WO2018190656A1 - In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도 - Google Patents
In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도 Download PDFInfo
- Publication number
- WO2018190656A1 WO2018190656A1 PCT/KR2018/004301 KR2018004301W WO2018190656A1 WO 2018190656 A1 WO2018190656 A1 WO 2018190656A1 KR 2018004301 W KR2018004301 W KR 2018004301W WO 2018190656 A1 WO2018190656 A1 WO 2018190656A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- intestinal
- hio
- vitro
- cells
- organoids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0679—Cells of the gastro-intestinal tract
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/37—Digestive system
- A61K35/38—Stomach; Intestine; Goblet cells; Oral mucosa; Saliva
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/11—Epidermal growth factor [EGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/119—Other fibroblast growth factors, e.g. FGF-4, FGF-8, FGF-10
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/16—Activin; Inhibin; Mullerian inhibiting substance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2301—Interleukin-1 (IL-1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2302—Interleukin-2 (IL-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2308—Interleukin-8 (IL-8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/25—Tumour necrosing factors [TNF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/40—Regulators of development
- C12N2501/415—Wnt; Frizzeled
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases [EC 2.]
- C12N2501/727—Kinases (EC 2.7.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/11—Coculture with; Conditioned medium produced by blood or immune system cells
- C12N2502/1114—T cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/99—Coculture with; Conditioned medium produced by genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2513/00—3D culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/90—Substrates of biological origin, e.g. extracellular matrix, decellularised tissue
Definitions
- the present invention relates to a method for preparing a human intestinal organoid similar to an adult intestine through in vitro maturation and an intestinal organoid (hIO) prepared by the method.
- IEC intestinal epithelial cells
- hPSC human pluripotent stem cells
- hESC human embryonic stem cells
- hiPSC human induced pluripotent stem cells
- hIO three-dimensional human intestinal organoids
- hSI human small intestine
- hPSC-derived hIO has been shown to be digestive, immune and intestinal stem cells such as OLFM4. cell) characteristic of immature fetus intestine with insufficient expression of marker gene.
- the present inventors overcome the problem of the method of maturation by culturing in a non-characterized in vivo environment with severe variation of the experimental procedure to mature hIO having the existing immature fetal characteristics,
- Adult human intestinal organoids similar to adults were produced in vitro using co-culture systems and defined growth factors that could provide an environment similar to the human environment.
- Intestinal organoids were first identified and completed, expressing genes associated with the adult small intestine and improving their function.
- Such models include both adult intestinal organoids and artificial organs matured in vitro, and can be used in fields such as human mimetic intestinal model development, absorption model, disease modeling, new drug development, and tissue therapy. .
- One object of the present invention is to provide a method for preparing mature intestinal organoids in vitro, comprising culturing immature intestinal organoids in a medium comprising T-lymphocytes, cytokines, or a combination thereof. To provide.
- Another object of the present invention is to provide a composition for in vitro maturation of immature intestinal organoids comprising T-lymphocytes, cytokines, STAT3 and mTOR signaling pathway activators or combinations thereof.
- Another object of the present invention is to provide an in vitro mature intestinal organoid prepared using the above method.
- Another object of the invention is in vitro, comprising culturing immature intestinal organoids in a medium comprising T-lymphocytes, cytokines, STAT3 and mTOR signaling pathway activators or combinations thereof It provides a way to mature immature intestinal organoids.
- Still another object of the present invention is to provide a method for preparing artificial intestines, which comprises the step of preparing mature enteric organoids according to the above method.
- Still another object of the present invention is to provide a tissue therapeutic agent comprising intestinal organoids matured in vitro prepared according to the above method.
- Still another object of the present invention is to provide a kit for screening a therapeutic agent for intestinal related diseases, comprising a mature enteric organoid prepared by the above method.
- Intestinal organoids matured in vitro according to the preparation method of the present invention can solve the problem that must be cultured in an in vivo environment in order to mature the immature enteric organoids, the mature enteric organoids of the present invention It can be usefully used for intestinal tract, drug screening and cell therapy.
- FIG. 1 is a diagram showing the production and characteristics of hiPSC lineage from wild-type fibroblasts.
