WO2019006007A1 - POSOLOGICAL REGIMES FOR ANTI-TIM3 ANTIBODIES AND USES THEREOF - Google Patents
POSOLOGICAL REGIMES FOR ANTI-TIM3 ANTIBODIES AND USES THEREOF Download PDFInfo
- Publication number
- WO2019006007A1 WO2019006007A1 PCT/US2018/039825 US2018039825W WO2019006007A1 WO 2019006007 A1 WO2019006007 A1 WO 2019006007A1 US 2018039825 W US2018039825 W US 2018039825W WO 2019006007 A1 WO2019006007 A1 WO 2019006007A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody molecule
- seq
- cancer
- amino acid
- tim
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001111—Immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
- A61K2039/507—Comprising a combination of two or more separate antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
Definitions
- Thl cells Activation of naive CD4+ T helper cells results in the development of at least two distinct effector populations, Thl cells and Th2 cells.
- Thl cells produce cytokines (e.g., interferon gamma, interleukin-2, tumor necrosis factor alpha, and lymphotoxin) which are commonly associated with cell-mediated immune responses against intracellular pathogens, delayed-type hypersensitivity reactions (Sher A et al.
- Th2 cells produce cytokines (e.g., IL-4, IL-10, and IL-13) that are crucial for control of extracellular helminthic infections and promote atopic and allergic diseases (Sher A et al. (1992) Annu Rev Immunol 10:385-409).
- cytokines e.g., IL-4, IL-10, and IL-13
- the Thl and Th2 cells cross-regulate each other' s expansion and functions.
- preferential induction of Th2 cells inhibits autoimmune diseases (Kuchroo V K et al. (1995) Cell
- ⁇ -3 is a transmembrane receptor protein that is expressed, e.g., on Thl (T helper 1) CD4+ cells and cytotoxic CD8+ T cells that secrete IFN- ⁇ .
- TIM-3 is generally not expressed on naive T cells but rather upregulated on activated, effector T cells.
- TIM-3 has a role in regulating immunity and tolerance in vivo (see Hastings et al. , Eur J Immunol. 2009; 39(9):2492-501). Therefore, the need exits for novel therapeutic approaches that regulate TIM-3 functions and the functions of TIM-3 expressing cells, including dosage regimens and formulations for anti-TIM-3 antibody molecules to treat diseases, such as cancer.
- antibody molecules e.g., humanized antibody molecules
- TIM-3 T-cell immunoglobulin domain and mucin domain 3
- Pharmaceutical compositions and dose formulations comprising the anti- ⁇ -3 antibody molecules are also provided.
- the anti-TIM-3 antibody molecules disclosed herein can be used (alone or in combination with other therapeutic agents, procedures, or modalities) to treat or prevent disorders, such as cancerous disorders (e.g., solid tumors and hematological cancers), as well as infectious diseases (e.g., chronic infectious disorders or sepsis).
- cancerous disorders e.g., solid tumors and hematological cancers
- infectious diseases e.g., chronic infectious disorders or sepsis
- methods, including dosage regimens, for treating various disorders using the anti-TIM-3 antibody molecules are disclosed herein.
- the anti-TIM-3 antibody molecule is administered or used at a flat or fixed dose.
- the disclosure features a method of treating (e.g., inhibiting, reducing, ameliorating, or preventing) a disorder, e.g., a hyperproliferative condition or disorder (e.g., a cancer) in a subject.
- the method includes administering to the subject an anti-TIM-3 antibody molecule, e.g., an anti-TIM-3 antibody molecule described herein, at a dose of about 10 mg to about 50 mg, about 50 mg to about 100 mg, about 200 mg to about 300 mg, about 500 mg to about 1000 mg, or about 1000 mg to about 1500 mg, once every two or every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg once every two or once every four weeks. In other embodiments, the anti-TIM- 3 antibody molecule is administered at a dose of about 50 mg to about 100 mg once every two or four weeks. In other embodiments, the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg once every two or every four weeks. In other embodiments, the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg once every two or four weeks. In other embodiments, the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to about 1500 mg once every two or every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 5 mg to about 50 mg, e.g., about 8 mg to about 40 mg, about 10 mg to about 30 mg, about 15 mg to about 35 mg, about 15 mg to about 25 mg, about 5 mg to about 25 mg, about 25 mg to about 50 mg, e.g., about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, or about 40 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 30 mg, e.g., about 20 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to about 100 mg, e.g., about 60 mg to about 100 mg, about 70 mg to about 90 mg, about 75 mg to about 85 mg, about 50 mg to about 60 mg, about 50 mg to about 80 mg, about 80 mg to about 100 mg, about 60 mg to about 100 mg, e.g. , about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg, e.g., about 80 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to about 100 mg, e.g., about 60 mg to about 100 mg, about 70 mg to about 90 mg, about 75 mg to about 85 mg, about 50 mg to about 60 mg, about 50 mg to about 80 mg, about 80 mg to about 100 mg, about 60 mg to about 100 mg, e.g. , about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg, e.g., about 80 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about
- the anti-TIM-3 antibody molecule is administered at a dose of about 220 mg to about 260 mg, e.g., about 240 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg, e.g., about 200 mg to about 280 mg, about 200 mg to about 250 mg, about 210 mg to about 270 mg, about 220 mg to about 260 mg, about 230 mg to about 250 mg, about 200 mg to about 220 mg, about 200 mg to about 240 mg, about 200 mg to about 260 mg, about 200 mg to about 280 mg, about 280 to about 300 mg, about 260 to about 300 mg, about 240 to about 300 mg, about 220 to about 300 mg, e.g., about 200 mg, about 240 mg, about 260 mg, about 280 mg, or about 300 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 220 mg to about 260 mg, e.g., about 240 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg, e.g., about 600 mg to about 1000 mg, about 700 mg to about 900 mg, about 750 mg to about 850 mg, about 500 mg to about 600 mg, about 500 mg to about 800 mg, about 800 mg to about 1000 mg, about 600 mg to about 1000 mg, e.g., about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1000 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 600 mg to about 1000 mg, e.g., about 800 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg, e.g., about 600 mg to about 1000 mg, about 700 mg to about 900 mg, about 750 mg to about 850 mg, about 500 mg to about 600 mg, about 500 mg to about 800 mg, about 800 mg to about 1000 mg, about 600 mg to about 1000 mg, e.g., about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1000 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 600 mg to about 1000 mg, e.g., about 800 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to about 1500 mg, e.g., about 1000 mg to about 1400 mg, about 1100 mg to about 1300 mg, about 1000 mg to about 1200 mg, about 1000 mg to about 1400 mg, about 1300 mg to about 1500 mg, about 1100 mg to about 1500 mg, about 1200 mg to about 1400 mg, about 1000 mg to about 1300 mg, about 1100 mg to about 1400 mg, about 1200 mg to about 1500 mg, e.g., about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, or about 1500 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1100 mg to about 1300 mg, e.g., about 1200 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to about 1500 mg, e.g., about 1000 mg to about 1400 mg, about 1100 mg to about 1300 mg, about 1000 mg to about 1200 mg, about 1000 mg to about 1400 mg, about 1300 mg to about 1500 mg, about 1100 mg to about 1500 mg, about 1200 mg to about 1400 mg, about 1000 mg to about 1300 mg, about 1100 mg to about 1400 mg, about 1200 mg to about 1500 mg, e.g., about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, or about 1500 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1100 mg to about 1300 mg, e.g., about 1200 mg, once every four weeks.
- the disorder is a cancer, e.g., a cancer described herein.
- the cancer is a solid tumor.
- the cancer is an ovarian cancer.
- the cancer is a lung cancer, e.g., a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC).
- SCLC small cell lung cancer
- NSCLC non-small cell lung cancer
- the cancer is a mesothelioma.
- the cancer is a skin cancer, e.g., a Merkel cell carcinoma or a melanoma.
- the cancer is a kidney cancer, e.g., a renal cell carcinoma (RCC).
- RRCC renal cell carcinoma
- the cancer is a bladder cancer.
- the cancer is a soft tissue sarcoma, e.g., a hemangiopericytoma (HPC).
- the cancer is a bone cancer, e.g., a bone sarcoma.
- the cancer is a colorectal cancer.
- the cancer is a pancreatic cancer.
- the cancer is a nasopharyngeal cancer.
- the cancer is a breast cancer.
- the cancer is a duodenal cancer.
- the cancer is an endometrial cancer.
- the cancer is an adenocarcinoma, e.g., an unknown adenocarcinoma.
- the cancer is a liver cancer, e.g., a hepatocellular carcinoma.
- the cancer is a cholangiocarcinoma.
- the cancer is a sarcoma.
- the cancer is a
- MDS myelodysplasia syndrome
- the cancer is a hematological cancer.
- the cancer is a leukemia (e.g., an acute myeloid leukemia (AML), e.g., a relapsed or refractory AML or a de novo AML).
- AML acute myeloid leukemia
- the cancer is a lymphoma.
- the cancer is a myeloma.
- the cancer is an MSI-high cancer. In some embodiments, the cancer is a metastatic cancer. In other embodiments, the cancer is an advanced cancer. In other embodiments, the cancer is a relapsed or refractory cancer.
- the anti-TIM-3 antibody molecule is administered by injection (e.g., intravenously or subcutaneously) at a dose (e.g., a flat dose) of about 10 mg to about 30 mg (e.g., about 20 mg), about 50 mg to about 100 mg (e.g., about 80 mg), about 200 mg to about 300 mg (e.g., about 240 mg), about 500 mg to about 1000 mg (e.g., about 800 mg), or about 1000 mg to about 1500 mg (e.g., about 1200 mg).
- the dosing schedule (e.g., flat dosing schedule) can vary from e.g. , once two weeks to once every four weeks.
- the anti-TIM-3 antibody molecule is administered intravenously at a dose from about 10 mg to about 30 mg (e.g. , about 20 mg) once every two weeks or once every four weeks. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose from about 60 mg to 100 mg (e.g., about 80 mg) once every two weeks or once every four weeks. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose from about 200 mg to about 300 mg (e.g., about 240 mg) once every two weeks or once every four weeks. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose from about 500 mg to about 1000 mg (e.g.
- the anti-TIM-3 antibody molecule is administered intravenously at a dose from about 1000 mg to about 1500 mg (e.g., about 1200 mg) once every two weeks or once every four weeks.
- the anti-TIM-3 antibody molecule is administered intravenously at a dose of about 20 mg once every two weeks or once every four weeks to treat a cancer disclosed herein. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose of about 80 mg once every two weeks or once every four weeks to treat a cancer disclosed herein. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose of about 240 mg once every two weeks or once every four weeks to treat a cancer disclosed herein. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose of about 800 mg once every two weeks or once every four weeks to treat a cancer disclosed herein. In one embodiment, the anti-TIM-3 antibody molecule is administered intravenously at a dose of about 1200 mg once every two weeks or once every four weeks to treat a cancer disclosed herein.
- the method further comprises administering to the subject a PD-1 inhibitor (e.g., an anti-PD-1 antibody molecule described herein) or a PD-Ll inhibitor (e.g., an anti- PD-L1 antibody molecule described herein).
- the subject is administered with an anti-PD-1 antibody molecule at a dose of about 200 mg to about 500 mg, e.g., about 200 mg to about 300 mg or about 300 mg to about 500 mg, once every four weeks or once every eight weeks.
- the subject is administered with an anti-PD-1 antibody molecule at a dose of about 240 mg once every four weeks.
- the subject is administered with an anti- PD-1 antibody molecule at a dose of about 400 mg once every four weeks.
- the subject is administered with an anti-PD-1 antibody molecule at a dose of about 400 mg once every eight weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg (e.g., 20 mg) once every two weeks and the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg (e.g., 20 mg) once every two weeks and the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg (e.g., about 80 mg) once every two weeks and the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g., about 240 mg) once every two weeks and the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg (e.g., about 800 mg) once every two weeks and the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks.
- the method further comprises administering to the subject a
- hypomethylating agent e.g., decitabine
- the subject is administered the hypomethylating agent or decitabine at a dose of about 10 mg/m 2 to about 60 mg/m 2 , e.g., about 10 mg/m 2 to about 50 mg/m 2 or about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the subject is administered the hypomethylating agent or decitabine at a dose of about 20 mg/m 2 every four weeks, e.g., on days 1-5.
- the method comprises administering to the subject an anti-TIM-3 antibody molecule (e.g. , an anti-TIM-3 antibody molecule described herein) and a hypomethylating agent (e.g. , decitabine).
- an anti-TIM-3 antibody molecule e.g. , an anti-TIM-3 antibody molecule described herein
- a hypomethylating agent e.g. , decitabine
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg (e.g., about 80 mg) once every two weeks and the hypomethylating agent (e.g., decitabine) is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g., about 240 mg) once every two weeks and the hypomethylating agent (e.g., decitabine) is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the anti- ⁇ -3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg (e.g., about 800 mg) once every two weeks and the hypomethylating agent (e.g., decitabine) is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to 1500 mg (e.g., about 1200 mg) once every two weeks and the hypomethylating agent (e.g., decitabine) is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the hypomethylating agent e.g., decitabine
- the method comprises administering to the subject an anti-TIM-3 antibody molecule (e.g. , an anti-TIM-3 antibody molecule described herein), a PD-1 inhibitor (e.g. , an anti-PD-1 antibody molecule described herein), and a hypomethylating agent (e.g., decitabine).
- an anti-TIM-3 antibody molecule e.g. , an anti-TIM-3 antibody molecule described herein
- a PD-1 inhibitor e.g. , an anti-PD-1 antibody molecule described herein
- a hypomethylating agent e.g., decitabine
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg (e.g., about 20 mg) once every two weeks
- the PD- 1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks
- the hypomethylating agent e.g.
- decitabine is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g. , about 20 mg/m 2 ) every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg (e.g., about 20 mg) once every two weeks
- the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks
- the hypomethylating agent e.g., decitabine
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg (e.g. , about 80 mg) once every two weeks, the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks, and the hypomethylating agent (e.g. , decitabine) is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g.
- the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks, and the hypomethylating agent (e.g., decitabine) is administered at a dose of about 10 mg/m 2 to about 30 mg/m 2 (e.g., about 20 mg/m 2 ) every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg (e.g., about 800 mg) once every two weeks
- the PD-1 inhibitor is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks
- the hypomethylating agent e.g. , decitabine
- the anti-TIM-3 antibody molecule is used to treat an acute myeloid leukemia (AML) or a myelodysplasia syndrome (MDS), e.g. , in accordance with a dosing schedule described herein.
- AML acute myeloid leukemia
- MDS myelodysplasia syndrome
- the subject has not been treated with a PD-1 or PD-L1 therapy prior to receiving the anti-TIM-3 antibody molecule. In other embodiments, the subject has been treated with a with a PD-1 or PD-L1 therapy prior to receiving the anti-TIM-3 antibody molecule.
- the subject has, or is identified as having, TIM-3 expression in tumor- infiltrating lymphocytes (TILs).
- TILs tumor- infiltrating lymphocytes
- the disclosure features a method of reducing an activity (e.g., growth, survival, or viability, or all), of a hyperproliferative (e.g., a cancer) cell.
- the method includes contacting the cell with an anti-TIM-3 antibody molecule, e.g., an anti-TIM-3 antibody molecule described herein.
- the method can be performed in a subject, e.g., as part of a therapeutic protocol, e.g., at a dose of about 10 mg to about 50 mg (e.g., about 20 mg), about 50 mg to about 100 mg (e.g., about 80 mg), about 200 mg to about 300 mg (e.g., about 240 mg), about 500 mg to about 1000 mg (e.g., about 800 mg), or about 1000 mg to about 1500 mg (e.g., about 1200 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks.
- a dose of about 10 mg to about 50 mg (e.g., about 20 mg), about 50 mg to about 100 mg (e.g., about 80 mg), about 200 mg to about 300 mg (e.g., about 240 mg), about 500 mg to about 1000 mg (e.g., about 800 mg), or about 1000 mg to about 1500 mg (e.g., about 1200 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks
- the dose is about 10 mg to about 50 mg (e.g. , about 20 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks. In certain embodiments, the dose is about 50 mg to 100 mg (e.g. , about 80 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks. In other embodiments, the dose is about 200 mg to about 300 mg (e.g., about 240 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks. In other embodiments, the dose is about 500 mg to about 1000 mg (e.g., about 800 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks.
- the dose is about 1000 mg to about 1500 mg (e.g., about 1200 mg) of an anti-TIM-3 antibody molecule once every two weeks or once every four weeks. In certain embodiments, the dose is about 20 mg of an anti-TIM-3 antibody molecule once every two weeks. In certain embodiments, the dose is about 80 mg of an anti-TIM-3 antibody molecule once every two weeks. In other embodiments, the dose is about 240 mg of an anti-TIM-3 antibody molecule once every two weeks. In other embodiments, the dose is about 800 mg of an anti-TIM-3 antibody molecule once every two weeks. In other embodiments, the dose is about 1200 mg of an anti-TIM-3 antibody molecule once every two weeks.
- the dose is about 80 mg of an anti-TIM-3 antibody molecule once every four weeks. In other embodiments, the dose is about 240 mg of an anti-TIM-3 antibody molecule once every four weeks. In other embodiments, the dose is about 800 mg of an anti-TIM-3 antibody molecule once every four weeks. In other embodiments, the dose is about 1200 mg of an anti-TIM-3 antibody molecule once every four weeks.
- the cancer cell can be, e.g., a cell from a cancer described herein, such as a solid tumor or a hematological cancer, e.g., an ovarian cancer, a lung cancer (e.g. , a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC)), a mesothelioma, a skin cancer (e.g., a Merkel cell carcinoma (MCC) or a melanoma), a kidney cancer (e.g. , a renal cell carcinoma), a bladder cancer, a soft tissue sarcoma (e.g., a hemangiopericytoma (HPC)), a bone cancer (e.g.
- a cancer described herein such as a solid tumor or a hematological cancer, e.g., an ovarian cancer, a lung cancer (e.g. , a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSC
- a bone sarcoma a colorectal cancer, a pancreatic cancer, a nasopharyngeal cancer, a breast cancer, a duodenal cancer, an endometrial cancer, an adenocarcinoma (an unknown adenocarcinoma), a liver cancer (e.g., a hepatocellular carcinoma), a cholangiocarcinoma, a sarcoma, a myelodysplasia syndrome (MDS) (e.g., a high risk MDS), a leukemia (e.g., an acute myeloid leukemia (AML), e.g.
- AML acute myeloid leukemia
- the cancer is an ovarian cancer.
- the cancer is a lung cancer, e.g. , a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC).
- SCLC small cell lung cancer
- NSCLC non-small cell lung cancer
- the cancer is a mesothelioma.
- the cancer is a skin cancer, e.g., a Merkel cell carcinoma or a melanoma.
- the cancer is a kidney cancer, e.g., a renal cell carcinoma.
- the cancer is a bladder cancer.
- the cancer is a soft tissue sarcoma, e.g. , a hemangiopericytoma (HPC).
- the cancer is a bone cancer, e.g., a bone sarcoma.
- the cancer is a colorectal cancer.
- the cancer is a pancreatic cancer.
- the cancer is a nasopharyngeal cancer.
- the cancer is a breast cancer.
- the cancer is a duodenal cancer.
- the cancer is an endometrial cancer.
- the cancer is an adenocarcinoma, e.g., an unknown adenocarcinoma.
- the cancer is a liver cancer, e.g. , a hepatocellular carcinoma.
- the cancer is a cholangiocarcinoma.
- the cancer is a sarcoma.
- the cancer is a myelodysplasia syndrome (MDS) (e.g. , a high risk MDS).
- MDS myelodysplasia syndrome
- the cancer is a leukemia (e.g., an acute myeloid leukemia (AML), e.g.
- the cancer is a lymphoma. In other embodiments, the cancer is a myeloma. In other embodiments, the cancer is an MSI-high cancer. In some embodiments, the cancer is a metastatic cancer. In other embodiments, the cancer is an advanced cancer. In other embodiments, the cancer is a relapsed or refractory cancer.
- the method further includes determining the level of TIM-3 expression in tumor infiltrating lymphocytes (TILs) in the subject.
- TILs tumor infiltrating lymphocytes
- the level of TIM-3 expression is determined in a sample (e.g., a tumor biopsy) acquired from the subject (e.g., using immunohistochemistry).
- the anti-TIM-3 antibody molecule is administered.
- the detection steps can also be used, e.g., to monitor the effectiveness of a therapeutic agent described herein. For example, the detection step can be used to monitor the effectiveness of the anti-TIM-3 antibody molecule.
- the disclosure features a composition (e.g., one or more compositions or dosage forms), that includes an anti-TIM-3 antibody molecule (e.g., an anti-TIM-3 antibody molecule as described herein).
- a composition e.g., one or more compositions or dosage forms
- an anti-TIM-3 antibody molecule e.g., an anti-TIM-3 antibody molecule as described herein.
- Formulations, e.g., dosage formulations, and kits, e.g., therapeutic kits, that include an anti-TIM-3 antibody molecule (e.g., an anti-TIM-3 antibody molecule as described herein) are also described herein.
- the composition or formulation comprises about 10 mg to about 50 mg (e.g., about 20 mg), about 60 mg to about 100 mg (e.g.
- the composition or formulation is administered or used once every two weeks or once every four weeks.
- the composition or formulation comprises about 20 mg, about 80 mg, about 240 mg, or about 1200 mg of an anti-TIM-3 antibody molecule (e.g., an anti-TIM-3 antibody molecule as described herein), and is administered or used once every two weeks or once every four weeks.
- the composition or formulation is used to treat a cancer, e.g., a cancer disclosed herein.
- the anti-TIM-3 antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 7 (e.g., from the heavy and light chain variable region sequences of ABTIM3-huml 1 or ABTIM3-hum03 disclosed in Table 7), or encoded by a nucleotide sequence shown in Table 7.
- the CDRs are according to the Kabat definition (e.g., as set out in Table 7).
- the CDRs are according to the Chothia definition (e.g., as set out in Table 7).
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 7, or encoded by a nucleotide sequence shown in Table 7.
- amino acid substitutions e.g., conservative amino acid substitutions
- deletions e.g., conservative amino acid substitutions
- the anti-TIM-3 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 801, a VHCDR2 amino acid sequence of SEQ ID NO: 802, and a VHCDR3 amino acid sequence of SEQ ID NO: 803; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 810, a VLCDR2 amino acid sequence of SEQ ID NO: 811, and a VLCDR3 amino acid sequence of SEQ ID NO: 812, each disclosed in Table 7.
- VH heavy chain variable region
- VL light chain variable region
- the anti-TIM-3 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 801, a VHCDR2 amino acid sequence of SEQ ID NO: 820, and a VHCDR3 amino acid sequence of SEQ ID NO: 803; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 810, a VLCDR2 amino acid sequence of SEQ ID NO: 811, and a VLCDR3 amino acid sequence of SEQ ID NO: 812, each disclosed in Table 7.
- VH heavy chain variable region
- VL light chain variable region
- the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 806, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 806. In one embodiment, the anti-TIM-3 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 816, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 816. In one embodiment, the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 822, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 822.
- the anti-TIM-3 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 826, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 826. In one embodiment, the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 806 and a VL comprising the amino acid sequence of SEQ ID NO: 816. In one embodiment, the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 822 and a VL comprising the amino acid sequence of SEQ ID NO: 826.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 807, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 807. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 817, or a nucleotide sequence at least 85%, 90%, 95%, or
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 823, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 823. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 827, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 827.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 807 and a VL encoded by the nucleotide sequence of SEQ ID NO: 817. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 823 and a VL encoded by the nucleotide sequence of SEQ ID NO: 827.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 808, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 808.
- the anti-TIM-3 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 818, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 818.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 824, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 824.
- the anti-TIM-3 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 828, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 828.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 808 and a light chain comprising the amino acid sequence of SEQ ID NO: 818.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 824 and a light chain comprising the amino acid sequence of SEQ ID NO: 828.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 809, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 809.
- the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 819, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 819.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 825, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 825. In one embodiment, the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 829, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 829. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 809 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 819. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 825 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 829.
- the anti-TIM-3 antibody molecule is TSR-022 (AnaptysBio/Tesaro). In one embodiment, the anti-TIM-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of TSR-022. In one embodiment, the anti-TIM-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of APE5137 or APE5121, e.g., as disclosed in Table 8. APE5137, APE5121, and other anti-TIM-3 antibodies are disclosed in WO 2016/161270, incorporated by reference in its entirety.
- the anti-TIM-3 antibody molecule is the antibody clone F38-2E2. In one embodiment, the anti-TIM-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of F38-2E2.
- anti-TIM-3 antibodies include those described, e.g., in WO 2016/111947, WO 2016/071448, WO 2016/144803, US 8,552, 156, US 8,841,418, and US 9, 163,087, incorporated by reference in their entirety.
- the anti-TIM-3 antibody is an antibody that competes for binding with, and/or binds to the same epitope on TIM-3 as, one of the anti-TIM-3 antibodies described herein.
- the anti-TIM-3 antibody molecules described herein can be formulated into a formulation (e.g., a dose formulation or dosage form) suitable for administration (e.g., intravenous administration) to a subject as described herein.
- a formulation e.g., a dose formulation or dosage form
- the formulation described herein can be a liquid formulation, a lyophilized formulation, or a reconstituted formulation.
- the formulation is a liquid formulation.
- the formulation e.g., liquid formulation
- the formulation comprises an anti-TIM-3 antibody molecule (e.g. , an anti-TIM-3 antibody molecule described herein) and a buffering agent.
- the formulation (e.g., liquid formulation) comprises an anti-TIM-3 antibody molecule present at a concentration of 25 mg/mL to 250 mg/mL, e.g., 50 mg/mL to 200 mg/mL, 60 mg/mL to 180 mg/mL, 70 mg/mL to 150 mg/mL, 80 mg/mL to 120 mg/mL, 90 mg/mL to 110 mg/mL, 50 mg/mL to 150 mg/mL, 50 mg/mL to 100 mg/mL, 150 mg/mL to 200 mg/mL, or 100 mg/mL to 200 mg/mL, e.g., 50 mg/mL, 60 mg/mL, 70 mg/mL, 80 mg/mL, 90 mg/mL, 100 mg/mL, 110 mg/mL, 120 mg/mL, 130 mg/mL, 140 mg/mL, or 150 mg/mL.
- the anti- ⁇ -3 antibody molecule is present at a concentration of 80 mg/
- the formulation (e.g., liquid formulation) comprises a buffering agent comprising histidine (e.g., a histidine buffer).
- the buffering agent e.g., histidine buffer
- the buffering agent is present at a concentration of 1 mM to 100 mM, e.g.
- the buffering agent e.g., histidine buffer
- the buffering agent is present at a concentration of 15 mM to 25 mM, e.g., 20 mM.
- the buffering agent e.g., a histidine buffer
- the formulation has a pH of 4 to 7, e.g., 5 to 6, e.g., 5, 5.5, or 6.
- the buffering agent e.g., histidine buffer
- the formulation has a pH of 5 to 6, e.g., 5.5.
- the buffering agent comprises a histidine buffer at a concentration of 15 mM to 25 mM (e.g., 20 mM) and has a pH of 5 to 6 (e.g., 5.5). In certain embodiments, the buffering agent comprises histidine and histidine-HCl.
- the formulation (e.g., liquid formulation) comprises an anti-TIM-3 antibody molecule present at a concentration of 80 to 120 mg/mL, e.g., 100 mg/mL; and a buffering agent that comprises a histidine buffer at a concentration of 15 mM to 25 mM (e.g., 20 mM), at a pH of 5 to 6 (e.g., 5.5).
- the formulation (e.g., liquid formulation) further comprises a carbohydrate.
- the carbohydrate is sucrose.
- the carbohydrate (e.g., sucrose) is present at a concentration of 50 mM to 500 mM, e.g., 100 mM to 400 mM, 150 mM to 300 mM, 180 mM to 250 mM, 200 mM to 240 mM, 210 mM to 230 mM, 100 mM to 300 mM, 100 mM to 250 mM, 100 mM to 200 mM, 100 mM to 150 mM, 300 mM to 400 mM, 200 mM to 400 mM, or 100 mM to 400 mM, e.g., 100 mM, 150 mM, 180 mM, 200 mM, 220 mM, 250 mM, 300 mM, 350 mM, or 400 mM.
- carbohydrate or sucrose present at a concentration of 200 mM to 250 mM, e.g., 220 mM.
- the formulation (e.g., liquid formulation) comprises an anti-TIM-3 antibody molecule present at a concentration of 80 to 120 mg/mL, e.g., 100 mg/mL; a buffering agent that comprises a histidine buffer at a concentration of 15 mM to 25 mM (e.g. , 20 mM); and a carbohydrate or sucrose present at a concentration of 200 mM to 250 mM, e.g., 220 mM, at a pH of 5 to 6 (e.g., 5.5).
- a buffering agent that comprises a histidine buffer at a concentration of 15 mM to 25 mM (e.g. , 20 mM)
- a carbohydrate or sucrose present at a concentration of 200 mM to 250 mM, e.g., 220 mM, at a pH of 5 to 6 (e.g., 5.5).
- the formulation (e.g., liquid formulation) further comprises a surfactant.
- the surfactant is polysorbate 20.
- the surfactant or polysorbate 20) is present at a concentration of 0.005 % to 0.1% (w/w), e.g., 0.01% to 0.08%, 0.02% to 0.06%, 0.03% to 0.05%, 0.01 % to 0.06%, 0.01% to 0.05%, 0.01% to 0.03%, 0.06% to 0.08%, 0.04% to 0.08%, or 0.02% to 0.08% (w/w), e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w).
- the formulation comprises a surfactant or polysorbate 20 present at a concentration of 0.03% to 0.05%, e.g., 0.04% (w/w).
- the formulation (e.g., liquid formulation) comprises an anti-TIM-3 antibody molecule present at a concentration of 80 to 120 mg/mL, e.g., 100 mg/mL; a buffering agent that comprises a histidine buffer at a concentration of 15 mM to 25 mM (e.g. , 20 mM); a carbohydrate or sucrose present at a concentration of 200 mM to 250 mM, e.g., 220 mM; and a surfactant or polysorbate 20 present at a concentration of 0.03% to 0.05%, e.g., 0.04% (w/w), at a pH of 5 to 6 (e.g., 5.5).
