. between the fourth cysteine of one module and the first cysteine of the next) lending further support to the discerned domain boundaries (Figure 5).
  • An alignment of the amino acid sequences of the 3 domains of HpARI-1 , HpARI-2 and HpARI-3 is shown in Figure 6.
  • IL-33 is an "alarmin" cytokine - it is released under conditions of necrosis and tissue damage. IL-33 is stored in the nucleus of epithelial cells bound to DNA, and is released under conditions of epithelial cell necrosis. In necrosis, the cell is lysed, allowing release of the nuclear contents, and entry of proteases which cleave off the DNA-binding region of IL-33, resulting in the release of active, receptor-binding cytokine. Shortly after release (within around 15 min to 4 h) the active IL-33 cytokine is oxidised, forming new disulphide bonds and changing conformation (Cohen, 2015, Nat Comm). This oxidation renders the cytokine inactive, and incapable of binding to its receptor. Thus the activity of IL-33 is constrained to a very short physical and temporal range.
  • HpARI-2 has very high affinity for mouse IL-33.
  • HpARI-3 while having a lower affinity for mouse IL-33, has the highest affinity for human IL-33.
  • HpARI binds DNA within necrotic cells, which, in addition to the IL-33 binding of HpARI, tethers IL-33 within the dead cells, preventing IL-33 release. This mode of action is one which no antibody would be able to replicate.
  • HpARI-1 When comparing HpARI-1 , HpARI-2 and HpARI-3, we found that although all three molecules suppressed the detection of mouse IL-33 (in response to in vivo allergen administration) by ELISA (indicating binding to the cytokine, and steric hindrance of ELISA antibody binding), only HpARI-2 was able to significantly suppress the release of mouse IL-33 as measured by western blot. In contrast, HpARI-1 only shows a trend for reduction of IL-33 release, and HpARI-3 shows no effect ( Figure 12). Thus HpARI-3 appears to have reduced "tethering" activity in this assay.
  • HpARI-2 and HpARI-3 could both suppress human IL-33 detection by ELISA (reflecting their higher affinity for the human cytokine) while again, HpARI-3 was unable to inhibit release ( Figure 13).
  • HpARI-3 has the strongest affinity for human IL-33, but has lower IL- 33 tethering activity.
  • CCP1/2 second domains
  • CCP2/3 second and third domains
  • CCP3 third domain
  • both CCP1/2 and CCP2/3 could bind to IL-33, while CCP3 could not ( Figure 14).
  • affinity of CCP1/2 for mouse IL-33 was measured by SPR, it was found to be similar to that of full-length HpARI-2 (Kd DO.5 nM). Therefore IL-33 binding appears to be mediated by the second domain of HpARI.
  • Electrostatic modelling of the first domain of HpARI-3 reveals insights into its deficiency in DNA binding - while the first domain of HpARI-2 has 2 exposed basic patches for DNA binding, the first domain of HpARI-3 has only one exposed basic patch ( Figure 17).
  • HpARI domain 2 and domain 3 contain atypical insertions - these insertions are not present in any other known CCP domain ( Figure 20A and Figure 6).
  • Mutant HpARI-2 molecules were expressed, which lacked either the atypical insertion domain 2 (CCP2 loop del) the atypical insertion in domain 3 (CCP3 loop del) or both atypical insertions (CCP2+3 loop del).
  • CCP2 loop del the atypical insertion in domain 3
  • CCP2+3 loop del both atypical insertions
  • deletion of the domain 3 atypical insertion resulted in similar tethering ability to unmodified HpARI-2 (as assessed by mlL-33 western blot - Figure 20B), while abrogated some ability to prevent detection of released IL-33 by ELISA (Figure 20C).
  • HpARI domain 2 atypical insertion is critical for IL-33 binding, and may represent an exposed IL-33 binding site. Peptides based on this atypical insertion may have activity against IL-33 in vivo. This is further supported by the lower levels of homology between the HpARI-2 and HpARI-3 second domain (note 3 missing amino acids in the HpARI-3 CCP2 atypical insertion ( Figure 6), and the differential activity of HpARI-2 and HpARI-3 for mouse and human IL-33 binding. Furthermore, as the lack of detection of IL-33 by ELISA in the presence of HpARI appears to correlate with blockade of IL-33 activity (i.e. prevention of IL-33 binding to the IL-33 receptor), we believe this data further indicates that the HpARI domain 3 atypical insertion is involved in blocking of IL-33-IL-33 receptor interactions.
  • HpARI domain 3 in blockade of IL-33 activity by culturing IL-33-responsive mouse bone marrow cells (which contain a significant proportion of ILC2s) with IL-2, IL-7 and IL-33, and HpARI-2 or truncation mutants (Figure 21).
  • IL-33-responsive mouse bone marrow cells which contain a significant proportion of ILC2s
  • HpARI-2 or truncation mutants Figure 21.
  • HpARI-2 domain 3 alone (CCP3) or domains 1 and 2 together (CCP1/2) were ineffective at blocking responses in this system.
  • HpARI-2 domains 2 and 3 had similar suppressive ability to full-length HpARI-2.
  • HpARI domain 3 in high affinity binding to IL-33 and blockade of IL-33 binding to its receptor, however clearly HpARI domain 2 is required for high affinity binding to IL-33.
  • HpARI-2 administration at day 0 suppressed BAL eosinophilia, ILC2 responses, histological changes in the lung, and airway hyperresponsiveness to methacholine (Figure 24) - all hallmark features of asthma.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un polypeptide comprenant un domaine 2 de HpARI et : - a. un domaine de liaison à l'ADN, et/ou b. un domaine 3 de HpARI, le polypeptide ayant un effet inhibiteur sur l'activité de l'IL-33. L'invention concerne en outre un acide nucléique associé, un vecteur d'expression, une cellule hôte, une composition pharmaceutique destinée à être utilisée dans la méthode de traitement, par exemple pour une utilisation dans le traitement de troubles allergiques ou inflammatoires. L'invention concerne également une méthode de traitement d'un trouble allergique ou inflammatoire, et un procédé ex vivo d'inhibition de l'IL-33, ces procédés impliquant l'utilisation du polypeptide.
PCT/GB2018/052298 2017-08-11 2018-08-13 Agent immunomodulateur WO2019030542A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1712952.9 2017-08-11
GBGB1712952.9A GB201712952D0 (en) 2017-08-11 2017-08-11 Immunomodulatory agent