- FIG. 1 (a) shows a schematic diagram of a reprogramming protocol. Human fibroblasts were reprogrammed with iPSC using nonintegrated episomal vectors.
- hiPSC # 1 derived from CRL2097 and hiPSC # 2 derived from IMR90 for the pluripotency marker, OCT4, NANOG, TRA-1-60, TRA-1-81, SSEA-3 and SSEA-4. Representative forms and immunofluorescence analysis of the are shown. All hiPSC colonies were found to express alkaline phosphatase (ALP). Scale bar is 100 ⁇ m.
- Figure 1 (c) shows the STR profile of the hiPSC line.
- Figure 1 (d) shows the copy number of the episomal vector of the hiPSC lineage, the passage number is shown in parentheses. Fibroblasts were analyzed as a positive control 5 days after electroporation.
- Figure 1 (e) is the result of in vitro differentiation of hiPSC lineage. Immunofluorescence analysis of endoderm markers FOXA2 and SOX17, mesoderm markers DESMIN and ⁇ -smooth muscle actin ( ⁇ -SMA), and ectoderm markers TUJ1 and NESTIN. Nuclei were stained with DAPI (blue). Scale bar is 100 ⁇ m.
- FIG. 1 (f) shows in vivo differentiation through teratoma formation.
- the histological analysis of teratoma derived from hiPSC by hematoxylin and eosin staining is shown.
- Figure 1 (g) shows karyotype analysis of hiPSC lineage.
- Figure 2 confirms the efficient differentiation of hPSCs into immature enteroorganoids efficiently.
- FIG. 2 (a) is a representative image of successful differentiation of hPSCs into final endoderm (DE), thickness (HG) and hIO. Scale bar is 200 ⁇ m.
- FIG. 2 (b) shows the results of immunofluorescence staining of DE markers (FOXA2, SOX17) and HG markers (CDX2, KLF5, SOX3). Scale bar is 200 ⁇ m.
- FIG. 2 (c) shows undifferentiated hPSCs (H9 hESC, three independent hPSC strains including hiPSC # 1 derived from CRL2097 and hiPSC # 2 derived from IMR90), differentiated hIO (p0, p2) and human small intestine Results of qPCR analysis of design markers.
- Figure 3 is a diagram confirming the in vitro maturation of hPSC-derived hIO through co-culture with immune cells.
- FIG. 3 (a) shows gastric specific markers (SOX9, CDX2 and KLF5), uptake cell marker (VIL1), germ cell marker (MUC2), panes cell marker (LYZ), intestinal endocrine cell marker (CHGA) and epithelial marker Representative morphology and immunofluorescence staining for (Ecad), results. Scale bar is 200 ⁇ m.
- Figure 3 shows differentially expressed genes (doubled) in undifferentiated hPSCs, final endoderm cells, posterior cells and immature hIOs (p0, p2), mature induced hIOs through coculture, and adult human small intestine (hSI). Change) (PCA).
- FIG. 3 (c) shows the comparison of stem cell lines, endoderm cells, posterior intestines, hIO p0, hIO p2, hIO p2 co-cultured with Jurkat T, and human small intestine tissue (hSI) in the order of differentiation at the gene expression level. It is a representation of a data as a heat map. Co-culture with Jurkat T cells was found to be more similar to the gene expression of human small intestine tissue.
- HIO co-cultured with heatmaps of genes known to be involved in protective responses, digestive function and intestinal markers are similar to the adult human small intestine (hSI).
- Figure 4 shows the expression of cytokines of Jurkat T cells with or without stimulation.
- Figure 4 (a) is a cytokine of Jurkat T cells (IL-2, IL-8, TNF ⁇ , IL-22, IL according to the presence or absence of stimulation, the type of culture medium, the presence or absence of matrigel through microarray-based heatmap analysis -6, IL-1 ⁇ , IL-11, EGF, OSM, and IL-10) is compared.
- Figure 4 (b) is a cytokine (IL-2, IL-8, TNF ⁇ , IL-22, IL-6, IL-1 ⁇ in the culture supernatant of Jurkat T cells according to the presence or absence of stimulation, culture medium type, Matrigel presence , IL-11, EGF, OSM, and IL-10) concentrations were analyzed using ELISA.