- a buffering agent that comprises a histidine buffer at a concentration of 15 mM to 25 mM (e.g. , 20 mM)
- a carbohydrate or sucrose present at a concentration of 200 mM to 250 mM, e.g., 220 m
- the formulation (e.g., liquid formulation) comprises an anti-TIM-3 antibody molecule present at a concentration of 100 mg/mL; a buffering agent that comprises a histidine buffer (e.g., histidine/histidine-HCL) at a concentration of 20 mM); a carbohydrate or sucrose present at a concentration of 220 mM; and a surfactant or polysorbate 20 present at a concentration of 0.04% (w/w), at a pH of 5 to 6 (e.g., 5.5).
- a buffering agent that comprises a histidine buffer (e.g., histidine/histidine-HCL) at a concentration of 20 mM); a carbohydrate or sucrose present at a concentration of 220 mM; and a surfactant or polysorbate 20 present at a concentration of 0.04% (w/w), at a pH of 5 to 6 (e.g., 5.5).
- a formulation described herein can be stored in a container.
- the container used for any of the formulations described herein can include, e.g., a vial, and optionally, a stopper, a cap, or both.
- the vial is a glass vial, e.g., a 6R white glass vial.
- the stopper is a rubber stopper, e.g., a grey rubber stopper.
- the cap is a flip-off cap, e.g., an aluminum flip-off cap.
- the container comprises a 6R white glass vial, a grey rubber stopper, and an aluminum flip-off cap.
- the container e.g., vial
- the container is for a single-use container.
- 25 mg/mL to 250 mg/mL e.g., 50 mg/mL to 200 mg/mL, 60 mg/mL to 180 mg/mL, 70 mg/mL to 150 mg/mL, 80 mg/mL to 120 mg/mL, 90 mg/mL to 110 mg/mL, 50 mg/mL to 150 mg/mL, 50 mg/mL to 100 mg/mL, 150 mg/mL to 200 mg/mL, or 100 mg/mL to 200 mg/mL, e.g., 50 mg/mL, 60 mg/mL, 70 mg/mL, 80 mg/mL, 90 mg/mL, 100 mg/mL, 110 mg/mL, 120 mg/mL, 130 mg/mL, 140 mg/mL, or 150 mg/mL, of the anti-TIM-3 antibody molecule, is present in the container (e.g., vial).
- the disclosure features therapeutic kits that include the anti-TIM-3 antibody molecules, compositions, or formulations described herein, and instructions for use, e.g., in accordance with dosage regimens described herein.
- the anti-TIM-3 antibody molecules described herein can inhibit, reduce, or neutralize one or more activities of TIM-3, resulting in blockade or reduction of an immune checkpoint.
- the anti- ⁇ -3 antibody molecules described herein can be used to treat or prevent disorders (e.g. , cancer), where enhancing an immune response in a subject is desired.
- a method of modulating an immune response in a subject comprises administering to the subject an anti-TIM-3 antibody molecule described herein in accordance with a dosage regimen described herein, alone or in combination with one or more therapeutic agents, procedures, or modalities, such that the immune response in the subject is modulated.
- the antibody molecule enhances, stimulates or increases the immune response in the subject.
- the subject can be a mammal, e.g., a primate, preferably a higher primate, e.g., a human (e.g., a patient having, or at risk of having, a disorder described herein).
- the subject is in need of enhancing an immune response.
- the subject has, or is at risk of, having a disorder described herein, e.g., a cancer or an infectious disorder as described herein.
- the subject is, or is at risk of being,
- the subject is undergoing or has undergone a chemotherapeutic treatment and/or radiation therapy.
- the subject is, or is at risk of being, immunocompromised as a result of an infection.
- a method of treating e.g., one or more of reducing, inhibiting, or delaying progression
- the method comprises administering to the subject an anti-TIM-3 antibody molecule described herein in accordance with a dosage regimen described herein, alone or in combination with one or more therapeutic agents, procedures, or modalities.
- the cancer treated with the anti-TIM-3 antibody molecule includes but is not limited to, a solid tumor, a hematological cancer (e.g., leukemia, lymphoma, myeloma, e.g., multiple myeloma), and a metastatic lesion.
- a hematological cancer e.g., leukemia, lymphoma, myeloma, e.g., multiple myeloma
- a metastatic lesion e.g., the cancer is a solid tumor.
- solid tumors include malignancies, e.g., sarcomas and carcinomas, e.g., adenocarcinomas of the various organ systems, such as those affecting the lung, breast, ovarian, lymphoid,
- gastrointestinal e.g., colon
- anal, genitals and genitourinary tract e.g., renal, urothelial, bladder cells, prostate
- pharynx e.g., CNS (e.g., brain, neural or glial cells), head and neck, skin (e.g., melanoma), and pancreas, as well as adenocarcinomas which include malignancies such as colon cancers, rectal cancer, renal cancer (e.g., renal-cell carcinoma (clear cell or non-clear cell renal cell carcinoma), liver cancer, lung cancer (e.g., non-small cell lung cancer (squamous or non-squamous non-small cell lung cancer)), cancer of the small intestine and cancer of the esophagus.
- the cancer may be at an early, intermediate, late stage or metastatic cancer.
- the cancer is chosen from a lung cancer (e.g., a non-small cell lung cancer (NSCLC) (e.g., a NSCLC with squamous and/or non-squamous histology, or a NSCLC adenocarcinoma), or a small cell lung cancer (SCLC)), a skin cancer (e.g., a Merkel cell carcinoma or a melanoma (e.g., an advanced melanoma)), an ovarian cancer, a mesothelioma, a bladder cancer, a soft tissue sarcoma (e.g., a hemangiopericytoma (HPC)), a bone cancer (a bone sarcoma), a kidney cancer (e.g., a renal cancer (e.g., a renal cell carcinoma)), a liver cancer (e.g., a hepatocellular carcinoma), a cholangiocarcinoma, a sarcom
- the cancer is a solid tumor. In some embodiments, the cancer is an ovarian cancer. In other embodiments, the cancer is a lung cancer, e.g. , a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC). In other embodiments, the cancer is a
- the cancer is a skin cancer, e.g. , a Merkel cell carcinoma or a melanoma.
- the cancer is a kidney cancer, e.g. , a renal cell carcinoma (RCC).
- the cancer is a bladder cancer.
- the cancer is a soft tissue sarcoma, e.g., a hemangiopericytoma (HPC).
- the cancer is a bone cancer, e.g., a bone sarcoma.
- the cancer is a colorectal cancer.
- the cancer is a pancreatic cancer.
- the cancer is a
- the cancer is a breast cancer. In other embodiments, the cancer is a duodenal cancer. In other embodiments, the cancer is an endometrial cancer. In other embodiments, the cancer is an adenocarcinoma, e.g., an unknown adenocarcinoma. In other embodiments, the cancer is a liver cancer, e.g. , a hepatocellular carcinoma. In other embodiments, the cancer is a cholangiocarcinoma. In other embodiments, the cancer is a sarcoma. In certain embodiments, the cancer is a myelodysplasia syndrome (MDS) (e.g. , a high risk MDS).
- MDS myelodysplasia syndrome
- the cancer is a hematological cancer.
- the cancer is a leukemia (e.g., an acute myeloid leukemia (AML), e.g., a relapsed or refractory AML or a de novo AML).
- AML acute myeloid leukemia
- the cancer is a lymphoma.
- the cancer is a myeloma.
- the cancer is chosen from a carcinoma (e.g., advanced or metastatic carcinoma), melanoma or a lung carcinoma, e.g., a non-small cell lung carcinoma.
- the cancer is a lung cancer, e.g., a non-small cell lung cancer or small cell lung cancer.
- the non-small cell lung cancer is a stage I (e.g., stage la or lb), stage II (e.g., stage Ila or lib), stage III (e.g., stage Ilia or Illb), or stage IV, non-small cell lung cancer.
- the cancer is a melanoma, e.g., an advanced melanoma.
- the cancer is an advanced or unresectable melanoma that does not respond to other therapies.
- the cancer is a melanoma with a BRAF mutation (e.g., a BRAF V600 mutation).
- the cancer is a hepatocarcinoma, e.g., an advanced hepatocarcinoma, with or without a viral infection, e.g., a chronic viral hepatitis.
- the cancer is a prostate cancer, e.g., an advanced prostate cancer.
- the cancer is a myeloma, e.g., multiple myeloma.
- the cancer is a renal cancer, e.g., a renal cell carcinoma (RCC) (e.g., a metastatic RCC, a non-clear cell renal cell carcinoma (nccRCC), or clear cell renal cell carcinoma (CCRCC)).
- RCC renal cell carcinoma
- nccRCC non-clear cell renal cell carcinoma
- CCRCC clear cell renal cell carcinoma
- the cancer microenvironment has an elevated level of TIM-3 expression. In one embodiment, the cancer microenvironment has an elevated level of PD-Ll expression.
- the cancer microenvironment can have increased IFNy and/or CD8 expression.
- the subject has, or is identified as having, a tumor that has one or more of high PD-Ll level or expression, or as being Tumor Infiltrating Lymphocyte (TIL)+ (e.g., as having an increased number of TILs), or both.
- TIL Tumor Infiltrating Lymphocyte
- the subject has, or is identified as having, a tumor that has high PD-Ll level or expression and that is TIL+.
- the methods described herein further include identifying a subject based on having a tumor that has one or more of high PD-Ll level or expression, or as being TIL+, or both.
- the methods described herein further include identifying a subject based on having a tumor that has high PD-Ll level or expression and as being TIL+.
- tumors that are TIL+ are positive for CD8 and IFNy.
- the subject has, or is identified as having, a high percentage of cells that are positive for one, two or more of PD-Ll, CD8, and/or IFNy.
- the subject has or is identified as having a high percentage of cells that are positive for all of PD-Ll, CD8, and IFNy.
- the methods described herein further include identifying a subject based on having a high percentage of cells that are positive for one, two or more of PD-Ll, CD8, and/or IFNy. In certain embodiments, the methods described herein further include identifying a subject based on having a high percentage of cells that are positive for all of PD-Ll, CD8, and IFNy. In some embodiments, the subject has, or is identified as having, one, two or more of PD-Ll, CD8, and/or IFNy, and one or more of a lung cancer, e.g., squamous cell lung cancer or lung
- adenocarcinoma e.g., an NSCLC
- a head and neck cancer e.g., a squamous cell cervical cancer; a stomach cancer; an esophageal cancer; a thyroid cancer (e.g., anaplastic thyroid carcinoma); a skin cancer (e.g., a Merkel cell carcinoma or a melanoma), a breast cancer (e.g., an NTBC), and/or a nasopharyngeal cancer (NPC).
- the methods described herein further describe identifying a subject based on having one, two or more of PD-Ll, CD8, and/or IFNy, and one or more of a lung cancer, e.g.
- squamous cell lung cancer or lung adenocarcinoma e.g., an NSCLC
- a head and neck cancer e.g., a squamous cell cervical cancer
- a stomach cancer e.g., a thyroid cancer (e.g., anaplastic thyroid carcinoma); a skin cancer (e.g., a Merkel cell carcinoma or a melanoma), an neuroendocrine tumor, a breast cancer (e.g., an NTBC), and/or a nasopharyngeal cancer.
- a thyroid cancer e.g., anaplastic thyroid carcinoma
- a skin cancer e.g., a Merkel cell carcinoma or a melanoma
- an neuroendocrine tumor e.g., an NTBC
- breast cancer e.g., an NTBC
- nasopharyngeal cancer e.g., a nasopharyngeal cancer.
- compositions, and formulations disclosed herein are useful for treating metastatic lesions associated with the aforementioned cancers.
- the disclosure provides a method of treating an infectious disease (e.g. , an infectious disease described herein) in a subject, comprising administering to the subject an anti-TIM- 3 antibody molecule described herein in accordance with a dosage regimen described herein.
- an infectious disease e.g. , an infectious disease described herein
- the invention provides a method of enhancing an immune response to an antigen in a subject, comprising administering to the subject: (i) the antigen; and (ii) an anti-TIM-3 antibody molecule described herein, in accordance with a dosage regimen described herein, such that an immune response to the antigen in the subject is enhanced.
- the antigen can be, for example, a tumor antigen, a viral antigen, a bacterial antigen or an antigen from a pathogen.
- the anti-TIM-3 antibody molecule described herein can be administered to the subject systemically (e.g., orally, parenterally, subcutaneously, intravenously, rectally, intramuscularly, intraperitoneally, intranasally, transdermally, or by inhalation or intracavitary installation), topically, or by application to mucous membranes, such as the nose, throat and bronchial tubes.
- the anti-TIM-3 antibody molecule is administered intravenously at a flat dose described herein.
- anti-TIM-3 antibody molecules described herein can be used in combination with other therapeutic agents, procedures or modalities.
- the methods described herein include administering to the subject a combination comprising an anti-TIM-3 antibody molecule described herein, in combination with a therapeutic agent, procedure, or modality, in an amount effective to treat or prevent a disorder.
- the anti-TIM-3 antibody molecule is administered or used in accordance with a dosage regimen described herein.
- the antibody molecule is administered or used as a composition or formulation described herein.
- the anti-TIM-3 antibody molecule and the therapeutic agent, procedure, or modality can be administered or used simultaneously or sequentially in any order. Any combination and sequence of the anti-TIM-3 antibody molecule and the therapeutic agent, procedure, or modality (e.g., as described herein) can be used.
- the antibody molecule and/or the therapeutic agent, procedure or modality can be administered or used during periods of active disorder, or during a period of remission or less active disease.
- the antibody molecule can be administered before, concurrently with, or after the treatment with the therapeutic agent, procedure or modality.
- the anti-TIM-3 antibody molecule described herein is administered in combination with one or more of other antibody molecules, chemotherapy, other anti-cancer therapy (e.g., targeted anti-cancer therapies, gene therapy, viral therapy, RNA therapy bone marrow transplantation, nanotherapy, or oncolytic drugs), cytotoxic agents, immune-based therapies (e.g., cytokines or cell-based immune therapies), surgical procedures (e.g., lumpectomy or mastectomy) or radiation procedures, or a combination of any of the foregoing.
- the additional therapy may be in the form of adjuvant or neoadjuvant therapy.
- the additional therapy is an enzymatic inhibitor (e.g., a small molecule enzymatic inhibitor) or a metastatic inhibitor.
- exemplary cytotoxic agents that can be administered in combination with include antimicrotubule agents, topoisomerase inhibitors, anti-metabolites, mitotic inhibitors, alkylating agents, anthracyclines, vinca alkaloids, intercalating agents, agents capable of interfering with a signal transduction pathway, agents that promote apoptosis, proteasome inhibitors, and radiation (e.g., local or whole body irradiation (e.g., gamma irradiation).
- the additional therapy is surgery or radiation, or a combination thereof.
- the additional therapy is a therapy targeting one or more of PI3K/AKT/mTOR pathway, an HSP90 inhibitor, or a tubulin inhibitor.
- the anti-TIM-3 antibody described herein can be administered or used in combination with, one or more of: an
- immunomodulator e.g., an activator of a costimulatory molecule or an inhibitor of an inhibitory molecule, e.g., an immune checkpoint molecule
- a vaccine e.g., a therapeutic cancer vaccine
- the anti-TIM-3 molecule described herein is administered or used in combination with a modulator of a costimulatory molecule or an inhibitory molecule, e.g., a co- inhibitory ligand or receptor.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a modulator, e.g., agonist, of a costimulatory molecule.
- a modulator e.g., agonist
- the agonist of the costimulatory molecule is chosen from an agonist (e.g., an agonistic antibody or antigen-binding fragment thereof, or a soluble fusion) of OX40, CD2, CD27, CDS, ICAM- 1, LFA-1 (CD1 la/CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3 or CD83 ligand.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a GITR agonist, e.g., an anti-GITR antibody molecule.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an inhibitor of an inhibitory (or immune checkpoint) molecule chosen from PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, CEACAM (e.g., CEACAM-1, CEACAM-3, and/or
- the inhibitor is a soluble ligand (e.g., a CTLA-4-Ig), or an antibody or antibody fragment that binds to PD-1, LAG-3, PD-L1, PD-L2, or CTLA-4.
- a soluble ligand e.g., a CTLA-4-Ig
- an antibody or antibody fragment that binds to PD-1, LAG-3, PD-L1, PD-L2, or CTLA-4.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a PD-1 inhibitor, e.g., an anti-PD-1 antibody molecule.
- a PD-1 inhibitor e.g., an anti-PD-1 antibody molecule.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a LAG-3 inhibitor, e.g., an anti-LAG-3 antibody molecule.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a PD- Ll inhibitor, e.g., an anti-PD-Ll antibody molecule.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a PD-1 inhibitor (e.g. , an anti-PD-1 antibody molecule) and a LAG-3 inhibitor (e.g., an anti-LAG-3 antibody molecule).
- a PD-1 inhibitor e.g., an anti-PD-1 antibody molecule
- a PD-L1 inhibitor e.g., an anti-PD-Ll antibody molecule
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a LAG-3 inhibitor (e.g. , an anti-LAG-3 antibody molecule) and a PD-L1 inhibitor (e.g., an anti-PD-Ll antibody molecule).
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a CEACAM inhibitor (e.g., CEACAM-1, CEACAM-3, and/or CEACAM-5 inhibitor), e.g., an anti- CEACAM antibody molecule.
- a CEACAM inhibitor e.g., CEACAM-1, CEACAM-3, and/or CEACAM-5 inhibitor
- the anti-TIM-3 antibody molecule is administered or used in combination with a CEACAM-1 inhibitor, e.g., an anti- CEACAM-1 antibody molecule.
- the anti-TIM-3 antibody molecule is administered or used in combination with a CEACAM-3 inhibitor, e.g., an anti-CEACAM-3 antibody molecule.
- the anti-PD- 1 antibody molecule is administered or used in combination with a CEACAM-5 inhibitor, e.g., an anti-CEACAM-5 antibody molecule.
- the combination of antibody molecules disclosed herein can be administered separately, e.g., as separate antibody molecules, or linked, e.g., as a bispecific or trispecific antibody molecule.
- a bispecific antibody that includes an anti-TIM-3 antibody molecule and an anti-PD- 1, anti-CEACAM (e.g., anti-CEACAM-1, CEACAM-3, and/or anti-CEACAM-5), anti-PD-Ll, or anti- LAG-3 antibody molecule, is administered.
- the combination of antibodies disclosed herein is used to treat a cancer, e.g., a cancer as described herein (e.g., a solid tumor or a hematologic malignancy).
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-1 antibody molecule, e.g., nivolumab, optionally, further in combination with a VEGF inhibitor (e.g., bevacizumab), an interferon gamma, a CD27 agonist (e.g., varlilumab), an IDO inhibitor (e.g. , epacadostat), a CTLA-4 inhibitor (e.g., ipilimumab), an CSFIR inhibitor (e.g., cabiralizumab), an OX40 agonist (e.g. , BMS 986178), or a KIR inhibitor (e.g., lirilumab), or any combination thereof.
- a VEGF inhibitor e.g., bevacizumab
- an interferon gamma e.g., varlilumab
- an IDO inhibitor e.g. ,
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-1 antibody molecule, e.g., pembrolizumab, optionally, further in combination with a chemotherapy (e.g., carboplatin, paclitaxel, doxorubicin, gemcitabine, cisplatin, or azacitidine), a DNMT inhibitor (e.g., guadecitabine), a receptor tyrosine kinase inhibitor (e.g., nintedanib), a CSFIR inhibitor (e.g., pexidartinib or ARRY-382), a BTK inhibitor (e.g., acalabrutinib), a PARP inhibitor (e.g.
- a chemotherapy e.g., carboplatin, paclitaxel, doxorubicin, gemcitabine, cisplatin, or azacitidine
- a DNMT inhibitor e.g.,
- niraparib an IDO inhibitor (e.g., epacadostat), an immunoconjugate targeting FOLR1 (e.g. , mirvetuximab soravtansine), a B7-H3 inhibitor (e.g. , enoblituzumab), or any combination thereof.
- IDO inhibitor e.g., epacadostat
- an immunoconjugate targeting FOLR1 e.g. , mirvetuximab soravtansine
- a B7-H3 inhibitor e.g. , enoblituzumab
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule, e.g., atezolizumab, optionally, further in combination with an ANG2/VEGF inhibitor (e.g., vanucizumab), a CSFIR inhibitor (e.g., emactuzumab), a chemotherapy (e.g., doxorubicin or a platinum-based chemotherapy, optionally, further in combination with a VEGF inhibitor (e.g., bevacizumab)), or any combination thereof.
- an anti-PD-Ll antibody molecule e.g., atezolizumab
- an ANG2/VEGF inhibitor e.g., vanucizumab
- CSFIR inhibitor e.g., emactuzumab
- a chemotherapy e.g., doxorubicin or a platinum-based chemotherapy, optionally, further in combination with a VEGF inhibitor (e.g., bevacizum
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule, e.g., durvalumab, optionally, further in combination with a CTLA-4 inhibitor (e.g., tremelimumab), a chemotherapy (e.g. , carboplatin, paclitaxel, or azacitidine), a PARP inhibitor (e.g. , olaparib), a VEGF inhibitor (e.g., cediranib), a cancer vaccine (e.g., multi-epitope anti-folate receptor peptide vaccine TPIV 200), a TLR8 agonist (e.g., motolimod), or any combination thereof.
- CTLA-4 inhibitor e.g., tremelimumab
- a chemotherapy e.g. , carboplatin, paclitaxel, or azacitidine
- PARP inhibitor e.g. , olaparib
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule, e.g., avelumab, optionally, further in combination with a chemotherapy (e.g., carboplatin, paclitaxel, or doxorubicin), an HDAC inhibitor (e.g., entinostat), a FAK inhibitor (e.g., defactinib), or any combination thereof.
- a chemotherapy e.g., carboplatin, paclitaxel, or doxorubicin
- an HDAC inhibitor e.g., entinostat
- FAK inhibitor e.g., defactinib
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a TLR8 agonist (e.g., motolimod), a chemotherapeutic agent (e.g. , doxorubicin, paclitaxel, carboplatin, bleomycin, etoposide, docetaxel, or dasatinib), an OX40 agonist (e.g., BMS 986178 or INCAGN- 1949), a CSFIR inhibitor (e.g., emactuzumab or pexidartinib), a VEGF inhibitor (e.g.
- a TLR8 agonist e.g., motolimod
- a chemotherapeutic agent e.g. , doxorubicin, paclitaxel, carboplatin, bleomycin, etoposide, docetaxel, or dasatinib
- an OX40 agonist e.g., BMS 986178 or INCAGN-
- bevacizumab an NKG2 inhibitor (e.g., monalizumab), a B7-H3 inhibitor (e.g. , enoblituzumab), a CTLA-4 inhibitor (e.g., ipilimumab), a recombinant interleukin-10 (e.g. , pegylated recombinant human interleukin-10 AM0010), a CD40 agonist (e.g., RG-7876), an ANG2/VEGF inhibitor (e.g., vanucizumab), a molecule targeting both B7-H3 and CD3 (e.g. , MGD-009), a PD- Ll/VISTA inhibitor (e.g.
- an IDO inhibitor e.g. , epacadostat
- a vaccine e.g., ANZ-207, DPX-Survivac, CDX1401, or bi-shRNA-furin/GMCSF-expressing autologous tumor cell vaccine (VIGIL®)
- a CEACAM inhibitor e.g., MK-6018
- a PARP inhibitor e.g. , olaparib or BGB-290
- a hormone e.g., leuprorelin
- a MIF inhibitor e.g. , imalumab
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a CTLA-4 inhibitor, e.g., an anti-CTLA-4 antibody molecule (e.g., ipilimumab).
- a CTLA-4 inhibitor e.g., an anti-CTLA-4 antibody molecule (e.g., ipilimumab).
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule (e.g., avelumab).
- an anti-PD-Ll antibody molecule e.g., avelumab
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule, e.g., avelumab, optionally, further in combination with a localized radiation therapy, a recombinant interferon beta, a MCPy V TAg-specific polyclonal autologous CD8-positive T cell vaccine, or a combination thereof.
- an anti-PD-Ll antibody molecule e.g., avelumab
- a localized radiation therapy e.g., a recombinant interferon beta, a MCPy V TAg-specific polyclonal autologous CD8-positive T cell vaccine, or a combination thereof.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with a genetically engineered oncolytic virus (e.g. , Talimogene laherparepvec), optionally, further in combination with a radiation therapy.
- a genetically engineered oncolytic virus e.g. , Talimogene laherparepvec
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-1 antibody molecule (e.g., nivolumab) and/or an anti-CTLA-4 antibody molecule (e.g. , ipilimumab), optionally, further in combination with a radiation therapy (e.g., stereotactic body radiation therapy (SBRT)).
- an anti-PD-1 antibody molecule e.g., nivolumab
- an anti-CTLA-4 antibody molecule e.g. , ipilimumab
- a radiation therapy e.g., stereotactic body radiation therapy (SBRT)
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-1 antibody molecule (e.g., nivolumab) in combination with a genetically engineered oncolytic virus (e.g., Talimogene laherparepvec).
- an anti-PD-1 antibody molecule e.g., nivolumab
- a genetically engineered oncolytic virus e.g., Talimogene laherparepvec
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule (e.g., atezolizumab) and a VEGF inhibitor (e.g., an an ti- VEGF antibody molecule, e.g. , bevacizumab).
- an anti-PD-Ll antibody molecule e.g., atezolizumab
- a VEGF inhibitor e.g., an an ti- VEGF antibody molecule, e.g. , bevacizumab.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule (e.g., durvalumab) in combination with an immuno stimulant (e.g. , poly ICLC), optionally, further in combination with a CTLA-4 inhibitor, e.g., an anti-CTLA-4 antibody molecule (e.g., tremelimumab).
- an anti-PD-Ll antibody molecule e.g., durvalumab
- an immuno stimulant e.g. , poly ICLC
- CTLA-4 inhibitor e.g., an anti-CTLA-4 antibody molecule (e.g., tremelimumab).
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-1 antibody molecule, e.g., nivolumab, optionally, further in combination with a chemo therapeutic agent, an interferon gamma, a CTLA-4 inhibitor (e.g. , ipilimumab), an antibody-drug conjugate (e.g., rovalpituzumab tesirine), a CXCR4 inhibitor (e.g. , ulocuplumab), an OX40 agonist (e.g., BMS 986178), or any combination thereof.
- a chemo therapeutic agent e.g., an interferon gamma
- CTLA-4 inhibitor e.g. , ipilimumab
- an antibody-drug conjugate e.g., rovalpituzumab tesirine
- CXCR4 inhibitor e.g. , ulocuplumab
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-1 antibody molecule, e.g., pembrolizumab, optionally, further in combination with a chemotherapeutic agent (e.g. , a platinum-based chemotherapeutic agent, paclitaxel, etoposide, or irinotecan), a fusion protein (e.g., DEC-205/NY-ESO- 1 fusion protein CDX- 1401), a radiation therapy, or any combination thereof.
- a chemotherapeutic agent e.g. , a platinum-based chemotherapeutic agent, paclitaxel, etoposide, or irinotecan
- a fusion protein e.g., DEC-205/NY-ESO- 1 fusion protein CDX- 1401
- a radiation therapy or any combination thereof.
- the anti-TIM-3 antibody molecule is administered or used in combination with a hypomethylating agent (e.g., decitabine), optionally, further in combination with a PD-1 inhibitor (e.g., a PD-1 inhibitor described herein), e.g., an anti-PD-1 antibody molecule (e.g. , an anti-PD-1 antibody molecule), e.g., PDR001.
- a hypomethylating agent e.g., decitabine
- a PD-1 inhibitor e.g., a PD-1 inhibitor described herein
- an anti-PD-1 antibody molecule e.g., an anti-PD-1 antibody molecule
- PDR001 e.g., PDR001.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule, e.g., atezolizumab, optionally, further in combination with a chemotherapeutic agent (e.g., carboplatin or etoposide), an interferon gamma, a CTLA-4 inhibitor (e.g., ipilimumab), an antibody- drug conjugate (e.g., rovalpituzumab tesirine), a CXCR4 inhibitor (e.g. , ulocuplumab), an OX40 agonist (e.g., BMS 986178), or any combination thereof.
- a chemotherapeutic agent e.g., carboplatin or etoposide
- CTLA-4 inhibitor e.g., ipilimumab
- an antibody- drug conjugate e.g., rovalpituzumab tesirine
- CXCR4 inhibitor
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an anti-PD-Ll antibody molecule, e.g., durvalumab, optionally, in combination with a CTLA-4 inhibitor (e.g., tremelimumab), a chemotherapeutic agent (e.g., carboplatin or etoposide), a PARP inhibitor (e.g., olaparib), a radiation therapy, or any combination thereof.
- the anti-TIM-3 antibody molecule described herein is administered or used in combination with an OX40 agonist (e.g., BMS 986178), a CTLA-4 inhibitor (e.g., ipilimumab), or both.
- the anti-TIM-3 antibody molecule is administered or used in combination with a cytokine.
- the cytokine can be administered as a fusion molecule to the anti-TIM- 3 antibody molecule, or as separate compositions.
- the anti-TIM-3 antibody molecule is administered or used in combination with one, two, three or more cytokines, e.g., as a fusion molecule or as separate compositions.
- the cytokine is an interleukin (IL) chosen from one, two, three or more of IL-1, IL-2, IL- 12, IL-15 or IL-21.
- a bispecific antibody molecule has a first binding specificity to a first target (e.g., to TIM-3), a second binding specificity to a second target (e.g., PD-1, LAG-3, or PD-L1), and is optionally linked to an interleukin (e.g., IL-12) domain e.g., full length IL-12 or a portion thereof.
- a first target e.g., to TIM-3
- a second binding specificity to a second target e.g., PD-1, LAG-3, or PD-L1
- an interleukin e.g., IL-12 domain
- the combination of anti-TIM-3 antibody molecule and the cytokine described herein is used to treat a cancer, e.g., a cancer as described herein (e.g., a solid tumor).
- the anti-TIM-3 antibody molecule is administered or used in combination with an antibody specific against an HLA C, e.g., an antibody specific to Killer-cell Immunoglobulin-like Receptors (also referred to herein as an "anti-KIR antibody").
- an antibody specific against an HLA C e.g., an antibody specific to Killer-cell Immunoglobulin-like Receptors (also referred to herein as an "anti-KIR antibody"
- the combination of anti-TIM-3 antibody molecule and anti-KIR antibody is used to treat a cancer, e.g., a cancer as described herein (e.g., a solid tumor, e.g., an advanced solid tumor).