Publications (1)

Publication Number Publication Date
WO2019030542A1 true WO2019030542A1 (fr) 2019-02-14

Family

ID=59896151

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2018/052298 WO2019030542A1 (fr) 2017-08-11 2018-08-13 Agent immunomodulateur

Country Status (2)

Country Link
GB (1) GB201712952D0 (fr)
WO (1) WO2019030542A1 (fr)

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4902505A (en) 1986-07-30 1990-02-20 Alkermes Chimeric peptides for neuropeptide delivery through the blood-brain barrier
US4957735A (en) 1984-06-12 1990-09-18 The University Of Tennessee Research Corporation Target-sensitive immunoliposomes- preparation and characterization
US5004697A (en) 1987-08-17 1991-04-02 Univ. Of Ca Cationized antibodies for delivery through the blood-brain barrier
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US5055303A (en) 1989-01-31 1991-10-08 Kv Pharmaceutical Company Solid controlled release bioadherent emulsions
US5188837A (en) 1989-11-13 1993-02-23 Nova Pharmaceutical Corporation Lipsopheres for controlled delivery of substances
US5254342A (en) 1991-09-30 1993-10-19 University Of Southern California Compositions and methods for enhanced transepithelial and transendothelial transport or active agents
US5268164A (en) 1990-04-23 1993-12-07 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5271961A (en) 1989-11-06 1993-12-21 Alkermes Controlled Therapeutics, Inc. Method for producing protein microspheres
US5413797A (en) 1992-03-12 1995-05-09 Alkermes Controlled Therapeutics, Inc. Controlled release ACTH containing microspheres
US5514670A (en) 1993-08-13 1996-05-07 Pharmos Corporation Submicron emulsions for delivery of peptides
US5534496A (en) 1992-07-07 1996-07-09 University Of Southern California Methods and compositions to enhance epithelial drug transport
WO2000067796A1 (fr) 1999-05-07 2000-11-16 Genentech, Inc. Traitement de maladies auto-immunes au moyen d'antagonistes se liant aux marqueurs de surface de lymphocytes b
WO2014090800A1 (fr) * 2012-12-10 2014-06-19 Vib Vzw Nouveaux inhibiteurs de l'interleukine-33
WO2017124110A1 (fr) * 2016-01-14 2017-07-20 Anaptysbio, Inc. Inhibition de réaction allergique à l'aide d'un inhibiteur d'il-33