- IL-2, IL-8, TNF ⁇ , IL-22, IL-6, IL-1 ⁇ in the culture supernatant of Jurkat T cells according to the presence or absence of stimulation, culture medium type, Matrigel presence , IL-11, EGF, OSM, and IL-10) concentrations were analyzed using ELISA.
- FIG. 5 is a schematic of the coculture system of hIO and human T lymphocytes.
- Matrigel inserted hIO was applied to transwell dishes with PMA / Ionophore stimulated Jurkat T cells.
- FIG. 6 is a diagram showing the key components of the IL-2 co-culture system.
- Figure 6 (a) is IL-2, IL-8, TNF ⁇ , IL-22, IL-6, IL-1 ⁇ , IL-11, EGF in the culture supernatant of Jurkat T cells with or without stimulation using ELISA , OSM, and IL-10 concentrations are shown graphically.
- Figure 6 (b) shows the expression of IL-2 receptor genes analyzed by RT-PCR in co-culture or IL-2 treated hIO.
- Figure 6 (c) shows the expression of IL-2 receptor at the protein level via Western blot in hIO cultured with co-culture or IL-2 treatment.
- FIG. 6 (d) shows the phosphorylation status of several proteins associated with IL-2 mediated signals using the human phosphokinease array kit in control and co-cultured hIO.
- FIG. 6 (e) shows the abundant pathways of differentially phosphorylated proteins in cocultured hIO and False discovery rate (FDR) ⁇ 0.001 (left panel), functional interaction of differentially phosphorylated proteins in cocultured hIO Represents a functional interaction (FI) network (right panel).
- FI network connections are indicated by arrows for activation / catalysis, solid lines ending in vertical lines for suppression, solid lines of FIs extracted from complexes or inputs, and dashed lines of expected FIs. It was confirmed that IL-2 mediated signaling was ranked high.
- Figure 7 shows the induction of hIO maturation, such as co-culture when treated with IL-2 in hIO.
- FIG. 7 (a) shows IL-2 receptor ⁇ antibody (Anti-IL-2R ⁇ ) and IL-2 receptor ⁇ c antibody (Anti) with treatment with PMA / ionophore stimulated Jurkat T conditioned medium (CM) or IL-2 -IL-2R ⁇ c) shows the numerical representation of the morphological changes of hIO area and budding structure when treated.
- Figure 7 shows the phosphorylation status of multiple proteins by IL-2 treatment using human phosphokinease array kit in control and IL-2 treated hIO (left panel). Also shown is a functional interaction (FI) network (right panel) of differentially phosphorylated proteins in IL-2 treated hIO. This confirms that the mTOR signaling pathway and the STAT3 signaling pathway are significantly enriched in the FI network.
- FI functional interaction
- Figure 7 (c) shows the phosphorylation status of several proteins associated with IL-2 mediated signals in co-culture with the control or IL-2 treatment via Western blot.
- FIG. 7 (d) shows the enhanced pathway of phosphorylated protein in IL-2 treated hIO with a false discovery rate (FDR) of less than 0.05.
- FIG. 7 (e) shows changes in hIO size and shoot structure when treated with STAT3 signal inhibitors (S3I-201, Stattic) and mTOR inhibitor (Rapamycin) simultaneously with control and IL-2 treatment.
- n 14 hIO per group (p ⁇ 0.01 and * p ⁇ 0.05 according to t-test).
- FIG. 8 shows human phosphokinease array results for detecting activated proteins after co-culture (a, b) or IL-2 treatment (c, d) with immune cells in hIO.
- 8 (a) and 8 (c) show human phosphokinease array results. Each antibody was evaluated in duplicate.
- 8 (b) and 8 (d) are graphs showing the fold change in concentration values for the control hIO.
- FIG. 10 is a diagram confirming that the co-culture system and IL-2 promote the high expression level of intestinal maturation markers affect the in vitro maturation of hIO.
- Figure 10 (d) shows the selected 11 GO term indicated by the purple circle in Figure 10 (c) shows the number of genes associated with it in a bar graph.
