WO2018222022A2 - Single nucleotide polymorphic marker composition for predicting response to anti-tnf preparation, and method using same to predict response to anti-tnf preparation - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphic marker composition for predicting response to an anti-TNF preparation, and a method using same to predict response to an anti-TNF preparation. With respect to IFX, the inventors classified a total of 349 CD registered patients into a good responder group containing 42 patients, a non-responder group containing 70 patients, and an intermediate responder group containing 237 patients, and analyzed a total of 112 patients through linkage analysis. 58 patients (15 in the good responder group and 43 in the non-responder group) were analyzed in a discovery analysis, and 54 patients (27 in the good responder group and 27 in the non-responder group) were analyzed in a replication analysis. As a result of the analyses, an rs2158962 SNP variation relating to better response to IFX treatment was identified, and a high frequency of the "A" allele was found in the good responder groups. Accordingly, the present invention can be usefully applied to establishing a treatment strategy and carrying out patient-tailored treatment during the IFX treatment of CD patients.

Description

Monobasic Polymorphic Marker Composition for Predicting Reactivity to Anti-TNF Agent and Method for Predicting Reactivity to Anti-TNF Agent Using the Same

The present invention relates to a monobasic polymorphic marker composition for predicting reactivity to an anti-TNF agent and a method for predicting reactivity to an anti-TNF agent using the same.

Crohn's disease (CD) is a chronic recurrent inflammatory disease of the intestine. Proinflammatory cytokine tumor necrosis factor-α (TNF) plays an important role in CD immunopathogenesis. Currently, anti-TNF agents, such as infliximab (IFX), play a pivotal role in the treatment of recovering and maintaining moderate to severe CD patients. Despite these clinical effects, about one third of patients do not respond to anti-TNF agent treatment, and more than 20% of the yearly initial response patients do not respond to treatment. Anti-TNF agents also have high costs and additional concerns such as the risk of malignant tumors or opportunistic infections.

In order to predict response to anti-TNF treatment in CD, several clinical factors have been proposed, such as smoking and C-reactive protein elevations, but these markers have limited clinical utility in the patient group. Previous attempts to identify genetic markers responsive to anti-TNF treatment have resulted in some successes, including the analysis of some candidate genes and the inter-individual variation in the pharmacokinetics of the drug. Some confounding factors have been applied. Recent immunochip association studies that identified genetic factors associated with response to anti-TNF treatment in CD identified genetic factors predicting non-response and persistence, but alleles common to non-response and persistence ( alleles) could not be identified, which is distinct from biological mechanisms.

It is an object of the present invention to provide a composition for predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases comprising a rs2158962 monobasic polymorphism marker.

Another object of the present invention is to provide a method for providing information for predicting responsiveness to an anti-TNF agent in a patient with TNF-α-related disease, including identifying the genotype of an rs2158962 monobasic polymorphism marker.

Still another object of the present invention is to provide an anti-TNF agent for patients with TNF-α-related diseases comprising a probe specifically binding to a polynucleotide comprising a rs2158962 monobasic polymorphism marker or a primer for amplifying the polynucleotide. To provide a reactivity prediction kit.

The present invention also relates to 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 for predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases. It is to provide a use of the polynucleotide consisting or a complementary polynucleotide thereof.

In order to solve the above problems, the present invention comprises a polynucleotide consisting of 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof Provided are compositions for predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases.

In addition, the present invention comprises the steps of extracting DNA from the separated sample of patients with TNF-α-related diseases; Identifying the genotype of the 101 nucleotide of SEQ ID NO: 1 from the extracted DNA; And predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases with the identified genotypes. to provide.

In addition, the present invention provides a probe specifically binding to a polynucleotide consisting of 10-100 contiguous DNA sequences or a complementary polynucleotide thereof comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 or A kit for predicting responsiveness to an anti-TNF agent in a TNF-α related disease patient containing a primer for amplifying the polynucleotide is provided.

The present invention also relates to 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 for predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases. Provided are uses of the constructed polynucleotides or their complementary polynucleotides.

