WO2018194411A1 - 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법 - Google Patents

코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법 Download PDF

Info

Publication number
WO2018194411A1
WO2018194411A1 PCT/KR2018/004597 KR2018004597W WO2018194411A1 WO 2018194411 A1 WO2018194411 A1 WO 2018194411A1 KR 2018004597 W KR2018004597 W KR 2018004597W WO 2018194411 A1 WO2018194411 A1 WO 2018194411A1
Authority
WO
WIPO (PCT)
Prior art keywords
fucosyllactose
corynebacterium glutamicum
mannose
lactose
gdp
Prior art date
Application number
PCT/KR2018/004597
Other languages
English (en)
French (fr)
Inventor
서진호
정상민
이도행
전형도
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to US16/606,921 priority Critical patent/US11512318B2/en
Priority to EP18787693.3A priority patent/EP3613858B1/en
Priority to CN201880033706.4A priority patent/CN110662842B/zh
Priority to JP2019556815A priority patent/JP6903256B6/ja
Priority claimed from KR1020180045845A external-priority patent/KR102050522B1/ko
Publication of WO2018194411A1 publication Critical patent/WO2018194411A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds

Definitions

  • the present invention relates to 3'-fucosyllactose producing mutant microorganisms using wild-type Corynebacterium glutamicum strains and to a method for producing fucosylactose from glucose and lactose, specifically, phosphoman to corynebacterium.
  • ManB mannose-1-phosphate guanylyl transferase
  • ManC mannose-1-phosphate guanylyl transferase
  • GDP- D-mannose-4,6-dehydratase Gmd
  • WcaG GDP-L-fucose synthase
  • ⁇ -1,3-fucosyltransferase a method for producing 3'-fucosyllactose using recombinant Corynebacterium glutamicum in which a mutant lac operon from which lacZ has been removed is introduced.
  • Human milk contains more than 200 different types of human milk oligosaccharides (HMOs), which are present at significantly higher concentrations (5-15 g / L) than other mammals. These HMOs have essential functions such as prebiotic effects, pathogen-intestinal inhibitory effects, and immune regulatory system regulation.
  • HMOs human milk oligosaccharides
  • 3'-fucosyllactose in HMOs is reported to be a major HMO involved in various biological activities.
  • Production methods of 3'-fucosyllactose include direct extraction from breast milk and synthesis by chemical or enzymatic methods.
  • the direct extraction method has disadvantages such as limitation of breast feeding and low productivity, and chemical synthesis has problems such as expensive substrate, low iso-selectivity and yield, and use of toxic organic solvent.
  • the enzymatic synthesis method has a disadvantage that GDP-L-fucose, which is used as a donor of fucose, is very expensive, and the purification cost of fucosyltransferase is high.
  • E. coli which is used for experiments, is not actually a pathogen, but has a strong recognition that it is harmful to consumers, and the cost of separation and purification may be high because cell membrane components can act as endotoxins. It is difficult to use E. coli as a host cell to produce fucosyllactose.
  • Republic of Korea Patent No. 10-1544184 (Registration Date: 2015.08.21), relates to a mutant microorganism for producing 2'-fucosyllactose and a method for producing 2'-fucosyllactose using the same, lacZ is modified or Mutations in which at least one gene selected from the group consisting of a gene encoding the removed operon and FucT2 or a variant thereof, a gene encoding G6PDH (glucose-6-phosphate dehydrogenase) and a GSK (guanosine-inosine kinase) is introduced or amplified Microorganisms and methods of making 2'-fucosyllactose using them are described.
  • G6PDH glucose-6-phosphate dehydrogenase
  • GSK guanosine-inosine kinase
  • fucose metabolic enzyme fucose isomerase fucose isomerase, FucI
  • fuculose kinase fuculose kinase, FucK
  • Fukulose 1 Beta-galactosidase which has one or more of the genes encoding fuculose 1-phosphate aldolase (FucA) disrupted and is less active than wild-type beta galactosidase instead of wild lac operon Recombination for the production of fucosylactose with a lac operon consisting of a lacZ gene, a wild type lacY gene and a wild type lacA gene, or a lac operon consisting entirely of a wild type lacY gene and a wild type lacA gene.
  • fucosilactose which is a food and pharmaceutical material
  • Corynebacterium glutamicum which is safer than Escherichia coli, 3'-fucosyllactose with high concentration, high yield, and high productivity.
  • the present invention is transformed to express ⁇ -1,3-fucosyltransferase ( ⁇ -1,3-fucosyltransferase), GDP-D-mannose-4,6-dehydratase (GDP-D-mannose Transformed to express -4,6-dehydratase, transformed to express GDP-L-fucose synthase, and transformed to express lactose permease Recombinant Corynebacterium glutamicum characterized by being converted and carrying Phosphomannomutase and GTP-mannose-1-phosphate guanylyltransferase ( Corynebacterium glutamicum ).
  • the ⁇ -1,3- fucose transferase ( ⁇ -1,3-fucosyltransferase) is, it is better to use the encrypted by azoT gene .
  • the azoT gene may be preferably composed of the nucleic acid sequence of SEQ ID NO: 5.
  • the recombinant Corynebacterium glutamicum of the present invention is preferably transformed to overexpress the phosphomannomutase, GTP-mannose- It is preferred that the 1-phosphate guanyltransferase (GTP-mannose-1-phosphate guanylyltransferase) is transformed to overexpress.
  • the present invention is transformed to express ⁇ -1,3-fucosyltransferase in the medium to which lactose is added, GDP-D-mannose-4,6-dehydrata Transformed to express an enzyme (GDP-D-mannose-4,6-dehydratase), transformed to express GDP-L-fucose synthase, and lactose permease ( recombinant corynebacterium transformed to express lactose permease and possessing phosphomannomutase and GTP-mannose-1-phosphate guanylyltransferase It provides a method for producing 3'-fucosyllactose, characterized in that culturing glutamicum ( Corynebacterium glutamicum ).
  • the medium preferably further contains glucose.
  • the production method of the fucosyllactose may be more preferably batch culture or fed-batch culture to further supply glucose or lactose.
  • 3'-fucosyllactose can be produced using the GRAS strain Corynebacterium glutamicum strain, and 3'-fucosyllactose can be produced safely compared to the conventional E. coli. .
  • Corynebacterium glutamicum strain of the present invention it is possible to produce 3'-fucosyllactose with high concentration, high yield, high productivity.
  • Figure 1 is a schematic diagram of the metabolic pathways introduced for the biosynthesis of GDP-L-fucose and 3'-fucosyllactose in Corynebacterium glutamicum strain.
  • Figure 2 is the result of measuring the 3'-fucosyllactose produced in Corynebacterium glutamicum pVBCL + pEGWA (pEGW + azoT) by HPLC.
  • Figure 3 is a graph showing the flask batch culture results using recombinant Corynebacterium glutamicum ( C. glutamicum ) pVBCL + pEGWA. Once the optical density (OD 600 ) reached about 0.8, IPTG and lactose were added so that the final concentrations were 1.0 mM and 10 g / L (arrows), respectively. Symbols in the graph are as follows: ⁇ : dry cell weight, ⁇ : glucose, ⁇ : lactose, ⁇ : lactate, ⁇ : 3'-fucosyllactose.
  • Figure 4 is a graph showing the fed-batch culture results using recombinant Corynebacterium glutamicum ( C. glutamicum ) pVBCL + pEGWT. After 40 g / L glucose was consumed at the beginning, glucose was fed by continuous feeding and IPTG and lactose were added at the same time (arrow). Symbols in the graph are as follows: ⁇ : dry cell weight, ⁇ : glucose, ⁇ : lactose, ⁇ : lactate, ⁇ : 3'-fucosyllactose.
  • the present invention is transformed so that ⁇ -1,3-fucosyltransferase is expressed, GDP-D-mannose-4,6-dehydratase (GDP-D- transformed to express mannose-4,6-dehydratase, transformed to express GDP-L-fucose synthase, and to express lactose permease Recombinant Corynebacterium glutamimes, which are transformed and possess phosphomannomutase and GTP-mannose-1-phosphate guanylyltransferase Provide Cormebacterium glutamicum .
  • the present inventors have previously applied for a method of producing 3'-fucosyllactose using E. coli through Korean Patent Application No. 10-2016-0012803 (2016.02.02).
  • Korean Patent Application No. 10-2016-0012803 Korean Patent Application No. 10-2016-0012803 (2016.02.02).
  • the present invention attempted to produce 3'-fucosyllactose through an alternative strain without food safety problems.