- the anti-TIM-3 antibody molecule is administered or used in combination with a cellular immunotherapy (e.g., PROVENGE® (e.g., Sipuleucel-T)), and optionally in combination with cyclophosphamide.
- a cellular immunotherapy e.g., PROVENGE® (e.g., Sipuleucel-T)
- cyclophosphamide optionally in combination with cyclophosphamide.
- the combination of anti-TIM-3 antibody molecule, PROVENGE® and/or cyclophosphamide is used to treat a cancer, e.g., a cancer as described herein (e.g., a prostate cancer, e.g., an advanced prostate cancer).
- the anti-TIM-3 antibody molecule is administered or used in combination with a vaccine, e.g., a cancer vaccine, (e.g., a dendritic cell renal carcinoma (DC-RCC) vaccine).
- a vaccine e.g., a cancer vaccine, (e.g., a dendritic cell renal carcinoma (DC-RCC) vaccine).
- the vaccine is peptide-based, DNA-based, RNA-based, or antigen- based, or a combination thereof.
- the vaccine comprises one or more peptides, nucleic acids (e.g., DNA or RNA), antigens, or a combination thereof.
- the combination of anti-TIM-3 antibody molecule and the DC-RCC vaccine is used to treat a cancer, e.g., a cancer as described herein (e.g., a renal carcinoma, e.g., metastatic renal cell carcinoma (RCC) or clear cell renal cell carcinoma (CCRCC)).
- a cancer e.g., a cancer as described herein (e.g., a renal carcinoma, e.g., metastatic renal cell carcinoma (RCC) or clear cell renal cell carcinoma (CCRCC)).
- a cancer as described herein e.g., a renal carcinoma, e.g., metastatic renal cell carcinoma (RCC) or clear cell renal cell carcinoma (CCRCC)
- the anti-TIM-3 antibody molecule is administered or used in combination with an adjuvant.
- the anti-TIM-3 antibody molecule is administered or used in combination with chemotherapy, and/or immunotherapy.
- the anti-TIM-3 antibody molecule can be used to treat a myeloma, alone or in combination with one or more of: chemotherapy or other anti-cancer agents (e.g., thalidomide analogs, e.g., lenalidomide), an anti-PD-1 antibody molecule, tumor antigen-pulsed dendritic cells, fusions (e.g., electrofusions) of tumor cells and dendritic cells, or vaccination with immunoglobulin idiotype produced by malignant plasma cells.
- the anti-TIM-3 antibody molecule is administered or used in combination with an anti-PD-1 antibody molecule to treat a myeloma, e.g., a multiple myeloma.
- the anti-TIM-3 antibody molecule is administered or used in combination with chemotherapy to treat a lung cancer, e.g., non-small cell lung cancer.
- a lung cancer e.g., non-small cell lung cancer.
- the anti-TIM-3 antibody molecule is administered or used with standard lung, e.g., NSCLC, chemotherapy, e.g., platinum doublet therapy, to treat lung cancer.
- the anti-TIM-3 antibody molecule is administered or used in combination with an indoleamine- pyrrole 2,3-dioxygenase (IDO) inhibitor (e.g., (4E)-4-[(3-chloro-4-fluoroanilino)- nitrosomethylidene]-l,2,5-oxadiazol-3-amine (also known as INCB24360), indoximod (1-methyl-D- tryptophan), a-cyclohexyl-5H-Imidazo[5,l-a]isoindole-5-ethanol (also known as NLG919), etc.) in a subject with advanced or metastatic cancer (e.g. , a patient with metastatic and recurrent NSCL cancer).
- IDO indoleamine- pyrrole 2,3-dioxygenase
- the anti-TIM-3 antibody molecule is administered or used in combination with one or more of: an immune-based strategy (e.g., interleukin- 2 or interferon-a), a targeting agent (e.g., a VEGF inhibitor such as a monoclonal antibody to VEGF); a VEGF tyrosine kinase inhibitor such as sunitinib, sorafenib, axitinib and pazopanib; an RNAi inhibitor; or an inhibitor of a downstream mediator of VEGF signaling, e.g., an inhibitor of the mammalian target of rapamycin (mTOR), e.g., everolimus and temsirolimus.
- an immune-based strategy e.g., interleukin- 2 or interferon-a
- a targeting agent e.g., a VEGF inhibitor such as a monoclonal antibody to VEGF
- a renal cancer e.g., renal cell carcinoma (RCC) (e.g., clear cell renal cell carcinoma (CCRCC) or a non-clear cell renal cell carcinoma (nccRCC) or metastatic RCC, or a liver cancer (e.g., a hepatocellular carcinoma).
- RCC renal cell carcinoma
- CCRCC clear cell renal cell carcinoma
- nccRCC non-clear cell renal cell carcinoma
- metastatic RCC e.g., metastatic RCC
- liver cancer e.g., a hepatocellular carcinoma
- the anti-TIM-3 antibody molecule is administered or used in combination with a MEK inhibitor (e.g., a MEK inhibitor as described herein).
- a MEK inhibitor e.g., a MEK inhibitor as described herein.
- the combination of the anti-TIM-3 antibody molecule and the MEK inhibitor is used to treat a cancer (e.g., a cancer described herein).
- the cancer treated with the combination is chosen from a melanoma, a colorectal cancer, a non-small cell lung cancer, an ovarian cancer, a breast cancer, a prostate cancer, a pancreatic cancer, a hematological malignancy or a renal cell carcinoma.
- the cancer includes a BRAF mutation (e.g., a BRAF V600E mutation), a BRAF wildtype, a KRAS wildtype or an activating KRAS mutation.
- the cancer may be at an early, intermediate or late stage.
- the anti-TIM-3 antibody molecule is administered or used in combination with one, two or all of oxaliplatin, leucovorin or 5-FU (e.g., a FOLFOX co-treatment).
- combination further includes a VEGF inhibitor (e.g., a VEGF inhibitor as disclosed herein).
- the combination of the anti-TIM-3 antibody molecule, the FOLFOX co-treatment, and the VEGF inhibitor is used to treat a cancer (e.g. , a cancer described herein).
- the cancer treated with the combination is chosen from a melanoma, a colorectal cancer, a non-small cell lung cancer, an ovarian cancer, a breast cancer, a prostate cancer, a pancreatic cancer, a hematological malignancy or a renal cell carcinoma.
- the cancer may be at an early, intermediate or late stage.
- the anti-TIM-3 antibody molecule is administered or used with a tyrosine kinase inhibitor (e.g., axitinib) to treat renal cell carcinoma and other solid tumors.
- a tyrosine kinase inhibitor e.g., axitinib
- the anti-TIM-3 antibody molecule is administered or used with a 4- IBB receptor targeting agent (e.g., an antibody that stimulates signaling through 4- IBB (CD- 137), e.g., PF-2566).
- a 4- IBB receptor targeting agent e.g., an antibody that stimulates signaling through 4- IBB (CD- 137), e.g., PF-2566.
- the anti-TIM-3 antibody molecule is administered or used in combination with a tyrosine kinase inhibitor (e.g., axitinib) and a 4-1BB receptor targeting agent.
- the anti-TIM-3 antibody molecule can be bound to a substance, e.g., a cytotoxic agent or moiety (e.g., a therapeutic drug; a compound emitting radiation; molecules of plant, fungal, or bacterial origin; or a biological protein (e.g., a protein toxin) or particle (e.g., a recombinant viral particle, e.g., via a viral coat protein).
- a cytotoxic agent or moiety e.g., a therapeutic drug; a compound emitting radiation; molecules of plant, fungal, or bacterial origin; or a biological protein (e.g., a protein toxin) or particle (e.g., a recombinant viral particle, e.g., via a viral coat protein).
- the antibody can be coupled to a radioactive isotope such as an ⁇ -, ⁇ -, or ⁇ -emitter, or a ⁇ -and ⁇ -emitter.
- the immunomodulator is an inhibitor of an immune checkpoint molecule.
- the immunomodulator is an inhibitor of PD-1, PD-Ll, PD-L2, CTLA- 4, LAG-3, CEACAM (e.g., CEACAM-1, -3 and/or -5), VISTA, BTLA, TIGIT, LAIRl, CD160, 2B4 and/or TGF beta.
- the inhibitor of an immune checkpoint molecule inhibits PD-1, PD-Ll, LAG-3, CEACAM (e.g., CEACAM-1, -3 and/or -5), CTLA-4, or any combination thereof.
- Inhibition of an inhibitory molecule can be performed at the DNA, RNA or protein level.
- an inhibitory nucleic acid e.g., a dsRNA, siRNA or shRNA
- a dsRNA, siRNA or shRNA can be used to inhibit expression of an inhibitory molecule.
- the inhibitor of an inhibitory signal is, a polypeptide e.g., a soluble ligand (e.g., PD-l-Ig or CTLA-4 Ig), or an antibody molecule that binds to the inhibitory molecule; e.g., an antibody molecule that binds to PD-1, PD-Ll, PD-L2, CEACAM (e.g., CEACAM-1, -3 and/or -5), CTLA-4, LAG-3, VISTA, BTLA, TIGIT, LAIRl, CD160, 2B4 and/or TGF beta, or a combination thereof.
- a polypeptide e.g., a soluble ligand (e.g., PD-l-Ig or CTLA-4 Ig), or an antibody molecule that binds to the inhibitory molecule; e.g., an antibody molecule that binds to PD-1, PD-Ll, PD-L2, CEACAM (e.g., CE
- the anti-TIM-3 antibody molecule is in the form of a bispecific or multispecific antibody molecule.
- the bispecific antibody molecule has a first binding specificity to TIM-3 and a second binding specificity, e.g., a second binding specificity to, PD-1, PD-Ll, CEACAM (e.g., CEACAM-1, -3 and/or -5), LAG-3, or PD-L2.
- the bispecific antibody molecule binds to (i) PD- 1 or PD-Ll (ii) and TIM-3.
- the bispecific antibody molecule binds to TIM-3 and LAG-3.
- the bispecific antibody molecule binds to TIM-3 and CEACAM (e.g., CEACAM-1, -3 and/or -5). In another embodiment, the bispecific antibody molecule binds to TIM-3 and CEACAM-1. In still another embodiment, the bispecific antibody molecule binds to TIM-3 and CEACAM-3. In yet another embodiment, the bispecific antibody molecule binds to TIM-3 and CEACAM-5.
- CEACAM e.g., CEACAM-1, -3 and/or -5.
- the anti-TIM-3 antibody molecule is used in combination with a bispecific or multispecific antibody molecule.
- the bispecific antibody molecule binds to PD-1 or PD-Ll .
- the bispecific antibody molecule binds to PD- 1 and PD-L2.
- the bispecific antibody molecule binds to CEACAM (e.g., CEACAM-1, -3 and/or -5) and LAG-3.
- any combination of the aforesaid molecules can be made in a multispecific antibody molecule, e.g., a trispecific antibody that includes a first binding specificity to TIM-3, and a second and third binding specificities to two or more of: PD-1, PD-Ll, CEACAM (e.g., CEACAM-1, -3 and/or -5), LAG-3, or PD-L2.
- a multispecific antibody molecule e.g., a trispecific antibody that includes a first binding specificity to TIM-3, and a second and third binding specificities to two or more of: PD-1, PD-Ll, CEACAM (e.g., CEACAM-1, -3 and/or -5), LAG-3, or PD-L2.
- the immunomodulator is an inhibitor of PD-1, e.g., human PD-1.
- the immunomodulator is an inhibitor of PD-Ll, e.g., human PD-Ll.
- the inhibitor of PD- 1 or PD-Ll is an antibody molecule to PD-1 or PD-Ll (e.g., an anti- PD-1 or anti-PD-Ll antibody molecule as described herein).
- the combination of the PD-1 or PD-Ll inhibitor with the anti-TIM-3 antibody molecule can further include one or more additional immunomodulators, e.g., in combination with an inhibitor of LAG-3, CEACAM (e.g., CEACAM- 1, -3 and/or -5) or CTLA-4.
- the inhibitor of PD-1 or PD-Ll e.g., the anti-PD-1 or PD-Ll antibody molecule
- a LAG-3 inhibitor e.g., an anti-LAG-3 antibody molecule.
- the inhibitor of PD- 1 or PD-Ll (e.g., the anti-PD-1 or PD-Ll antibody molecule) is administered in combination with the anti-TIM-3 antibody molecule and a CEACAM inhibitor (e.g., CEACAM-1, -3 and/or -5 inhibitor), e.g., an anti-CEACAM antibody molecule.
- a CEACAM inhibitor e.g., CEACAM-1, -3 and/or -5 inhibitor
- the inhibitor of PD- 1 or PD-Ll is administered in combination with the anti-TIM-3 antibody molecule and a CEACAM-1 inhibitor (e.g., an anti-CEACAM-1 antibody molecule).
- the inhibitor of PD- 1 or PD-Ll is administered in combination with the anti-TIM-3 antibody molecule and a CEACAM-5 inhibitor (e.g., an anti-CEACAM-5 antibody molecule).
- the inhibitor of PD-1 or PD-Ll is administered in combination with the anti-TIM-3 antibody molecule, a LAG-3 inhibitor (e.g., an anti-LAG-3 antibody molecule), and a TIM-3 inhibitor (e.g., an anti-TIM-3 antibody molecule).
- PD- 1 inhibitor e.g., one or more of PD-L2, CTLA-4, LAG-3, CEACAM (e.g., CEACAM-1, -3 and/or -5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4 and/or TGF beta
- PD-L2 CTLA-4, LAG-3, CEACAM (e.g., CEACAM-1, -3 and/or -5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4 and/or TGF beta
- the immunomodulator is an inhibitor of CEACAM (e.g., CEACAM-1,
- the immunomodulator is an inhibitor of CEACAM-1, e.g., human CEACAM- 1.
- the immunomodulator is an inhibitor of CEACAM-3, e.g., human CEACAM-3.
- the immunomodulator is an inhibitor of CEACAM-5, e.g., human CEACAM-5.
- the inhibitor of CEACAM (e.g., CEACAM- 1, -3 and/or -5) is an antibody molecule to CEACAM (e.g., CEACAM-1, -3 and/or -5).
- the combination of the CEACAM (e.g., CEACAM-1, - 3 and/or -5) inhibitor and the anti-TIM-3 antibody molecule can further include one or more additional immunomodulators, e.g., in combination with an inhibitor of LAG-3, PD-1, PD-Ll or CTLA-4.
- additional immunomodulators e.g., in combination with an inhibitor of LAG-3, PD-1, PD-Ll or CTLA-4.
- the immunomodulator is an inhibitor of LAG-3, e.g., human LAG-3.
- the inhibitor of LAG-3 is an antibody molecule to LAG-3.
- the combination of the LAG-3 inhibitor and the anti-TIM-3 antibody molecule can further include one or more additional immunomodulators, e.g., in combination with an inhibitor of CEACAM (e.g., CEACAM-1, -3 and/or -5), PD-1, PD-Ll or CTLA-4.
- CEACAM e.g., CEACAM-1, -3 and/or -5
- PD-1 e.g., PD-Ll or CTLA-4.
- the immunomodulator used in the combinations disclosed herein are the immunomodulator used in the combinations disclosed herein.
- the agonist of the costimulatory molecule is chosen from an agonist (e.g., an agonistic antibody or antigen-binding fragment thereof, or a soluble fusion) of OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA- 1 (CDl la/CD18), ICOS (CD278), 4-lBB (CD137), GITR, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, or CD83 ligand.
- an agonist e.g., an agonistic antibody or antigen-binding fragment thereof, or a soluble fusion
- the immunomodulator is a GITR agonist. In one embodiment, the
- GITR agonist is an antibody molecule to GITR.
- the anti-GITR antibody molecule and the anti-TIM- 3 antibody molecule may be in the form of separate antibody composition, or as a bispecific antibody molecule.
- the combination of the GITR agonist with the anti-TIM-3 antibody molecule can further include one or more additional immunomodulators, e.g., in combination with an inhibitor of PD-1, PD-Ll, CTLA-4, CEACAM (e.g., CEACAM-1, -3 and/or -5), or LAG-3.
- the anti-GITR antibody molecule is a bispecific antibody that binds to GITR and PD- 1, PD-Ll, CTLA-4, CEACAM (e.g., CEACAM-1, -3 and/or -5), or LAG-3.
- a GITR agonist can be administered in combination with one or more additional activators of costimulatory molecules, e.g., an agonist of OX40, CD2, CD27, CD28, CDS, ICAM- 1, LFA-1 (CDl la/CD18), ICOS (CD278), 4- IBB (CD137), CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, or CD83 ligand.
- costimulatory molecules e.g., an agonist of OX40, CD2, CD27, CD28, CDS, ICAM- 1, LFA-1 (CDl la/CD18), ICOS (CD278), 4- IBB (CD137), CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, or CD83 ligand.
- the immunomodulator is an OX40 agonist.
- the OX40 agonist is an antibody molecule to OX40.
- the OX40 antibody molecule and the anti-TIM-3 antibody molecule may be in the form of separate antibody composition, or as a bispecific antibody molecule.
- the combination of the OX40 agonist with the anti-TIM-3 antibody molecule can further include one or more additional immunomodulators, e.g., in combination with an inhibitor of PD-1, PD-Ll, CTLA-4, CEACAM (e.g., CEACAM-1, -3 and/or -5), or LAG-3.
- the anti-OX40 antibody molecule is a bispecific antibody that binds to OX40 and PD-1, PD-Ll, CTLA-4, CEACAM (e.g., CEACAM-1, -3 and/or -5), or LAG-3.
- the OX40 agonist can be administered in combination with other costimulatory molecule, e.g., an agonist of GITR, CD2,
- any of the methods disclosed herein further includes evaluating or monitoring the effectiveness of a therapy (e.g., a monotherapy or a combination therapy) described herein, in a subject (e.g., a subject having a cancer, e.g., a cancer described herein).
- the method includes acquiring a value of effectiveness to the therapy, wherein said value is indicative of the effectiveness of the therapy.
- the value of effectiveness to the therapy comprises a measure of one, two, three, four, five, six, seven, eight, nine or more (e.g., all) of the following:
- TIL tumor infiltrating lymphocyte
- the parameter of a TIL phenotype comprises the level or activity of one, two, three, four or more (e.g., all) of Hematoxylin and eosin (H&E) staining for TIL counts, CD8, FOXP3, CD4, or CD3, in the subject, e.g., in a sample from the subject (e.g., a tumor sample).
- H&E Hematoxylin and eosin
- the parameter of a myeloid cell population comprises the level or activity of one or both of CD68 or CD163, in the subject, e.g., in a sample from the subject (e.g., a tumor sample).
- the parameter of a surface expression marker comprises the level or activity of one, two, three or more (e.g., all) of TIM-3, PD-1, PD-Ll, or LAG-3, in the subject, e.g., in a sample from the subject (e.g., a tumor sample).
- the level of TIM-3, PD-1, PD-Ll, or LAG-3 is determined by immunohistochemistry (IHC). In certain embodiments, the level of TIM-3 is determined.
- the parameter of a biomarker of an immunologic response comprises the level or sequence of one or more nucleic acid-based markers, in the subject, e.g., in a sample from the subject (e.g., a tumor sample).
- the parameter of systemic cytokine modulation comprises the level or activity of one, two, three, four, five, six, seven, eight, or more (e.g., all) of IL- 18, IFN- ⁇ , ITAC (CXCL11), IL-6, IL- 10, IL-4, IL-17, IL-15, or TGF-beta, in the subject, e.g., in a sample from the subject (e.g., a blood sample, e.g., a plasma sample).
- a sample from the subject e.g., a blood sample, e.g., a plasma sample.
- the parameter of cfDNA comprises the sequence or level of one or more circulating tumor DNA (cfDNA) molecules, in the subject, e.g., in a sample from the subject (e.g., a blood sample, e.g., a plasma sample).
- a sample from the subject e.g., a blood sample, e.g., a plasma sample.
- the parameter of systemic immune-modulation comprises phenotypic characterization of an activated immune cell, e.g., a CD3-expressing cell, a CD8-expressing cell, or both, in the subject, e.g., in a sample from the subject (e.g., a blood sample, e.g., a PBMC sample).
- the parameter of microbiome comprises the sequence or expression level of one or more genes in the microbiome, in the subject, e.g., in a sample from the subject (e.g., a stool sample).
- the parameter of a marker of activation in a circulating immune cell comprises the level or activity of one, two, three, four, five or more (e.g., all) of circulating CD8+, HLA-DR+Ki67+, T cells, IFN- ⁇ , IL-18, or CXCLl 1 (IFN- ⁇ induced CCK) expressing cells, in a sample (e.g., a blood sample, e.g., a plasma sample).
- a sample e.g., a blood sample, e.g., a plasma sample.
- the parameter of a circulating cytokine comprises the level or activity of IL-6, in the subject, e.g., in a sample from the subject (e.g., a blood sample, e.g., a plasma sample).
- a sample from the subject e.g., a blood sample, e.g., a plasma sample.
- the therapy comprises a combination of an anti-TIM-3 antibody molecule described herein and a second inhibitor of an immune checkpoint molecule, e.g., an inhibitor of PD-1 (e.g., an anti-PD-1 antibody molecule) or an inhibitor of PD-L1 (e.g. , an anti-PD-Ll antibody molecule).
- an inhibitor of PD-1 e.g., an anti-PD-1 antibody molecule
- an inhibitor of PD-L1 e.g. , an anti-PD-Ll antibody molecule
- the measure of one or more of (i)-(x) is obtained from a sample acquired from the subject.
- the sample is chosen from a tumor sample, a blood sample (e.g., a plasma sample or a PBMC sample), or a stool sample.
- the subject is evaluated prior to receiving, during, or after receiving, the therapy.
- (i)-(x) evaluates a profile for one or more of gene expression, flow cytometry or protein expression.
- the presence of an increased level or activity of one, two, three, four, five, or more (e.g., all) of circulating CD8+, HLA-DR+Ki67+, T cells, IFN- ⁇ , IL-18, or CXCLl 1 (IFN- ⁇ induced CCK) expressing cells, and/or the presence of an decreased level or activity of IL-6, in the subject or sample, is a positive predictor of the effectiveness of the therapy.
- administering to the subject an additional agent (e.g., a therapeutic agent described herein) in combination with the therapy; or
- any of the methods disclosed herein further includes identifying in a subject or a sample (e.g., a subject's sample comprising cancer cells and/or immune cells such as TILs) the presence of TIM-3, thereby providing a value for TIM-3.
- the method can further include comparing the TIM-3 value to a reference value, e.g., a control value. If the TIM-3 value is greater than the reference value, e.g., the control value, administering a therapeutically effective amount of an anti-TIM-3 antibody molecule described herein to the subject, and optionally, in combination with a second therapeutic agent, procedure, or modality described herein, thereby treating a cancer.
- any of the methods disclosed herein further includes identifying in a subject or a sample (e.g., a subject's sample comprising cancer cells and/or immune cells such as
- the method can further include comparing the PD-L1 value to a reference value, e.g., a control value. If the PD-L1 value is greater than the reference value, e.g., the control value, administering a therapeutically effective amount of an anti-TIM-3 antibody molecule described herein to the subject, and optionally, in combination with a second therapeutic agent, procedure, or modality described herein, thereby treating a cancer.
- a reference value e.g., a control value.
- any of the methods disclosed herein further includes identifying in a subject or a sample (e.g., a subject's sample comprising cancer cells and optionally immune cells such as TILs) the presence of one, two or all of PD-L1, CD8, or IFN- ⁇ , thereby providing a value for one, two or all of PD-L1, CD8, and IFN- ⁇ .
- the method can further include comparing the PD-L1, CD8, and/or IFN- ⁇ values to a reference value, e.g., a control value.
- the PD-L1, CD8, and/or IFN- ⁇ values are greater than the reference value, e.g., the control values, administering a therapeutically effective amount of an anti-TIM-3 antibody molecule described herein to the subject, and optionally, in combination with a second therapeutic agent, procedure, or modality described herein, thereby treating a cancer.
- the reference value e.g., the control values
- the subject may have a cancer described herein, such as a solid tumor or a hematological cancer, e.g., an ovarian cancer, a lung cancer (e.g., a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC)), a mesothelioma, a skin cancer (e.g., a Merkel cell carcinoma (MCC) or a melanoma), a kidney cancer (e.g. , a renal cell carcinoma), a bladder cancer, a soft tissue sarcoma (e.g., a hemangiopericytoma (HPC)), a bone cancer (e.g.
- a cancer described herein such as a solid tumor or a hematological cancer, e.g., an ovarian cancer, a lung cancer (e.g., a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC)), a mesothelioma,
- a bone sarcoma a colorectal cancer, a pancreatic cancer, a nasopharyngeal cancer, a breast cancer, a duodenal cancer, an endometrial cancer, an adenocarcinoma (an unknown adenocarcinoma), a liver cancer (e.g., a hepatocellular carcinoma), a cholangiocarcinoma, a sarcoma, a myelodysplasia syndrome (MDS) (e.g. , a high risk MDS), a leukemia (e.g., an acute myeloid leukemia (AML), e.g. , a relapsed or refractory AML or a de novo AML), a lymphoma, or a myeloma.
- AML acute myeloid leukemia
- AML acute myeloid leukemia
- a lymphoma or a myeloma.
- DETAILED DESCRIPTION ⁇ -3 is constitutively expressed on multiple innate immune cells, e.g. , myeloid cells. The expression is induced on activated and regulatory T cells.
- the ligands for TIM-3 include, e.g., PtdSer, CEACAM1, HMGB 1, and Galectin-9.
- Anti-TIM-3 blockade can restore activity of effector cells, reduce suppressor activity of Tregs, and enhance anti-PD-l/PD-Ll antitumor and antiviral activity.
- an anti- ⁇ -3 antibody molecule described herein can block the TIM-3/PtdSer interaction, increase inflammatory cytokine secretion from myeloid cells, enhance an in vitro MLR response, restore function to dysfunctional CD8+ T cells, and deprogram potent intratumoral Tregs, tumor-associated dendritic cells, and myeloid derived suppressor cells in combination with PD-1 blockade.
- antibody molecules e.g., humanized antibody molecules
- Pharmaceutical compositions and dose formulations comprising the anti-TIM-3 antibody molecules are also provided.
- the anti-TIM-3 antibody molecules disclosed herein can be used (alone or in combination with other therapeutic agents, procedures, or modalities) to treat or prevent disorders, such as cancerous disorders (e.g., solid tumors and hematological cancers), as well as infectious diseases (e.g., chronic infectious disorders or sepsis).
- cancerous disorders e.g., solid tumors and hematological cancers
- infectious diseases e.g., chronic infectious disorders or sepsis
- methods, including dosage regimens, for treating various disorders using the anti-TIM- 3 antibody molecules are disclosed herein.
- the anti-TIM-3 antibody molecule is administered or used at a flat or fixed dose.
- the articles “a” and “an” refer to one or to more than one (e.g., to at least one) of the grammatical object of the article.
- “About” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values.
- a combination or “in combination with,” it is not intended to imply that the therapy or the therapeutic agents must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope described herein.
- the therapeutic agents in the combination can be administered concurrently with, prior to, or subsequent to, one or more other additional therapies or therapeutic agents.
- the therapeutic agents or therapeutic protocol can be administered in any order. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent.
- the additional therapeutic agent utilized in this combination may be administered together in a single composition or administered separately in different compositions. In general, it is expected that additional therapeutic agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.
- the additional therapeutic agent is administered at a therapeutic or lower- than therapeutic dose.
- the concentration of the second therapeutic agent that is required to achieve inhibition, e.g., growth inhibition is lower when the second therapeutic agent is administered in combination with the first therapeutic agent, e.g., the anti-TIM-3 antibody molecule, than when the second therapeutic agent is administered individually.
- the concentration of the first therapeutic agent that is required to achieve inhibition, e.g., growth inhibition is lower when the first therapeutic agent is administered in combination with the second therapeutic agent than when the first therapeutic agent is administered individually.
- the concentration of the second therapeutic agent that is required to achieve inhibition, e.g., growth inhibition is lower than the therapeutic dose of the second therapeutic agent as a monotherapy, e.g. , 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70- 80%, or 80-90% lower.
- the concentration of the first therapeutic agent that is required to achieve inhibition, e.g., growth inhibition is lower than the therapeutic dose of the first therapeutic agent as a monotherapy, e.g. , 10-20%, 20-30%, 30-40%, 40- 50%, 50-60%, 60-70%, 70-80%, or 80-90% lower.
- inhibitor includes a reduction in a certain parameter, e.g., an activity, of a given molecule, e.g., an immune checkpoint inhibitor.
- a certain parameter e.g., an activity, of a given molecule
- an immune checkpoint inhibitor e.g., an enzyme that catalyzes azes the oxidation of a compound that has a reduced capacity.
- inhibition of an activity e.g., a PD-1 or PD-L1 activity, of at least 5%, 10%, 20%, 30%, 40% or more is included by this term. Thus, inhibition need not be 100%.
- activation includes an increase in a certain parameter, e.g., an activity, of a given molecule, e.g., a costimulatory molecule.
- a certain parameter e.g., an activity, of a given molecule
- a costimulatory molecule e.g., a costimulatory molecule
- increase of an activity, e.g., a costimulatory activity, of at least 5%, 10%, 25%, 50%, 75% or more is included by this term.
- anti-cancer effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g., a decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, or amelioration of various physiological symptoms associated with the cancerous condition.
- An "anti-cancer effect” can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies in prevention of the occurrence of cancer in the first place.
- anti-tumor effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g., a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, or a decrease in tumor cell survival.
- cancer refers to a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, solid tumors, e.g., lung cancer, breast cancer,
- prostate cancer ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, and brain cancer, and hematologic malignancies, e.g., lymphoma and leukemia, and the like.
- hematologic malignancies e.g., lymphoma and leukemia, and the like.
- cancer or tumor includes premalignant, as well as malignant cancers and tumors.
- an immune system cell such as an accessory cell (e.g., a B-cell, a dendritic cell, and the like) that displays a foreign antigen complexed with major histocompatibility complexes (MHC's) on its surface.
- MHC's major histocompatibility complexes
- T-cells may recognize these complexes using their T-cell receptors (TCRs).
- APCs process antigens and present them to T-cells.
- costimulatory molecule refers to the cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory
- Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response.