The present invention relates to a monobasic polymorphic marker composition for predicting reactivity to an anti-TNF agent and a method for predicting reactivity to an anti-TNF agent using the same. Of the 349 CD-registered patients, we categorized 42 patients as good responders to IFX, 70 as non-responders, and 237 as intermediate responders, with a total of 112 patients. We analyzed 58 patients (15 good responders and 43 non-responders) in excavation analysis and 54 patients (27 good responders and 27 non-responders) in reproducible analysis. As a result of the analysis, the mutation of rs2158962 SNP associated with good response to IFX treatment was identified, and the "A" allele was high in the good response group. Therefore, the present invention can be usefully used in establishing a treatment strategy and proceeding patient-specific treatment in IFX treatment of CD patients.

1 is a schematic diagram showing an experimental design. A good response group was defined as patients with mucosal healing observed and who maintained IFX treatment for at least 5 years without major abdominal surgery (MAS) or dose escalation. Non-responder groups were defined as patients showing no change in lesion improvement or progression on colonoscopy and / or tomography following IFX administration. Excavation and reproduction analysis focused on the "extreme" phenotype. Patients with intermediate phenotypes were excluded from the genotyping study (n = 237; 67.9%). We assessed whether SNPs identified from genotyping could predict mucosal healing in all enrolled patients (n = 349).

2 shows the clinical reproducibility of rs2158962. (A) Of 112 Crohn's patients, cumulative survival according to rs2158962 genotype of patients maintaining IFX treatment without MAS or dose escalation ( P = 0.004, log-rank test). (B) the recipient on the response characteristic for all registered patients (n = 349) with additional mucosal healing TRAP1 SNP rs2158962 indicates a prediction model curve (Receiver operating characteristic curve). The area under the curve was 0.631 (95% confidence interval = 0.58-0.68). The overall sensitivity was 71.8 and the specificity was 48.1.

Figure 3 shows the effect on infliximab (IFX) in dextran sulfate sodium (DSS) -induced colitis mice. (a) shows weight-loss curves following DSS colitis induction. When 5% DSS dissolved in drinking water was administered for 5 days, TRAP1 transgenic (TG) and wild-type (WT) -C57BL mice similarly lost 13% of their initial weight. (b) shows weight-loss curves between IFX-treated vs untreated groups. After 3 and 4 days of IFX administration, TRAP1 TG mice had significantly reduced weight loss (WT-IFX vs TG-IFX: P _{3-day after IFX} = 3.26 × 10 ^-4 and P _{4-day after IFX} = 7.47 × 10 ^-3 , two-tailed t-test. (c) Representative images of H & E stained colon tissue sections are shown at 4 × magnification. (d) Histologic scores are shown (WT-IFX vs TG-IFX: P = 3.60 × 10 ⁻³ , two-tailed t-test). Data is shown as mean ± SD. ** P <0.01, *** P <0.001 (n = 17 IFX untreated WT mouse, n = 17 IFX untreated TG mouse, n = 15 IFX untreated WT mouse and n = 16 IFX untreated TG mouse ).

Thus, based on genetic factors as well as several clinical and environmental factors that indicate inappropriate responses to IFX, we have identified genetic predictive markers that show good response in a hypothetical manner through genome-wide association studies. The present invention has been completed.

The present invention relates to a patient with a TNF-α-related disease comprising a polynucleotide consisting of 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof. Provided is a composition for predicting reactivity to an anti-TNF agent.

Specifically, the allele of the 101 nucleotide of SEQ ID NO: 1 may be A / G.

In detail, the TNF-α-related disease may be Crohn's disease, ulcerative colitis, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis or psoriasis, and more particularly, Crohn's disease, but is not limited thereto.

Specifically, the anti-TNF agent may be infliximab (IFX), but is not limited thereto.

The polymorphic SNP mutation in the polynucleotide comprising the 101 nucleotide of SEQ ID NO: 1 can be described by marking rs2158962. The rs2158962 is TNF receptor on Chromosome 16 - associated protein 1 (TNF receptor-associated protein 1 ; TRAP1) present in the intron 3, the allele is an A / G. The 101 nucleotide of SEQ ID NO: 1 was prepared according to the multibase system method, and may be A or G, so it was described as "r".