- Figure 11 confirms the increased expression of mature small intestinal markers in hIO upon co-culture or IL-2 treatment.
- Figure 11 (a) shows qRT-PCR analysis of intestinal maturation related genes of human adult tissue-derived enteric organoids (hAT-IO) and hSI with or without control, co-culture, IL-2 treated hIO, nicotinamide will be. The fold change in expression levels was found to be related to control hIO.
- FIG. 11 (b) shows proliferative markers (Ki-67), epithelial markers (ECAD) and mature intestinal markers (DEFA5, OLFM4, MUC13 and KRT20) and intestinal enzyme markers (sucrase-isomaltase (SI)) and functional transporters (multidrug resistance) Protein 1, MDR1, peptide transporter 1, PEPT1) show control, co-culture and immunofluorescence staining of IL-2 treated hIO. Scale bar is 100 ⁇ m.
- FIG. 11 (e) is a schematic diagram based on hierarchical cluster data using canberra distance and mcquitty linkage method. The similarity between samples is shown, and the longer the length of the twig, the lower the similarity between samples. This means that co-cultured or IL-2 treated hIO samples are similar to adult small intestine tissue (hSI # 1 ⁇ # 2) and distal adult small intestine tissue (his Dist. # 1 ⁇ # 4).
- Figure 12 confirms that matured hIO in vitro significantly improves the expression and function of intestinal enzymes and transporters.
- FIG. 12 (b) shows hierarchical clustering of representative genes encoding intestinal enzymes and transporters found in control, co-culture, IL-2 treated hIO, hAT-10, and hSI.
- Figure 12 (c) shows the intercellular permeability of hIO cultured with 4kDa FITC-dextran (left panel) and 40 kDa FITC-dextran (right panel).
- Figure 12 (d) shows the relative expression of P-gp (MDR1, ABCB1), the change in the expression level increased in a pattern similar to hSI compared to the control hIO.
- FIS Forskolin-induced swelling
- FIG. 12 (i) shows gene expression patterns of gastric inhibitory polypeptide (GIP), which is one of hormones produced by entero-endocrine cells, in each hIO.
- GIP gastric inhibitory polypeptide
- Figure 12 (j) shows the release of GIP hormone by condition hIO culture supernatant via ELISA.
- Figure 13 confirms that maturation in vitro of hIO promotes neovascularization linked to host blood vessels in vivo.
- FIG. 13 (a) shows in vitro fluorescence images of kidneys with DiR-labeled hIO one week after implantation using the IVIS imaging system (left panel).
- Figure 13 (b) shows the results of H & E staining of hIO one week after transplantation into the kidney bag of immune deficient (NSG) mice.
- Figure 13 (c) confirms that the intestinal maturation markers (DEFA5, OLFM4, MUC13 and KRT20) are still mainly expressed in co-culture and IL-2 treated hIO after transplantation.
- Figure 13 (d) confirms that enteric enzymes (sucrase-isomaltase, SIM) and functional transporters (polydrug resistant protein 1, MDR1, peptide transporter 1, PEPT1) are found in co-culture and IL-2 treated hIO after transplantation. will be.
- FIG. 13 (e) shows the results of immunofluorescence staining of transplanted hIO on human blood vessels containing vascular endothelial cells with hCD31 and stacked smooth muscle (top panel) with ⁇ -SMA. Co-staining for ⁇ -SMA and hCD31 indicates that these endothelial cells can be derived from adjacent hepatitis tissues of hIO.
- FIG. 14 (b) shows that there are all four intestinal lineages in transplanted hIO, including intestinal cells (VIL), goblet cells (MUC2), intestinal endocrine cells (CHGA) and Panes cells (LYSO). E-cadherin (ECAD) was used for intestinal epithelial staining. Scale bar is 50 ⁇ m.
- Figure 15 (a) is a diagram showing the results of immunofluorescence staining of human-specific endothelial cell CD31 (hCD31 for human vascular endothelial cells) in hIO prior to in vivo transplantation. Scale bar is 100 ⁇ m. Differentiation into vascular endothelial cells was not found in hIO itself matured in vitro.
- Figure 17 shows the results of in vitro maturation of hIO by the STAT3 activator colivelin (colivelin).