- Costimulatory molecules include, but are not limited to, an MHC class I molecule, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signalling lymphocytic activation molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40,
- CDS ICAM-1, LFA-1 (CDl la/CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS
- CD278 CD278
- GITR GITR
- BAFFR LIGHT
- HVEM LIGHTR
- KIRDS2 SLAMF7
- NKp80 KLRFl
- NKp44 NKp30
- NKp46 CD19
- CD4 CD8alpha
- CD8beta IL2R beta
- IL2R gamma IL7R alpha
- ITGA4 VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD
- DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD19a, and a ligand that specifically binds with CD83.
- Immuno effector cell refers to a cell that is involved in an immune response, e.g., in the promotion of an immune effector response.
- immune effector cells include T cells, e.g., alpha/beta T cells and gamma/delta T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.
- Immuno effector or “effector” “function” or “response,” as that term is used herein, refers to function or response, e.g., of an immune effector cell, that enhances or promotes an immune attack of a target cell.
- an immune effector function or response refers a property of a T or NK cell that promotes killing or the inhibition of growth or proliferation, of a target cell.
- primary stimulation and co-stimulation are examples of immune effector function or response.
- effector function refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines.
- the terms “treat,” “treatment” and “treating” refer to the reduction or amelioration of the progression, severity and/or duration of a disorder, e.g., a proliferative disorder, or the amelioration of one or more symptoms (preferably, one or more discernible symptoms) of the disorder resulting from the administration of one or more therapies.
- the terms “treat,” “treatment” and “treating” refer to the amelioration of at least one measurable physical parameter of a proliferative disorder, such as growth of a tumor, not necessarily discernible by the patient.
- the terms “treat,” “treatment” and “treating” refer to the inhibition of the progression of a proliferative disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both.
- the terms “treat,” “treatment” and “treating” refer to the reduction or stabilization of tumor size or cancerous cell count.
- compositions, formulations, and methods of the present invention encompass polypeptides and nucleic acids having the sequences specified, or sequences substantially identical or similar thereto, e.g., sequences at least 85%, 90%, 95% identical or higher to the sequence specified.
- substantially identical is used herein to refer to a first amino acid that contains a sufficient or minimum number of amino acid residues that are i) identical to, or ii) conservative substitutions of aligned amino acid residues in a second amino acid sequence such that the first and second amino acid sequences can have a common structural domain and/or common functional activity.
- amino acid sequences that contain a common structural domain having at least about 85%, 90%. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to a reference sequence, e.g., a sequence provided herein.
- nucleotide sequence in the context of nucleotide sequence, the term "substantially identical" is used herein to refer to a first nucleic acid sequence that contains a sufficient or minimum number of nucleotides that are identical to aligned nucleotides in a second nucleic acid sequence such that the first and second nucleotide sequences encode a polypeptide having common functional activity, or encode a common structural polypeptide domain or a common functional polypeptide activity.
- the term "functional variant” refers to polypeptides that have a substantially identical amino acid sequence to the naturally-occurring sequence, or are encoded by a substantially identical nucleotide sequence, and are capable of having one or more activities of the naturally-occurring sequence.
- the sequences are aligned for optimal comparison purposes (e.g. , gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
- the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence.
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
- amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”
- the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
- the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
- the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) /. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
- the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
- a particularly preferred set of parameters are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
- the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of E. Meyers and W. Miller ((1989) CABIOS, 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- nucleic acid and protein sequences described herein can be used as a "query sequence" to perform a search against public databases, for example, to identify other family members or related sequences.
- Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) /. Mol. Biol. 215:403- 10.
- Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402.
- the default parameters of the respective programs e.g., XBLAST and NBLAST
- XBLAST and NBLAST can be used. See www.ncbi.nlm.nih.gov.
- hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions describes conditions for hybridization and washing.
- Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6, which is incorporated by reference. Aqueous and nonaqueous methods are described in that reference and either can be used. Specific
- hybridization conditions referred to herein are as follows: 1) low stringency hybridization conditions in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by two washes in 0.2X SSC, 0.1% SDS at least at 50°C (the temperature of the washes can be increased to 55°C for low stringency conditions); 2) medium stringency hybridization conditions in 6X SSC at about 45 D C, followed by one or more washes in 0.2X SSC, 0.1 % SDS at 60°C; 3) high stringency hybridization conditions in 6X SSC at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 65°C; and preferably 4) very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS at 65 °C, followed by one or more washes at 0.2X SSC, 1 % SDS at 65°C. Very high stringency conditions (4) are the preferred conditions and the ones that should be used unless otherwise specified.
- molecules of the present invention may have additional conservative or non-essential amino acid substitutions, which do not have a substantial effect on their functions.
- amino acid is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids.
- exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing.
- amino acid includes both the D- or L- optical isomers and peptidomimetics.
- a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- polypeptide polypeptide
- peptide protein
- protein protein
- the terms “polypeptide,” “peptide” and “protein” (if single chain) are used interchangeably herein to refer to polymers of amino acids of any length.
- the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids.
- the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
- the polypeptide can be isolated from natural sources, can be a produced by recombinant techniques from a eukaryotic or prokaryotic host, or can be a product of synthetic procedures.
- nucleic acid refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
- the polynucleotide may be either single-stranded or double- stranded, and if single- stranded may be the coding strand or non-coding (antisense) strand.
- a polynucleotide may comprise modified
- nucleotides such as methylated nucleotides and nucleotide analogs.
- sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- the nucleic acid may be a recombinant polynucleotide, or a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in a nonnatural arrangement.
- isolated refers to material that is removed from its original or native environment (e.g., the natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated by human intervention from some or all of the coexisting materials in the natural system, is isolated.
- Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of the environment in which it is found in nature.
- the anti-TIM-3 antibody molecules described herein can be administered according to a dosage regimen described herein to treat (e.g., inhibit, reduce, ameliorate, or prevent) a disorder, e.g., a hyperproliferative condition or disorder (e.g., a cancer) in a subject.
- a disorder e.g., a hyperproliferative condition or disorder (e.g., a cancer)
- the anti-TIM-3 antibody molecule is administered to the subject at a dose of about 10 mg to about 2000 mg or about 20 mg to about 2000 mg, e.g., once every two, three, four, six, or eight weeks.
- the anti-TIM-3 antibody molecule is administered at a dose that binds, e.g., saturates, soluble TIM-3 in the subject. In some embodiments, the anti-TIM-3 antibody molecule is administered at a dose that results in at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% binding, e.g. , saturation, of soluble TIM-3 in the subject, e.g. , within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks of administration.
- the anti-TIM-3 antibody molecule is administered at a dose that results in at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% binding, e.g., occupancy, of TIM-3 in a tumor in the subject, e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks of administration.
- the anti-TIM-3 antibody molecule is administered at a dose that results in at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% binding, e.g., saturation, of soluble TIM-3 in the subject; and that results in at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% binding, e.g. , occupancy, of TIM-3 in a tumor in the subject.
- the saturation and/or occupancy occurs, e.g. , within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks of administration.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 1800 mg, about 15 mg to about 1600 mg, about 20 mg to about 1400 mg, about 25 mg to about 1200 mg, about 40 mg to about 1800 mg, about 60 mg to about 1600 mg, about 80 mg to about 1400 mg, about 100 mg to about 1200 mg, about 120 mg to about 1000 mg, about 140 mg to about 800 mg, about 160 mg to about 600 mg, about 180 mg to about 400 mg, about 200 mg to about 300 mg, about 220 mg to about 260 mg, about 40 mg to about 1600 mg, about 40 mg to about 1200 mg, 40 mg to about 1000 mg, 40 mg to about 800 mg, about 40 mg to about 600 mg, about 40 mg to about 400 mg, about 40 mg to about 200 mg, about 40 mg to about 100 mg, about 40 mg to about 80 mg, about 1600 mg to about 1800 mg, about 1200 mg to about 1800 mg, about 1000 mg to about 1800 mg, about 800 mg to about 1800 mg, about 600 mg to about 1800 mg, about 400 mg to about
- the anti-TIM-3 antibody molecule is administered at a dose of about
- the anti-TIM-3 antibody molecule is administered at a dose of about
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg, e.g., about 20 mg, once every two weeks. In other embodiments, the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg, e.g., about 20 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 40 mg to about 120 mg, 60 mg to about 100 mg, about 70 mg to about 90 mg, about 60 mg to about 80 mg, about 80 mg to about lOOmg, e.g., about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg, e.g. , once every two or four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg, e.g., about 80 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 60 mg to about 100 mg, e.g., about 80 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg, about 220 mg to about 280 mg, about 230 mg and 250 mg, about 200 mg to about 240 mg, about 240 mg to about 260 mg, e.g., about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, or about 300 mg, e.g. , once every two or four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 220 mg to about 260 mg, e.g. , about 240 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 220 mg to about 260 mg, e.g., about 240 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg, about 550 mg to about 950 mg, about 600 mg to about 900 mg, about 650 mg to about 925, about 700 mg to about 900 mg, e.g., about 700 mg, about 725 mg, about 750 mg, about 800 mg, about 825 mg, about 850 mg, or about 900 mg, e.g., once every two or four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 700 mg to about 900 mg, e.g. , about 800 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 700 mg to about 900 mg, e.g., about 800 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 900 mg to about 1500 mg, about 1000 mg to about 1400 mg, about 1100 mg and 1300 mg, about 1000 mg to about 1200, about 1200 mg to about 1400 mg, e.g., about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, or about 1500 mg, e.g. , once every two, three, or four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to about 1400 mg, e.g., about 1200 mg, once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to about 1400 mg, e.g. , about 1200 mg, once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 20 mg to about 1200 mg, about 80 mg to about 800 mg, about 20 mg to about 800 mg, about 20 mg to about 240 mg, about 20 mg to about 80 mg, about 800 mg to about 1200 mg, about 240 mg to about 1200 mg, about 80 mg to about 1200 mg, about 80 to about 240 mg, about 240 mg to about 800 mg, once every two or four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 2000 mg or less, about 1900 mg or less, about 1800 mg or less, about 1700 mg or less, about 1600 mg or less, about 1500 mg or less, about 1400 mg or less, about 1300 mg or less, about 1200 mg or less, about 1100 mg or less, about 1000 mg or less, about 900 mg or less, about 800 mg or less, about 700 mg or less, about 600 mg or less, about 500 mg or less, about 400 mg or less, about 300 mg or less, about 250 mg or less, about 200 mg or less, about 150 mg or less, about 100 mg or less, about 50 mg or less, or about 25 mg or less, once every two or four weeks.
- the disorder is a cancer, e.g., a cancer described herein.
- the cancer is a solid tumor.
- the cancer is an ovarian cancer.
- the cancer is a lung cancer, e.g., a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC).
- SCLC small cell lung cancer
- NSCLC non-small cell lung cancer
- the cancer is a mesothelioma.
- the cancer is a skin cancer, e.g., a Merkel cell carcinoma or a melanoma.
- the cancer is a kidney cancer, e.g., a renal cell carcinoma.
- the cancer is a bladder cancer.
- the cancer is a soft tissue sarcoma, e.g., a hemangiopericytoma (HPC).
- the cancer is a bone cancer, e.g., a bone sarcoma.
- the cancer is a colorectal cancer.
- the cancer is a pancreatic cancer.
- the cancer is a nasopharyngeal cancer.
- the cancer is a breast cancer.
- the cancer is a duodenal cancer.
- the cancer is an endometrial cancer.
- the cancer is an adenocarcinoma, e.g., an unknown adenocarcinoma.
- the cancer is a liver cancer, e.g., a hepatocellular carcinoma.
- the cancer is a cholangiocarcinoma.
- the cancer is a sarcoma.
- the cancer is a myelodysplastic syndrome (MDS) (e.g., a high risk MDS).
- the cancer is a leukemia (e.g., an acute myeloid leukemia (AML), e.g. , a relapsed or refractory AML or a de novo AML).
- AML acute myeloid leukemia
- the cancer is a lymphoma. In other embodiments, the cancer is a myeloma. In other embodiments, the cancer is an MSI-high cancer. In some embodiments, the cancer is a metastatic cancer. In other embodiments, the cancer is an advanced cancer. In other embodiments, the cancer is a relapsed or refractory cancer.
- the cancer is a Merkel cell carcinoma. In other embodiments, the cancer is a melanoma. In other embodiments, the cancer is a breast cancer, e.g., a triple negative breast cancer (TNBC) or a HER2-negative breast cancer. In other embodiments, the cancer is a renal cell carcinoma (e.g., a clear cell renal cell carcinoma (CCRCC) or a non-clear cell renal cell carcinoma (nccRCC)). In other embodiments, the cancer is a thyroid cancer, e.g., an anaplastic thyroid carcinoma (ATC).
- TNBC triple negative breast cancer
- HER2-negative breast cancer e.g., the cancer is a renal cell carcinoma (e.g., a clear cell renal cell carcinoma (CCRCC) or a non-clear cell renal cell carcinoma (nccRCC)).
- the cancer is a thyroid cancer, e.g., an anaplastic thyroid carcinoma (ATC).
- the cancer is a neuroendocrine tumor (NET), e.g., an atypical pulmonary carcinoid tumor or an NET in pancreas, gastrointestinal (GI) tract, or lung.
- NET neuroendocrine tumor
- the cancer is a non-small cell lung cancer (NSCLC) (e.g., a squamous NSCLC or a non-squamous NSCLC).
- NSCLC non-small cell lung cancer
- the cancer is a fallopian tube cancer.
- the cancer is a micro satellite instability-high colorectal cancer (MSI-high CRC) or a microsatellite stable colorectal cancer (MSS CRC).
- the anti-TIM-3 antibody molecule is administered in combination with an anti-PD-1 antibody molecule (e.g., an anti-PD-1 antibody molecule described herein).
- the anti- PD-1 antibody molecule can be administered with or without a hypomethylating agent (e.g., decitabine).
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks or about 200 mg to about 400 mg (e.g., about 300 mg) once every three weeks.
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks.
- the anti-PD-1 antibody molecule is administered at a dose of about 200 mg to about 400 mg (e.g., about 300 mg) once every three weeks. In some embodiments, the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to 300 mg (e.g. , about 240 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g. , about 240 mg) once every four weeks. In certain embodiments, the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to 300 mg (e.g. , about 240 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to 1000 mg (e.g. , about 800 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 1000 mg to 1500 mg (e.g. , about 1200 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg (e.g., about 20 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every eight weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 50 mg (e.g., about 20 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g. , about 80 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g., about 240 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to 30 mg (e.g., about 20 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g., about 80 mg) once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to 100 mg (e.g., about 80 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g., about 80 mg) once every two weeks. In certain embodiments, the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to 100 mg (e.g., about 80 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g., about 80 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to 300 mg (e.g. , about 240 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g., about 80 mg) once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to 300 mg (e.g., about 240 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g., about 80 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to 300 mg (e.g. , about 240 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g. , about 240 mg) once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to 1000 mg (e.g., about 800 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g., about 80 mg) once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to 1000 mg (e.g., about 800 mg) once every two weeks and the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 240 mg) once every two weeks.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to 300 mg (e.g. , about 240 mg) once every four weeks and the anti-PD-1 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g. , about 240 mg) once every four weeks.
- the anti-TIM-3 antibody molecule is administered in combination with a hypomethylating agent.
- the hypomethylating agent is decitabine.
- the hypomethylating agent is azacitidine.
- the anti-TIM-3 antibody molecule is administered in combination with decitabine (5-aza-2'-deoxycytidine).
- decitabine is administered at a dose of about 5 mg/m 2 to about 60 mg/m 2 , e.g.
- decitabine can be administered on one or more days of a 28-day cycle.
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks. In some embodiments, decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1 and 2.
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-3. In some embodiments, decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-4.
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5. In some embodiments, decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-6.
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-7.
- the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g. , about 80 mg) once every two weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g., about 240 mg) once every two weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg (e.g., about 800 mg) once every two weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about
- 1000 mg to 1500 mg e.g. , about 1200 mg
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered in combination with an anti-PD-1 antibody molecule (e.g., an anti-PD-1 antibody molecule described herein) and decitabine (5-aza-2'-deoxycytidine).
- an anti-PD-1 antibody molecule e.g., an anti-PD-1 antibody molecule described herein
- decitabine (5-aza-2'-deoxycytidine).
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) once every four weeks.
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1 and 2.
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g.
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g. , on days 1-3.
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-4.
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g. , on days 1-6.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-7.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) once every four weeks.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g. , on days 1-3.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g. , about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-4.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g. , on days 1-6.
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every eight weeks and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-7.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 30 mg (e.g., about 20 mg) once every two weeks
- the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every eight weeks
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about 10 mg to about 30 mg (e.g., about 20 mg) once every two weeks
- the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks
- decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about 50 mg to about 100 mg (e.g. , about 80 mg) once every two weeks, the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks, and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about 200 mg to about 300 mg (e.g., about 240 mg) once every two weeks, the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g. , about 400 mg) once every four weeks, and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is administered at a dose of about 500 mg to about 1000 mg (e.g., about 800 mg) once every two weeks, the anti-PD-1 antibody molecule is administered at a dose of about 300 mg to about 500 mg (e.g., about 400 mg) once every four weeks, and decitabine is administered at a dose of about 10 mg/m 2 to about 60 mg/m 2 (e.g., about 10 mg/m 2 to about 30 mg/m 2 or about 20 mg/m 2 ) every four weeks, e.g., on days 1-5.
- the anti-TIM-3 antibody molecule is ABTIM3-huml 1 and the anti- PD-1 antibody molecule is PDR001. In certain embodiments, the anti-TIM-3 antibody molecule is ABTIM3-hum03 and the anti-PD-1 antibody molecule is PDR001.
- the anti-TIM-3 antibody molecule is ABTIM3-huml 1 and the hypomethylating agent is decitabine. In certain embodiments, the anti-TIM-3 antibody molecule is ABTIM3-hum03 and the hypomethylating agent is decitabine.
- the anti-TIM-3 antibody molecule is ABTIM3-huml l
- the anti-PD- 1 antibody molecule is PDR001
- the hypomethylating agent is decitabine.
- the anti-TIM-3 antibody molecule is ABTIM3-hum03
- the anti-PD-1 antibody molecule is PDR001
- the hypomethylating agent is decitabine.
- an antibody molecule that binds to a mammalian, e.g., human, TIM- 3.
- the antibody molecule binds specifically to an epitope, e.g., linear or conformational epitope, (e.g., an epitope as described herein) on TIM-3.
- an epitope e.g., linear or conformational epitope, (e.g., an epitope as described herein) on TIM-3.
- the term “antibody molecule” refers to a protein, e.g., an immunoglobulin chain or fragment thereof, comprising at least one immunoglobulin variable domain sequence.
- the term "antibody molecule” includes, for example, a monoclonal antibody (including a full length antibody which has an immunoglobulin Fc region).
- an antibody molecule comprises a full length antibody, or a full length immunoglobulin chain. In an embodiment, an antibody molecule comprises an antigen binding or functional fragment of a full length antibody, or a full length immunoglobulin chain. In an embodiment, an antibody molecule is a multispecific antibody molecule, e.g., it comprises a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In an embodiment, a multispecific antibody molecule is a bispecific antibody molecule.
- an antibody molecule is a monospecific antibody molecule and binds a single epitope.
- a monospecific antibody molecule can have a plurality of
- immunoglobulin variable domain sequences each of which binds the same epitope.
- an antibody molecule is a multispecific antibody molecule, e.g., it comprises a plurality of immunoglobulin variable domains sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope.
- the first and second epitopes are on the same antigen, e.g., the same protein (or subunit of a multimeric protein).
- the first and second epitopes overlap. In an embodiment, the first and second epitopes do not overlap.
- the first and second epitopes are on different antigens, e.g., the different proteins (or different subunits of a multimeric protein).
- a multispecific antibody molecule comprises a third, fourth or fifth immunoglobulin variable domain.
- a multispecific antibody molecule is a bispecific antibody molecule, a trispecific antibody molecule, or tetraspecific antibody molecule,
- a multispecific antibody molecule is a bispecific antibody molecule.
- a bispecific antibody has specificity for no more than two antigens.
- a bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.
- the first and second epitopes are on the same antigen, e.g. , the same protein (or subunit of a multimeric protein).
- the first and second epitopes overlap.
- the first and second epitopes do not overlap.
- the first and second epitopes are on different antigens, e.g.
- a bispecific antibody molecule comprises a heavy chain variable domain sequence and a light chain variable domain sequence which have binding specificity for a first epitope and a heavy chain variable domain sequence and a light chain variable domain sequence which have binding specificity for a second epitope.
- a bispecific antibody molecule comprises a half antibody having binding specificity for a first epitope and a half antibody having binding specificity for a second epitope.
- a bispecific antibody molecule comprises a half antibody, or fragment thereof, having binding specificity for a first epitope and a half antibody, or fragment thereof, having binding specificity for a second epitope.
- a bispecific antibody molecule comprises a scFv, or fragment thereof, have binding specificity for a first epitope and a scFv, or fragment thereof, have binding specificity for a second epitope.
- the first epitope is located on TIM-3 and the second epitope is located on a PD-1, LAG-3, CEACAM (e.g., CEACAM-1 and/or CEACAM-5), PD-L1, or PD-L2.
- Protocols for generating multi-specific (e.g., bispecific or trispecific) or heterodimeric antibody molecules are known in the art; including but not limited to, for example, the "knob in a hole" approach described in, e.g., US 5,731, 168; the electrostatic steering Fc pairing as described in, e.g., WO 09/089004, WO 06/106905 and WO 2010/129304; Strand Exchange Engineered Domains (SEED) heterodimer formation as described in, e.g., WO 07/110205; Fab arm exchange as described in, e.g., WO 08/119353, WO 2011/131746, and WO 2013/060867; double antibody conjugate, e.g., by antibody cross-linking to generate a bi-specific structure using a heterobifunctional reagent having an amine-reactive group and a sulfhydryl reactive group as described in, e.g., US 4,433,059;
- bispecific antibody determinants generated by recombining half antibodies (heavy-light chain pairs or Fabs) from different antibodies through cycle of reduction and oxidation of disulfide bonds between the two heavy chains, as described in, e.g., US 4,444,878; trifunctional antibodies, e.g., three Fab' fragments cross-linked through sulfhdryl reactive groups, as described in, e.g., US 5,273,743;
- biosynthetic binding proteins e.g., pair of scFvs cross-linked through C-terminal tails preferably through disulfide or amine-reactive chemical cross-linking, as described in, e.g., US 5,534,254;
- bifunctional antibodies e.g., Fab fragments with different binding specificities dimerized through leucine zippers (e.g., c-fos and c-jun) that have replaced the constant domain, as described in, e.g., US 5,582,996; bispecific and oligospecific mono-and oligovalent receptors, e.g., VH-CH1 regions of two antibodies (two Fab fragments) linked through a polypeptide spacer between the CHI region of one antibody and the VH region of the other antibody typically with associated light chains, as described in, e.g., US 5,591,828; bispecific DNA-antibody conjugates, e.g., crosslinking of antibodies or Fab fragments through a double stranded piece of DNA, as described in, e.g., US 5,635,602; bispecific fusion proteins, e.g., an expression construct containing two scFvs with a hydrophilic helical peptide linker between them and a
- the anti-TIM-3 antibody molecule (e.g. , a monospecific, bispecific, or multispecific antibody molecule) is covalently linked, e.g., fused, to another partner e.g. , a protein e.g., one, two or more cytokines, e.g., as a fusion molecule for example a fusion protein.
- the fusion molecule comprises one or more proteins, e.g., one, two or more cytokines.
- the cytokine is an interleukin (IL) chosen from one, two, three or more of IL- 1, IL-2, IL- 12, IL-15 or IL-21.
- IL interleukin
- a bispecific antibody molecule has a first binding specificity to a first target (e.g., to PD-1), a second binding specificity to a second target (e.g. , LAG-3 or TIM-3), and is optionally linked to an interleukin (e.g., IL-12) domain e.g., full length IL-12 or a portion thereof.
- a first target e.g., to PD-1
- a second binding specificity to a second target e.g. , LAG-3 or TIM-3
- an interleukin e.g., IL-12 domain e.g., full length IL-12 or a portion thereof.
- a “fusion protein” and a “fusion polypeptide” refer to a polypeptide having at least two portions covalently linked together, where each of the portions is a polypeptide having a different property.
- the property may be a biological property, such as activity in vitro or in vivo.
- the property can also be simple chemical or physical property, such as binding to a target molecule, catalysis of a reaction, etc.
- the two portions can be linked directly by a single peptide bond or through a peptide linker, but are in reading frame with each other.
- an antibody molecule comprises a diabody, and a single-chain molecule, as well as an antigen-binding fragment of an antibody (e.g., Fab, F(ab' )2, and Fv).
- an antibody molecule can include a heavy (H) chain variable domain sequence (abbreviated herein as VH), and a light (L) chain variable domain sequence (abbreviated herein as VL).
- VH heavy chain variable domain sequence
- VL light chain variable domain sequence
- an antibody molecule comprises or consists of a heavy chain and a light chain (referred to herein as a half antibody.
- an antibody molecule in another example, includes two heavy (H) chain variable domain sequences and two light (L) chain variable domain sequence, thereby forming two antigen binding sites, such as Fab, Fab' , F(ab' )2, Fc, Fd, Fd', Fv, single chain antibodies (scFv for example), single variable domain antibodies, diabodies (Dab) (bivalent and bispecific), and chimeric (e.g., humanized) antibodies, which may be produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA technologies. These functional antibody fragments retain the ability to selectively bind with their respective antigen or receptor.
- Antibodies and antibody fragments can be from any class of antibodies including, but not limited to, IgG, IgA, IgM, IgD, and IgE, and from any subclass (e.g., IgGl, IgG2, IgG3, and IgG4) of antibodies.
- the preparation of antibody molecules can be monoclonal or polyclonal.
- An antibody molecule can also be a human, humanized, CDR-grafted, or in vitro generated antibody.
- the antibody can have a heavy chain constant region chosen from, e.g., IgGl, IgG2, IgG3, or IgG4.
- the antibody can also have a light chain chosen from, e.g., kappa or lambda.
- immunoglobulin (Ig) is used interchangeably with the term "antibody” herein.
- antigen-binding fragments of an antibody molecule include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a diabody (dAb) fragment, which consists of a VH domain; (vi) a camelid or camelized variable domain; (vii) a single chain Fv (scFv), see e.g.
- antibody includes intact molecules as well as functional fragments thereof.
- Constant regions of the antibodies can be altered, e.g., mutated, to modify the properties of the antibody (e.g., to increase or decrease one or more of: Fc receptor binding, antibody glycosylation, the number of cysteine residues, effector cell function, or complement function).
- Antibody molecules can also be single domain antibodies.
- Single domain antibodies can include antibodies whose complementary determining regions are part of a single domain polypeptide. Examples include, but are not limited to, heavy chain antibodies, antibodies naturally devoid of light chains, single domain antibodies derived from conventional 4-chain antibodies, engineered antibodies and single domain scaffolds other than those derived from antibodies.
- Single domain antibodies may be any of the art, or any future single domain antibodies.
- Single domain antibodies may be derived from any species including, but not limited to mouse, human, camel, llama, fish, shark, goat, rabbit, and bovine.
- a single domain antibody is a naturally occurring single domain antibody known as heavy chain antibody devoid of light chains. Such single domain antibodies are disclosed in WO 94/04678, for example. For clarity reasons, this variable domain derived from a heavy chain antibody naturally devoid of light chain is known herein as a
- VHH or nanobody to distinguish it from the conventional VH of four chain immunoglobulins can be derived from antibodies raised in Camelidae species, for example in camel, llama, dromedary, alpaca and guanaco. Other species besides Camelidae may produce heavy chain antibodies naturally devoid of light chain; such VHHs are within the scope of the invention.
- VH and VL regions can be subdivided into regions of hypervariability, termed
- CDR complementarity determining regions
- FR framework regions
- CDR complementarity determining region
- the CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31-35 (HCDRl), 50-65 (HCDR2), and 95- 102 (HCDR3); and the CDR amino acid residues in the light chain variable domain (VL) are numbered 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3).
- the CDR amino acids in the VH are numbered 26-32 (HCDRl), 52-56 (HCDR2), and 95-102 (HCDR3); and the amino acid residues in VL are numbered 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3).
- the CDRs consist of amino acid residues 26-35 (HCDRl), 50-65 (HCDR2), and 95-102 (HCDR3) in human VH and amino acid residues 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) in human VL.
- the anti-PD-1 antibody molecules can include any combination of one or more Kabat CDRs and/or Chothia hypervariable loops, e.g., described in Table 1.
- the following definitions are used for the anti-PD-1 antibody molecules described in Table 1 : HCDRl according to the combined CDR definitions of both Kabat and Chothia, and HCCDRs 2-3 and LCCDRs 1-3 according the CDR definition of Kabat.
- each VH and VL typically includes three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- an "immunoglobulin variable domain sequence” refers to an amino acid sequence which can form the structure of an immunoglobulin variable domain.
- the sequence may include all or part of the amino acid sequence of a naturally-occurring variable domain.
- the sequence may or may not include one, two, or more N- or C-terminal amino acids, or may include other alterations that are compatible with formation of the protein structure.
- antigen-binding site refers to the part of an antibody molecule that comprises determinants that form an interface that binds to the PD-1 polypeptide, or an epitope thereof.
- the antigen-binding site typically includes one or more loops (of at least four amino acids or amino acid mimics) that form an interface that binds to the PD-1 polypeptide.
- the antigen-binding site of an antibody molecule includes at least one or two CDRs and/or hypervariable loops, or more typically at least three, four, five or six CDRs and/or hypervariable loops.
- Compet or “cross-compete” are used interchangeably herein to refer to the ability of an antibody molecule to interfere with binding of an anti-PD- 1 antibody molecule, e.g., an anti-PD-1 antibody molecule provided herein, to a target, e.g., human PD-1.
- the interference with binding can be direct or indirect (e.g., through an allosteric modulation of the antibody molecule or the target).
- the extent to which an antibody molecule is able to interfere with the binding of another antibody molecule to the target, and therefore whether it can be said to compete can be determined using a competition binding assay, for example, a FACS assay, an ELISA or BIACORE assay.
- a competition binding assay is a quantitative competition assay.
- a first anti-TIM-3 antibody molecule is said to compete for binding to the target with a second anti-TIM-3 antibody molecule when the binding of the first antibody molecule to the target is reduced by 10% or more, e.g., 20% or more, 30% or more, 40% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more in a competition binding assay (e.g., a competition assay described herein).
- a competition binding assay e.g., a competition assay described herein.
- monoclonal antibody or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition.