  • Corynebacterium glutamicum ( Corynebacterium glutamicum ) was selected as a host cell for producing 3'-fucosyllactose, and this strain was recognized as GRAS (generally recognized as safe) unlike conventionally used Escherichia coli. Not only is it a strain, but also does not produce endotoxin and is a strain widely used for industrial production of amino acids and nucleic acids as food additives. Therefore, Corynebacterium glutamicum can be said to be a suitable strain for the production of food and pharmaceutical materials, there is an advantage that can dispel the concern for consumers on the safety aspects.
  • E. coli and Corynebacterium glutamicum differ in the genetic characteristics of the strain itself, a strategy different from that applied to E. coli should be used. It is basically the same to introduce the foreign ⁇ -1,3-fucosyltransferase, whether E. coli or Corynebacterium glutamicum to produce 3'-fucosyllactose.
  • Corynebacterium glutamicum additionally contains GDP-D-mannose-4,6-dehydratase ( Gmd ), GDP-L-fucose synth (GDP-L-fucose synthase, this enzyme is also called 'GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase'. Also abbreviated as ' WcaG ' The genes encoding these enzymes, in particular called ⁇ WcaG '', and lactose permease ( LacY ) should be introduced.
  • Escherichia coli contains GDP-D-mannose-4,6-dehydratase (GDP-D-mannose-4,6-dehydratase, Gmd ), and GDP-L-fucose synthase. , WcaG ), and lactose permease ( LacY ), but have genes encoding it, but because the Corynebacterium glutamicum strain does not have a gene encoding the enzymes, it is introduced from outside It should be expressed.
  • ⁇ -1,3- fucose transferase ( ⁇ -1,3-fucosyltransferase) gene (azoT) gene is preferably derived from an azo RY rilreom bra chamber lances (Azospirillum brasilense) coding for Good to do.
  • GDP-D-mannose-4,6-dehydratase (GDP-D-mannose-4,6-dehydratase, Gmd ) GDP-L-fucose-synthase
  • LacY lactose permease
  • the recombinant Corynebacterium glutamicum of the present invention is preferably transformed to overexpress the phosphomannomutase, GTP-mannose-1-phosphate guanyltransferase (GTP-mannose-1- It is recommended that the phosphate guanylyltransferase be transformed to overexpress.
  • Corynebacterium glutamicum is no force satiety Muta dehydratase (Phosphomannomutase, ManB), GTP- mannose-1-phosphate referred to obtain the kinase not transfer (GTP-mannose-1-phosphate guanylyltransferase, ManC) with a gene encoding its own Since it can be retained and expressed, it is not necessary to introduce a gene encoding the enzyme, but it is necessary to overexpress the enzyme for mass production. Accordingly, in the present invention, it is desirable to transform Corynebacterium glutamicum to overexpress these two enzymes.
  • lactose permease lactose permease, LacY
  • lacYA gene lacZ is a special enzyme that is involved in the transport of lactose existing outside the strain into the strain.
  • the term 'expression' used in the present invention the expression of the gene derived from the outside introduced into the strain in order to artificially express the enzyme that the Corynebacterium glutamicum strain of the present invention can not express itself
  • the term 'overexpression' means that the Corynebacterium glutamicum strain of the present invention has a gene encoding its own enzyme and can be expressed by itself, but its expression amount is for the purpose of mass production. In order to increase the artificially increased the amount of expression of the enzyme means overexpressed.
  • Corynebacterium glutamicum C. glutamicum
  • C. glutamicum can mass-produce 3'- fucosyllactose , a breast milk oligosaccharide.
  • the gene encoding ⁇ -1,3- fucose transferase is good to use the encrypted by azoT gene
  • the gene is preferably azoT It may be composed of the nucleic acid sequence of SEQ ID NO: 5.
  • ⁇ -1,3-fucosyllactose production reaction is carried out using GDP-L-fucose and lactose as substrates.
  • ⁇ -1,3-fucosyltransferase is required (see FIG. 1).
  • the enzyme is present in a variety of microorganisms, and in the present invention, azoT derived from Azospirillum brasilense is used.
  • azoT derived from Azospirillum brasilense
  • the amount of 3'- fucosyllactose was insignificant, but when the azoT gene was used, Yields were significantly higher.
  • the present invention provides a method for producing 3'-fucosyllactose, characterized in that the culture of the recombinant Corynebacterium glutamicum of the present invention in a medium to which lactose is added.
  • the recombinant Corynebacterium glutamicum strain of the present invention it is possible to produce 3'-fucosyllactose with high concentration, high yield, high productivity.
  • the medium preferably further contains glucose.
  • glucose is added to the medium, the growth of the strain is enhanced, and 3'-fucosyllactose can be produced with higher productivity.
  • the method of producing 3'-fucosyllactose of the present invention may be carried out through a fed-batch culture to further supply a batch or lactose.
  • Detailed local techniques relating to batch or fed-batch cultivation may use techniques known in the art, and thus description thereof will be omitted.
  • the strain Corynebacterium glutamicum of the present invention introduced lactose permease (lactose permease) in order to introduce the lactose which is a substrate of 3'-FL production into the cells. That is, in order to produce 3'-FL using Corynebacterium glutamicum, lactose should be transformed with lactose permease that can introduce the cells into cells, and the strain of the present invention is transformed with this enzyme. It is.
  • lactose permease lactose permease
  • lactose permease is usually subjected to "glucose repression" (glucose inhibition) in the presence of glucose to inhibit its activity.
  • glucose repression glucose inhibition
  • the 3'-FL production method constructed using Corynebacterium glutamicum in the present invention is a method capable of maximizing the production of 3'-FL.
  • Example 1 Recombinant strain and plasmid preparation
  • Cloning was performed using Escherichia coli TOP10 for plasmid preparation, and Corynebacterium glutamicum ATCC 13032 for the production of 3'-fucosyllactose (3'-FL).
  • a vector was constructed to express ⁇ -1,3-fucosyltransferase (azoT) in pEGW expression plasmids expressing gmd and wcaG genes.
  • azoT ⁇ -1,3-fucosyltransferase
  • ⁇ -1,3-fucose transferase is azospirillum brasilense ATCC 29145, ⁇ -1,3-fucose using a restriction enzyme of Sac1 in the pEGW vector Transferase (azoT) was inserted.
  • coli shuttle vector for regulated gene expression P tac , lacIq, pHM1519 , oriVC .g., oriVE.c.
  • test tube containing 5 mL of BHI (Brain Heart Infusion) medium containing appropriate antibiotics (kanamycin 25 ⁇ g / mL, tetracycline 5 ⁇ g / mL) was used. The temperature was maintained at 30 ° C. and the stirring speed was 250 rpm. And incubated for 12 hours.
  • BHI Brain Heart Infusion
  • antibiotics kanamycin 25 ⁇ g / mL, tetracycline 5 ⁇ g / mL
  • Batch cultures consist of 100 mL ((NH 4 ) 2 SO 4 20 g / L, urea 5 g / L, KH 2 PO 4 1 g / L, K 2 HPO 4 1 g / L, MgSO 4 0.25 g / L, MOPS 42 g / L, CaCl 2 10 mg / L, Biotin 0.2 mg / L, Protocatechuic acid 30 mg / L, FeSO 4 7H20 10 mg / L, MnSO 4 H 2 O 10 mg / L, ZnSO 4 7H 2 O 1 mg / L, CuSO 4 0.2 mg / L, NiCl 2 6H 2 O 0.02 mg / L, pH7.0) at 250 ° C.
  • a fed-batch culture for high concentration cell culture consists of a 2.5 L bioreactor containing a 1.0 L minimal medium containing 40 g / L glucose and appropriate antibiotics (kanamycin 25 ⁇ g / mL, tetracycline 5 ⁇ g / mL). , Kobiotech, Incheon, Korea).
  • a feeding solution containing 800 g / L of glucose was supplied by a continuous feeding method at a rate of 5.7 g / L / h.
  • IPTG and lactose were added to a final concentration of 1.0 mM, 10 g / L.
  • Dry cell weight was determined by multiplying the optical density (OD) by a conversion factor of 0.3.
  • Optical density (OD) was measured at an absorbance of 600 nm using a spectrophotometer (spectrophotometer, Ultrospec 2000, Amersham Pharmacia Biotech, USA) after appropriate dilution of the sample to adjust the optical density in the range of 0.1-0.5.
  • FIG. 3 is a graph showing the flask batch culture results using recombinant Corynebacterium glutamicum ( C. glutamicum ) pVBCL + pEGWA.
  • a feeding solution was supplied at a rate of 5.7 g / L / h by using a continuous feeding method.
  • IPTG and lactose were added to induce the production of 3'-fucosyllactose.
  • Figure 4 is a graph showing the fed-batch culture using recombinant Corynebacterium glutamicum pVBCL + pEGWA.