- Figure 17 (a) is a comparison of the morphological changes of the hIO and the size of the surface area when using various concentrations of choliberine.
- the scale bar is 500 ⁇ m.
- Figure 17 (b) is the result confirmed by qPCR expression of intestinal maturation marker gene. Overall expression increased compared to control hIO.
- Figure 17 (c) shows immunofluorescence staining of control, choliberine treated hIO with proliferation marker (Ki-67), epithelial marker (ECAD) and mature intestinal markers (OLFM4, MUC13 and KRT20).
- the scale bar is 50 ⁇ m.
- One aspect of the present invention for achieving the above object is to culture an immature intestinal organoid in a medium comprising T-lymphocytes, cytokines, STAT3 and mTOR signaling pathway activators or combinations thereof It provides a method for preparing a mature intestinal organoid in vitro, comprising the step of:
- organoid refers to a cell mass having a 3D conformation and refers to a reduced and simplified version of an organ prepared through an artificial culture process that is not collected or obtained from an animal.
- the origin of the cells which constitute it is not limited.
- Organoids can be derived from tissues, embryonic stem cells or induced pluripotent stem cells and can be cultured in three dimensions due to their self-renewal and differentiation capacity.
- the organoid may have an environment that allows it to interact with its surroundings during cell growth. Accordingly, in the present invention, the 3D organoid may be an excellent model that can closely observe the organs that are actually interacting in vivo, and develop a therapeutic agent for the disease, and the like.
- human intestinal organoids includes intestinal gland cells, chorionic-like structures, and four major special cells (absorbable enterocytes, panes cells, intestinal endocrine cells and germ cells). And it means an organoid to reproduce the diversity and structure of the small intestinal epithelial cells.
- HIO also contains primitive mesenchyme that can differentiate into smooth muscle, myofibroblasts and fibroblasts commonly found in the submucosal layer of human adult small intestine (hSI), and hIO secretes mucus and Can perform basic physiological functions of hSI such as amino acid uptake.
- intestinal hIO refers to the diversity and structure of small intestinal epithelial cells that are characteristic of intestinal organoids and can differentiate into smooth muscle, myofibroblasts and fibroblasts commonly found in the submucosa. It can carry out the basic physiological functions of hSI such as mucous secretion and amino acid uptake, including primitive hepatitis tissues, but it can be used for digestive, transport, immune, and host defenses that are characteristic of mature intestinal organoids. By intestinal organoids are expressed without genes and mature intestinal stem cell markers.
- the immature intestinal organoid is a mature small intestine (adult small intestine), which is not yet mature, and refers to a state similar to that of the fetus.
- 'maturation' may be used in combination with 'similar to the small intestine of the fetus'. have.
- the immature intestinal organoid is not limited thereto unless it has the characteristics of a mature intestinal organoid, and includes intestinal organoids differentiated from human pluripotent stem cells according to existing known methods.
- the immature intestinal organoid further comprises the step of culturing stem cells or hindgut spheroids differentiated from stem cells in intestinal organoid medium to produce immature intestinal organoids, in vitro
- intestinal organoid medium refers to a medium for culturing stem cells with intestinal organoids.
- Materials that can be cultured with intestinal organoids include, without limitation, commercially available or manufactured.
- culture FRP4 R & D Systems
- WNT3A R & D Systems
- FBS FBS
- RPMI 1640 medium RPMI 1640 medium
- the spheroid can then be incubated in DMEM / F12 medium containing 1X B27 (Invitrogen), R-Spondin 1 (R & D Systems), EGF (R & D Systems) and Noggin (R & D Systems).
- 1X B27 Invitrogen
- R-Spondin 1 R & D Systems
- EGF R & D Systems
- Noggin R & D Systems
- the term "STAT3 and mTOR signaling pathway activator” refers to a substance that activates the STAT3 and mTOR signaling pathway.
- the STAT3 and mTOR signaling pathway activator activates the STAT3 and mTOR signaling pathway of immature intestinal organoids, so long as it is a substance that matures immature intestinal organoids. It is not limited. Specifically, it may be colivelin, but is not limited thereto.