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4957735A (en) 1984-06-12 1990-09-18 The University Of Tennessee Research Corporation Target-sensitive immunoliposomes- preparation and characterization
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US4902505A (en) 1986-07-30 1990-02-20 Alkermes Chimeric peptides for neuropeptide delivery through the blood-brain barrier
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5004697A (en) 1987-08-17 1991-04-02 Univ. Of Ca Cationized antibodies for delivery through the blood-brain barrier
US5055303A (en) 1989-01-31 1991-10-08 Kv Pharmaceutical Company Solid controlled release bioadherent emulsions
US5271961A (en) 1989-11-06 1993-12-21 Alkermes Controlled Therapeutics, Inc. Method for producing protein microspheres
US5188837A (en) 1989-11-13 1993-02-23 Nova Pharmaceutical Corporation Lipsopheres for controlled delivery of substances
US5268164A (en) 1990-04-23 1993-12-07 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5506206A (en) 1990-04-23 1996-04-09 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5254342A (en) 1991-09-30 1993-10-19 University Of Southern California Compositions and methods for enhanced transepithelial and transendothelial transport or active agents
US5413797A (en) 1992-03-12 1995-05-09 Alkermes Controlled Therapeutics, Inc. Controlled release ACTH containing microspheres
US5534496A (en) 1992-07-07 1996-07-09 University Of Southern California Methods and compositions to enhance epithelial drug transport
US5514670A (en) 1993-08-13 1996-05-07 Pharmos Corporation Submicron emulsions for delivery of peptides
WO2000067796A1 (fr) 1999-05-07 2000-11-16 Genentech, Inc. Traitement de maladies auto-immunes au moyen d'antagonistes se liant aux marqueurs de surface de lymphocytes b
WO2014090800A1 (fr) * 2012-12-10 2014-06-19 Vib Vzw Nouveaux inhibiteurs de l'interleukine-33
WO2017124110A1 (fr) * 2016-01-14 2017-07-20 Anaptysbio, Inc. Inhibition de réaction allergique à l'aide d'un inhibiteur d'il-33

Non-Patent Citations (37)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Science", 1995, MACK PUBLISHING COMPANY
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10
BANGA, A. J.: "Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems", 1995, TECHNOMIC PUBLISHING COMPANY, INC.
BEN-BASSAT ET AL., J. BACTERIOL., vol. 169, 1987, pages 751 - 7
BETAGERI ET AL.: "Liposome Drug Delivery Systems", 1993, TECHNOMIC PUBLISHING CO., INC.
BUCK, NAT COMM, 2014
BUCK, NAT COMM, 2015
CORPET ET AL., NUC. ACIDS RES., vol. 16, 1988, pages 10881 - 90
DATABASE UniParc [online] 6 April 2016 (2016-04-06), XP002784878, retrieved from UniProt Database accession no. UPI0007A14C22 *
H J MCSORLEY ET AL: "Blockade of IL-33 release and suppression of type 2 innate lymphoid cell responses by helminth secreted products in airway allergy", MUCOSAL IMMUNOLOGY, vol. 7, no. 5, 5 February 2014 (2014-02-05), US, pages 1068 - 1078, XP055507801, ISSN: 1933-0219, DOI: 10.1038/mi.2013.123 *
HANCOCK; ARMSTRONG, COMPUT. APPL. BIOSCI., vol. 10, 1994, pages 67 - 70
HEWITSON, INT J PARASITOL, 2016
HEWITSON, J PROTEOMICS, 2011
HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 3
HIGGINS; SHARP, GENE, vol. 73, 1988, pages 23744
HOCHULI ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1321 - 5
HUANG ET AL., COMPUTER APPLS. IN THE BIOSCIENCES, vol. 8, 1992, pages 155 - 65
IJNTEMA ET AL., INT. J. PHARM., vol. 112, 1994, pages 215 - 224
JOHNSTON ET AL., PHARM. RES., vol. 9, 1992, pages 425 - 434
JOHNSTON, J VIS EXP, 2015
KREUTER, J.: "Colloidal Drug Delivery Systems", 1994, MARCEL DEKKER, INC., pages: 219 - 342
LANGER, ACCOUNTS CHEM. RES., vol. 26, 1993, pages 537 - 542
LEE, NUCLEIC ACIDS RESEARCH, 2016
MCSORLEY, EXP PARASITOL, 2015
MCSORLEY, MUCOSAL IMMUNOL, 2014
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
O'REGAN ET AL., GENE, vol. 77, 1989, pages 237 - 51
PEARSON ET AL., METH MOL. BIO., vol. 24, 1994, pages 307 - 31
PEARSON; LIPMAN, PROC. NAT. ACAD SCI. USA, 1988
PEC ET AL., J. PARENT. SCI. TECH., vol. 44, no. 2, 1990, pages 58 - 65
SAHIN-TOTH ET AL., PROTEIN SCI., vol. 3, 1994, pages 240 - 7
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR
SMITH, CHEM SCI, 2016
SMITH; WATERMAN: "2", ADV. APPL. MATH., 1981, pages 482
TICE; TABIBI: "Treatise on Controlled Drug Delivery, A. Kydonieus", 1992, MARCEL DEKKER, INC., pages: 315 - 339
WILSON, J EXP MED, 2005
WUHAO LIN ET AL: "Parasites and asthma", PARASITOLOGY RESEARCH, vol. 116, no. 9, 8 July 2017 (2017-07-08), Springer Verlag, Berlin DE, pages 2373 - 2383, XP036294029, ISSN: 0932-0113, [retrieved on 20170708], DOI: 10.1007/S00436-017-5548-1 *