The term "polymorphism" of the present invention refers to the case where two or more alleles exist in a single locus, and the term "polymorphic site" means a locus in which the allele exists. Among polymorphic sites, a single base that differs from person to person is called "monobase polymorphism," or SNP (single nucleotide polymorphism).

In addition, the present invention comprises the steps of extracting DNA from the separated sample of patients with TNF-α-related diseases; Identifying the genotype of the 101 nucleotide of SEQ ID NO: 1 from the extracted DNA; And predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases with the identified genotypes. to provide.

Specifically, the step of predicting the responsiveness to the anti-TNF agent of the patient of the TNF-α-related disease is the anti-TNF-α-related disease of the patient when the genotype of the 101 nucleotide of SEQ ID NO: 1 is AA homozygous It can be expected that the reactivity to the TNF preparation is a good response.

In detail, the TNF-α-related disease may be Crohn's disease, ulcerative colitis, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis or psoriasis, and more particularly, Crohn's disease, but is not limited thereto.

On the other hand, if the TNF-α-related disease is Crohn's disease, predicting that it is a good response to anti-TNF preparations in Crohn's disease patients, the mucous membrane is cured when treating anti-TNF preparations in Crohn's disease patients, major abdominal surgery It can be predicted to show high survival rate without major abdominal surgery (MAS).

Specifically, the anti-TNF agent may be infliximab (IFX), but is not limited thereto.

In the step of extracting DNA from the separated sample, the DNA may be separated from all cells such as blood, skin cells, mucosal cells and hair of the subject. The method for extracting DNA from the cell is not particularly limited, and techniques known in the art or commercially available kits for DNA extraction can be used.

In the step of identifying the genotype, gene sequence analysis may be performed. Sequencing may use any method known in the art, and the present invention is not limited thereto, but may include, but is not limited to, an autobase sequencer, pyrosequencing, PCR-RELP (restriction fragment length polymorphism), PCRSSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), PCR-SSO and dot hybridization combined ASO (allele specific oligonucleotide) hybridization, TaqMan-PCR, MALDI-TOF / MS, Any one or more selected from known methods such as RCA method (rolling circle amplification), HRM (high resolution melting) method, primer extension method, Southern blot hybridization method and dot hybridization method can be used.

In addition, the present invention provides a probe specifically binding to a polynucleotide consisting of 10-100 contiguous DNA sequences or a complementary polynucleotide thereof comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 or A kit for predicting responsiveness to an anti-TNF agent in a TNF-α related disease patient containing a primer for amplifying the polynucleotide is provided. The kit is preferably a PCR kit or a DNA chip kit, but is not limited thereto.

In detail, the TNF-α-related disease may be Crohn's disease, ulcerative colitis, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis or psoriasis, and more particularly, Crohn's disease, but is not limited thereto.

Specifically, the anti-TNF agent may be infliximab (IFX), but is not limited thereto.

The "probe" refers to nucleic acid fragments such as RNA or DNA corresponding to short bases to hundreds of bases capable of specific binding other than mRNA, and are labeled to identify presence or absence of expression of specific mRNAs. Can be. The probe may be manufactured in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, an RNA probe, or the like. Selection of appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.

The “primer” is a nucleic acid sequence having a short free 3-terminal hydroxyl group, which forms base pairs with complementary templates and acts as a starting point for template strand copying. Say. Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffers and temperatures. PCR conditions, sense and antisense primer lengths may be appropriately selected according to techniques known in the art.

The present invention also relates to 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 for predicting responsiveness to anti-TNF agents in patients with TNF-α-related diseases. Provided are uses of the constructed polynucleotides or their complementary polynucleotides.

Hereinafter, examples will be described in detail to help understand the present invention. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Experimental Example

The following experimental examples are intended to provide experimental examples that are commonly applied to each embodiment according to the present invention.