- the STAT3 and mTOR signaling pathway activator provides at least one phosphorylation activator selected from the group consisting of STAT3, AKT and P70 S6 kinase, a method for producing mature intestinal organoids in vitro.
- a method for preparing mature enteric organoids which comprises for the purposes of the present invention, comprises immature enteric organoids by culturing with a medium comprising T-lymphocytes, cytokines or STAT3 and mTOR signaling pathway activators or combinations thereof.
- mature intestinal organoids having the characteristics of an adult intestine can be prepared.
- the production method provides a method for producing mature intestinal organoids in vitro, further comprising the step of differentiating immature intestinal organoids from stem cells.
- the stem cells may be embryonic stem cells or induced pluripotent stem cells (iPSC), but is not limited thereto.
- iPSC induced pluripotent stem cells
- iPSC induced pluripotent stem cell
- iPSCs induced pluripotent stem cells
- hIOs immature intestinal organoids
- Example 1 specifically confirming the expression of markers related to intestinal electronic factor, it can be seen that the differentiation of immature intestinal organoids well from fibroblasts.
- the term “reprogramming” refers to a process of restoring or converting from differentiated cells, which are present in different aspects, such as non-differentiating cells or cells with partial differentiation, into a state with a finally new type of differentiation potential. I mean a process that can.
- the reprogramming may be used in the same sense as dedifferentiation.
- the reprogramming mechanism of these cells means establishing a different set of epigenetic marks after the epigenetics in the nucleus (the DNA state associated with causing a genetic change in function without a change in nucleotide sequence) are deleted. In contrast, while multicellular organisms differentiate and grow, different cells and tissues acquire different gene expression programs.
- the reprogramming is not limited as long as it can make induced pluripotent stem cells from differentiated cells, and known methods in the art can be used.
- the artificial reprogramming process in the present invention is carried out by the introduction of a virus-mediated or non-inserted non-viral vector using a non-inserted virus, the introduction of a non-virus-mediated reprogramming factor using proteins and cell extracts, It may include a reprogramming process by stem cell extracts, compounds and the like.
- Induced pluripotent stem cells have almost the same characteristics as embryonic stem cells. Specifically, they show the same cell shape, have similar gene and protein expression patterns, have pluripotency in vitro and in vivo , and form teratoma.
- induced mouse pluripotent stem cells when induced mouse pluripotent stem cells are inserted into the blastocyst of the mouse (chimera) can form a mouse (germline transmission) (germline transmission) is possible.
- the induced pluripotent stem cells of the present invention may be derived from all humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, or rabbits, and may be specifically derived from humans.
- the "reprogramming factor” is a substance that induces finally differentiated cells to be reprogrammed into pluripotent stem cells having a new type of differentiation potential.
- the reprogramming factor may be included as long as it is a substance that induces reprogramming of finally differentiated cells, and may be selected according to the type of cells to be differentiated.
- the reprogramming factor may be, but is not limited to, one or more proteins selected from the group consisting of Oct4, Sox2, Klf4, c-Myc, Nanog, Lin-28, and Rex1 or nucleic acid molecules encoding the proteins.
- differentiated cell is not particularly limited, but specifically, may be a cell in which a lineage is already specified, such as a germ cell, a somatic cell or a progenitor cell. Examples may be cells derived from humans, but cells derived from various individuals are also within the scope of the present invention.
- the differentiated cells of the present invention may include both differentiated cells in vivo or ex vivo, and specifically, may be differentiated cells separated in vivo.
- the "somatic cell” refers to all cells that have completed differentiation constituting a plant or plant except for germ cells, and the "progenitor cell” expresses differentiation traits when it is found that cells corresponding to progeny express specific differentiation traits. It does not, but refers to the parent cell with its differentiation fate.
- neuroblasts neurovascular stem cells
- myoblasts correspond to progenitor cells for myotubes.
- the differentiated cells used in the preparation of the intestinal organoids of the present invention may be, in particular, human-derived fibroblasts, and specifically, human-derived fibroblasts may be CRL-2097 cell lines or IMR90, but are not limited thereto. It doesn't work.