Abstract

본 발명은 야생형 코리네박테리움 글루타미쿰 균주를 이용하여 3'-푸코실락토오스를 제조하는 방법에 관한 것으로, GRAS 균주인 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum) 균주를 사용하여 3'-푸코실락토오스를 안전하게 생산할 수 있고, 고농도, 고수율, 고생산성으로 3'-푸코실락토오스를 생산할 수 있다.

Description

코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법
본 발명은 야생형 코리네박테리움 글루타미쿰 균주를 이용하여 3'-푸코실락토오스 생산 변이 미생물 및 글루코오스, 락토오스로부터 푸코실락토오스를 제조하는 방법에 관한 것으로, 상세하게는 코리네박테리움에 포스포만노뮤타아제 (phosphomannomutase, ManB), 만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase, ManC), GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase, Gmd), GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase, WcaG), α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)와 lacZ가 제거된 변이 lac오페론을 도입시킨 재조합 코리네박테리움 글루타미쿰을 이용하여 3'-푸코실락토오스를 생산하는 방법에 관한 것이다.
인간의 모유에는 200여종 이상의 각기 다른 구조를 가지는 올리고당 (Human Milk Oligosaccharide, HMO)을 가지고 있으며 이는 다른 포유류에 비해 상당히 높은 농도 (5~15 g/L)로 존재한다. 이러한 HMO는 전생물적 (prebiotic) 효과, 병원균 장내부착 억제 효과 그리고 면역조절시스템 조절효과 등 영유아에게 필수적인 기능성을 지닌다.
한편, HMO 중 3'-푸코실락토오스는 다양한 생물학적 활성에 관여하는 주요 HMO인 것으로 보고되고 있다. 3'-푸코실락토오스의 생산방법으로는 직접 모유로부터 추출하는 방법과 화학적 또는 효소적 방법으로 합성하는 방법이 있다. 하지만, 직접 추출하는 방법은 모유수급의 한계와 낮은 생산성이란 단점이 있으며, 화학적 합성법은 고가의 기질, 낮은 이성체 선택성 (stereo-selectivity) 및 생산수율, 독성 유기용매의 사용 등의 문제가 존재한다. 또한, 효소적 합성법은 푸코오스의 공여체 (donor)로 이용되는 GDP-L-fucose가 매우 고가이고, 푸코오스 전이효소 (fucosyltransferase)의 정제비용이 많이 소요되는 단점이 있다.
이와 같이 직접추출, 화학적 또는 효소적 생산법은 푸코실락토오스의 대량생산에 적용이 어려운 실정이다. 그러나 미생물을 이용한 생물공학적 생산방법은, 단순한 공정을 통해 저렴한 기질로부터 푸코실락토오스를 대량으로 생산할 수 있기 때문에, 건강기능성식품 및 의약품 소재로의 개발 가능성을 지닌 3'-푸코실락토오스를 생산을 위한 방법으로 각광받고 있다.
한편, 미생물을 이용한 3'-푸코실락토오스 생산에 관한 종래의 기술은 대부분 재조합 대장균을 이용한 생산기술이었다. 실험용으로 이용되는 대장균은 실제로는 병원균이 아니지만 소비자들에게는 해로운 균이라는 인식이 강하고, 세포막 성분이 엔도톡신으로 작용할 수 있기 때문에 분리 정제의 비용이 많이 소비되는 단점이 있어, 식품 및 의약품 소재인 3'-푸코실락토오스를 생산하는 숙주세포로써 대장균을 이용하기에는 어려움이 있는 실정이다.
대한민국 등록특허 제10-1544184호 (등록일자: 2015.08.21)에는, 2'-푸코실락토오스를 생산하기 위한 변이 미생물 및 이를 이용한 2'-푸코실락토오스의 제조방법에 관한 것으로, lacZ가 변형 또는 제거된 오페론 도입 및 FucT2 또는 이의 변이체를 코딩하는 유전자, G6PDH (glucose-6-phosphate dehydrogenase) 및 GSK (guanosine-inosine kinase)를 코딩하는 유전자로 이루어진 군에서 선택된 하나 이상의 유전자가 도입 또는 증폭되어 있는 변이 미생물 및 이를 이용하여 2'-푸코실락토오스를 제조하는 방법이 기재되어 있다.
대한민국 등록특허 제10-1648352호 (등록일자: 2016.08.09.)에는 푸코오스 대사효소인 푸코오스 아이소머라아제 (fucose isomerase, FucI), 푸쿨로오스 키나아제 (fuculose kinase, FucK) 및 푸쿨로오스 1-포스페이트 알돌라아제 (fuculose 1-phosphate aldolase, FucA)를 코딩하는 유전자 중 어느 하나 이상이 파쇄되어 있고, '야생형 lac 오페론' 대신 '야생형 베타 갈락토시다아제보다 활성이 낮춰진 베타갈락토시다아제를 코딩하는 lacZ 유전자, 야생형 lacY 유전자 및 야생형 lacA 유전자로 구성된 lac 오페론' 또는 '야생형 lacZ 유전자가 완전히 제거되고, 야생형 lacY 유전자 및 야생형 lacA 유전자만으로 구성된 lac 오페론'을 보유하고 있는 푸코실락토오스 생산용 재조합 대장균 및 이를 이용한 푸코실락토오스의 생산방법에 관한 것으로, 고 생산성으로 2-또는 3-푸코실락토오스를 생산할 수 있는 방법이 기재되어 있다.
본 발명에서는 식품 및 의약품 소재인 푸코실락토오스를 생산하는 숙주세포로서, 대장균보다 안전한 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)을 이용하되, 고농도, 고수율, 고생산성으로 3'-푸코실락토오스를 생산하는 방법을 개발하여 제공하고자 한다.
본 발명은 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)가 발현되도록 형질전환되고, GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase)가 발현되도록 형질전환되며, GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase)가 발현되도록 형질전환되고, 락토오즈 퍼미아제 (lactose permease)가 발현되도록 형질전환되며, 포스포만노뮤타아제 (Phosphomannomutase) 및 GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)를 보유하고 있는 것을 특징으로 하는 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)를 제공한다.
본 발명의 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)에 있어서, 상기 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)는, azoT 유전자로 암호화된 것을 사용하는 것이 좋다. 이때, 상기 azoT 유전자는, 바람직하게 서열번호 5의 핵산서열로 구성된 것일 수 있다.
본 발명의 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)에 있어서, 상기 재조합 코리네박테리움 글루타미쿰은, 바람직하게 포스포만노뮤타아제 (Phosphomannomutase)가 과발현되도록 형질전환되고, GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)가 과발현되도록 형질전환된 것이 좋다.
본 발명은 락토오스가 첨가된 배지에, α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)가 발현되도록 형질전환되고, GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase)가 발현되도록 형질전환되며, GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase)가 발현되도록 형질전환되고, 락토오즈 퍼미아제 (lactose permease)가 발현되도록 형질전환되며, 포스포만노뮤타아제 (Phosphomannomutase) 및 GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)를 보유하고 있는 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)을 배양하는 것을 특징으로 하는 3'-푸코실락토오스의 생산방법을 제공한다.