Also Published As

Publication number Publication date
GB201712952D0 (en) 2017-09-27

Similar Documents

Publication Publication Date Title
JP7503794B2 (ja) インターロイキン－２のスーパーアンタゴニスト、パーシャルアゴニスト及びアンタゴニスト
AU2015232352B2 (en) Antibody-fynomer conjugates
US9611307B2 (en) Method for increasing granulocyte number in a patient by administering superactive IL-33 fragments
JP6216772B2 (ja) 抗ｂａｆｆ−抗ｉｌ−１７二重特異性抗体
KR20140129163A (ko) 인간 보체 c5에 결합하는 폴리펩티드
JP2002526073A (ja) 新規のヒト生長分化因子のコード配列、そのｄｎａ配列によりコードされるポリペプチド、およびこれらの製造方法。
KR20160102039A (ko) 인간 fgfr2b 세포외 도메인 및 이의 코딩을 위한 핵산
Xu et al. A native-like bispecific antibody suppresses the inflammatory cytokine response by simultaneously neutralizing tumor necrosis factor-alpha and interleukin-17A
CA3060336A1 (fr) Polypeptides de coversine depourvus de liaison c5
JP2007510403A (ja) ケモカイン変異体の治療への使用
JP2010507382A (ja) Ｉｌ−２１変異体
KR101243951B1 (ko) 가용성 종양 괴사 인자 수용체 돌연변이
EP2621510A2 (fr) Agent anticancéreux
GB2526898A (en) Biological materials and therapeutic uses thereof
JP2017508446A (ja) 二機能性融合タンパク質及びその製造方法並びに使用
WO2019030542A1 (fr) Agent immunomodulateur
JP2022161922A (ja) 創傷治癒ペプチド
CN108295242B (zh) 用于预防和/或治疗银屑病药物组合物、cd317胞外段蛋白的应用
KR20220137876A (ko) 조직 재생의 촉진에 유용한 hmgb1과 관련된 폴리펩티드, 이를 포함하는 조성물, 및 이들의 용도
CN109529040B (zh) LGR4和R-spondin结合抑制剂及其在肿瘤治疗中的用途
JP6416480B2 (ja) 関節リウマチまたはその関連疾患の予防または治療剤
JP2023526218A (ja) 生体高分子標的特異的補体阻害剤及びその製造方法と応用
WO2016011003A1 (fr) Protéines hybrides comprenant les récepteurs de type ii et de type iii du tgfβ
CA2343719C (fr) Nouvelle sequence codant pour le facteur de croissance derive de l'hepatome humain et polypeptide code par cette sequence d'adn, et procede de production de ceux-ci
JP7375163B2 (ja) Ｔｇｆ－ベータトラップ

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18758951

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18758951

Country of ref document: EP

Kind code of ref document: A1