1. Experimental subject

The present inventors used the inflammatory bowel disease (IBD) register of Asan Medical Center, the third hospital in Seoul. The IBD Registry has been created since 1997, and clinical information, including patient basic characteristics, condition status or location, degree of complications, drug use patterns, and type and date of surgery, is regularly updated in the database. CD was diagnosed based on conventional clinical, radiation, endoscopic and histopathological criteria. A total of 582 CD patients who received IFX treatment were identified from the IBD registry. Each patient received three doses of IFX for six weeks for treatment (typically at weeks 0, 2 and 6). Then, depending on the clinical response of the patients, the patients were administered at different times of administration, usually at 8 week intervals, for maintenance therapy. Of the 582 patients, 233 patients were excluded from the present invention, except for the following reasons. (a) no DNA sample (n = 64), (b) start of IFX administration in an external hospital (n = 63), (c) no significant mucosal ulceration identified (n = 5), (d) side effects, infection or cancer Initial discontinuation of IFX treatment for reasons other than no response, such as concurrent onset and insurance issues (n = 32), or (e) no follow-up assessment (n = 69). The present invention was approved through the Institutional Review Board of Asan Medical Center, and received written consent from all participants.

2. Clinical Phenotype

Demographic and clinical characteristics of the patient group of the present invention are shown in Table 1. Gender, age at diagnosis of CD, age at start of IFX treatment, duration of illness before IFX treatment, smoking status at diagnosis of CD, presence of perianal fistula at diagnosis of CD, symptoms defined by Montreal classification at the beginning of IFX treatment Location [(L1, ileum; L2, colon; L3, ileocolon)], a condition defined by the Montreal classification at the start of IFX treatment [B1, nonstricturing, non-perforated (nonpenetrating; B2, stricturing; and B3, penetrating), major abdominal surgery (MAS) history prior to the start of IFX treatment, and simultaneous use of immunomodulators at the start of IFX treatment (azathioprine / 6-mercaptopurine or methotrexate), baseline CD activity index and baseline levels of C-reactive protein were obtained from the IBD registry.

3. Results and Definitions

It is an object of the present invention to identify genetic loci associated with good response to IFX treatment. To this end, we first identified patients at both extremes by comparing their response to IFX (FIG. 1). The good response group was defined as patients with mucosal healing observed through ileocolonoscopy and cross-sectional imaging and who maintained a good response for at least 5 years without MAS or dose escalation. Non-responder groups were defined as patients showing no change in lesion improvement or progression on colonoscopy and / or tomography following IFX administration. The middle responder group was defined as patients who did not meet the good or non-responder criteria. They initially consisted of patients with confirmed mucosal healing but with a response or follow-up period of less than 5 years and initially responding partially to IFX. Mucosal healing on colonoscopy was defined as the disappearance of all active and ulcerative lesions except for the often occurring aphthae, residual superficial erosion, or thickened folds. On tomography, mucosal healing is characterized by mild wall thickening or contrast, in which the active intestinal inflammation that has already been found through imaging diagnosis is completely resolved or the intestinal inflammation is markedly reduced, and not accompanied by other active inflammatory imaging findings. It was defined as the case where hyperenhancement appeared.

4. Genotyping and Association Analysis

Fifteen good responders and 43 non-responders of the CD patients in the excavation cohort were partially genotyped through the preceding GWAS of IBD. Samples and single-nucleotide polymorphisms (SNPs) that did not meet quality control criteria in previous studies were excluded. After SNP and sample quality control analysis, we used genotype data of 522,285 SNPs in GWAS analysis. To confirm that the case and control were compared well, we performed principal component analysis, including the patient and healthy control. The HapMap distributions of the control, good and non-responder groups were identified according to the two main variance principal components, and no outliers were found in the two major constituents (PC1, PC2) and three principal constituents (PC1, PC3). TaqMan SNP genotyping for top locus SNPs ( P <1 × 10 ⁻⁵ ) of 8 loci suggested to be relevant in the reproduction cohort of 27 good and 27 non-responders in the reproducibility test. Genotypes were analyzed using assays (FIG. 1 and Table 2).