본 발명의 3'-푸코실락토오스 생산방법에 있어서, 상기 배지는, 바람직하게 글루코오스를 더 포함하는 것이 좋다. 이때, 상기 푸코실락토오스의 생산방법은, 더욱 바람직하게 글루코오스 또는 락토오스를 추가로 공급하는 회분식 배양 또는 유가식 배양인 것일 수 있다.
본 발명에 의하면, GRAS 균주인 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum) 균주를 사용하여 3'-푸코실락토오스를 생산할 수 있는데, 종래의 대장균에 비해 안전하게 3'-푸코실락토오스를 생산할 수 있다. 또한, 본 발명의 코리네박테리움 글루타미쿰 균주를 이용할 경우, 고농도, 고수율, 고생산성으로 3'-푸코실락토오스를 생산할 수 있다.
도 1은 코리네박테리움 글루타미쿰 균주에서 GDP-L-fucose 및 3'-푸코실락토오스를 생합성하기 위하여 도입한 대사경로를 도식화한 것이다.
도 2는 코리네박테리움 글루타미쿰 pVBCL + pEGWA (pEGW + azoT)에서 생산된 3'-푸코실락토오스를 HPLC를 통해 측정한 결과이다.
도 3은 재조합 코리네박테리움 글루타미쿰 (C. glutamicum) pVBCL + pEGWA를 이용한 플라스크 회분식 배양결과를 나타낸 그래프이다. 광학밀도 (OD600)가 약 0.8에 도달하면, IPTG와 락토오스를 최종 농도가 각각 1.0 mM, 10 g/L (화살표)이 되도록 첨가하였다. 그래프 중 기호는 다음과 같다: ●: 건조세포중량, ▲: 글루코오스, ■: 락토오스, ▼: 락테이트, ◆: 3'-푸코실락토오스.
도 4는 재조합 코리네박테리움 글루타미쿰 (C. glutamicum) pVBCL + pEGWT를 이용한 유가식 배양결과를 나타낸 그래프이다. 초기에 투입한 40 g/L 글루코오스가 모두 소모된 후, 글루코오스를 연속식 (continuous feeding)방법으로 공급하기 시작하였고, IPTG와 락토오스를 동시에 첨가하였다 (화살표). 그래프 중 기호는 다음과 같다: ●: 건조세포중량, ▲: 글루코오스, ■: 락토오스, ▼: 락테이트, ◆: 3'-푸코실락토오스.
본 발명은, α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)가 발현되도록 형질전환되고, GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase)가 발현되도록 형질전환되며, GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase)가 발현되도록 형질전환되고, 락토오즈 퍼미아제 (lactose permease)가 발현되도록 형질전환되며, 포스포만노뮤타아제 (Phosphomannomutase) 및 GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)를 보유하고 있는 것을 특징으로 하는 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)을 제공한다.
본 발명자들은 이전에 대한민국 특허출원번호 제10-2016-0012803호 (2016.02.02)를 통해, 대장균을 이용한 3'-푸코실락토오스 생산방법을 출원한 바 있다. 하지만, 3'-푸코실락토오스를 기능성 식품첨가물로 이용함에 있어서, 이를 대장균을 통해 생산하는 것은, 대장균이 갖는 여러 가지 안전상의 염려로 인해 문제가 될 수 있다는 지적이 많다. 따라서, 본 발명에서는 식품안전상 문제가 없는 대체 균주를 통해 3'-푸코실락토오스를 생산해보고자 하였다.
본 발명에서는 3'-푸코실락토오스를 생산하는 숙주세포로서 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)을 선정하였는데, 이 균주는 종래에 사용하던 대장균과는 달리 GRAS (generally recognized as safe)로 인정된 균주일 뿐만 아니라, 엔도톡신을 생산하지 않으며, 식품첨가물인 아미노산 및 핵산의 산업적 생산에 널리 이용되고 있는 균주이다. 따라서, 코리네박테리움 글루타미쿰은 식품 및 의약품 소재의 생산을 위해 적합한 균주라 할 수 있고, 안전성 측면에 대한 소비자에 대한 우려를 불식시킬 수 있는 장점이 있다.
그런데, 대장균과 코리네박테리움 글루타미쿰은 균주 자체의 유전적 특성이 다르기 때문에, 대장균에 적용하였던 전략과는 다른 전략을 사용해야 한다. 3'-푸코실락토오스를 생산하기 위해 대장균이든 코리네박테리움 글루타미쿰이든 기본적으로 외래의 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)를 도입해야 하는 것은 동일하나, 코리네박테리움 글루타미쿰은 그 외에 추가적으로 GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase, Gmd), GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase, 이 효소는 'GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase'로도 불림. 또한, 약어로는 'WcaG'로 불리는데, 이 효소를 암호화하는 유전자를 특히 'WcaG'로 부름), 락토오즈 퍼미아제 (lactose permease, LacY)를 도입해야 한다. 즉, 대장균에는 GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase, Gmd), GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase, WcaG), 락토오즈 퍼미아제 (lactose permease, LacY)를 암호화하는 유전자를 가지고 있으나, 코리네박테리움 글루타미쿰 균주는 상기 효소들을 암호화하는 유전자를 가지고 있지 않기 때문에, 이를 외부에서 도입시켜 이를 발현시켜 주어야 하는 것이다.
이때, 바람직하게 상기 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)를 암호화하는 유전자는 바람직하게 아조스피릴럼 브라실렌스(Azospirillum brasilense)에서 유래한 유전자(azoT)를 사용하는 것이 좋다. 또한, GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase, Gmd), GDP-L-푸코오스 신타아제 (GDP-L-fucose-synthase, WcaG) 및 락토오즈 퍼미아제 (lactose permease, LacY)를 암호화하는 유전자는 대장균에서 유래한 것을 사용하는 것이 좋다.
한편, 본 발명의 재조합 코리네박테리움 글루타미쿰은 바람직하게 포스포만노뮤타아제 (Phosphomannomutase)가 과발현되도록 형질전환되고, GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)가 과발현되도록 형질전환된 것이 좋다. 코리네박테리움 글루타미쿰은 포스포만노뮤타아제 (Phosphomannomutase, ManB), GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase, ManC)를 암호화하는 유전자를 자체적으로 보유하여 발현시킬 수 있기 때문에, 굳이 이 효소를 암호화하는 유전자를 도입시켜줄 필요는 없으나, 대량 생산을 위해서는 이 효소를 과발현시켜줄 필요가 있다. 따라서, 본 발명에서는 바람직하게 이들 두 효소를 과발현할 수 있도록 코리네박테리움 글루타미쿰을 형질전환하는 것이 필요한 것이다.