- a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- a monoclonal antibody can be made by hybridoma technology or by methods that do not use hybridoma technology (e.g., recombinant methods).
- An "effectively human” protein is a protein that does not evoke a neutralizing antibody response, e.g., the human anti-murine antibody (HAMA) response.
- HAMA can be problematic in a number of circumstances, e.g., if the antibody molecule is administered repeatedly, e.g. , in treatment of a chronic or recurrent disease condition.
- a HAMA response can make repeated antibody administration potentially ineffective because of an increased antibody clearance from the serum (see e.g., Saleh et al. ⁇ Cancer Immunol. Immunother. 32: 180-190 (1990)) and also because of potential allergic reactions (see e.g., LoBuglio et al., Hybridoma, 5:5117-5123 (1986)).
- the antibody molecule can be a polyclonal or a monoclonal antibody.
- the antibody can be recombinantly produced, e.g., produced by phage display or by combinatorial methods.
- Phage display and combinatorial methods for generating antibodies are known in the art (as described in, e.g., Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271; Winter et al. International Publication WO 92/20791; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No.
- the antibody is a fully human antibody (e.g., an antibody made in a mouse which has been genetically engineered to produce an antibody from a human immunoglobulin sequence), or a non-human antibody, e.g., a rodent (mouse or rat), goat, primate (e.g., monkey), camel antibody.
- a rodent mouse or rat
- the non-human antibody is a rodent (mouse or rat antibody).
- Methods of producing rodent antibodies are known in the art.
- Human monoclonal antibodies can be generated using transgenic mice carrying the human immunoglobulin genes rather than the mouse system. Splenocytes from these transgenic mice immunized with the antigen of interest are used to produce hybridomas that secrete human mAbs with specific affinities for epitopes from a human protein (see, e.g., Wood et al. International Application WO 91/00906, Kucherlapati et al. PCT publication WO 91/10741; Lonberg et al. International Application WO 92/03918; Kay et al. International Application 92/03917; Lonberg, N. et al. 1994 Nature 368:856-859; Green, L.L. et al.
- An antibody can be one in which the variable region, or a portion thereof, e.g., the CDRs, are generated in a non-human organism, e.g., a rat or mouse. Chimeric, CDR-grafted, and humanized antibodies are within the invention. Antibodies generated in a non-human organism, e.g., a rat or mouse, and then modified, e.g., in the variable framework or constant region, to decrease antigenicity in a human are within the invention.
- Chimeric antibodies can be produced by recombinant DNA techniques known in the art (see Robinson et al., International Patent Publication PCT/US86/02269; Akira, et al., European Patent Application 184, 187; Taniguchi, M., European Patent Application 171,496; Morrison et al., European Patent Application 173,494; Neuberger et al., International Application WO 86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al. , European Patent Application 125,023; Better et al. (1988 Science 240: 1041-1043); Liu et al. (1987) PNAS 84:3439-3443; Liu et al., 1987, /. Immunol.
- a humanized or CDR-grafted antibody will have at least one or two but generally all three recipient CDRs (of heavy and or light immunoglobulin chains) replaced with a donor CDR.
- the antibody may be replaced with at least a portion of a non-human CDR or only some of the CDRs may be replaced with non-human CDRs. It is only necessary to replace the number of CDRs required for binding of the humanized antibody to PD-1.
- the donor will be a rodent antibody, e.g., a rat or mouse antibody
- the recipient will be a human framework or a human consensus framework.
- the immunoglobulin providing the CDRs is called the "donor” and the immunoglobulin providing the framework is called the “acceptor.”
- the donor immunoglobulin is a non-human (e.g., rodent).
- the acceptor framework is a naturally-occurring (e.g., a human) framework or a consensus framework, or a sequence about 85% or higher, preferably 90%, 95%, 99% or higher identical thereto.
- the term "consensus sequence” refers to the sequence formed from the most frequently occurring amino acids (or nucleotides) in a family of related sequences (see e.g., Winnaker, From Genes to Clones (Verlagsgesellschaft, Weinheim, Germany 1987).
- each position in the consensus sequence is occupied by the amino acid occurring most frequently at that position in the family. If two amino acids occur equally frequently, either can be included in the consensus sequence.
- a "consensus framework” refers to the framework region in the consensus immunoglobulin sequence.
- An antibody can be humanized by methods known in the art (see e.g., Morrison, S. L., 1985, Science 229: 1202-1207, by Oi et al, 1986, BioTechniques 4:214, and by Queen et al. US 5,585,089, US 5,693,761 and US 5,693,762, the contents of all of which are hereby incorporated by reference).
- Humanized or CDR-grafted antibodies can be produced by CDR-grafting or CDR substitution, wherein one, two, or all CDRs of an immunoglobulin chain can be replaced.
- CDR-grafting or CDR substitution wherein one, two, or all CDRs of an immunoglobulin chain can be replaced.
- U.S. Patent 5,225,539 Jones et al. 1986 Nature 321 :552-525; Verhoeyan et al. 1988 Science 239: 1534; Beidler et al. 1988 /. Immunol. 141 :4053-4060; Winter US 5,225,539, the contents of all of which are hereby expressly incorporated by reference.
- Winter describes a CDR-grafting method which may be used to prepare the humanized antibodies of the present invention (UK Patent Application GB 2188638A, filed on March 26, 1987; Winter US 5,225,539), the contents of which is expressly incorporated by reference.
- humanized antibodies in which specific amino acids have been substituted, deleted or added. Criteria for selecting amino acids from the donor are described in US 5,585,089, e.g., columns 12-16 of US 5,585,089, e.g., columns 12-16 of US
- the antibody molecule can be a single chain antibody.
- a single-chain antibody (scFV) may be engineered (see, for example, Colcher, D. et al. (1999) Ann N Y Acad Sci 880:263-80; and Reiter, Y. (1996) Clin Cancer Res 2:245-52).
- the single chain antibody can be dimerized or multimerized to generate multivalent antibodies having specificities for different epitopes of the same target protein.
- the antibody molecule has a heavy chain constant region chosen from, e.g., the heavy chain constant regions of IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgD, and IgE; particularly, chosen from, e.g., the (e.g., human) heavy chain constant regions of IgGl, IgG2, IgG3, and IgG4.
- the antibody molecule has a light chain constant region chosen from, e.g., the (e.g., human) light chain constant regions of kappa or lambda.
- the constant region can be altered, e.g., mutated, to modify the properties of the antibody (e.g., to increase or decrease one or more of: Fc receptor binding, antibody glycosylation, the number of cysteine residues, effector cell function, and/or complement function).
- the antibody has: effector function; and can fix complement.
- the antibody does not; recruit effector cells; or fix complement.
- the antibody has reduced or no ability to bind an Fc receptor. For example, it is a isotype or subtype, fragment or other mutant, which does not support binding to an Fc receptor, e.g., it has a mutagenized or deleted Fc receptor binding region.
- Antibodies with altered function e.g. altered affinity for an effector ligand, such as FcR on a cell, or the CI component of complement can be produced by replacing at least one amino acid residue in the constant portion of the antibody with a different residue (see e.g., EP 388,151 Al, U.S. Pat. No. 5,624,821 and U.S. Pat. No. 5,648,260, the contents of all of which are hereby incorporated by reference). Similar type of alterations could be described which if applied to the murine, or other species immunoglobulin would reduce or eliminate these functions.
- an antibody molecule can be derivatized or linked to another functional molecule (e.g., another peptide or protein).
- a "derivatized" antibody molecule is one that has been modified. Methods of derivatization include but are not limited to the addition of a fluorescent moiety, a radionucleotide, a toxin, an enzyme or an affinity ligand such as biotin. Accordingly, the antibody molecules of the invention are intended to include derivatized and otherwise modified forms of the antibodies described herein, including immunoadhesion molecules.
- an antibody molecule can be functionally linked (by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other molecular entities, such as another antibody (e.g., a bispecific antibody or a diabody), a detectable agent, a cytotoxic agent, a pharmaceutical agent, and/or a protein or peptide that can mediate association of the antibody or antibody portion with another molecule (such as a strep tavidin core region or a polyhistidine tag).
- another antibody e.g., a bispecific antibody or a diabody
- detectable agent e.g., a detectable agent, a cytotoxic agent, a pharmaceutical agent, and/or a protein or peptide that can mediate association of the antibody or antibody portion with another molecule (such as a strep tavidin core region or a polyhistidine tag).
- One type of derivatized antibody molecule is produced by crosslinking two or more antibodies (of the same type or of different types, e.g., to create bispecific antibodies).
- Suitable crosslinkers include those that are heterobifunctional, having two distinctly reactive groups separated by an appropriate spacer (e.g., m-maleimidobenzoyl-N-hydroxysuccinimide ester) or
- Exemplary fluorescent detectable agents include fluorescein, fluorescein isothiocyanate, rhodamine, 5dimethylamine-l- napthalenesulfonyl chloride, phycoerythrin and the like.
- An antibody may also be derivatized with detectable enzymes, such as alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, acetylcholinesterase, glucose oxidase and the like.
- detectable enzymes such as alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, acetylcholinesterase, glucose oxidase and the like.
- detectable enzymes such as alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, acetylcholinesterase, glucose oxidase and the like.
- detectable agent horseradish peroxidase is present, the addition of hydrogen peroxide and diaminobenzidine leads to a colored reaction product, which is detectable.
- An antibody molecule may also be derivatized with a prosthetic group (e.g.,
- streptavidin/biotin and avidin/biotin may be derivatized with biotin, and detected through indirect measurement of avidin or streptavidin binding.
- suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of bioluminescent materials include luciferase, luciferin, and aequorin.
- Labeled antibody molecule can be used, for example, diagnostically and/or experimentally in a number of contexts, including (i) to isolate a predetermined antigen by standard techniques, such as affinity chromatography or immunoprecipitation; (ii) to detect a predetermined antigen (e.g. , in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the protein; (iii) to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to determine the efficacy of a given treatment regimen.
- a predetermined antigen e.g. , in a cellular lysate or cell supernatant
- An antibody molecules may be conjugated to another molecular entity, typically a label or a therapeutic (e.g., a cytotoxic or cytostatic) agent or moiety.
- Radioactive isotopes can be used in diagnostic or therapeutic applications.
- the invention provides radiolabeled antibody molecules and methods of labeling the same.
- a method of labeling an antibody molecule is disclosed. The method includes contacting an antibody molecule, with a chelating agent, to thereby produce a conjugated antibody.
- the antibody molecule can be conjugated to a therapeutic agent.
- therapeutically active radioisotopes have already been mentioned.
- examples of other therapeutic agents include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydro testosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, e.g., maytansinol (see, e.g., U.S.
- Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, CC- 1065, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclinies (e.g., daunorubicin (formerly daunomycin
- the disclosure provides a method of providing a target binding molecule that specifically binds to a target disclosed herein, e.g., TIM-3.
- the target binding molecule is an antibody molecule.
- the method includes: providing a target protein that comprises at least a portion of non-human protein, the portion being homologous to (at least 70, 75, 80, 85, 87, 90, 92, 94, 95, 96, 97, 98% identical to) a corresponding portion of a human target protein, but differing by at least one amino acid (e.g., at least one, two, three, four, five, six, seven, eight, or nine amino acids); obtaining an antibody molecule that specifically binds to the antigen; and evaluating efficacy of the binding agent in modulating activity of the target protein.
- the method can further include administering the binding agent (e.g., antibody molecule) or a derivative (e.g., a humanized antibody molecule) to a human subject.
- nucleic acid molecule encoding the above antibody molecule, vectors and host cells thereof.
- the nucleic acid molecule includes but is not limited to RNA, genomic DNA and cDNA.
- the anti-TIM-3 antibody molecule is disclosed in US 2015/0218274, published on August 6, 2015, entitled “Antibody Molecules to TIM-3 and Uses Thereof,” incorporated by reference in its entirety.
- the anti-TIM-3 antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 7 (e.g., from the heavy and light chain variable region sequences of ABTIM3-huml 1 or ABTIM3-hum03 disclosed in Table 7), or encoded by a nucleotide sequence shown in Table 7.
- the CDRs are according to the Kabat definition (e.g., as set out in Table 7).
- the CDRs are according to the Chothia definition (e.g., as set out in Table 7).
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 7, or encoded by a nucleotide sequence shown in Table 7.
- amino acid substitutions e.g., conservative amino acid substitutions
- deletions e.g., conservative amino acid substitutions
- the anti-TIM-3 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 801, a VHCDR2 amino acid sequence of SEQ ID NO: 802, and a VHCDR3 amino acid sequence of SEQ ID NO: 803; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 810, a VLCDR2 amino acid sequence of SEQ ID NO: 811, and a VLCDR3 amino acid sequence of SEQ ID NO: 812, each disclosed in Table 7.
- VH heavy chain variable region
- VL light chain variable region
- the anti-TIM-3 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 801, a VHCDR2 amino acid sequence of SEQ ID NO: 820, and a VHCDR3 amino acid sequence of SEQ ID NO: 803; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 810, a VLCDR2 amino acid sequence of SEQ ID NO: 811, and a VLCDR3 amino acid sequence of SEQ ID NO: 812, each disclosed in Table 7.
- VH heavy chain variable region
- VL light chain variable region
- the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 806, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 806. In one embodiment, the anti-TIM-3 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 816, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 816. In one embodiment, the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 822, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 822.
- the anti-TIM-3 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 826, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 826. In one embodiment, the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 806 and a VL comprising the amino acid sequence of SEQ ID NO: 816. In one embodiment, the anti-TIM-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 822 and a VL comprising the amino acid sequence of SEQ ID NO: 826.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 807, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 807. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 817, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 817.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 823, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 823. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 827, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 827. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 807 and a VL encoded by the nucleotide sequence of SEQ ID NO: 817. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 823 and a VL encoded by the nucleotide sequence of SEQ ID NO: 827.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 808, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 808.
- the anti-TIM-3 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 818, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 818.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 824, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 824.
- the anti-TIM-3 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 828, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 828.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 808 and a light chain comprising the amino acid sequence of SEQ ID NO: 818.
- the anti-TIM-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 824 and a light chain comprising the amino acid sequence of SEQ ID NO: 828.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 809, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 809.
- the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 819, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 819.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 825, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 825. In one embodiment, the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 829, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 829. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 809 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 819. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 825 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 829.
- the antibody molecules described herein can be made by vectors, host cells, and methods described in US 2015/0218274, incorporated by reference in its entirety.
- the anti-TIM-3 antibody molecule includes at least one or two heavy chain variable domain (optionally including a constant region), at least one or two light chain variable domain (optionally including a constant region), or both, comprising the amino acid sequence of ABTIM3, ABTIM3-hum01, ABTIM3-hum02, ABTIM3-hum03, ABTIM3-hum04, ABTIM3-hum05, ABTIM3-hum06, ABTIM3-hum07, ABTIM3-hum08, ABTIM3-hum09, ABTIM3-huml0, ABTIM3- huml l, ABTIM3-huml2, ABTIM3-huml3, ABTIM3-huml4, ABTIM3-huml5, ABTIM3-huml6, ABTIM3-huml7, ABTIM3-huml8, ABTIM3-huml9, ABTIM3-hum20, ABTIM3-hum21, ABTIM3- hum22, ABTIM3-hum23; or
- the anti-TIM-3 antibody molecule includes at least one, two, or three complementarity determining regions (CDRs) from a heavy chain variable region and or a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of ABTIM3, ABTIM3-hum01, ABTIM3-hum02, ABTIM3-hum03, ABTIM3-hum04, ABTIM3-hum05, ABTIM3- hum06, ABTIM3-hum07, ABTIM3-hum08, ABTIM3-hum09, ABTIM3-huml0, ABTIM3-huml l, ABTIM3-huml2, ABTIM3-huml3, ABTIM3-huml4, ABTIM3-huml5, ABTIM3-huml6, ABTIM3- huml7, ABTIM3-huml8, ABTIM3-huml9, ABTIM3-hum20, ABTIM3-hum21, ABTIM3-hum22,
- CDRs
- the anti-TIM-3 antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a heavy chain variable region comprising an amino acid sequence shown in Tables 1-4 of US 2015/0218274, or encoded by a nucleotide sequence shown in Tables 1-4.
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Tables 1-4, or encoded by a nucleotide sequence shown in Table 1- 4.
- the anti-TIM-3 antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a light chain variable region comprising an amino acid sequence shown in Tables 1-4 of US 2015/0218274, or encoded by a nucleotide sequence shown in Tables 1-4.
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Tables 1-4, or encoded by a nucleotide sequence shown in Tables 1-4.
- the anti-TIM-3 antibody molecule includes a substitution in a light chain CDR, e.g., one or more substitutions in a CDR1, CDR2 and/or CDR3 of the light chain.
- the anti-TIM-3 antibody molecule includes at least one, two, three, four, five or six CDRs (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Tables 1-4 of US 2015/0218274, or encoded by a nucleotide sequence shown in Tables 1-4.
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Tables 1-4, or encoded by a nucleotide sequence shown in Tables 1-4.
- the anti-TIM-3 antibody molecule is TSR-022 (AnaptysBio/Tesaro). In one embodiment, the anti-TIM-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of TSR-022. In one embodiment, the anti-TIM-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of APE5137 or APE5121, e.g., as disclosed in Table 8. APE5137, APE5121, and other anti-TIM-3 antibodies are disclosed in WO 2016/161270, incorporated by reference in its entirety.
- the anti-TIM-3 antibody molecule is the antibody clone F38-2E2. In one embodiment, the anti-TIM-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of F38-2E2.
- anti-TIM-3 antibodies include those described, e.g., in WO 2016/111947, WO 2016/071448, WO 2016/144803, US 8,552, 156, US 8,841,418, and US 9, 163,087, incorporated by reference in their entirety.
- the anti-TIM-3 antibody is an antibody that competes for binding with, and/or binds to the same epitope on TIM-3 as, one of the anti-TIM-3 antibodies described herein.
- Table 8 Amino acid sequences of other exemplary anti-TIM-3 antibody molecules
- the anti-TIM-3 antibody molecule described herein is administered in combination with a PD-1 inhibitor.
- the PD-1 inhibitor is chosen from PDR001 (Novartis), Nivolumab (Bristol-Myers Squibb), Pembrolizumab (Merck & Co), Pidilizumab (CureTech), MEDI0680 (Medimmune), REGN2810 (Regeneron), TSR-042 (Tesaro), PF-06801591 (Pfizer), BGB-A317 (Beigene), BGB-108 (Beigene), INCSHR1210 (Incyte), or AMP-224
- the PD-1 inhibitor is an anti-PD-1 antibody molecule. In one embodiment, the PD-1 inhibitor is an anti-PD-1 antibody molecule as described in US 2015/0210769, published on July 30, 2015, entitled “Antibody Molecules to PD- 1 and Uses Thereof,” incorporated by reference in its entirety.
- the anti-PD-1 antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 1 (e.g., from the heavy and light chain variable region sequences of B AP049-Clone-E or BAP049-Clone-B disclosed in Table 1), or encoded by a nucleotide sequence shown in Table 1.
- the CDRs are according to the Kabat definition (e.g., as set out in Table 1).
- the CDRs are according to the Chothia definition (e.g., as set out in Table 1).
- the CDRs are according to the combined CDR definitions of both Kabat and Chothia (e.g., as set out in Table 1).
- the combination of Kabat and Chothia CDR of VH CDR1 comprises the amino acid sequence GYTFTTYWMH (SEQ ID NO: 541).
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 1, or encoded by a nucleotide sequence shown in Table 1.
- the anti-PD-1 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 501, a VHCDR2 amino acid sequence of SEQ ID NO: 502, and a VHCDR3 amino acid sequence of SEQ ID NO: 503; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 510, a VLCDR2 amino acid sequence of SEQ ID NO: 511, and a VLCDR3 amino acid sequence of SEQ ID NO: 512, each disclosed in Table 1.
- VH heavy chain variable region
- VL light chain variable region
- the antibody molecule comprises a VH comprising a VHCDR1 encoded by the nucleotide sequence of SEQ ID NO: 524, a VHCDR2 encoded by the nucleotide sequence of SEQ ID NO: 525, and a VHCDR3 encoded by the nucleotide sequence of SEQ ID NO: 526; and a VL comprising a VLCDRl encoded by the nucleotide sequence of SEQ ID NO: 529, a VLCDR2 encoded by the nucleotide sequence of SEQ ID NO: 530, and a VLCDR3 encoded by the nucleotide sequence of SEQ ID NO: 531, each disclosed in Table 1.
- the anti-PD-1 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 506, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 506. In one embodiment, the anti-PD-1 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 520, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 520. In one embodiment, the anti-PD-1 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 516, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 516.
- the anti-PD-1 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 506 and a VL comprising the amino acid sequence of SEQ ID NO: 520. In one embodiment, the anti-PD-1 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 506 and a VL comprising the amino acid sequence of SEQ ID NO: 516.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 507, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 507. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 521 or 517, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 521 or 517. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 507 and a VL encoded by the nucleotide sequence of SEQ ID NO: 521 or 517.
- the anti-PD-1 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 508, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 508. In one embodiment, the anti-PD-1 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 522, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 522. In one embodiment, the anti-PD-1 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 518, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 518.
- the anti-PD-1 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 508 and a light chain comprising the amino acid sequence of SEQ ID NO: 522. In one embodiment, the anti-PD-1 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 508 and a light chain comprising the amino acid sequence of SEQ ID NO: 518.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 509, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 509.
- the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 523 or 519, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 523 or 519.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 509 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 523 or 519.
- the antibody molecules described herein can be made by vectors, host cells, and methods described in US 2015/0210769, incorporated by reference in its entirety.
- the anti-PD-1 antibody molecule is Nivolumab (Bristol-Myers Squibb), also known as MDX-1106, MDX-1106-04, ONO-4538, BMS-936558, or OPDIVO®. Nivolumab (clone 5C4) and other anti-PD- 1 antibodies are disclosed in US 8,008,449 and WO 2006/121168, incorporated by reference in their entirety.
- the anti-PD- 1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of
- Nivolumab e.g. , as disclosed in Table 2.
- the anti-PD-1 antibody molecule is Pembrolizumab (Merck & Co), also known as Lambrolizumab, MK-3475, MK03475, SCH-900475, or KEYTRUDA®.
- Pembrolizumab and other anti-PD-1 antibodies are disclosed in Hamid, O. et al. (2013) New England Journal of Medicine 369 (2): 134-44, US 8,354,509, and WO 2009/114335, incorporated by reference in their entirety.
- the anti-PD- 1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Pembrolizumab, e.g. , as disclosed in Table 2.
- the anti-PD-1 antibody molecule is Pidilizumab (CureTech), also known as CT-011. Pidilizumab and other anti-PD-1 antibodies are disclosed in Rosenblatt, J. et al. (2011) J Immunotherapy 34(5): 409-18, US 7,695,715, US 7,332,582, and US 8,686, 119, incorporated by reference in their entirety.
- the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Pidilizumab, e.g., as disclosed in Table 2.
- the anti-PD-1 antibody molecule is MEDI0680 (Medimmune), also known as AMP-514. MEDI0680 and other anti-PD-1 antibodies are disclosed in US 9,205, 148 and WO 2012/145493, incorporated by reference in their entirety.
- the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of MEDI0680.
- the anti-PD-1 antibody molecule is REGN2810 (Regeneron). In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of REGN2810.
- the anti-PD-1 antibody molecule is PF-06801591 (Pfizer). In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of PF-06801591.
- the anti-PD-1 antibody molecule is BGB-A317 or BGB-108 (Beigene). In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of BGB-A317 or BGB-108.
- the anti-PD-1 antibody molecule is INCSHR1210 (Incyte), also known as INCSHR01210 or SHR- 1210.
- the anti-PD- 1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of INCSHR1210.
- the anti-PD-1 antibody molecule is TSR-042 (Tesaro), also known as
- the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of TSR-042.
- anti-PD-1 antibodies include those described, e.g., in WO 2015/112800, WO 2016/092419, WO 2015/085847, WO 2014/179664, WO 2014/194302, WO 2014/209804, WO 2015/200119, US 8,735,553, US 7,488,802, US 8,927,697, US 8,993,731, and US 9, 102,727, incorporated by reference in their entirety.
- the anti-PD-1 antibody is an antibody that competes for binding with, and/or binds to the same epitope on PD-1 as, one of the anti-PD-1 antibodies described herein.
- the PD-1 inhibitor is a peptide that inhibits the PD-1 signaling pathway, e.g., as described in US 8,907,053, incorporated by reference in its entirety.
- the PD-1 inhibitor is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PD-L1 or PD-L2 fused to a constant region (e.g., an Fc region of an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PD-L1 or PD-L2 fused to a constant region (e.g., an Fc region of an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PD-L1 or PD-L2 fused to a constant region (e.g., an Fc region of an immunoadhesin (e.g., an immunoad
- the PD-1 inhibitor is AMP-224 (B7-DCIg (Amplimmune), e.g., disclosed in WO 2010/027827 and WO 2011/066342, incorporated by reference in their entirety).
- the anti-TIM-3 antibody molecule described herein is administered in combination with a PD-L1 inhibitor.
- the PD-L1 inhibitor is chosen from FAZ053 (Novartis), Atezolizumab (Genentech/Roche), Avelumab (Merck Serono and Pfizer),
- the PD-L1 inhibitor is an anti-PD-Ll antibody molecule. In one embodiment, the PD-L1 inhibitor is an anti-PD-Ll antibody molecule as disclosed in US
- the anti-PD-Ll antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 3 (e.g., from the heavy and light chain variable region sequences of BAP058-Clone O or BAP058-Clone N disclosed in Table 3), or encoded by a nucleotide sequence shown in Table 3.
- the CDRs are according to the Kabat definition (e.g., as set out in Table 3).
- the CDRs are according to the Chothia definition (e.g., as set out in Table 3).
- the CDRs are according to the combined CDR definitions of both Kabat and Chothia (e.g., as set out in Table 3).
- the combination of Kabat and Chothia CDR of VH CDR1 or collectively all of the CDRs from a heavy and light chain variable region comprising an amino acid sequence
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 3, or encoded by a nucleotide sequence shown in Table 3.
- the anti-PD-Ll antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 601, a VHCDR2 amino acid sequence of SEQ ID NO: 602, and a VHCDR3 amino acid sequence of SEQ ID NO: 603; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 609, a VLCDR2 amino acid sequence of SEQ ID NO: 610, and a VLCDR3 amino acid sequence of SEQ ID NO: 611, each disclosed in Table 3.
- VH heavy chain variable region
- VL light chain variable region
- the anti-PD-Ll antibody molecule comprises a VH comprising a
- the anti-PD-Ll antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 606, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 606. In one embodiment, the anti-PD-Ll antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 616, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 616. In one embodiment, the anti-PD-Ll antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 620, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 620.
- the anti-PD-Ll antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 624, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 624.
- the anti-PD-Ll antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 606 and a VL comprising the amino acid sequence of SEQ ID NO: 616.
- the anti-PD-Ll antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 620 and a VL comprising the amino acid sequence of SEQ ID NO: 624.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 607, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 607. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 617, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 617.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 621, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 621. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 625, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 625. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 607 and a VL encoded by the nucleotide sequence of SEQ ID NO: 617. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 621 and a VL encoded by the nucleotide sequence of SEQ ID NO: 625.
- the anti-PD-Ll antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 608, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 608. In one embodiment, the anti-PD-Ll antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 618, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 618. In one embodiment, the anti-PD-Ll antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 622, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 622.
- the anti-PD-Ll antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 626, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 626.
- the anti-PD-Ll antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 608 and a light chain comprising the amino acid sequence of SEQ ID NO: 618.
- the anti-PD-Ll antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 622 and a light chain comprising the amino acid sequence of SEQ ID NO: 626.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 615, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 615. In one embodiment, the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 619, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 619.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 623, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 623. In one embodiment, the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 627, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 627. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 615 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 619. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 623 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 627.
- the antibody molecules described herein can be made by vectors, host cells, and methods described in US 2016/0108123, incorporated by reference in its entirety. Table 3. Amino acid and nucleotide sequences of exemplary anti-PD-Ll antibody molecules
- SEQ ID NO: 617 DNA VL GCTATTCAGCTGACTCAGTCACCTAGTAGCCTGAGCGCTAGTG
- SEQ ID NO: 619 DNA light GCTATTCAGCTGACTCAGTCACCTAGTAGCCTGAGCGCTAGTG chain TGGGCGATAGAGTGACTATCACCTGTAAAGCCTCTCAGGACGT
- SEQ ID NO: 625 DNA VL GACGTCGTGATGACTCAGTCACCCCTGAGCCTGCCCGTGACCC
- SEQ ID NO: 627 DNA light GACGTCGTGATGACTCAGTCACCCCTGAGCCTGCCCGTGACCC chain TGGGGCAGCCCGCCTCTATTAGCTGTAAAGCCTCTCAGGACGT
- SEQ ID NO: 629 (Kabat) HCDR2 AGAATCGACCCTAATAGCGGCTCTACTAAGTATAACGAGAAG
- SEQ ID NO: 630 (Kabat) HCDR3 GACTATAGAAAGGGCCTGTACGCTATGGACTAC
- SEQ ID NO: 633 (Kabat) LCDR1 AAAGCCTCTCAGGACGTGGGCACCGCCGTGGCC
- SEQ ID NO: 634 (Kabat) LCDR2 TGGGCCTCTACTAGACACACC
- SEQ ID NO: 635 (Kabat) LCDR3 CAGCAGTATAATAGCTACCCCCTGACC
- SEQ ID NO: 629 (Kabat) HCDR2 AGAATCGACCCTAATAGCGGCTCTACTAAGTATAACGAGAAG
- SEQ ID NO: 630 (Kabat) HCDR3 GACTATAGAAAGGGCCTGTACGCTATGGACTAC
- SEQ ID NO: 633 (Kabat) LCDR1 AAAGCCTCTCAGGACGTGGGCACCGCCGTGGCC
- SEQ ID NO: 634 (Kabat) LCDR2 TGGGCCTCTACTAGACACACC
- SEQ ID NO: 635 (Kabat) LCDR3 CAGCAGTATAATAGCTACCCCCTGACC
- the anti-PD-Ll antibody molecule is Atezolizumab (Genentech/Roche), also known as MPDL3280A, RG7446, R05541267, YW243.55.S70, or TECENTRIQTM.
- Atezolizumab and other anti-PD-Ll antibodies are disclosed in US 8,217, 149, incorporated by reference in its entirety.