5. Mice and DSS-induced Acute Colitis

Animal studies were conducted in accordance with the guidelines for the use and management of laboratory animals, with the approval of the Animal Experimental Ethics Committee of the Asan Life Science Institute (Project number: 2017-12-084). All mice were bred and maintained in specific pathogen-free conditions at the Asan Life Science Institute animal facility. C57BL / 6 mice were purchased from Orientbio (Korea). Tumor necrosis factor-related protein 1 (Tumor necrosis factor-associated protein 1; TRAP1) transgenic mice (C57BL / 6NCrjBgi / pcDNA3.1-hTRAP1 ) was purchased from Macrogen (Seoul, Korea). Pups of transgenic mice were genotyped by PCR (forward primer 5′-GGGAGCTCAAAATGGAGGAC-3 ′; reverse primer 5′-GATGGTGATGGTGCCTTTCT-3 ′). All mice were used at 8-10 weeks of age and male mice were used for the present invention. Transgenic and control mice matched gender in the experiment. To create a dextran sulfate sodium (DSS) -induced colitis model, mice (8-10 weeks old) were dissolved in drinking water with 5% DSS (MP Biomedicals, cat no. 160110, CA, USA) for 5 days. Provided. On day 5, mice were divided into 2 groups, one group was intravenously injected with IFX (5 mg / kg, 200ul) (Remicade, Janssen, USA) and the other group received water. The same experimental settings were also applied to wild type C57BL mice. Animal weights were measured daily and monitored for pain as well as rectal bleeding. Mice were sacrificed 4 days after IFX administration. The colon was then removed and the colon length was measured. Relative weight was calculated by dividing the weight of the day0 by the weight of the sacrifice day.

6. RT-PCR and Histology

Total RNA was isolated from colon tissue using the Qiagen RNeasy Mini kit according to the manufacturer's instructions (Qiagen, German). CDNA was synthesized using Premium ^® reverse transcriptase (Thermo Scientific, Mass., USA). Polymerase chain reaction to confirm the hTRAP1 overexpressed in colon tissue (Polymerase chain reaction; PCR) was carried out by h TRAP1 primer (forward primer 5'- CCGTCCATGTTTGATGTGAG -3 '; reverse primer 5'- CAGGGGAATGTCCTCACTGT -3'). For histology analysis, 3% of colon tissue (ascending, transverse, descending / sigmoid colon) collected from mice were fixed with 4% paraformaldehyde. Formalin fixed paraffin embedding sections were stained with hematoxylin and eosin according to standard protocols.

 To measure spontaneous intestinal inflammation, a previously developed semi-quantitative combination score system was modified to add the five histologic subscales. Histologic subscales [each parameter: 0, absent; 1, mild; 2, moderate; 3, severe]: mononuclear cell infiltrate (0-3), granulation (0-3), epithelial injury / erosion (0-3), polymorphonuclear cell infiltration (polymorphonuclear cell infiltrates; 0-3) and systemic inflammation [0, absent; 1, submucosal; 2, one focal expansion into the muscularis and serosa; 3 to 5 lesion expansion into the muscularis and serosa; 4, diffuse]. Colonic inflammation was evaluated by a medical pathology expert (I. L.) who did not know the experimental conditions of the sample.

7. TRAP1 Expression in Peripheral Blood

Blood samples were collected from eight patients with poor response and four patients with good response. RNA was isolated from PAXgene blood RNA tube preservation samples using the PAXgene Blood RNA kit according to the manufacturer's instructions (Preanalytix, Switzerland). CDNA was synthesized using Premium ^® reverse transcriptase (Thermo Scientific, MA, USA). To verify the TRAP1 expressed in peripheral blood, the polymerase chain reaction (Polymerase chain reaction; PCR) was performed with primers for TRAP1 (forward primer 5'- CCGTCCATGTTTGATGTGAG -3 '; reverse primer 5'- CAGGGGAATGTCCTCACTGT -3') .

8. Statistical Analysis

Continuous variables are expressed as mean with standard deviations. Separation data are expressed in numbers and percentages. The comparison of category data between groups was performed using Pearson's chi-squared test. Continuous variables were compared using the two-tailed t-test or ANOVA test as appropriate. All significant items from univariate analysis were included in the binary logistic regression model for multivariate analysis. All variables of P <0.05 were included in the model, and variables of P <0.05 were maintained in the model. The results are expressed in odds ratios (ORs) with 95% confidence intervals.