한편, 상기 효소들의 작용은 도 1을 통해서 이해될 수 있으므로, 이에 대한 설명은 생략하기로 한다. 다만, 락토오즈 퍼미아제 (lactose permease, LacY)는 균주 외부에 존재하는 락토오스를 균주 내부로 수송하는데 관여하는 효소임을 특별히 밝혀두는 바이다. 하기 본 발명의 실시예에서는 대장균의 Lac 오페론에서 lacZ가 제거된 lacYA 유전자를 도입하여 실험하였으나, 본 발명에서 Lac 오페론의 도입 이유가 락토오스의 유입에 관한 것이기 때문에, 굳이 lacA 유전자까지는 필요 없고, lacY 유전자만 도입시켜도 충분하다.
한편, 본 발명에서 사용하는 '발현'이라는 용어는, 본 발명의 코리네박테리움 글루타미쿰 균주가 자체적으로 발현시킬 수 없는 효소를, 인위적으로 발현시키기 위해 외부 유래의 유전자를 균주 내로 도입하여 발현시키는 것을 의미하고, '과발현'이라는 용어는 본 발명의 코리네박테리움 글루타미쿰 균주가 자체적으로 해당 효소를 암호화하는 유전자를 가지고 있어, 스스로 발현시킬 수 있으나, 대량생산을 위한 목적으로 이의 발현량을 증대시키기 위해 인위적으로 해당 효소의 발현량을 증대시켜 과발현한 것을 의미한다.
한편, 본 발명자들은 상기에서 설명한 형질전환 전략을 통해, 코리네박테리움 글루타미쿰 (C. glutamicum)에서 모유올리고당인 3'-푸코실락토오스를 대량 생산할 수 있음을 확인할 수 있었다.
한편, 본 발명에 있어서, 상기 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)를 코딩하는 유전자는, azoT 유전자로 암호화된 것을 사용하는 것이 좋고, 상기 azoT 유전자는 바람직하게 서열번호 5의 핵산서열로 구성된 것일 수 있다. α-1,3-푸코실락토오스를 생산하기 위해서는, GDP-L-푸코오스 (GDP-L-fucose)와 락토오즈 (lactose)를 기질로 하여 α-1,3-푸코실락토오스 생산 반응을 수행하는 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)가 필요하다 (도 1 참조 요망). 이 효소는 다양한 미생물에 존재하는데, 본 발명에서는 아조스피릴럼 브라실렌스(Azospirillum brasilense)에서 유래한 유전자(azoT)를 사용한 것이다. 다른 유래의 α-1,3-푸코오스 전이효소를 사용한 경우에는 3'-푸코실락토오스의 생산량이 미미하였으나, azoT 유전자를 사용한 경우, 다른 유래의 것을 사용하는 것에 비해 3'-푸코실락토오스의 생산량이 현저히 높게 나타났다.
한편, 본 발명은 락토오스가 첨가된 배지에, 본 발명의 재조합 코리네박테리움 글루타미쿰을 배양하는 것을 특징으로 하는 3'-푸코실락토오스의 생산방법을 제공한다. 본 발명의 재조합 코리네박테리움 글루타미쿰 균주를 이용할 경우, 고농도, 고수율, 고생산성으로 3'-푸코실락토오스를 생산할수 있다.
한편, 상기 본 발명의 3'-푸코실락토오스의 생산방법에 있어서, 상기 배지는, 바람직하게 글루코오스를 더 포함하는 것이 좋다. 글루코오스가 배지에 추가됨으로써 균주의 생육이 활발해져 더욱 높은 생산성으로 3'-푸코실락토오스를 생산할 수 있다.
한편, 상기 본 발명의 3'-푸코실락토오스의 생산방법은, 회분식 또는 락토오스를 추가로 공급하는 유가식 배양을 통해 수행될 수 있다. 회분식 또는 유가식 배양에 관한 세부 지엽적 기술들은 당업계의 공지 기술을 사용할 수 있으므로, 이에 대해서는 그 기재를 생략하기로 한다.
한편, 본 발명의 균주 코리네박테리움 글루타미쿰은, 3'-FL 생산의 기질인 락토오스를 균체 내로 유입하기 위하여 락토오즈 퍼미아제 (lactose permease)를 도입하였다. 즉, 코리네박테리움 글루타미쿰을 이용하여 3'-FL을 생산하기 위해서는 락토오즈를 균체 내로 유입시킬 수 있는 락토오즈 퍼미아제로 형질전환시켜 줘야 하는데, 본 발명의 균주는 이 효소로 형질전환된 것이다.
그런데, 락토오즈 퍼미아제는 통상적으로 포도당 존재하에서 "glucose repression (포도당 저해)"을 받아 그 활성이 저해된다. 그 결과, 포도당 존재하에서 락토오즈의 유입이 일어나지 못하게 되고, 결과적으로 3-FL을 생산하지 못하게 된다.
하지만, 3'-FL의 생산을 위한 호스트 균주로 본 발명에서 사용한 코리네박테리움 글루타미쿰에서는 "glucose repression (포도당 저해)" 작용이 일어나지 않아, 포도당의 존재하에서도 락토오스의 유입에 따른 3'-FL을 생산할 수가 있었고, 이를 통해 3'-FL의 생산성을 극대화할 수 있었다.
한편, 본 발명의 코리네박테리움 글루타미쿰을 이용한 3'-FL의 생산방법은 3'-FL을 'nongrowth-associated product formation'의 생산 패턴으로 생산함이 본 발명의 하기 실험을 통해 확인되었다.
대사산물의 생산이 호스트 균주의 생육과 무관하게 생산되는'nongrowth-associated product formation'은 대사산물의 생산을 위한 호스트 균주의 생장이 같이 요구되지 않기 때문에, 호스트 균주를 대량으로 배양한 후, 기질을 투입하여 단시간에 대사산물을 대량으로 생산할 수 있는 장점이 있다. 또한, 배양에 사용된 호스트 균주를 반복해서 사용할 수도 있기 때문에 생산성을 극대화시킬 수 있는 장점도 있다. 따라서, 본 발명에서 코리네박테리움 글루타미쿰을 사용하여 구축한 3'-FL 생산방법은 3'-FL의 생산을 극대화 할 수 있는 방법인 것이다.
이하, 본 발명의 내용을 하기 실시예를 통해 더욱 상세히 설명하고자 한다. 다만, 본 발명의 권리범위가 하기 실시예에만 한정되는 것은 아니고, 그와 등가의 기술적 사상의 변형까지를 포함한다.
[실시예 1: 재조합 균주 및 플라스미드 제작]
플라스미드 제작을 위해 클로닝은 대장균 (Escherichia coli TOP10)을 이용하였고, 3'-푸코실락토오스 (3'-fucosyllactose, 3'-FL)의 생산을 위하여 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum) ATCC 13032를 이용하였다. 선행연구에서 개발된 manB 와 manC 그리고 lacYA 유전자 클러스터를 발현하는 pVBCL 발현용 플라스미드를 이용하였다. 또한, gmd와 wcaG 유전자를 발현하는 pEGW 발현용 플라스미드에 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase(azoT))를 발현시키기 위하여 벡터를 구축하였다. 이때, α-1,3-푸코오스 전이효소(azoT)의 유래는 아조스피릴럼 브라실렌스(Azospirillum brasilense) ATCC 29145이며, pEGW 벡터에 Sac1의 제한효소를 이용하여 α-1,3-푸코오스 전이효소 (azoT)를 삽입하였다.
한편, 상기에서 사용된 manB, manC, gmd, WcaG, lacYA 및 α-1,3-푸코오스 전이효소 (azoT)의 유전자 서열, 균주, 플라스미드 및 올리고뉴클레오티드를 하기 표 1 내지 3에 기재하였다.
유전자명 서열번호
manB 서열번호 1
manC 서열번호 2
gmd-wcaG 서열번호 3
lacYA 서열번호 4
azoT 서열번호 5
균주 관련된 특징
E. coli TOP10 F-,mcrAΔ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139Δ(ara-leu)7697 galU galKrpsL(StrR)endA1 nupG
C. glutamicum Wild-type strain, ATCC 13032
플라스미드 관련된 특징
pEKEx2 KmR;C. glutamicum/E. coli shuttle vector for regulatedgene expression (P tac ,lacIq,pBL1, oriVC .g., oriVE.c.)
pVWEx2 TcR;C. glutamicum/E. coli shuttle vector for regulatedgene expression (P tac ,lacIq,pHM1519, oriVC .g., oriVE.c.)