- the anti-PD-Ll antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Atezolizumab, e.g. , as disclosed in Table 4.
- the anti-PD-Ll antibody molecule is Avelumab (Merck Serono and
- the anti-PD-Ll antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Avelumab, e.g. , as disclosed in Table 4.
- the anti-PD-Ll antibody molecule is Durvalumab
- the anti-PD-Ll antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Durvalumab, e.g., as disclosed in Table 4.
- the anti-PD-Ll antibody molecule is BMS-936559 (Bristol-Myers Squibb), also known as MDX-1105 or 12A4. BMS-936559 and other anti-PD-Ll antibodies are disclosed in US 7,943,743 and WO 2015/081158, incorporated by reference in their entirety.
- the anti-PD-Ll antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of BMS-936559, e.g., as disclosed in Table 4.
- anti-PD-Ll antibodies include those described, e.g., in WO 2015/181342, WO 2014/100079, WO 2016/000619, WO 2014/022758, WO 2014/055897, WO 2015/061668, WO 2013/079174, WO 2012/145493, WO 2015/112805, WO 2015/109124, WO 2015/195163, US 8, 168, 179, US 8,552, 154, US 8,460,927, and US 9, 175,082, incorporated by reference in their entirety.
- the anti-PD-Ll antibody is an antibody that competes for binding with, and/or binds to the same epitope on PD-Ll as, one of the anti-PD-Ll antibodies described herein.
- the anti-TIM-3 antibody molecule described herein is administered in combination with a LAG-3 inhibitor.
- the LAG-3 inhibitor is chosen from LAG525 (Novartis), BMS-986016 (Bristol-Myers Squibb), or TSR-033 (Tesaro).
- the LAG-3 inhibitor is an anti-LAG-3 antibody molecule. In one embodiment, the LAG-3 inhibitor is an anti-LAG-3 antibody molecule as disclosed in US
- the anti-LAG-3 antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 5 (e.g., from the heavy and light chain variable region sequences of BAP050-Clone I or BAP050-Clone J disclosed in Table 5), or encoded by a nucleotide sequence shown in Table 5.
- the CDRs are according to the Kabat definition (e.g., as set out in Table 5).
- the CDRs are according to the Chothia definition (e.g., as set out in Table 5).
- the CDRs are according to the combined CDR definitions of both Kabat and Chothia (e.g., as set out in Table 5).
- the combination of Kabat and Chothia CDR of VH CDR1 or collectively all of the CDRs from a heavy and light chain variable region comprising an amino acid sequence shown in Table
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 5, or encoded by a nucleotide sequence shown in
- the anti-LAG-3 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 701, a VHCDR2 amino acid sequence of SEQ ID NO: 702, and a VHCDR3 amino acid sequence of SEQ ID NO: 703; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 710, a VLCDR2 amino acid sequence of SEQ ID NO: 711, and a VLCDR3 amino acid sequence of SEQ ID NO: 712, each disclosed in Table 5.
- VH heavy chain variable region
- VL light chain variable region
- the anti-LAG-3 antibody molecule comprises a VH comprising a VHCDR1 encoded by the nucleotide sequence of SEQ ID NO: 736 or 737, a VHCDR2 encoded by the nucleotide sequence of SEQ ID NO: 738 or 739, and a VHCDR3 encoded by the nucleotide sequence of SEQ ID NO: 740 or 741; and a VL comprising a VLCDR1 encoded by the nucleotide sequence of SEQ ID NO: 746 or 747, a VLCDR2 encoded by the nucleotide sequence of SEQ ID NO: 748 or 749, and a VLCDR3 encoded by the nucleotide sequence of SEQ ID NO: 750 or 751, each disclosed in Table 5.
- the anti-LAG-3 antibody molecule comprises a VH comprising a VHCDR1 encoded by the nucleotide sequence of SEQ ID NO: 758 or 737, a VHCDR2 encoded by the nucleotide sequence of SEQ ID NO: 759 or 739, and a VHCDR3 encoded by the nucleotide sequence of SEQ ID NO: 760 or 741; and a VL comprising a VLCDR1 encoded by the nucleotide sequence of SEQ ID NO: 746 or 747, a VLCDR2 encoded by the nucleotide sequence of SEQ ID NO: 748 or 749, and a VLCDR3 encoded by the nucleotide sequence of SEQ ID NO: 750 or 751, each disclosed in Table 5.
- the anti-LAG-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 706, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 706. In one embodiment, the anti-LAG-3 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 718, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 718. In one embodiment, the anti-LAG-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 724, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 724.
- the anti-LAG-3 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 730, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 730.
- the anti-LAG-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 706 and a VL comprising the amino acid sequence of SEQ ID NO: 718.
- the anti-LAG-3 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 724 and a VL comprising the amino acid sequence of SEQ ID NO: 730.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 707 or 708, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 707 or 708. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 719 or 720, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 719 or 720.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 725 or 726, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 725 or 726. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 731 or 732, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 731 or 732.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 707 or 708 and a VL encoded by the nucleotide sequence of SEQ ID NO: 719 or 720. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 725 or 726 and a VL encoded by the nucleotide sequence of SEQ ID NO: 731 or 732.
- the anti-LAG-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 709, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 709.
- the anti-LAG-3 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 721, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 721.
- the anti-LAG-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 727, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 727.
- the anti-LAG-3 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 733, or an amino acid sequence at least
- the anti-LAG-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 709 and a light chain comprising the amino acid sequence of SEQ ID NO: 721. In one embodiment, the anti-LAG-3 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 727 and a light chain comprising the amino acid sequence of SEQ ID NO: 733.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 716 or 717, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 716 or 717.
- the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 722 or 723, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 722 or 723.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 728 or 729, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 728 or 729.
- the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 734 or 735, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 734 or 735.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 716 or 717 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 722 or 723. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 728 or 729 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 734 or 735.
- the antibody molecules described herein can be made by vectors, host cells, and methods described in US 2015/0259420, incorporated by reference in its entirety. Table 5. Amino acid and nucleotide sequences of exemplary anti-LAG-3 antibody molecules
- SEQ ID NO: 717 chain AAGAGGAGATGACCAAGAACCAGGTGTCCCTGACCTGTCTGGT GAAGGGCTTCTACCCAAGCGACATCGCCGTGGAGTGGGAGAGC
- the anti-LAG-3 antibody molecule is BMS-986016 (Bristol-Myers Squibb), also known as BMS986016.
- BMS-986016 and other anti-LAG-3 antibodies are disclosed in WO 2015/116539 and US 9,505,839, incorporated by reference in their entirety.
- the anti-LAG-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of BMS-986016, e.g., as disclosed in Table 6.
- the anti-LAG-3 antibody molecule is TSR-033 (Tesaro). In one embodiment, the anti-LAG-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of TSR-033.
- the anti-LAG-3 antibody molecule is IMP731 or GSK2831781 (GSK and Prima BioMed). IMP731 and other anti-LAG-3 antibodies are disclosed in WO 2008/132601 and US 9,244,059, incorporated by reference in their entirety.
- the anti-LAG-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of IMP731, e.g., as disclosed in Table 6.
- the anti-LAG-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of
- the anti-LAG-3 antibody molecule is IMP761 (Prima BioMed). In one embodiment, the anti-LAG-3 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of IMP761.
- anti-LAG-3 antibodies include those described, e.g. , in WO 2008/132601, WO 2010/019570, WO 2014/140180, WO 2015/116539, WO 2015/200119, WO 2016/028672, US 9,244,059, US 9,505,839, incorporated by reference in their entirety.
- the anti-LAG-3 antibody is an antibody that competes for binding with, and/or binds to the same epitope on LAG-3 as, one of the anti-LAG-3 antibodies described herein.
- the anti-LAG-3 inhibitor is a soluble LAG-3 protein, e.g. , IMP321 (Prima BioMed), e.g. , as disclosed in WO 2009/044273, incorporated by reference in its entirety.
- IMP321 Primary BioMed
- the anti-TIM-3 antibody molecule described herein is administered in combination with a GITR agonist.
- the GITR agonist is GWN323 (NVS), BMS-986156, MK-4166 or MK- 1248 (Merck), TRX518 (Leap Therapeutics), INCAGN1876 (Incyte/Agenus), AMG 228 (Amgen) or INBRX-110 (Inhibrx).
- the GITR agonist is an anti-GITR antibody molecule. In one embodiment, the GITR agonist is an anti-GITR antibody molecule as described in WO 2016/057846, published on April 14, 2016, entitled “Compositions and Methods of Use for Augmented Immune Response and Cancer Therapy,” incorporated by reference in its entirety.
- the anti-GITR antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 9 (e.g., from the heavy and light chain variable region sequences of MAB7 disclosed in Table 9), or encoded by a nucleotide sequence shown in Table 9.
- CDRs are according to the Kabat definition (e.g., as set out in Table 9).
- the CDRs are according to the Chothia definition (e.g. , as set out in Table 9).
- one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 9, or encoded by a nucleotide sequence shown in Table 9.
- amino acid substitutions e.g., conservative amino acid substitutions
- deletions e.g., conservative amino acid substitutions
- the anti-GITR antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 909, a VHCDR2 amino acid sequence of SEQ ID NO: 911, and a VHCDR3 amino acid sequence of SEQ ID NO: 913; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 914, a VLCDR2 amino acid sequence of SEQ ID NO: 916, and a VLCDR3 amino acid sequence of SEQ ID NO: 918, each disclosed in Table 9.
- VH heavy chain variable region
- VL light chain variable region
- the anti-GITR antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 901, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 901.
- the anti-GITR antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 902, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 902.
- the anti-GITR antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 901 and a VL comprising the amino acid sequence of SEQ ID NO: 902.
- the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 905, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 905. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 906, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 906. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 905 and a VL encoded by the nucleotide sequence of SEQ ID NO: 906.
- the anti-GITR antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 903, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 903. In one embodiment, the anti-GITR antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 904, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 904. In one embodiment, the anti-GITR antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 903 and a light chain comprising the amino acid sequence of SEQ ID NO: 904.
- the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 907, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 907. In one embodiment, the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 908, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 908. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 907 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 908.
- the antibody molecules described herein can be made by vectors, host cells, and methods described in WO 2016/057846, incorporated by reference in its entirety.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3066747A CA3066747A1 (en) | 2017-06-27 | 2018-06-27 | Dosage regimens for anti-tim-3 antibodies and uses thereof |
| JP2019572138A JP2020525483A (ja) | 2017-06-27 | 2018-06-27 | 抗tim−3抗体のための投与レジメンおよびその使用 |
| KR1020207001985A KR20200022447A (ko) | 2017-06-27 | 2018-06-27 | 항-tim-3 항체의 투여 요법 및 그의 용도 |
| CN201880054820.5A CN111050791A (zh) | 2017-06-27 | 2018-06-27 | 用于抗tim-3抗体的给药方案及其用途 |
| US16/626,148 US20200223924A1 (en) | 2017-06-27 | 2018-06-27 | Dosage regimens for anti-tim-3 antibodies and uses thereof |
| MX2019015738A MX2019015738A (es) | 2017-06-27 | 2018-06-27 | Regimen de dosificacion para anticuerpos anti-tim-3 y usos de los mismos. |
| AU2018292618A AU2018292618A1 (en) | 2017-06-27 | 2018-06-27 | Dosage regimens for anti-TIM-3 antibodies and uses thereof |
| RU2020102863A RU2804775C2 (ru) | 2017-06-27 | 2018-06-27 | Режимы дозирования для антител против tim-3 и их применения |
| EP18743243.0A EP3645037A1 (en) | 2017-06-27 | 2018-06-27 | Dosage regimens for anti-tim-3 antibodies and uses thereof |
| IL271222A IL271222A (en) | 2017-06-27 | 2019-12-05 | Dosing regimens for anti-tim-3 antibodies and their uses |
| JP2023111992A JP2023145487A (ja) | 2017-06-27 | 2023-07-07 | 抗tim-3抗体のための投与レジメンおよびその使用 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762525465P | 2017-06-27 | 2017-06-27 | |
| US62/525,465 | 2017-06-27 | ||
| US201862633899P | 2018-02-22 | 2018-02-22 | |
| US62/633,899 | 2018-02-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019006007A1 true WO2019006007A1 (en) | 2019-01-03 |
Family
ID=62976246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/039825 Ceased WO2019006007A1 (en) | 2017-06-27 | 2018-06-27 | POSOLOGICAL REGIMES FOR ANTI-TIM3 ANTIBODIES AND USES THEREOF |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20200223924A1 (https=) |
| EP (1) | EP3645037A1 (https=) |
| JP (2) | JP2020525483A (https=) |
| KR (1) | KR20200022447A (https=) |
| CN (1) | CN111050791A (https=) |
| AU (1) | AU2018292618A1 (https=) |
| CA (1) | CA3066747A1 (https=) |
| IL (1) | IL271222A (https=) |
| MX (1) | MX2019015738A (https=) |
| WO (1) | WO2019006007A1 (https=) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019143607A1 (en) * | 2018-01-16 | 2019-07-25 | Bristol-Myers Squibb Company | Methods of treating cancer with antibodies against tim3 |
| US10472419B2 (en) | 2014-01-31 | 2019-11-12 | Novartis Ag | Antibody molecules to TIM-3 and uses thereof |
| US10570204B2 (en) | 2013-09-26 | 2020-02-25 | The Medical College Of Wisconsin, Inc. | Methods for treating hematologic cancers |
| WO2020146196A1 (en) * | 2019-01-11 | 2020-07-16 | Eli Lilly And Company | Tim-3 antibodies and combinations with other checkpoint inhibitors for the treatment of cancer |
| US10752687B2 (en) | 2014-01-24 | 2020-08-25 | Novartis Ag | Antibody molecules to PD-1 and uses thereof |
| WO2021051352A1 (zh) * | 2019-09-19 | 2021-03-25 | 上药生物治疗(香港)有限公司 | 一种分离的抗原结合蛋白及其用途 |
| WO2021079195A1 (en) * | 2019-10-21 | 2021-04-29 | Novartis Ag | Tim-3 inhibitors and uses thereof |
| WO2021206652A1 (en) * | 2020-04-10 | 2021-10-14 | Hacettepe Üni̇versi̇tesi̇ | Targeting tim-3 and lag-3 receptors induced by cd44+ cd90+ cancer stem cells in small cell lung cancer |
| US11344620B2 (en) | 2014-09-13 | 2022-05-31 | Novartis Ag | Combination therapies |
| US20220185896A1 (en) * | 2019-05-01 | 2022-06-16 | New York University | Anti-galectin-9 antibodies and uses thereof |
| US12252535B2 (en) | 2014-03-14 | 2025-03-18 | Novartis Ag | Antibody molecules to LAG-3 and uses thereof |
| US12600777B2 (en) | 2015-07-29 | 2026-04-14 | Novartis Ag | Combination therapies comprising antibody molecules to LAG-3 |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7542529B2 (ja) | 2018-10-17 | 2024-08-30 | バイオラインアールエックス・リミテッド | 転移性膵臓腺癌の処置 |
| CN113080114A (zh) * | 2021-04-12 | 2021-07-09 | 浙江大学 | 一种提高鱼类子代成活率的方法 |
| KR20250035054A (ko) * | 2022-06-07 | 2025-03-11 | 인사이트 코포레이션 | 암을 치료하기 위한 항-pd-1 활성제, 항-tim-3 활성제, 및 항-lag-3 활성제의 조합 요법 |
| CN117986383A (zh) * | 2022-11-02 | 2024-05-07 | 北京昌平实验室 | 融合蛋白及其应用 |
| US20250034255A1 (en) * | 2023-03-08 | 2025-01-30 | Incyte Corporation | Combination therapy of anti-pd-1 active agent, anti-tim-3 active agent, and anti-lag-3 active agent for treating cancer |
Citations (206)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4433059A (en) | 1981-09-08 | 1984-02-21 | Ortho Diagnostic Systems Inc. | Double antibody conjugate |
| US4444878A (en) | 1981-12-21 | 1984-04-24 | Boston Biomedical Research Institute, Inc. | Bispecific antibody determinants |
| EP0125023A1 (en) | 1983-04-08 | 1984-11-14 | Genentech, Inc. | Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor |
| EP0171496A2 (en) | 1984-08-15 | 1986-02-19 | Research Development Corporation of Japan | Process for the production of a chimera monoclonal antibody |
| EP0173494A2 (en) | 1984-08-27 | 1986-03-05 | The Board Of Trustees Of The Leland Stanford Junior University | Chimeric receptors by DNA splicing and expression |
| WO1986001533A1 (en) | 1984-09-03 | 1986-03-13 | Celltech Limited | Production of chimeric antibodies |
| EP0184187A2 (en) | 1984-12-04 | 1986-06-11 | Teijin Limited | Mouse-human chimaeric immunoglobulin heavy chain, and chimaeric DNA encoding it |
| GB2188638A (en) | 1986-03-27 | 1987-10-07 | Gregory Paul Winter | Chimeric antibodies |
| EP0346087A2 (en) | 1988-06-09 | 1989-12-13 | Snow Brand Milk Products Co., Ltd. | Hybrid antibody and process for the production thereof |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| EP0388151A1 (en) | 1989-03-13 | 1990-09-19 | Celltech Limited | Modified antibodies |
| WO1991000906A1 (en) | 1989-07-12 | 1991-01-24 | Genetics Institute, Inc. | Chimeric and transgenic animals capable of producing human antibodies |
| WO1991003493A1 (en) | 1989-08-29 | 1991-03-21 | The University Of Southampton | Bi-or trispecific (fab)3 or (fab)4 conjugates |
| WO1991010741A1 (en) | 1990-01-12 | 1991-07-25 | Cell Genesys, Inc. | Generation of xenogeneic antibodies |
| WO1991017271A1 (en) | 1990-05-01 | 1991-11-14 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| WO1992003918A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1992003917A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International | Homologous recombination in mammalian cells |
| WO1992009690A2 (en) | 1990-12-03 | 1992-06-11 | Genentech, Inc. | Enrichment method for variant proteins with altered binding properties |
| WO1992015679A1 (en) | 1991-03-01 | 1992-09-17 | Protein Engineering Corporation | Improved epitode displaying phage |
| WO1992018619A1 (en) | 1991-04-10 | 1992-10-29 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| WO1992020791A1 (en) | 1990-07-10 | 1992-11-26 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| EP0519596A1 (en) | 1991-05-17 | 1992-12-23 | Merck & Co. Inc. | A method for reducing the immunogenicity of antibody variable domains |
| WO1993001288A1 (de) | 1991-07-08 | 1993-01-21 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Phagemid zum screenen von antikörpern |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| WO1993023537A1 (en) | 1992-05-08 | 1993-11-25 | Creative Biomolecules | Chimeric multivalent protein analogues and methods of use thereof |
| US5273743A (en) | 1990-03-09 | 1993-12-28 | Hybritech Incorporated | Trifunctional antibody-like compounds as a combined diagnostic and therapeutic agent |
| WO1994004678A1 (en) | 1992-08-21 | 1994-03-03 | Casterman Cecile | Immunoglobulins devoid of light chains |
| WO1994009131A1 (en) | 1992-10-15 | 1994-04-28 | Scotgen Limited | Recombinant specific binding protein |
| WO1994012625A2 (en) | 1992-11-23 | 1994-06-09 | Zeneca Limited | LIGAND BINDING VARIABLE DOMAIN (V-MIN) COMPRISING A FRAMEWORK REGION WITH A CYCLICALLY PERMUTED CENTRAL β-BARREL |
| WO1995009917A1 (en) | 1993-10-07 | 1995-04-13 | The Regents Of The University Of California | Genetically engineered bispecific tetravalent antibodies |
| US5475092A (en) | 1992-03-25 | 1995-12-12 | Immunogen Inc. | Cell binding agent conjugates of analogues and derivatives of CC-1065 |
| US5534254A (en) | 1992-02-06 | 1996-07-09 | Chiron Corporation | Biosynthetic binding proteins for immuno-targeting |
| WO1996037621A2 (en) | 1995-05-23 | 1996-11-28 | Morphosys Gesellschaft Für Proteinoptimierung Mbh | Multimeric proteins |
| US5582996A (en) | 1990-12-04 | 1996-12-10 | The Wistar Institute Of Anatomy & Biology | Bifunctional antibodies and method of preparing same |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5591828A (en) | 1989-06-22 | 1997-01-07 | Behringwerke Aktiengesellschaft | Bispecific and oligospecific mono-and oligovalent receptors, the preparation and use thereof |
| US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5635602A (en) | 1993-08-13 | 1997-06-03 | The Regents Of The University Of California | Design and synthesis of bispecific DNA-antibody conjugates |
| US5637481A (en) | 1993-02-01 | 1997-06-10 | Bristol-Myers Squibb Company | Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell |
| US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
| US5837821A (en) | 1992-11-04 | 1998-11-17 | City Of Hope | Antibody construct |
| US5837242A (en) | 1992-12-04 | 1998-11-17 | Medical Research Council | Multivalent and multispecific binding proteins, their manufacture and use |
| US5844094A (en) | 1992-09-25 | 1998-12-01 | Commonwealth Scientific And Industrial Research Organization | Target binding polypeptide |
| US5864019A (en) | 1990-06-11 | 1999-01-26 | Celltech Limited | Multivalent antigen-binding proteins |
| US5869620A (en) | 1986-09-02 | 1999-02-09 | Enzon, Inc. | Multivalent antigen-binding proteins |
| US5910573A (en) | 1992-01-23 | 1999-06-08 | Merck Patent Gesellschaft Mit Beschrankter Haftung | Monomeric and dimeric antibody-fragment fusion proteins |
| US5932448A (en) | 1991-11-29 | 1999-08-03 | Protein Design Labs., Inc. | Bispecific antibody heterodimers |
| US5959083A (en) | 1991-06-03 | 1999-09-28 | Behringwerke Aktiengellschaft | Tetravalent bispecific receptors, the preparation and use thereof |
| US5989830A (en) | 1995-10-16 | 1999-11-23 | Unilever Patent Holdings Bv | Bifunctional or bivalent antibody fragment analogue |
| WO1999064460A1 (en) | 1998-06-10 | 1999-12-16 | Celltech Therapeutics Limited | Divalent antibody fragments |
| US6005079A (en) | 1992-08-21 | 1999-12-21 | Vrije Universiteit Brussels | Immunoglobulins devoid of light chains |
| WO2000006605A2 (en) | 1998-07-28 | 2000-02-10 | Micromet Ag | Heterominibodies |
| US6239259B1 (en) | 1996-04-04 | 2001-05-29 | Unilever Patent Holdings B.V. | Multivalent and multispecific antigen-binding protein |
| US6294353B1 (en) | 1994-10-20 | 2001-09-25 | Morphosys Ag | Targeted hetero-association of recombinant proteins to multi-functional complexes |
| US6333396B1 (en) | 1998-10-20 | 2001-12-25 | Enzon, Inc. | Method for targeted delivery of nucleic acids |
| US20020004587A1 (en) | 2000-04-11 | 2002-01-10 | Genentech, Inc. | Multivalent antibodies and uses therefor |
| US20020076406A1 (en) | 2000-07-25 | 2002-06-20 | Leung Shui-On | Multivalent target binding protein |
| US20020103345A1 (en) | 2000-05-24 | 2002-08-01 | Zhenping Zhu | Bispecific immunoglobulin-like antigen binding proteins and method of production |
| WO2002072635A2 (en) | 2001-03-13 | 2002-09-19 | University College London | Specific binding members |
| US6476198B1 (en) | 1993-07-13 | 2002-11-05 | The Scripps Research Institute | Multispecific and multivalent antigen-binding polypeptide molecules |
| US6511663B1 (en) | 1991-06-11 | 2003-01-28 | Celltech R&D Limited | Tri- and tetra-valent monospecific antigen-binding proteins |
| US20030207346A1 (en) | 1997-05-02 | 2003-11-06 | William R. Arathoon | Method for making multispecific antibodies having heteromultimeric and common components |
| US20030211078A1 (en) | 2001-12-07 | 2003-11-13 | Heavner George A. | Pseudo-antibody constructs |
| US6670453B2 (en) | 1997-10-27 | 2003-12-30 | Unilever Patent Holdings B.V. | Multivalent antigen-binding proteins |
| US6743896B2 (en) | 1997-04-30 | 2004-06-01 | Enzon, Inc. | Single-chain antigen-binding proteins capable of glycosylation, production and uses thereof |
| WO2004081051A1 (en) | 2003-03-12 | 2004-09-23 | The University Of Birmingham | Bispecific antibodies |
| US6809185B1 (en) | 1998-01-23 | 2004-10-26 | Vlaams Interuniversitair Instituut Voor Biotechnologie | Multipurpose antibody derivatives |
| US20040219643A1 (en) | 2001-06-28 | 2004-11-04 | Greg Winter | Dual-specific ligand |
| US20040220388A1 (en) | 2000-06-30 | 2004-11-04 | Nico Mertens | Novel heterodimeric fusion proteins |
| US20040242847A1 (en) | 2000-10-20 | 2004-12-02 | Naoshi Fukushima | Degraded agonist antibody |
| US6833441B2 (en) | 2001-08-01 | 2004-12-21 | Abmaxis, Inc. | Compositions and methods for generating chimeric heteromultimers |
| US20050004352A1 (en) | 1998-04-09 | 2005-01-06 | Roland Kontermann | Single-chain multiple antigen-binding molecule, its preparation and use |
| US20050003403A1 (en) | 2003-04-22 | 2005-01-06 | Rossi Edmund A. | Polyvalent protein complex |
| US20050069552A1 (en) | 2003-07-28 | 2005-03-31 | Bleck Gregory T. | Fusion antibodies |
| US20050079170A1 (en) | 2001-09-14 | 2005-04-14 | Fabrice Le Gall | Dimeric and multimeric antigen binding structure |
| US20050100543A1 (en) | 2003-07-01 | 2005-05-12 | Immunomedics, Inc. | Multivalent carriers of bi-specific antibodies |
| US20050136049A1 (en) | 2001-01-17 | 2005-06-23 | Ledbetter Jeffrey A. | Binding constructs and methods for use thereof |
| US20050136051A1 (en) | 2003-12-22 | 2005-06-23 | Bernard Scallon | Methods for generating multimeric molecules |
| US20050163782A1 (en) | 2003-06-27 | 2005-07-28 | Biogen Idec Ma Inc. | Modified binding molecules comprising connecting peptides |
| US20050266425A1 (en) | 2003-12-31 | 2005-12-01 | Vaccinex, Inc. | Methods for producing and identifying multispecific antibodies |