All genetic association analyzes were performed through association based experiments using PLINK version 1.07 (see URLs). To assess the overall significance of the excavation linkage analysis and the potential population hierarchy, a quantile-quantile plot was created using R version 3.23. In addition, to assess the impact of population stratification, genome controlled expansion coefficients were calculated. The genomic control value (λ _GC ) of the present invention, 1.102, was used to correct the associated P value. After calibration, two loci, including the SNPs validated in the reproduction samples, were shown to be relevant ( P <1 × 10 ⁻⁵ ) (Table 2). Manhattan plots were created using the associated P values through Haploview version 4.2. Reproduction analysis was performed for association analysis using independent samples. Finally, combinatorial analysis was performed using the Cochran-Mantel-Haenszel test. OR measurement between excavation and reproduction samples The Breslow-Day test was used to analyze heterogeneity.

Example 1 Analysis of Extreme Phenotypes

To identify genetic variations associated with IFX treatment results, we applied an "extremes of phenotype" approach. First, we defined the opposite extremes of patients with IFX response, namely those with good response (mucosal healing observed, and those who maintained a good response to IFX for at least 5 years without MAS or dose increase) and non- Response groups (defined as patients showing no change in lesion improvement or progression on colonoscopy and / or tomography following IFX administration) were identified.

Of the 349 enrolled patients in total, 42 patients were classified as good responders to IFX, 70 patients were non-responders, and 237 patients were intermediate responders (FIG. 1). Demographic and clinical characteristics for 349 patients are shown in Table 1. Good and non-responder groups were similar in age at diagnosis, smoking status, location of disease, perianal fistula at diagnosis, co-administration of immunomodulators or MAS history. However, non-responders had a longer duration of illness prior to the start of IFX treatment (7.4 vs 4.2 years), were older at the start of IFX treatment (31.6 vs 26.5 years), and a lower percentage of men (51.4% vs 76.2%). Indicated. The penetrating status was more common in non-responders (50%) than in good responders (21.4%).

Example 2 Genome-Wide Association Analysis

A total of 112 patients were analyzed through association analysis: 58 patients (15 good and 43 non-responders) in excavation analysis and 54 patients (27 good and 27 non-responders) in reconstruction analysis. Reaction group) (FIG. 1). The genome-wide association analysis of 522,285 SNPs in 15 good and 43 non-responders was plotted on a Manhattan plot. Of the 8 loci identified as candidates for reproduction (defined as P <10 ^-5 , Table 2), within the intron 3 of TNF receptor-associated protein 1 ( TRAP1 ) in the reproduction cohort present was rs2158962 is reproduced (P = 0.004), "a " allele was higher in a good responder group (OR = 4.94; 95% confidence interval = 2.65 to 9.24; combination ^{P = 1.35 × 10 - 7)} ( Table 3) . Further analysis of the effect of rs2158962 on clinical outcomes showed a significant association among 112 CD patients with high cumulative survival while maintaining IFX treatment without MAS or dose escalation ( P = 0.004) (FIG. 2A). ). TRAP1 is a mitochondrial-specific Hsp90 chaperone that is involved in the regulation of mitochondrial permeability transition pores, as well as protective mechanisms against oxidative stress and apoptosis. TRAP1 was positively correlated with the degree of colon inflammation in patients with ulcerative colitis.

<Example 3> TRAP1  Infliximab Treatment in Transgenic Mice

Next, we sought to use human TRAP1 transgenic mice to see if increased TRAP1 expression caused a better response to infliximab. Intracolonal expression of human TRAP1 in TRAP1 transgenic mice was better than in wild type mice. To induce acute colitis, TRAP1 transgenic and wild type mice were given 5% DSS dissolved in drinking water for 5 days and then IFX was administered intravenously. After acute colitis induction, the relative weight curves of wild-type and TRAP1 transgenic mice changed similarly (FIG. 3A). However, TRAP1 in transgenic mice as compared to wild type mice, the weight of the recovered colitis mice were significantly (IFX administered three days after the P = 3.26 × 10 ^-4 and IFX administration 4 days P = 7.47 × 10 ^{- 3)} (FIG. 3B). In addition, micro enteritis based on histological criteria after IFX treatment also showed a significant difference between TRAP1 transgenic and wild type mice, supporting that TRAP1 is associated with a good response to IFX (FIGS. 3C and 3D). ).