pEGW pEKEx2 + gmd-wcaG
pVBCL pVWEx2 + manB + manC + lacYA
pEGWA pEGW + azoT
프라이머 이름 서열(5'→3') 서열번호
F_inf_sac1_azoT GCTTTCGGGGGTAAGAGCTCAAGGAGATATACAATGCTCGATCAGCGGACAAGC 서열번호 6
R_inf_sac1_azoT CGGCCAGTGAATTCGAGCTCTTACAGCCGGCTCTCGATCC 서열번호 7
[실시예 2: 재조합 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산]
(1) 배양조건 및 방법
종균배양에는 적절한 항생제 (kanamycin 25 μg/mL, tetracycline 5 μg/mL)가 포함된 5 mL의 BHI (Brain Heart Infusion) 배지가 담긴 실험관을 이용하였고, 온도는 30℃, 교반 속도를 250 rpm으로 유지하며 12시간 배양하였다.
회분식 배양은 100 mL ((NH4)2SO4 20 g/L, urea 5 g/L, KH2PO4 1 g/L, K2HPO4 1 g/L, MgSO4 0.25 g/L, MOPS 42 g/L, CaCl2 10 mg/L, Biotin 0.2 mg/L, Protocatechuic acid 30 mg/L, FeSO47H20 10 mg/L, MnSO4H2O 10 mg/L, ZnSO47H2O 1 mg/L, CuSO4 0.2 mg/L, NiCl26H2O 0.02 mg/L, pH7.0)가 담긴 250ml 플라스크에서 30℃로 수행하였다. 교반속도는 250 rpm으로 유지하며 배양하였다. 회분식 배양시에는 광학밀도 (OD600)가 0.8에 도달한 시점에 서 IPTG (isopropyl-β-D-thiogalactopyranoside), 락토오스를 최종 농도가 각각 1.0mM, 10 g/L가 되도록 첨가하였다.
고농도 세포배양을 위한 유가식 배양은 40 g/L 의 글루코오스 및 적절한 항생제 (kanamycin 25 μg/mL, tetracycline 5 μg/mL)를 포함하는 1.0 L의 최소배지를 포함하는 2.5 L 들이의 생물반응기 (bioreactor, Kobiotech, Incheon, Korea)에서 실시하였다.
초기에 첨가한 글루코오스가 완전히 고갈된 후, 800 g/L의 글루코오스를 포함하는 유입용액 (feeding solution)을 5.7 g/L/h의 속도로 연속식(continuous feeding)방법으로 공급하였다. 이와 동시에, tac 프로모터-매개 유전자 발현을 유도하여 3'-푸코실락토오스를 생산하기 위해 IPTG, 락토오스를 최종 농도가 1.0 mM, 10 g/L가 되도록 첨가하였다.
발효 도중 배지의 pH가 설정포인트 (set-point)보다 더 낮아지면 자동으로 28% NH4OH가 공급되고, 높아지면 2N HCl이 첨가되어 pH가 일정범위 내 (pH6.98~7.02)에서 유지되도록 하였다. 배지의 pH는 pH 전극 (Mettler Toledo, USA)을 사용하여 실시간으로 측정되었다. 교반 속도 및 통기 속도는 산소결핍을 방지하기 위하여 각각 1000 rpm 및 2 vvm으로 유지하였다.
(2) 세포 및 대사산물의 농도 결정
건조세포중량은 광학밀도 (optical density, OD)에 미리 측정한 변환 상수 0.3을 곱해 결정하였다. 광학밀도 (OD)는 샘플을 적절하게 희석하여 광학밀도를 0.1-0.5 사이의 범위에 맞춘 후에 분광광도계 (spectrophotometer, Ultrospec 2000, Amersham Pharmacia Biotech, USA)를 사용하여 흡광도 600 nm 에서 측정하였다.
3'-푸코실락토오스, 락토오스, 락테이트, 글루코오스 및 아세트산의 농도는 'Carbohydrate Analysis column (Rezex ROA-organic acid, Phenomenex, USA)' 및 'RI (refractive index)' 검출기가 장착된 HPLC (high performance liquid chromatography) (Agilent 1100LC, USA)를 이용하여 측정하였다. 60℃에서 가열된 컬럼을 적용하여 10배 희석된 20 ㎕의 배양 배지를 분석하였다. 0.6 mL/min 유속으로 5 mM의 H2SO4 용액을 이동상으로 사용하였다.
(3) 회분식 배양을 통한 3‘푸코실락토오스의 생산
3'-푸코실락토오스 생산성능 및 발효특징을 알아보기 위하여 ManB, ManC, Gmd, WcaG, azoT 및 lacZ가 제거된 lac 오페론 (lacYA)을 도입한 재조합 코리네박테리움 글루타미쿰을 각각 플라스크에서 회분식 배양을 실시하였다. 광학밀도 (OD600)가 0.8에 도달한 시점에서 IPTG, 락토오스를 최종 농도가 각각 1.0 mM, 10 g/L가 되도록 첨가하였다.
플라스크 회분식 배양의 결과, 390 mg/L의 3'-푸코실락토오스가 생산되었고, 이때의 락토오스 대비 2'-푸코실락토오스의 수율은 0.32 mole 2'-푸코실락토오스 /mole 락토오스, 생산성은 5.49 mg/L/h였다 (도 3 및 표 4). 도 2는 코리네박테리움 글루타미쿰 pVBCL + pEGWA (pEGW + azoT)에서 생산된 3'-푸코실락토오스를 HPLC를 통해 측정한 결과이다. 상기 회분식 배양의 결과는 하기 표 4에 기재하였으며, 도 3은 재조합 코리네박테리움 글루타미쿰 (C. glutamicum) pVBCL + pEGWA를 이용한 플라스크 회분식 배양결과를 나타낸 그래프이다.
재조합 코리네박테리움 글루타미쿰 (C. glutamicum) pVBCL + pEGWA를 이용한 플라스크 회분식 배양 결과
최종 건조 세포 중량 (g/L) 락토오스 소모량a(g/L) 최대 3'-푸코실락토오스 농도a(mg/L) 수율 (mole 3'-푸코실락토오스 / mole 락토오스) 생산성a(mg/L/h)
플라스크 12.0 0.71 390 0.38 5.49
a락토오스의 3'-푸코실락토오스의 농도는 배지에 있는 것만을 정량한 수치임.
(4) 유가식 배양을 통한 3‘푸코실락토오스의 생산
고농도의 세포배양을 통하여 고농도 3'-푸코실락토오스를 생산하기 위해 pVBCL, pEGWA플라스미드를 도입한 재조합 코리네박테리움 글루타미쿰 (C. glutamicum)을 이용하여 2.5 L 수준의 발효기에서 유가식 배양을 실시하였다.
초기에 첨가해준 40 g/L의 글루코오스를 모두 소모한 시점부터 세포생장을 유지하기 위해 피딩용액 (feeding solution)을 연속식 (continuous feeding)방법을 이용하여 5.7 g/L/h의 속도로 공급하였다. 이와 동시에 3'-푸코실락토오스의 생산을 유도하기 위해 IPTG와 락토오스를 첨가해 주었다.
실험 결과, 발효가 진행되는 동안 아세트산은 전혀 생성되지 않았으며, 글루코오스의 대사를 통해 세포는 최종적으로 건조세포중량 48.9 g/L에 도달하였다. 또한, 최대 3'-푸코실락토오스의 농도는 3.6 g/L, 락토오스 대비 생산수율은 0.17 mole 3'-푸코실락토오스 /mole 락토오스이고, 생산성은 0.03 g/L/h를 얻을 수 있었다 (도 4 및 표 5).
3'-푸코실락토오스의 생산을 위한 유가식 배양의 결과는 하기 표 5에 기재하였으며, 도 4는 재조합 코리네박테리움 글루타미쿰 pVBCL + pEGWA를 이용한 유가식 배양결과를 나타낸 그래프이다.
재조합 코리네박테리움 글루타미쿰 (C. glutamicum) pVBCL + pEGWA를 이용한 플라스크 유가식 배양 결과
플라스미드 최종 건조 세포 중량 (g/L) 락토오스 소모량a(g/L) 최대 3'-푸코실락토오스 농도a(g/L) 수율(mole 3'-푸코실락토오스 / mole 락토오스) 생산성b(mg/L/h)
pVBCLpEGWA 48.9 15.3 3.6 0.17 0.03
a락토오스의 3'-푸코실락토오스의 농도는 배지에 있는 것만을 정량한 수치임.b3-FL 생산성은 IPTG 인덕션 이후부터 계산한 수치임.