| WO2006020258A2 (en) | 2004-07-17 | 2006-02-23 | Imclone Systems Incorporated | Novel tetravalent bispecific antibody |
| US20060083747A1 (en) | 2002-12-27 | 2006-04-20 | Domantis Limited | Fc fusion |
| US20060120960A1 (en) | 2004-01-30 | 2006-06-08 | Sergey Deyev | Multivalent complexes, their production and method of use |
| US20060204493A1 (en) | 2004-09-02 | 2006-09-14 | Genentech, Inc. | Heteromultimeric molecules |
| WO2006105021A2 (en) | 2005-03-25 | 2006-10-05 | Tolerrx, Inc. | Gitr binding molecules and uses therefor |
| WO2006106905A1 (ja) | 2005-03-31 | 2006-10-12 | Chugai Seiyaku Kabushiki Kaisha | 会合制御によるポリペプチド製造方法 |
| US7129330B1 (en) | 1998-05-05 | 2006-10-31 | Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts | Multivalent antibody constructs |
| WO2006121168A1 (en) | 2005-05-09 | 2006-11-16 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics |
| US20060263367A1 (en) | 2005-05-23 | 2006-11-23 | Fey Georg H | Bispecific antibody devoid of Fc region and method of treatment using same |
| US20070004909A1 (en) | 2005-04-15 | 2007-01-04 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
| WO2007004606A1 (ja) | 2005-07-04 | 2007-01-11 | Nikon Vision Co., Ltd. | 測距装置 |
| US7183076B2 (en) | 1997-05-02 | 2007-02-27 | Genentech, Inc. | Method for making multispecific antibodies having heteromultimeric and common components |
| US20070087381A1 (en) | 2002-04-15 | 2007-04-19 | Tetsuo Kojima | Methods for constructing scdb libraries |
| WO2007044887A2 (en) | 2005-10-11 | 2007-04-19 | Transtarget, Inc. | Method for producing a population of homogenous tetravalent bispecific antibodies |
| US20070128150A1 (en) | 2003-12-23 | 2007-06-07 | Norman Timothy J | Branched molecular scaffolds for linking polymer residues to biologically active moieties |
| US20070141049A1 (en) | 2005-08-26 | 2007-06-21 | Reinhard Bredehorst | Bivalent IgY antibody constructs for diagnostic and therapeutic applications |
| US20070154901A1 (en) | 1997-06-11 | 2007-07-05 | Protein Engineering Technology Aps | Trimerising module |
| WO2007084342A2 (en) | 2006-01-13 | 2007-07-26 | The Government Of The United States, As Represented By The Secretary Of The Department Of Health And Human Services, National Institutes Of Health | Codon optimi zed il- 15 and il- 15r-alpha genes for expression in mammalian cells |
| WO2007095338A2 (en) | 2006-02-15 | 2007-08-23 | Imclone Systems Incorporated | Functional antibodies |
| WO2007110205A2 (en) | 2006-03-24 | 2007-10-04 | Merck Patent Gmbh | Engineered heterodimeric protein domains |
| US20070274985A1 (en) | 2006-05-26 | 2007-11-29 | Stefan Dubel | Antibody |
| WO2007137760A2 (en) | 2006-05-25 | 2007-12-06 | Bayer Schering Pharma Aktiengesellschaft | Dimeric molecular complexes |
| US7332582B2 (en) | 2002-05-23 | 2008-02-19 | Curetech Ltd. | Humanized immunomodulatory monoclonal antibodies for the treatment of neoplastic disease or immunodeficiency |
| US20080050370A1 (en) | 2006-03-17 | 2008-02-28 | Scott Glaser | Stabilized polypeptide compositions |
| US20080069820A1 (en) | 2006-08-30 | 2008-03-20 | Genentech, Inc. | Multispecific antibodies |
| US20080152645A1 (en) | 2006-08-18 | 2008-06-26 | Armagen Technologies, Inc. | Genetically Encoded Multifunctional Compositions Bidrectionally Transported Between Peripheral Blood and the CNS |
| US20080241884A1 (en) | 2003-10-08 | 2008-10-02 | Kenya Shitara | Fused Protein Composition |
| WO2008119353A1 (en) | 2007-03-29 | 2008-10-09 | Genmab A/S | Bispecific antibodies and methods for production thereof |
| US20080254512A1 (en) | 2006-11-02 | 2008-10-16 | Capon Daniel J | Hybrid immunoglobulins with moving parts |
| US20080260738A1 (en) | 2007-04-18 | 2008-10-23 | Moore Margaret D | Single chain fc, methods of making and methods of treatment |
| WO2008132601A1 (en) | 2007-04-30 | 2008-11-06 | Immutep | Cytotoxic anti-lag-3 monoclonal antibody and its use in the treatment or prevention of organ transplant rejection and autoimmune disease |
| WO2008143794A1 (en) | 2007-05-11 | 2008-11-27 | Altor Bioscience Corporation | Fusion molecules and il-15 variants |
| US7470428B2 (en) | 2002-01-30 | 2008-12-30 | The Brigham And Women's Hospital, Inc. | Compositions and methods related to TIM-3, a Th1-specific cell surface molecule |
| US7488802B2 (en) | 2002-12-23 | 2009-02-10 | Wyeth | Antibodies against PD-1 |
| WO2009021754A2 (en) | 2007-08-15 | 2009-02-19 | Bayer Schering Pharma Aktiengesellschaft | Monospecific and multispecific antibodies and method of use |
| WO2009044273A2 (en) | 2007-10-05 | 2009-04-09 | Immutep | Use of recombinant lag-3 or the derivatives thereof for eliciting monocyte immune response |
| US7521056B2 (en) | 2005-04-06 | 2009-04-21 | Ibc Pharmaceuticals, Inc. | Stably tethered structures of defined compositions with multiple functions or binding specificities |
| US7527787B2 (en) | 2005-10-19 | 2009-05-05 | Ibc Pharmaceuticals, Inc. | Multivalent immunoglobulin-based bioactive assemblies |
| US7534866B2 (en) | 2005-10-19 | 2009-05-19 | Ibc Pharmaceuticals, Inc. | Methods and compositions for generating bioactive assemblies of increased complexity and uses |
| US20090130106A1 (en) | 2005-11-29 | 2009-05-21 | The University Of Sydney | Demibodies: dimerization-activated therapeutic agents |
| WO2009068630A1 (en) | 2007-11-27 | 2009-06-04 | Ablynx N.V. | Immunoglobulin constructs |
| US20090148905A1 (en) | 2007-11-30 | 2009-06-11 | Claire Ashman | Antigen-binding constructs |
| US20090155275A1 (en) | 2007-07-31 | 2009-06-18 | Medimmune, Llc | Multispecific epitope binding proteins and uses thereof |
| US20090162360A1 (en) | 2007-12-21 | 2009-06-25 | Christian Klein | Bivalent, bispecific antibodies |
| US20090162359A1 (en) | 2007-12-21 | 2009-06-25 | Christian Klein | Bivalent, bispecific antibodies |
| US20090175867A1 (en) | 2006-06-12 | 2009-07-09 | Trubion Pharmaceuticals, Inc. | Single-Chain Multivalent Binding Proteins with Effector Function |
| US20090175851A1 (en) | 2007-12-21 | 2009-07-09 | Christian Klein | Bivalent, bispecific antibodies |
| WO2009089004A1 (en) | 2008-01-07 | 2009-07-16 | Amgen Inc. | Method for making antibody fc-heterodimeric molecules using electrostatic steering effects |
| US20090232811A1 (en) | 2007-12-21 | 2009-09-17 | Christian Klein | Bivalent, bispecific antibodies |
| US20090234105A1 (en) | 2006-03-24 | 2009-09-17 | The Regents Of The University Of California | Construction of a Multivalent SCFV Through Alkyne-Azide 1,3-Dipolar Cycloaddition |
| WO2009114335A2 (en) | 2008-03-12 | 2009-09-17 | Merck & Co., Inc. | Pd-1 binding proteins |
| US20090263392A1 (en) | 2006-03-31 | 2009-10-22 | Chugai Seiyaku Kabushiki Kaisha | Methods of modifying antibodies for purification of bispecific antibodies |
| US7612181B2 (en) | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| US20090274649A1 (en) | 2002-03-01 | 2009-11-05 | Immunomedics, Inc. | Bispecific Antibody Point Mutations for Enhancing Rate of Clearance |
| WO2010019570A2 (en) | 2008-08-11 | 2010-02-18 | Medarex, Inc. | Human antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| WO2010027827A2 (en) | 2008-08-25 | 2010-03-11 | Amplimmune, Inc. | Targeted costimulatory polypeptides and methods of use to treat cancer |
| US7695715B2 (en) | 1999-03-31 | 2010-04-13 | Mor Research Applications Ltd. | Monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases |
| WO2010129304A2 (en) | 2009-04-27 | 2010-11-11 | Oncomed Pharmaceuticals, Inc. | Method for making heteromultimeric molecules |
| WO2011028683A1 (en) | 2009-09-03 | 2011-03-10 | Schering Corporation | Anti-gitr antibodies |
| US7943743B2 (en) | 2005-07-01 | 2011-05-17 | Medarex, Inc. | Human monoclonal antibodies to programmed death ligand 1 (PD-L1) |
| WO2011066342A2 (en) | 2009-11-24 | 2011-06-03 | Amplimmune, Inc. | Simultaneous inhibition of pd-l1/pd-l2 |
| WO2011131746A2 (en) | 2010-04-20 | 2011-10-27 | Genmab A/S | Heterodimeric antibody fc-containing proteins and methods for production thereof |
| US8168179B2 (en) | 2002-07-03 | 2012-05-01 | Ono Pharmaceutical Co., Ltd. | Treatment method using anti-PD-L1 antibody |
| US8217149B2 (en) | 2008-12-09 | 2012-07-10 | Genentech, Inc. | Anti-PD-L1 antibodies, compositions and articles of manufacture |
| WO2012145493A1 (en) | 2011-04-20 | 2012-10-26 | Amplimmune, Inc. | Antibodies and other molecules that bind b7-h1 and pd-1 |
| WO2012175222A1 (en) | 2011-06-24 | 2012-12-27 | Cytune | AN IL-15 AND IL-15Rα SUSHI DOMAIN BASED IMMUNOCYTOKINES |
| US8354509B2 (en) | 2007-06-18 | 2013-01-15 | Msd Oss B.V. | Antibodies to human programmed death receptor PD-1 |
| WO2013060867A2 (en) | 2011-10-27 | 2013-05-02 | Genmab A/S | Production of heterodimeric proteins |
| WO2013079174A1 (en) | 2011-11-28 | 2013-06-06 | Merck Patent Gmbh | Anti-pd-l1 antibodies and uses thereof |
| US8460927B2 (en) | 1999-11-30 | 2013-06-11 | Mayo Foundation For Medical Education And Research | B7-H1 antibodies and method of use |
| US8552154B2 (en) | 2008-09-26 | 2013-10-08 | Emory University | Anti-PD-L1 antibodies and uses therefor |
| US8552156B2 (en) | 2010-06-11 | 2013-10-08 | Kyowa Hakko Kirin Co., Ltd | Anti-TIM-3 antibody |
| US8602269B2 (en) | 2009-09-14 | 2013-12-10 | Guala Dispensing S.P.A. | Trigger sprayer |
| WO2014022758A1 (en) | 2012-08-03 | 2014-02-06 | Dana-Farber Cancer Institute, Inc. | Single agent anti-pd-l1 and pd-l2 dual binding antibodies and methods of use |
| US8686119B2 (en) | 2011-07-24 | 2014-04-01 | Curetech Ltd. | Variants of humanized immunomodulatory monoclonal antibodies |
| WO2014055897A2 (en) | 2012-10-04 | 2014-04-10 | Dana-Farber Cancer Institute, Inc. | Human monoclonal anti-pd-l1 antibodies and methods of use |
| WO2014066527A2 (en) | 2012-10-24 | 2014-05-01 | Admune Therapeutics Llc | Il-15r alpha forms, cells expressing il-15r alpha forms, and therapeutic uses of il-15r alpha and il-15/il-15r alpha complexes |
| US8735553B1 (en) | 2013-09-13 | 2014-05-27 | Beigene, Ltd. | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
| WO2014100079A1 (en) | 2012-12-21 | 2014-06-26 | Merck Sharp & Dohme Corp. | Antibodies that bind to human programmed death ligand 1 (pd-l1) |
| US8779108B2 (en) | 2009-11-24 | 2014-07-15 | Medimmune, Limited | Targeted binding agents against B7-H1 |
| WO2014140180A1 (en) | 2013-03-15 | 2014-09-18 | Glaxosmithkline Intellectual Property Development Limited | Anti-lag-3 binding proteins |
| US8841418B2 (en) | 2011-07-01 | 2014-09-23 | Cellerant Therapeutics, Inc. | Antibodies that specifically bind to TIM3 |
| WO2014179664A2 (en) | 2013-05-02 | 2014-11-06 | Anaptysbio, Inc. | Antibodies directed against programmed death-1 (pd-1) |
| WO2014194302A2 (en) | 2013-05-31 | 2014-12-04 | Sorrento Therapeutics, Inc. | Antigen binding proteins that bind pd-1 |
| US8907053B2 (en) | 2010-06-25 | 2014-12-09 | Aurigene Discovery Technologies Limited | Immunosuppression modulating compounds |
| WO2014209804A1 (en) | 2013-06-24 | 2014-12-31 | Biomed Valley Discoveries, Inc. | Bispecific antibodies |
| US8927697B2 (en) | 2008-09-12 | 2015-01-06 | Isis Innovation Limited | PD-1 specific antibodies and uses thereof |
| WO2015026684A1 (en) | 2013-08-20 | 2015-02-26 | Merck Sharp & Dohme Corp. | Modulation of tumor immunity |
| WO2015031667A2 (en) | 2013-08-30 | 2015-03-05 | Amgen Inc. | Gitr antigen binding proteins |
| US8993731B2 (en) | 2010-03-11 | 2015-03-31 | Ucb Biopharma Sprl | PD-1 antibody |
| WO2015061668A1 (en) | 2013-10-25 | 2015-04-30 | Dana-Farber Cancer Institute, Inc. | Anti-pd-l1 monoclonal antibodies and fragments thereof |
| WO2015081158A1 (en) | 2013-11-26 | 2015-06-04 | Bristol-Myers Squibb Company | Method of treating hiv by disrupting pd-1/pd-l1 signaling |
| WO2015085847A1 (zh) | 2013-12-12 | 2015-06-18 | 上海恒瑞医药有限公司 | Pd-1抗体、其抗原结合片段及其医药用途 |
| WO2015109124A2 (en) | 2014-01-15 | 2015-07-23 | Kadmon Corporation, Llc | Immunomodulatory agents |
| WO2015112800A1 (en) | 2014-01-23 | 2015-07-30 | Regeneron Pharmaceuticals, Inc. | Human antibodies to pd-1 |
| US20150210769A1 (en) | 2014-01-24 | 2015-07-30 | Novartis Ag | Antibody molecules to pd-1 and uses thereof |
| WO2015112805A1 (en) | 2014-01-23 | 2015-07-30 | Regeneron Pharmaceuticals, Inc. | Human antibodies to pd-l1 |
| WO2015117002A1 (en) * | 2014-01-31 | 2015-08-06 | Novartis Ag | Antibody molecules to tim-3 and uses thereof |
| WO2015116539A1 (en) | 2014-01-28 | 2015-08-06 | Bristol-Myers Squibb Company | Anti-lag-3 antibodies to treat hematological malignancies |
| US20150259420A1 (en) | 2014-03-14 | 2015-09-17 | Novartis Ag | Antibody molecules to lag-3 and uses thereof |
| US9163087B2 (en) | 2010-06-18 | 2015-10-20 | The Brigham And Women's Hospital, Inc. | Bi-specific antibodies against TIM-3 and PD-1 for immunotherapy in chronic immune conditions |
| US9175082B2 (en) | 2012-05-31 | 2015-11-03 | Sorrento Therapeutics, Inc. | Antigen binding proteins that bind PD-L1 |
| WO2015184099A1 (en) | 2014-05-28 | 2015-12-03 | 4-Antibody Ag | Anti-gitr antibodies and methods of use thereof |
| WO2015181342A1 (en) | 2014-05-29 | 2015-12-03 | Spring Bioscience Corporation | Pd-l1 antibodies and uses thereof |
| WO2015195163A1 (en) | 2014-06-20 | 2015-12-23 | R-Pharm Overseas, Inc. | Pd-l1 antagonist fully human antibody |
| WO2015200119A1 (en) | 2014-06-26 | 2015-12-30 | Macrogenics, Inc. | Covalently bonded diabodies having immunoreactivity with pd-1 and lag-3, and methods of use thereof |
| US9228016B2 (en) | 2014-06-06 | 2016-01-05 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (GITR) and uses thereof |
| WO2016000619A1 (en) | 2014-07-03 | 2016-01-07 | Beigene, Ltd. | Anti-pd-l1 antibodies and their use as therapeutics and diagnostics |
| US9244059B2 (en) | 2007-04-30 | 2016-01-26 | Immutep Parc Club Orsay | Cytotoxic anti-LAG-3 monoclonal antibody and its use in the treatment or prevention of organ transplant rejection and autoimmune disease |
| WO2016028672A1 (en) | 2014-08-19 | 2016-02-25 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
| WO2016054638A1 (en) | 2014-10-03 | 2016-04-07 | Dana-Farber Cancer Institute, Inc. | Glucocorticoid-induced tumor necrosis factor receptor (gitr) antibodies and methods of use thereof |
| WO2016057846A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Compositions and methods of use for augmented immune response and cancer therapy |
| US20160108123A1 (en) | 2014-10-14 | 2016-04-21 | Novartis Ag | Antibody molecules to pd-l1 and uses thereof |
| WO2016071448A1 (en) | 2014-11-06 | 2016-05-12 | F. Hoffmann-La Roche Ag | Anti-tim3 antibodies and methods of use |
| WO2016092419A1 (en) | 2014-12-09 | 2016-06-16 | Rinat Neuroscience Corp. | Anti-pd-1 antibodies and methods of use thereof |
| WO2016111947A2 (en) | 2015-01-05 | 2016-07-14 | Jounce Therapeutics, Inc. | Antibodies that inhibit tim-3:lilrb2 interactions and uses thereof |
| WO2016144803A2 (en) | 2015-03-06 | 2016-09-15 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind tim3 |
| WO2016161270A1 (en) | 2015-04-01 | 2016-10-06 | Anaptysbio, Inc. | Antibodies directed against t cell immunoglobulin and mucin protein 3 (tim-3) |
| US9505839B2 (en) | 2012-07-02 | 2016-11-29 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| WO2016196792A1 (en) | 2015-06-03 | 2016-12-08 | Bristol-Myers Squibb Company | Anti-gitr antibodies for cancer diagnostics |
| US20170022284A1 (en) | 2015-07-23 | 2017-01-26 | Inhibrx Lp | Multivalent and multispecific gitr-binding fusion proteins |
| WO2017019897A1 (en) | 2015-07-29 | 2017-02-02 | Novartis Ag | Combination therapies comprising antibody molecules to tim-3 |
| WO2017025610A1 (en) | 2015-08-12 | 2017-02-16 | Medimmune Limited | Gitrl fusion proteins and uses thereof |
-
2018
- 2018-06-27 CA CA3066747A patent/CA3066747A1/en active Pending
- 2018-06-27 MX MX2019015738A patent/MX2019015738A/es unknown
- 2018-06-27 WO PCT/US2018/039825 patent/WO2019006007A1/en not_active Ceased
- 2018-06-27 US US16/626,148 patent/US20200223924A1/en not_active Abandoned
- 2018-06-27 KR KR1020207001985A patent/KR20200022447A/ko not_active Ceased
- 2018-06-27 JP JP2019572138A patent/JP2020525483A/ja active Pending
- 2018-06-27 EP EP18743243.0A patent/EP3645037A1/en not_active Withdrawn
- 2018-06-27 AU AU2018292618A patent/AU2018292618A1/en not_active Abandoned
- 2018-06-27 CN CN201880054820.5A patent/CN111050791A/zh active Pending
-
2019
- 2019-12-05 IL IL271222A patent/IL271222A/en unknown
-
2023
- 2023-07-07 JP JP2023111992A patent/JP2023145487A/ja active Pending
Patent Citations (226)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4433059A (en) | 1981-09-08 | 1984-02-21 | Ortho Diagnostic Systems Inc. | Double antibody conjugate |
| US4444878A (en) | 1981-12-21 | 1984-04-24 | Boston Biomedical Research Institute, Inc. | Bispecific antibody determinants |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| EP0125023A1 (en) | 1983-04-08 | 1984-11-14 | Genentech, Inc. | Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor |
| EP0171496A2 (en) | 1984-08-15 | 1986-02-19 | Research Development Corporation of Japan | Process for the production of a chimera monoclonal antibody |
| EP0173494A2 (en) | 1984-08-27 | 1986-03-05 | The Board Of Trustees Of The Leland Stanford Junior University | Chimeric receptors by DNA splicing and expression |
| WO1986001533A1 (en) | 1984-09-03 | 1986-03-13 | Celltech Limited | Production of chimeric antibodies |
| EP0184187A2 (en) | 1984-12-04 | 1986-06-11 | Teijin Limited | Mouse-human chimaeric immunoglobulin heavy chain, and chimaeric DNA encoding it |
| GB2188638A (en) | 1986-03-27 | 1987-10-07 | Gregory Paul Winter | Chimeric antibodies |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US5869620A (en) | 1986-09-02 | 1999-02-09 | Enzon, Inc. | Multivalent antigen-binding proteins |
| US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5648260A (en) | 1987-03-18 | 1997-07-15 | Scotgen Biopharmaceuticals Incorporated | DNA encoding antibodies with altered effector functions |
| EP0346087A2 (en) | 1988-06-09 | 1989-12-13 | Snow Brand Milk Products Co., Ltd. | Hybrid antibody and process for the production thereof |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5693761A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Polynucleotides encoding improved humanized immunoglobulins |
| US5693762A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| EP0388151A1 (en) | 1989-03-13 | 1990-09-19 | Celltech Limited | Modified antibodies |
| US5591828A (en) | 1989-06-22 | 1997-01-07 | Behringwerke Aktiengesellschaft | Bispecific and oligospecific mono-and oligovalent receptors, the preparation and use thereof |
| WO1991000906A1 (en) | 1989-07-12 | 1991-01-24 | Genetics Institute, Inc. | Chimeric and transgenic animals capable of producing human antibodies |
| WO1991003493A1 (en) | 1989-08-29 | 1991-03-21 | The University Of Southampton | Bi-or trispecific (fab)3 or (fab)4 conjugates |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| WO1991010741A1 (en) | 1990-01-12 | 1991-07-25 | Cell Genesys, Inc. | Generation of xenogeneic antibodies |
| US5273743A (en) | 1990-03-09 | 1993-12-28 | Hybritech Incorporated | Trifunctional antibody-like compounds as a combined diagnostic and therapeutic agent |
| WO1991017271A1 (en) | 1990-05-01 | 1991-11-14 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5864019A (en) | 1990-06-11 | 1999-01-26 | Celltech Limited | Multivalent antigen-binding proteins |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| WO1992020791A1 (en) | 1990-07-10 | 1992-11-26 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| WO1992003918A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1992003917A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International | Homologous recombination in mammalian cells |
| WO1992009690A2 (en) | 1990-12-03 | 1992-06-11 | Genentech, Inc. | Enrichment method for variant proteins with altered binding properties |
| US5582996A (en) | 1990-12-04 | 1996-12-10 | The Wistar Institute Of Anatomy & Biology | Bifunctional antibodies and method of preparing same |
| WO1992015679A1 (en) | 1991-03-01 | 1992-09-17 | Protein Engineering Corporation | Improved epitode displaying phage |
| WO1992018619A1 (en) | 1991-04-10 | 1992-10-29 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| EP0519596A1 (en) | 1991-05-17 | 1992-12-23 | Merck & Co. Inc. | A method for reducing the immunogenicity of antibody variable domains |
| US5959083A (en) | 1991-06-03 | 1999-09-28 | Behringwerke Aktiengellschaft | Tetravalent bispecific receptors, the preparation and use thereof |
| US6511663B1 (en) | 1991-06-11 | 2003-01-28 | Celltech R&D Limited | Tri- and tetra-valent monospecific antigen-binding proteins |
| WO1993001288A1 (de) | 1991-07-08 | 1993-01-21 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Phagemid zum screenen von antikörpern |
| US5932448A (en) | 1991-11-29 | 1999-08-03 | Protein Design Labs., Inc. | Bispecific antibody heterodimers |
| US5910573A (en) | 1992-01-23 | 1999-06-08 | Merck Patent Gesellschaft Mit Beschrankter Haftung | Monomeric and dimeric antibody-fragment fusion proteins |
| US5534254A (en) | 1992-02-06 | 1996-07-09 | Chiron Corporation | Biosynthetic binding proteins for immuno-targeting |
| US5846545A (en) | 1992-03-25 | 1998-12-08 | Immunogen, Inc. | Targeted delivery of cyclopropylbenzindole-containing cytotoxic drugs |
| US5475092A (en) | 1992-03-25 | 1995-12-12 | Immunogen Inc. | Cell binding agent conjugates of analogues and derivatives of CC-1065 |
| US5585499A (en) | 1992-03-25 | 1996-12-17 | Immunogen Inc. | Cyclopropylbenzindole-containing cytotoxic drugs |
| WO1993023537A1 (en) | 1992-05-08 | 1993-11-25 | Creative Biomolecules | Chimeric multivalent protein analogues and methods of use thereof |
| WO1994004678A1 (en) | 1992-08-21 | 1994-03-03 | Casterman Cecile | Immunoglobulins devoid of light chains |
| US6005079A (en) | 1992-08-21 | 1999-12-21 | Vrije Universiteit Brussels | Immunoglobulins devoid of light chains |
| US5844094A (en) | 1992-09-25 | 1998-12-01 | Commonwealth Scientific And Industrial Research Organization | Target binding polypeptide |
| WO1994009131A1 (en) | 1992-10-15 | 1994-04-28 | Scotgen Limited | Recombinant specific binding protein |
| US5837821A (en) | 1992-11-04 | 1998-11-17 | City Of Hope | Antibody construct |
| WO1994012625A2 (en) | 1992-11-23 | 1994-06-09 | Zeneca Limited | LIGAND BINDING VARIABLE DOMAIN (V-MIN) COMPRISING A FRAMEWORK REGION WITH A CYCLICALLY PERMUTED CENTRAL β-BARREL |
| US5837242A (en) | 1992-12-04 | 1998-11-17 | Medical Research Council | Multivalent and multispecific binding proteins, their manufacture and use |
| US5637481A (en) | 1993-02-01 | 1997-06-10 | Bristol-Myers Squibb Company | Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell |
| US6476198B1 (en) | 1993-07-13 | 2002-11-05 | The Scripps Research Institute | Multispecific and multivalent antigen-binding polypeptide molecules |
| US5635602A (en) | 1993-08-13 | 1997-06-03 | The Regents Of The University Of California | Design and synthesis of bispecific DNA-antibody conjugates |
| WO1995009917A1 (en) | 1993-10-07 | 1995-04-13 | The Regents Of The University Of California | Genetically engineered bispecific tetravalent antibodies |
| US6294353B1 (en) | 1994-10-20 | 2001-09-25 | Morphosys Ag | Targeted hetero-association of recombinant proteins to multi-functional complexes |
| US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
| WO1996037621A2 (en) | 1995-05-23 | 1996-11-28 | Morphosys Gesellschaft Für Proteinoptimierung Mbh | Multimeric proteins |
| US5989830A (en) | 1995-10-16 | 1999-11-23 | Unilever Patent Holdings Bv | Bifunctional or bivalent antibody fragment analogue |
| US6239259B1 (en) | 1996-04-04 | 2001-05-29 | Unilever Patent Holdings B.V. | Multivalent and multispecific antigen-binding protein |
| US6743896B2 (en) | 1997-04-30 | 2004-06-01 | Enzon, Inc. | Single-chain antigen-binding proteins capable of glycosylation, production and uses thereof |
| US7183076B2 (en) | 1997-05-02 | 2007-02-27 | Genentech, Inc. | Method for making multispecific antibodies having heteromultimeric and common components |
| US20030207346A1 (en) | 1997-05-02 | 2003-11-06 | William R. Arathoon | Method for making multispecific antibodies having heteromultimeric and common components |
| US20070154901A1 (en) | 1997-06-11 | 2007-07-05 | Protein Engineering Technology Aps | Trimerising module |
| US6670453B2 (en) | 1997-10-27 | 2003-12-30 | Unilever Patent Holdings B.V. | Multivalent antigen-binding proteins |
| US6809185B1 (en) | 1998-01-23 | 2004-10-26 | Vlaams Interuniversitair Instituut Voor Biotechnologie | Multipurpose antibody derivatives |
| US20050004352A1 (en) | 1998-04-09 | 2005-01-06 | Roland Kontermann | Single-chain multiple antigen-binding molecule, its preparation and use |
| US7129330B1 (en) | 1998-05-05 | 2006-10-31 | Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts | Multivalent antibody constructs |
| WO1999064460A1 (en) | 1998-06-10 | 1999-12-16 | Celltech Therapeutics Limited | Divalent antibody fragments |
| WO2000006605A2 (en) | 1998-07-28 | 2000-02-10 | Micromet Ag | Heterominibodies |
| US6333396B1 (en) | 1998-10-20 | 2001-12-25 | Enzon, Inc. | Method for targeted delivery of nucleic acids |
| US7695715B2 (en) | 1999-03-31 | 2010-04-13 | Mor Research Applications Ltd. | Monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases |
| US8460927B2 (en) | 1999-11-30 | 2013-06-11 | Mayo Foundation For Medical Education And Research | B7-H1 antibodies and method of use |
| US20020004587A1 (en) | 2000-04-11 | 2002-01-10 | Genentech, Inc. | Multivalent antibodies and uses therefor |
| US20020103345A1 (en) | 2000-05-24 | 2002-08-01 | Zhenping Zhu | Bispecific immunoglobulin-like antigen binding proteins and method of production |
| US20040220388A1 (en) | 2000-06-30 | 2004-11-04 | Nico Mertens | Novel heterodimeric fusion proteins |
| US20020076406A1 (en) | 2000-07-25 | 2002-06-20 | Leung Shui-On | Multivalent target binding protein |
| US20040242847A1 (en) | 2000-10-20 | 2004-12-02 | Naoshi Fukushima | Degraded agonist antibody |
| US20050136049A1 (en) | 2001-01-17 | 2005-06-23 | Ledbetter Jeffrey A. | Binding constructs and methods for use thereof |
| WO2002072635A2 (en) | 2001-03-13 | 2002-09-19 | University College London | Specific binding members |
| US20040219643A1 (en) | 2001-06-28 | 2004-11-04 | Greg Winter | Dual-specific ligand |
| US6833441B2 (en) | 2001-08-01 | 2004-12-21 | Abmaxis, Inc. | Compositions and methods for generating chimeric heteromultimers |