Example 4 Clinical Results According to rs2158962

To determine if rs2158962 can be used to predict mucosal healing in extreme cases, we measured mucosal healing rates in all enrolled patients (n = 349). Mucosal cure rates were 46.7% (21/45) in homozygotes (AA), 26.1% (40/153) in heterozygotes (AG) and 15.9% (in non-carriers (GG)). 24/151). Cumulative survival was significantly higher in homozygotes (AA) than non-carriers (GG): 93.8% vs 41.6% at 3 years, 87.5% vs 31.4% at 5 years and 80.8% vs 31.4% at 10 years (Figure 2A) . In the presence of rs2158962 "A" allele, the area under the curve value of 0.631 showed 71.8% sensitivity (61/85) and 48.1% specificity (127/264) for mucosal healing (Figure 2B). For 349 patients, multivariate analysis using clinical variables (gender, age at start of IFX treatment, duration of illness before IFX treatment, disease status at start of IFX treatment and MAS history before IFX treatment) and TRAP1 risk allele, non- The mucosal healing rate in the homozygote (AA) was 5.5 times higher than in the carrier (GG) (Table 4).

Having described the specific parts of the present invention in detail, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (12)

1. Anti-TNF in a patient with a TNF-α-related disease containing a polynucleotide consisting of 10-100 consecutive DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof Composition for predicting reactivity to the formulation.
2. According to claim 1, wherein the allele of the 101 nucleotide of SEQ ID NO: 1 is A / G composition for predicting the reactivity to the anti-TNF agent in patients with TNF-α-related diseases.
3. According to claim 1, wherein the TNF-α-related disease is Crohn's disease, ulcerative colitis, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis or psoriasis patients with TNF-α-related disease responsive to the anti-TNF agent Predictive composition.
4. According to claim 1, wherein the anti-TNF agent is infliximab (infliximab; IFX) composition for predicting the reactivity of the anti-TNF agent in patients with TNF-α-related diseases.
5. Extracting DNA from an isolated sample of a TNF-α related disease patient;

   Identifying the genotype of the 101 nucleotide of SEQ ID NO: 1 from the extracted DNA; And

   A method of providing information for predicting responsiveness to an anti-TNF agent in a TNF-α related disease patient comprising predicting responsiveness to an anti-TNF agent in a patient of TNF-α related disease with the identified genotype.
6. The method of claim 5, wherein the predicting responsiveness of the TNF-α-related disease patient to the anti-TNF agent is performed when the genotype of the 101 nucleotide of SEQ ID NO: 1 is an AA homozygote. A method for providing information for predicting responsiveness to an anti-TNF agent in a patient with a TNF-α-related disease characterized by predicting that the response to the anti-TNF agent is a good response.
7. The method according to claim 5, wherein the TNF-α-related disease is Crohn's disease, ulcerative colitis, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis or psoriasis. How to provide information for prediction.
8. 6. The method of claim 5, wherein the anti-TNF agent is infliximab (IFX), providing information for predicting responsiveness to an anti-TNF agent in a patient with TNF-α-related disease.
9. Amplifying a polynucleotide consisting of 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 or a probe that specifically binds to its complementary polynucleotide A reactivity prediction kit for an anti-TNF agent in a TNF-α related disease patient containing a primer to
10. 11. The method of claim 10, wherein the TNF-α-related disease is Crohn's disease, ulcerative colitis, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis or psoriasis patients with TNF-α-related disease responsive to the anti-TNF agent Prediction Kit.
11. The kit for predicting reactivity of an anti-TNF agent in a patient with TNF-α-related disease according to claim 10, wherein the anti-TNF agent is infliximab (IFX).
12. A polynucleotide consisting of 10-100 contiguous DNA sequences comprising a single nucleotide polymorphism (SNP) marker of the 101 nucleotide of SEQ ID NO: 1 for predicting responsiveness to an anti-TNF agent in a patient with TNF-α or Use of its complementary polynucleotides.

Images