Claims (7)

  1. α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)가 발현되도록 형질전환되고,
    GDP-D-만노오스-4,6-데하이드라타아제 (GDP-D-mannose-4,6-dehydratase)가 발현되도록 형질전환되며,
    GDP-L-푸코오스 신타아제 (GDP-L-fucose synthase)가 발현되도록 형질전환되고,
    락토오즈 퍼미아제 (lactose permease)가 발현되도록 형질전환되며,
    포스포만노뮤타아제 (Phosphomannomutase) 및 GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)를 보유하고 있는 것을 특징으로 하는 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum).
  2. 제1항에 있어서,
    상기 α-1,3-푸코오스 전이효소 (α-1,3-fucosyltransferase)는,
    azoT 유전자로 암호화된 것을 특징으로 하는 재조합 코리네박테리움 글루타미쿰.
  3. 제2항에 있어서,
    상기 azoT 유전자는,
    서열번호 5의 핵산서열로 구성된 것을 특징으로 하는 재조합 코리네박테리움 글루타미쿰.
  4. 제1항에 있어서,
    상기 재조합 코리네박테리움 글루타미쿰은,
    포스포만노뮤타아제 (Phosphomannomutase)가 과발현되도록 형질전환되고,
    GTP-만노오스-1-포스페이트 구아닐트랜스퍼라아제 (GTP-mannose-1-phosphate guanylyltransferase)가 과발현되도록 형질전환된 것을 특징으로 하는 재조합 코리네박테리움 글루타미쿰.
  5. 락토오스가 첨가된 배지에, 제1항의 재조합 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)을 배양하는 것을 특징으로 하는 3'-푸코실락토오스의 생산방법.
  6. 제5항에 있어서,
    상기 배지는,
    글루코오스를 더 포함하는 것을 특징으로 하는 3'-푸코실락토오스의 생산방법.
  7. 제6항에 있어서,
    상기 푸코실락토오스의 생산방법은,
    글루코오스 또는 락토오스를 추가로 공급하는 회분식 배양 또는 유가식 배양인 것을 특징으로 하는 3'-푸코실락토오스의 생산방법.
PCT/KR2018/004597 2017-04-21 2018-04-20 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법 WO2018194411A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US16/606,921 US11512318B2 (en) 2017-04-21 2018-04-20 Method for producing 3-fucosyllactose using Corynebacterium glutamicum
EP18787693.3A EP3613858B1 (en) 2017-04-21 2018-04-20 Method for producing 3'-fucosyllactose using corynebacterium glutamicum
CN201880033706.4A CN110662842B (zh) 2017-04-21 2018-04-20 利用谷氨酸棒状杆菌的3-岩藻糖基乳糖的生产方法
JP2019556815A JP6903256B6 (ja) 2017-04-21 2018-04-20 コリネバクテリウムグルタミクムを用いた３’−フコシルラクトースの生産方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2017-0051871 2017-04-21
KR20170051871 2017-04-21
KR1020180045845A KR102050522B1 (ko) 2017-04-21 2018-04-20 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법
KR10-2018-0045845 2018-04-20