| US20050079170A1 (en) | 2001-09-14 | 2005-04-14 | Fabrice Le Gall | Dimeric and multimeric antigen binding structure |
| US20030211078A1 (en) | 2001-12-07 | 2003-11-13 | Heavner George A. | Pseudo-antibody constructs |
| US7470428B2 (en) | 2002-01-30 | 2008-12-30 | The Brigham And Women's Hospital, Inc. | Compositions and methods related to TIM-3, a Th1-specific cell surface molecule |
| US20090274649A1 (en) | 2002-03-01 | 2009-11-05 | Immunomedics, Inc. | Bispecific Antibody Point Mutations for Enhancing Rate of Clearance |
| US20070087381A1 (en) | 2002-04-15 | 2007-04-19 | Tetsuo Kojima | Methods for constructing scdb libraries |
| US7332582B2 (en) | 2002-05-23 | 2008-02-19 | Curetech Ltd. | Humanized immunomodulatory monoclonal antibodies for the treatment of neoplastic disease or immunodeficiency |
| US8168179B2 (en) | 2002-07-03 | 2012-05-01 | Ono Pharmaceutical Co., Ltd. | Treatment method using anti-PD-L1 antibody |
| US7488802B2 (en) | 2002-12-23 | 2009-02-10 | Wyeth | Antibodies against PD-1 |
| US20060083747A1 (en) | 2002-12-27 | 2006-04-20 | Domantis Limited | Fc fusion |
| WO2004081051A1 (en) | 2003-03-12 | 2004-09-23 | The University Of Birmingham | Bispecific antibodies |
| US20080171855A1 (en) | 2003-04-22 | 2008-07-17 | Ibc Pharmaceuticals, Inc. | Polyvalent protein complex |
| US20050003403A1 (en) | 2003-04-22 | 2005-01-06 | Rossi Edmund A. | Polyvalent protein complex |
| US20050163782A1 (en) | 2003-06-27 | 2005-07-28 | Biogen Idec Ma Inc. | Modified binding molecules comprising connecting peptides |
| US20050100543A1 (en) | 2003-07-01 | 2005-05-12 | Immunomedics, Inc. | Multivalent carriers of bi-specific antibodies |
| US20050069552A1 (en) | 2003-07-28 | 2005-03-31 | Bleck Gregory T. | Fusion antibodies |
| US20080241884A1 (en) | 2003-10-08 | 2008-10-02 | Kenya Shitara | Fused Protein Composition |
| US20050136051A1 (en) | 2003-12-22 | 2005-06-23 | Bernard Scallon | Methods for generating multimeric molecules |
| US20070128150A1 (en) | 2003-12-23 | 2007-06-07 | Norman Timothy J | Branched molecular scaffolds for linking polymer residues to biologically active moieties |
| US20050266425A1 (en) | 2003-12-31 | 2005-12-01 | Vaccinex, Inc. | Methods for producing and identifying multispecific antibodies |
| US20060120960A1 (en) | 2004-01-30 | 2006-06-08 | Sergey Deyev | Multivalent complexes, their production and method of use |
| WO2006020258A2 (en) | 2004-07-17 | 2006-02-23 | Imclone Systems Incorporated | Novel tetravalent bispecific antibody |
| US20060204493A1 (en) | 2004-09-02 | 2006-09-14 | Genentech, Inc. | Heteromultimeric molecules |
| US9028823B2 (en) | 2005-03-25 | 2015-05-12 | Gitr, Inc. | Methods of inducing or enhancing an immune response in a subject by administering agonistic GITR binding antibodies |
| US8388967B2 (en) | 2005-03-25 | 2013-03-05 | Gitr, Inc. | Methods for inducing or enhancing an immune response by administering agonistic GITR-binding antibodies |
| WO2006105021A2 (en) | 2005-03-25 | 2006-10-05 | Tolerrx, Inc. | Gitr binding molecules and uses therefor |
| US7812135B2 (en) | 2005-03-25 | 2010-10-12 | Tolerrx, Inc. | GITR-binding antibodies |
| WO2006106905A1 (ja) | 2005-03-31 | 2006-10-12 | Chugai Seiyaku Kabushiki Kaisha | 会合制御によるポリペプチド製造方法 |
| US7521056B2 (en) | 2005-04-06 | 2009-04-21 | Ibc Pharmaceuticals, Inc. | Stably tethered structures of defined compositions with multiple functions or binding specificities |
| US20070004909A1 (en) | 2005-04-15 | 2007-01-04 | Macrogenics, Inc. | Covalent diabodies and uses thereof |
| WO2006121168A1 (en) | 2005-05-09 | 2006-11-16 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics |
| US8008449B2 (en) | 2005-05-09 | 2011-08-30 | Medarex, Inc. | Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| US20060263367A1 (en) | 2005-05-23 | 2006-11-23 | Fey Georg H | Bispecific antibody devoid of Fc region and method of treatment using same |
| US7943743B2 (en) | 2005-07-01 | 2011-05-17 | Medarex, Inc. | Human monoclonal antibodies to programmed death ligand 1 (PD-L1) |
| WO2007004606A1 (ja) | 2005-07-04 | 2007-01-11 | Nikon Vision Co., Ltd. | 測距装置 |
| US7612181B2 (en) | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| US20070141049A1 (en) | 2005-08-26 | 2007-06-21 | Reinhard Bredehorst | Bivalent IgY antibody constructs for diagnostic and therapeutic applications |
| WO2007044887A2 (en) | 2005-10-11 | 2007-04-19 | Transtarget, Inc. | Method for producing a population of homogenous tetravalent bispecific antibodies |
| US7527787B2 (en) | 2005-10-19 | 2009-05-05 | Ibc Pharmaceuticals, Inc. | Multivalent immunoglobulin-based bioactive assemblies |
| US7534866B2 (en) | 2005-10-19 | 2009-05-19 | Ibc Pharmaceuticals, Inc. | Methods and compositions for generating bioactive assemblies of increased complexity and uses |
| US20090130106A1 (en) | 2005-11-29 | 2009-05-21 | The University Of Sydney | Demibodies: dimerization-activated therapeutic agents |
| WO2007084342A2 (en) | 2006-01-13 | 2007-07-26 | The Government Of The United States, As Represented By The Secretary Of The Department Of Health And Human Services, National Institutes Of Health | Codon optimi zed il- 15 and il- 15r-alpha genes for expression in mammalian cells |
| WO2007095338A2 (en) | 2006-02-15 | 2007-08-23 | Imclone Systems Incorporated | Functional antibodies |
| US20080050370A1 (en) | 2006-03-17 | 2008-02-28 | Scott Glaser | Stabilized polypeptide compositions |
| US20090234105A1 (en) | 2006-03-24 | 2009-09-17 | The Regents Of The University Of California | Construction of a Multivalent SCFV Through Alkyne-Azide 1,3-Dipolar Cycloaddition |
| WO2007110205A2 (en) | 2006-03-24 | 2007-10-04 | Merck Patent Gmbh | Engineered heterodimeric protein domains |
| US20090263392A1 (en) | 2006-03-31 | 2009-10-22 | Chugai Seiyaku Kabushiki Kaisha | Methods of modifying antibodies for purification of bispecific antibodies |
| WO2007137760A2 (en) | 2006-05-25 | 2007-12-06 | Bayer Schering Pharma Aktiengesellschaft | Dimeric molecular complexes |
| US20070274985A1 (en) | 2006-05-26 | 2007-11-29 | Stefan Dubel | Antibody |
| US20090175867A1 (en) | 2006-06-12 | 2009-07-09 | Trubion Pharmaceuticals, Inc. | Single-Chain Multivalent Binding Proteins with Effector Function |
| US20080152645A1 (en) | 2006-08-18 | 2008-06-26 | Armagen Technologies, Inc. | Genetically Encoded Multifunctional Compositions Bidrectionally Transported Between Peripheral Blood and the CNS |
| US20080069820A1 (en) | 2006-08-30 | 2008-03-20 | Genentech, Inc. | Multispecific antibodies |
| US20080254512A1 (en) | 2006-11-02 | 2008-10-16 | Capon Daniel J | Hybrid immunoglobulins with moving parts |
| WO2008119353A1 (en) | 2007-03-29 | 2008-10-09 | Genmab A/S | Bispecific antibodies and methods for production thereof |
| US20080260738A1 (en) | 2007-04-18 | 2008-10-23 | Moore Margaret D | Single chain fc, methods of making and methods of treatment |
| WO2008132601A1 (en) | 2007-04-30 | 2008-11-06 | Immutep | Cytotoxic anti-lag-3 monoclonal antibody and its use in the treatment or prevention of organ transplant rejection and autoimmune disease |
| US9244059B2 (en) | 2007-04-30 | 2016-01-26 | Immutep Parc Club Orsay | Cytotoxic anti-LAG-3 monoclonal antibody and its use in the treatment or prevention of organ transplant rejection and autoimmune disease |
| WO2008143794A1 (en) | 2007-05-11 | 2008-11-27 | Altor Bioscience Corporation | Fusion molecules and il-15 variants |
| US8354509B2 (en) | 2007-06-18 | 2013-01-15 | Msd Oss B.V. | Antibodies to human programmed death receptor PD-1 |
| US20090155275A1 (en) | 2007-07-31 | 2009-06-18 | Medimmune, Llc | Multispecific epitope binding proteins and uses thereof |
| WO2009021754A2 (en) | 2007-08-15 | 2009-02-19 | Bayer Schering Pharma Aktiengesellschaft | Monospecific and multispecific antibodies and method of use |
| WO2009044273A2 (en) | 2007-10-05 | 2009-04-09 | Immutep | Use of recombinant lag-3 or the derivatives thereof for eliciting monocyte immune response |
| WO2009068630A1 (en) | 2007-11-27 | 2009-06-04 | Ablynx N.V. | Immunoglobulin constructs |
| US20090148905A1 (en) | 2007-11-30 | 2009-06-11 | Claire Ashman | Antigen-binding constructs |
| US20090162359A1 (en) | 2007-12-21 | 2009-06-25 | Christian Klein | Bivalent, bispecific antibodies |
| US20090175851A1 (en) | 2007-12-21 | 2009-07-09 | Christian Klein | Bivalent, bispecific antibodies |
| US20090162360A1 (en) | 2007-12-21 | 2009-06-25 | Christian Klein | Bivalent, bispecific antibodies |
| US20090232811A1 (en) | 2007-12-21 | 2009-09-17 | Christian Klein | Bivalent, bispecific antibodies |
| WO2009089004A1 (en) | 2008-01-07 | 2009-07-16 | Amgen Inc. | Method for making antibody fc-heterodimeric molecules using electrostatic steering effects |
| WO2009114335A2 (en) | 2008-03-12 | 2009-09-17 | Merck & Co., Inc. | Pd-1 binding proteins |
| WO2010019570A2 (en) | 2008-08-11 | 2010-02-18 | Medarex, Inc. | Human antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| WO2010027827A2 (en) | 2008-08-25 | 2010-03-11 | Amplimmune, Inc. | Targeted costimulatory polypeptides and methods of use to treat cancer |
| US8927697B2 (en) | 2008-09-12 | 2015-01-06 | Isis Innovation Limited | PD-1 specific antibodies and uses thereof |
| US8552154B2 (en) | 2008-09-26 | 2013-10-08 | Emory University | Anti-PD-L1 antibodies and uses therefor |
| US9102727B2 (en) | 2008-09-26 | 2015-08-11 | Emory University | Human anti-PD-1 antibodies and uses therefor |
| US20130045202A1 (en) | 2008-12-09 | 2013-02-21 | Genentech, Inc. | Anti-pd-l1 antibodies and articles of manufacture |
| US8217149B2 (en) | 2008-12-09 | 2012-07-10 | Genentech, Inc. | Anti-PD-L1 antibodies, compositions and articles of manufacture |
| WO2010129304A2 (en) | 2009-04-27 | 2010-11-11 | Oncomed Pharmaceuticals, Inc. | Method for making heteromultimeric molecules |
| US8709424B2 (en) | 2009-09-03 | 2014-04-29 | Merck Sharp & Dohme Corp. | Anti-GITR antibodies |
| WO2011028683A1 (en) | 2009-09-03 | 2011-03-10 | Schering Corporation | Anti-gitr antibodies |
| US8602269B2 (en) | 2009-09-14 | 2013-12-10 | Guala Dispensing S.P.A. | Trigger sprayer |
| WO2011066342A2 (en) | 2009-11-24 | 2011-06-03 | Amplimmune, Inc. | Simultaneous inhibition of pd-l1/pd-l2 |
| US8779108B2 (en) | 2009-11-24 | 2014-07-15 | Medimmune, Limited | Targeted binding agents against B7-H1 |
| US8993731B2 (en) | 2010-03-11 | 2015-03-31 | Ucb Biopharma Sprl | PD-1 antibody |
| WO2011131746A2 (en) | 2010-04-20 | 2011-10-27 | Genmab A/S | Heterodimeric antibody fc-containing proteins and methods for production thereof |
| US8552156B2 (en) | 2010-06-11 | 2013-10-08 | Kyowa Hakko Kirin Co., Ltd | Anti-TIM-3 antibody |
| US9163087B2 (en) | 2010-06-18 | 2015-10-20 | The Brigham And Women's Hospital, Inc. | Bi-specific antibodies against TIM-3 and PD-1 for immunotherapy in chronic immune conditions |
| US8907053B2 (en) | 2010-06-25 | 2014-12-09 | Aurigene Discovery Technologies Limited | Immunosuppression modulating compounds |
| WO2012145493A1 (en) | 2011-04-20 | 2012-10-26 | Amplimmune, Inc. | Antibodies and other molecules that bind b7-h1 and pd-1 |
| US9205148B2 (en) | 2011-04-20 | 2015-12-08 | Medimmune, Llc | Antibodies and other molecules that bind B7-H1 and PD-1 |
| WO2012175222A1 (en) | 2011-06-24 | 2012-12-27 | Cytune | AN IL-15 AND IL-15Rα SUSHI DOMAIN BASED IMMUNOCYTOKINES |
| US8841418B2 (en) | 2011-07-01 | 2014-09-23 | Cellerant Therapeutics, Inc. | Antibodies that specifically bind to TIM3 |
| US8686119B2 (en) | 2011-07-24 | 2014-04-01 | Curetech Ltd. | Variants of humanized immunomodulatory monoclonal antibodies |
| WO2013060867A2 (en) | 2011-10-27 | 2013-05-02 | Genmab A/S | Production of heterodimeric proteins |
| WO2013079174A1 (en) | 2011-11-28 | 2013-06-06 | Merck Patent Gmbh | Anti-pd-l1 antibodies and uses thereof |
| US9175082B2 (en) | 2012-05-31 | 2015-11-03 | Sorrento Therapeutics, Inc. | Antigen binding proteins that bind PD-L1 |
| US9505839B2 (en) | 2012-07-02 | 2016-11-29 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| WO2014022758A1 (en) | 2012-08-03 | 2014-02-06 | Dana-Farber Cancer Institute, Inc. | Single agent anti-pd-l1 and pd-l2 dual binding antibodies and methods of use |
| WO2014055897A2 (en) | 2012-10-04 | 2014-04-10 | Dana-Farber Cancer Institute, Inc. | Human monoclonal anti-pd-l1 antibodies and methods of use |
| WO2014066527A2 (en) | 2012-10-24 | 2014-05-01 | Admune Therapeutics Llc | Il-15r alpha forms, cells expressing il-15r alpha forms, and therapeutic uses of il-15r alpha and il-15/il-15r alpha complexes |
| WO2014100079A1 (en) | 2012-12-21 | 2014-06-26 | Merck Sharp & Dohme Corp. | Antibodies that bind to human programmed death ligand 1 (pd-l1) |
| WO2014140180A1 (en) | 2013-03-15 | 2014-09-18 | Glaxosmithkline Intellectual Property Development Limited | Anti-lag-3 binding proteins |
| WO2014179664A2 (en) | 2013-05-02 | 2014-11-06 | Anaptysbio, Inc. | Antibodies directed against programmed death-1 (pd-1) |
| WO2014194302A2 (en) | 2013-05-31 | 2014-12-04 | Sorrento Therapeutics, Inc. | Antigen binding proteins that bind pd-1 |
| WO2014209804A1 (en) | 2013-06-24 | 2014-12-31 | Biomed Valley Discoveries, Inc. | Bispecific antibodies |
| WO2015026684A1 (en) | 2013-08-20 | 2015-02-26 | Merck Sharp & Dohme Corp. | Modulation of tumor immunity |
| WO2015031667A2 (en) | 2013-08-30 | 2015-03-05 | Amgen Inc. | Gitr antigen binding proteins |
| US9464139B2 (en) | 2013-08-30 | 2016-10-11 | Amgen Inc. | GITR antigen binding proteins and methods of use thereof |
| US8735553B1 (en) | 2013-09-13 | 2014-05-27 | Beigene, Ltd. | Anti-PD1 antibodies and their use as therapeutics and diagnostics |
| WO2015061668A1 (en) | 2013-10-25 | 2015-04-30 | Dana-Farber Cancer Institute, Inc. | Anti-pd-l1 monoclonal antibodies and fragments thereof |
| WO2015081158A1 (en) | 2013-11-26 | 2015-06-04 | Bristol-Myers Squibb Company | Method of treating hiv by disrupting pd-1/pd-l1 signaling |
| WO2015085847A1 (zh) | 2013-12-12 | 2015-06-18 | 上海恒瑞医药有限公司 | Pd-1抗体、其抗原结合片段及其医药用途 |
| WO2015109124A2 (en) | 2014-01-15 | 2015-07-23 | Kadmon Corporation, Llc | Immunomodulatory agents |
| WO2015112805A1 (en) | 2014-01-23 | 2015-07-30 | Regeneron Pharmaceuticals, Inc. | Human antibodies to pd-l1 |
| WO2015112800A1 (en) | 2014-01-23 | 2015-07-30 | Regeneron Pharmaceuticals, Inc. | Human antibodies to pd-1 |
| US20150210769A1 (en) | 2014-01-24 | 2015-07-30 | Novartis Ag | Antibody molecules to pd-1 and uses thereof |
| WO2015116539A1 (en) | 2014-01-28 | 2015-08-06 | Bristol-Myers Squibb Company | Anti-lag-3 antibodies to treat hematological malignancies |
| US20150218274A1 (en) | 2014-01-31 | 2015-08-06 | Novartis Ag | Antibody molecules to tim-3 and uses thereof |
| WO2015117002A1 (en) * | 2014-01-31 | 2015-08-06 | Novartis Ag | Antibody molecules to tim-3 and uses thereof |
| US20150259420A1 (en) | 2014-03-14 | 2015-09-17 | Novartis Ag | Antibody molecules to lag-3 and uses thereof |
| WO2015184099A1 (en) | 2014-05-28 | 2015-12-03 | 4-Antibody Ag | Anti-gitr antibodies and methods of use thereof |
| US20150368349A1 (en) | 2014-05-28 | 2015-12-24 | 4-Antibody Ag | Anti-GITR Antibodies and Methods of Use Thereof |
| WO2015181342A1 (en) | 2014-05-29 | 2015-12-03 | Spring Bioscience Corporation | Pd-l1 antibodies and uses thereof |
| US9228016B2 (en) | 2014-06-06 | 2016-01-05 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (GITR) and uses thereof |
| WO2015195163A1 (en) | 2014-06-20 | 2015-12-23 | R-Pharm Overseas, Inc. | Pd-l1 antagonist fully human antibody |
| WO2015200119A1 (en) | 2014-06-26 | 2015-12-30 | Macrogenics, Inc. | Covalently bonded diabodies having immunoreactivity with pd-1 and lag-3, and methods of use thereof |
| WO2016000619A1 (en) | 2014-07-03 | 2016-01-07 | Beigene, Ltd. | Anti-pd-l1 antibodies and their use as therapeutics and diagnostics |
| WO2016028672A1 (en) | 2014-08-19 | 2016-02-25 | Merck Sharp & Dohme Corp. | Anti-lag3 antibodies and antigen-binding fragments |
| WO2016054638A1 (en) | 2014-10-03 | 2016-04-07 | Dana-Farber Cancer Institute, Inc. | Glucocorticoid-induced tumor necrosis factor receptor (gitr) antibodies and methods of use thereof |
| WO2016057846A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Compositions and methods of use for augmented immune response and cancer therapy |
| US20160108123A1 (en) | 2014-10-14 | 2016-04-21 | Novartis Ag | Antibody molecules to pd-l1 and uses thereof |
| WO2016071448A1 (en) | 2014-11-06 | 2016-05-12 | F. Hoffmann-La Roche Ag | Anti-tim3 antibodies and methods of use |
| WO2016092419A1 (en) | 2014-12-09 | 2016-06-16 | Rinat Neuroscience Corp. | Anti-pd-1 antibodies and methods of use thereof |
| WO2016111947A2 (en) | 2015-01-05 | 2016-07-14 | Jounce Therapeutics, Inc. | Antibodies that inhibit tim-3:lilrb2 interactions and uses thereof |
| WO2016144803A2 (en) | 2015-03-06 | 2016-09-15 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind tim3 |
| WO2016161270A1 (en) | 2015-04-01 | 2016-10-06 | Anaptysbio, Inc. | Antibodies directed against t cell immunoglobulin and mucin protein 3 (tim-3) |
| WO2016196792A1 (en) | 2015-06-03 | 2016-12-08 | Bristol-Myers Squibb Company | Anti-gitr antibodies for cancer diagnostics |
| US20170022284A1 (en) | 2015-07-23 | 2017-01-26 | Inhibrx Lp | Multivalent and multispecific gitr-binding fusion proteins |
| WO2017015623A2 (en) | 2015-07-23 | 2017-01-26 | Inhibrx Lp | Multivalent and multispecific gitr-binding fusion proteins |
| WO2017019897A1 (en) | 2015-07-29 | 2017-02-02 | Novartis Ag | Combination therapies comprising antibody molecules to tim-3 |
| WO2017025610A1 (en) | 2015-08-12 | 2017-02-16 | Medimmune Limited | Gitrl fusion proteins and uses thereof |
| US20170073386A1 (en) | 2015-08-12 | 2017-03-16 | Medimmune Limited | Gitrl fusion proteins and uses thereof |
Non-Patent Citations (75)
| Title |
|---|
| "Antibody Engineering Lab Manual", SPRINGER-VERLAG, article "Protein Sequence and Structure Analysis of Antibody Variable Domains" |
| "Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS, pages: 6.3.1 - 6.3.6 |
| ABBAS A K ET AL., NATURE, vol. 383, 1996, pages 787 - 793 |
| AFANASIEV ET AL., CLIN CANCER RES., vol. 19, no. 19, 2013, pages 5351 - 60 |
| AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| ANDERSON, CANCER IMMUNOL RES., vol. 2, no. 5, 2014, pages 393 - 8 |
| BARBAS ET AL., PNAS, vol. 88, 1991, pages 7978 - 7982 |
| BEIDLER ET AL., J. IMMUNOL., vol. 141, 1988, pages 4053 - 4060 |
| BETTER ET AL., SCIENCE, vol. 240, 1988, pages 1041 - 1043 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BRUGGEMAN ET AL., EUR J IMMUNOL, vol. 21, 1991, pages 1323 - 1326 |
| BRUGGEMAN ET AL., YEAR IMMUNOL, vol. 7, 1993, pages 33 - 40 |
| BU ET AL., TUMOUR BIOL., vol. 37, no. 3, 2016, pages 3949 - 56 |
| CAO ET AL., PLOS ONE, vol. 8, no. 1, 2013, pages e53834 |
| CHOTHIA, C. ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628 |
| COLCHER, D. ET AL., ANN N Y ACAD SCI, vol. 880, 1999, pages 263 - 80 |
| E. MEYERS; W. MILLER, CABIOS, vol. 4, 1989, pages 11 - 17 |
| FOURCADE ET AL., JEM, vol. 207, no. 10, 2010, pages 2175 |
| FUCHS ET AL., BIOLTECHNOLOGY, vol. 9, 1991, pages 1370 - 1372 |
| GARRAD ET AL., BIOLTECHNOLOGY, vol. 9, 1991, pages 1373 - 1377 |
| GRAM ET AL., PNAS, vol. 89, 1992, pages 3576 - 3580 |
| GREEN, L.L. ET AL., NATURE GENET, vol. 7, 1994, pages 13 - 21 |
| GRIFFTHS ET AL., EMBO J, vol. 12, 1993, pages 725 - 734 |
| HAMID, O. ET AL., NEW ENGLAND JOURNAL OF MEDICINE, vol. 369, no. 2, 2013, pages 134 - 44 |
| HASTINGS ET AL., EUR J IMMUNOL., vol. 39, no. 9, 2009, pages 2492 - 501 |
| HAWKINS ET AL., JMOL BIOL, vol. 226, 1992, pages 889 - 896 |
| HAY ET AL., HUM ANTIBODY HYBRIDOMAS, vol. 3, 1992, pages 81 - 85 |
| HOFSTRA C L ET AL., J IMMUNOL, vol. 161, 1998, pages 5054 - 60 |
| HOOGENBOOM ET AL., NUC ACID RES, vol. 19, 1991, pages 4133 - 4137 |
| HUSE ET AL., SCIENCE, vol. 246, 1989, pages 1275 - 1281 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883 |
| JONES ET AL., NATURE, vol. 321, 1986, pages 552 - 525 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH |
| KABAT, E. A. ET AL.: "Sequences of Proteins of Immunological Interest", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES |
| KIKUSHIGE ET AL., CELL STEM CELL, vol. 7, no. 6, 2010, pages 708 - 717 |
| KIKUSHIGE ET AL., CELL STEM CELL, vol. 7, no. 6, 3 December 2010 (2010-12-03), pages 708 - 17 |
| KUCHROO V K ET AL., CELL, vol. 80, 1995, pages 707 - 18 |
| LACK G ET AL., J IMMUNOL, vol. 152, 1994, pages 2546 - 54 |
| LIBLAU R S ET AL., IMMUNOL TODAY, vol. 16, 1995, pages 34 - 38 |
| LIU ET AL., J. IMMUNOL., vol. 139, 1987, pages 3521 - 3526 |
| LIU ET AL., PNAS, vol. 84, 1987, pages 3439 - 3443 |
| LOBUGLIO ET AL., HYBRIDOMA, vol. 5, 1986, pages 5117 - 5123 |
| LONBERG, N. ET AL., NATURE, vol. 368, 1994, pages 856 - 859 |
| MAHNE ET AL., CANCER RES., vol. 77, no. 5, 2017, pages 1108 - 1118 |
| MORRISON, S. L., SCIENCE, vol. 229, 1985, pages 1202 - 1207 |
| MORRISON, S.L. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1994, pages 6851 - 6855 |
| MOSMANN T R ET AL., IMMUNOL TODAY, vol. 17, 1996, pages 138 - 46 |
| MOSMANN T R ET AL., J IMMUNOL, vol. 136, 1986, pages 2348 - 57 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453 |
| NGIOW ET AL., CANCER RES, vol. 71, no. 10, 2011, pages 3540 - 51 |
| NICHOLSON L B ET AL., IMMUNITY, vol. 3, 1995, pages 397 - 405 |
| NISHIMURA ET AL., CANC. RES., vol. 47, 1987, pages 999 - 1005 |
| OI ET AL., BIOTECHNIQUES, vol. 4, 1986, pages 214 |
| ORSKOV ET AL., ONCOTARGER, vol. 6, no. 11, 2015, pages 9612 - 26 |
| PONTE J ET AL., CLINICAL IMMUNOLOGY, vol. 135, 2010, pages S96 |
| REITER, Y., CLIN CANCER RES, vol. 2, 1996, pages 245 - 52 |
| RIVALLAND ET AL.: "Small cell lung cancer: the immune microenvironment and prognostic impact of checkpoint expression", ASCO, 2017 |
| ROSENBLATT, J. ET AL., J IMMUNOTHERAPY, vol. 34, no. 5, 2011, pages 409 - 18 |
| ROSS ET AL., CANCER RES, vol. 76, no. 14, 2016 |
| SAKUISHI ET AL., J EXP MED, vol. 207, no. 10, 2010, pages 2187 - 94 |
| SALEH ET AL., CANCER IMMUNOL. IMMUNOTHER., vol. 32, 1990, pages 180 - 190 |
| SHAW ET AL., J. NATL CANCER INST., vol. 80, 1988, pages 1553 - 1559 |
| SHER A ET AL., ANNU REV IMMUNOL, vol. 10, 1992, pages 385 - 409 |
| SOHLBERG ET AL., ONCOTARGET, vol. 6, no. 33, 2015, pages 34178 - 90 |
| SUN ET AL., PNAS, vol. 84, 1987, pages 214 - 218 |
| TUAILLON ET AL., PNAS, vol. 90, 1993, pages 3720 - 3724 |
| VERHOEYAN ET AL., SCIENCE, vol. 239, 1988, pages 1534 |
| WINNAKER: "From Genes to Clones", 1987, VERLAGSGESELLSCHAFT |
| WOOD ET AL., NATURE, vol. 314, 1985, pages 446 - 449 |
| YAN ET AL., PLOS ONE, vol. 8, no. 3, 2013, pages e58006 |
| YANG ET AL., LEUKEMIA, vol. 28, no. 6, 2014, pages 1280 - 8 |
| ZHUANG ET AL., AM J CLIN PATHOL., vol. 137, no. 6, 2012, pages 978 - 985 |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11708412B2 (en) | 2013-09-26 | 2023-07-25 | Novartis Ag | Methods for treating hematologic cancers |
| US10570204B2 (en) | 2013-09-26 | 2020-02-25 | The Medical College Of Wisconsin, Inc. | Methods for treating hematologic cancers |
| US10752687B2 (en) | 2014-01-24 | 2020-08-25 | Novartis Ag | Antibody molecules to PD-1 and uses thereof |
| US11827704B2 (en) | 2014-01-24 | 2023-11-28 | Novartis Ag | Antibody molecules to PD-1 and uses thereof |
| US11155620B2 (en) | 2014-01-31 | 2021-10-26 | Novartis Ag | Method of detecting TIM-3 using antibody molecules to TIM-3 |
| US10981990B2 (en) | 2014-01-31 | 2021-04-20 | Novartis Ag | Antibody molecules to TIM-3 and uses thereof |
| US10472419B2 (en) | 2014-01-31 | 2019-11-12 | Novartis Ag | Antibody molecules to TIM-3 and uses thereof |
| US12252535B2 (en) | 2014-03-14 | 2025-03-18 | Novartis Ag | Antibody molecules to LAG-3 and uses thereof |
| US11344620B2 (en) | 2014-09-13 | 2022-05-31 | Novartis Ag | Combination therapies |
| US12600777B2 (en) | 2015-07-29 | 2026-04-14 | Novartis Ag | Combination therapies comprising antibody molecules to LAG-3 |
| US20210363242A1 (en) * | 2018-01-16 | 2021-11-25 | Bristol-Myers Squibb Company | Methods of treating cancer with antibodies against tim3 |
| WO2019143607A1 (en) * | 2018-01-16 | 2019-07-25 | Bristol-Myers Squibb Company | Methods of treating cancer with antibodies against tim3 |
| WO2020146196A1 (en) * | 2019-01-11 | 2020-07-16 | Eli Lilly And Company | Tim-3 antibodies and combinations with other checkpoint inhibitors for the treatment of cancer |
| US20220185896A1 (en) * | 2019-05-01 | 2022-06-16 | New York University | Anti-galectin-9 antibodies and uses thereof |
| WO2021051352A1 (zh) * | 2019-09-19 | 2021-03-25 | 上药生物治疗(香港)有限公司 | 一种分离的抗原结合蛋白及其用途 |
| WO2021079195A1 (en) * | 2019-10-21 | 2021-04-29 | Novartis Ag | Tim-3 inhibitors and uses thereof |
| WO2021206652A1 (en) * | 2020-04-10 | 2021-10-14 | Hacettepe Üni̇versi̇tesi̇ | Targeting tim-3 and lag-3 receptors induced by cd44+ cd90+ cancer stem cells in small cell lung cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| MX2019015738A (es) | 2020-02-20 |
| JP2020525483A (ja) | 2020-08-27 |
| KR20200022447A (ko) | 2020-03-03 |
| US20200223924A1 (en) | 2020-07-16 |
| AU2018292618A1 (en) | 2019-12-19 |
| JP2023145487A (ja) | 2023-10-11 |
| RU2020102863A3 (https=) | 2021-10-08 |
| RU2020102863A (ru) | 2021-07-27 |
| CA3066747A1 (en) | 2019-01-03 |
| EP3645037A1 (en) | 2020-05-06 |
| CN111050791A (zh) | 2020-04-21 |
| IL271222A (en) | 2020-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250034259A1 (en) | Dosage Regimens For Anti-Pd-L1 Antibodies And Uses Thereof | |
| AU2018302283B2 (en) | Dosage regimens of anti-LAG-3 antibodies and uses thereof | |
| US20250213684A1 (en) | Combination therapies comprising antibody molecules to tim-3 | |
| WO2019006007A1 (en) | POSOLOGICAL REGIMES FOR ANTI-TIM3 ANTIBODIES AND USES THEREOF | |
| US11155620B2 (en) | Method of detecting TIM-3 using antibody molecules to TIM-3 | |
| IL293752A (en) | Combination comprising a tim-3 inhibitor and a hypomethylating agent for use in treating myelodysplastic syndrome or chronic myelomonocytic leukemia | |
| RU2804775C2 (ru) | Режимы дозирования для антител против tim-3 и их применения | |
| RU2801208C2 (ru) | Режимы дозирования антител анти-lag-3 и их применение |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18743243 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3066747 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2018292618 Country of ref document: AU Date of ref document: 20180627 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019572138 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20207001985 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018743243 Country of ref document: EP Effective date: 20200127 |