Publications (1)

Publication Number Publication Date
WO2018194411A1 true WO2018194411A1 (ko) 2018-10-25

Family

ID=63856903

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/004597 WO2018194411A1 (ko) 2017-04-21 2018-04-20 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법

Country Status (1)

Country Link
WO (1) WO2018194411A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113337554A (zh) * 2021-05-28 2021-09-03 华东理工大学 一种体外多酶级联催化合成岩藻糖基化乳糖的方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120122098A (ko) * 2011-04-28 2012-11-07 주식회사 진켐 박테로이드 프라질리스 균주 유래 푸코실전이효소
KR101544184B1 (ko) 2014-12-19 2015-08-21 서울대학교산학협력단 2-푸코실락토오스 생산 변이 미생물 및 이를 이용한 2-푸코실락토오스의 제조방법
KR20160012803A (ko) 2014-07-25 2016-02-03 삼성전자주식회사 이미지 센서
WO2016040531A1 (en) * 2014-09-09 2016-03-17 Glycosyn LLC Alpha (1,3) fucosyltransferases for use in the production of fucosylated oligosaccharides
KR101648352B1 (ko) 2015-11-09 2016-08-16 서울대학교산학협력단 푸코실락토오스 생산용 재조합 대장균 및 이를 이용한 푸코실락토오스의 생산방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120122098A (ko) * 2011-04-28 2012-11-07 주식회사 진켐 박테로이드 프라질리스 균주 유래 푸코실전이효소
KR20160012803A (ko) 2014-07-25 2016-02-03 삼성전자주식회사 이미지 센서
WO2016040531A1 (en) * 2014-09-09 2016-03-17 Glycosyn LLC Alpha (1,3) fucosyltransferases for use in the production of fucosylated oligosaccharides
KR101544184B1 (ko) 2014-12-19 2015-08-21 서울대학교산학협력단 2-푸코실락토오스 생산 변이 미생물 및 이를 이용한 2-푸코실락토오스의 제조방법
KR101648352B1 (ko) 2015-11-09 2016-08-16 서울대학교산학협력단 푸코실락토오스 생산용 재조합 대장균 및 이를 이용한 푸코실락토오스의 생산방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHIN, YOUNG-WOOK: "Metabolic engineering of Corynebacterium glutamicum to produce GDP-l-fucose from glucose and mannose", BIOPROCESS BIOSYST ENG, vol. 36, 2013, pages 749 - 756, XP002765469 *
DATABASE Nucleotide 26 July 2016 (2016-07-26), "Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence", XP055613332, retrieved from NCBI Database accession no. CP007794.1 *
See also references of EP3613858A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113337554A (zh) * 2021-05-28 2021-09-03 华东理工大学 一种体外多酶级联催化合成岩藻糖基化乳糖的方法

Similar Documents

Publication Publication Date Title
WO2017188684A1 (ko) 코리네박테리움 글루타미쿰을 이용한 2'-푸코실락토오스의 생산방법
KR102050522B1 (ko) 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법
WO2019194410A1 (ko) 슈도페도박터 살탄스 유래 푸코오스 전이효소를 이용한 2'-푸코실락토오스의 생산방법
WO2016153300A1 (ko) 2-푸코실락토오스 생산 변이 미생물 및 이를 이용한 2-푸코실락토오스의 제조방법
WO2018194411A1 (ko) 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법
CN113755411B (zh) 高产β-烟酰胺单核苷酸的重组微生物及其生产β-烟酰胺单核苷酸的方法
WO2023096197A1 (ko) 효소 처리를 통한 2'-푸코실락토오스의 생산성 증대 방법
KR102154256B1 (ko) 코리네박테리움 글루타미쿰을 이용한 3'-푸코실락토오스의 생산방법
CN116769808A (zh) 一种专一生产2′-岩藻糖基乳糖的菌株及应用
KR101794971B1 (ko) α-1,3-푸코실락토오즈의 대량 생산 방법
KR101152878B1 (ko) 글루코오스-6-포스페이트-데하이드로지나아제 및 구아노신-이노신 키나아제의 추가 발현에 의한 재조합 대장균에서 ｇｄｐ-푸코즈의 생산방법
WO2023219437A1 (ko) 코리네박테리움 글루타미쿰을 이용한 락토-n-테트라오스 및 락토-n-네오테트라오스의 생산 방법
WO2023080576A1 (ko) 배양 배지 조성 및 배양 방식 변화에 따른 2'-푸코실락토오스의 생산성 증대 방법
KR101152876B1 (ko) 구아노신-이노신 키나아제의 추가 발현에 의한 재조합 대장균에서 ｇｄｐ-푸코즈의 생산방법
KR101794972B1 (ko) α-1,3-푸코실락토오즈의 대량 생산 방법
CN116478894A (zh) 一种提高唾液酸乳糖产量的基因工程菌及其生产方法
CN116426452A (zh) 合成2’-岩藻糖基乳糖的重组大肠杆菌菌株及其应用
KR101179914B1 (ko) Ｎａｄｐｈ 및 구아노신 누클레오타이드 생합성 효소의 추가 발현에 의한 재조합 대장균에서 ｇｄｐ-푸코즈의 생산방법
Li et al. Synthesis of GDP-Mannose in Recombinant Escherichia coli

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18787693

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019556815

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018787693

Country of ref document: EP

Effective date: 20191121