- the term "differentiation” refers to a phenomenon in which cells divide and proliferate, and the structure or function of the cell is specialized while the entire individual is growing. That is, a process in which cells, tissues, etc. of an organism are transformed into suitable forms and functions in order to play a role given to each, for example, a process in which pluripotent stem cells such as embryonic stem cells are transformed into ectoderm, mesoderm, and endoderm cells. In addition, the process of turning hematopoietic stem cells into erythrocytes, white blood cells, platelets, etc., that is, progenitor cells to express a specific differentiation may be included in the differentiation.
- T lymphocyte in the present invention is also called T-cell as one of the lymphocytes that play a central role in cell-mediated immunity. T cells are distinguished from other lymphocytes such as B cells and natural killer cells by the presence of T cell receptors on the cell surface.
- the T-lymphocyte means that it is used in co-culture to mimic the in vivo intestinal environment, and can be included without limitation, as long as it can be used in co-culture to mimic the in vivo intestinal environment.
- the T-lymphocytes of the present invention include all derived T-lymphocytes, such as humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, rabbits, and the like. It may be, and more specifically, Jurkat T cells, but is not limited thereto.
- hPSC-derived immature intestinal organoid hIO
- hSI mature human small intestine
- cytokine refers to a protein that plays an important role in cellular signal transduction.
- the release of cytokines affects the behavior of the cells around the cytokines. Specifically, cytokines are involved in self-secreting signals, paracrine signaling and endocrine signaling as immunomodulators. Cytokines are also produced by a wide range of cells, including endothelial cells, fibroblasts and various stromal cells, as well as immune cells such as macrophages, B lymphocytes, T lymphocytes, and mast cells. Cytokines play a role in regulating the balance between humoral and cell-based immune responses and in regulating maturation, growth and response of specific cell populations.
- Cytokines in the present invention can be used in coculture to mimic in vivo enteroenvironment, or can be used to produce more in vivo intestinal environment by treating only cytokines secreted in T-lymphocyte coculture.
- the main cytokines secreted by T-lymphocytes for the purposes of the present invention are IL-2 (interleukin-2), IL-8 (interleukin-8), TNF ⁇ (Tumor Necrosis Factor- ⁇ ), and IL-22 (interleukin-22).
- IL-6 interleukin-6
- IL-1 ⁇ interleukin-1 ⁇
- IL-11 interleukin-11
- EGF epidermal growth factor
- OSM oncostatin M
- IL-10 interleukin-10
- hPSC-derived enteric organoids are similar to hSI upon IL-2 treatment used in the present invention.
- a phospho-kinase array of intestinal organoids co-cultured with T lymphocytes is performed to produce IL-2-mediated signaling related proteins such as STAT3, c-Jun, p38 ⁇ and ERK1 / 2.
- IL-2-mediated signaling related proteins such as STAT3, c-Jun, p38 ⁇ and ERK1 / 2.
- IL-2 is a key factor for the in vitro maturation of human enteroorganoids (hIO) differentiated from hPSCs in the effect of coculture for in vitro maturation
- hIO human enteroorganoids
- the degree of phosphorylation was determined by po-kinase array analysis (FIGS. 8C, 8D).
- STAT3 Y705
- mTOR signaling components such as AKT and P70 S6 kinase was confirmed (Fig. 7b, 7d).
- gene expression profiling was performed to determine whether the IL-2-mediated signaling pathway is involved in the maturation of hIO in vitro in addition to its role in promoting hIO growth. It was confirmed that the gene expression profile of hIO shifted to that of hSI when co-cultured with lymphocytes or treated with IL-2 (FIG. 10A).
- DEGs differentially expressed genes
- the term "maturated enteric organoid (mature hIO)" is a term opposite to immature enteric organoids, the genes necessary for digestion, transport system, immune function and host defense that the adult small intestine has Refers to expressed intestinal organoids.
- the mature small intestine has unique characteristics, including small intestine stem cell marker genes, digestive function, transport system, extensive immune function, and expression of genes necessary for host defense.
- proper expression and activity of transporters involved in physiological and pharmacokinetic roles is a prerequisite for normal intestinal function, such as absorption, distribution and excretion of drugs.
- 'mature' may be used in combination with 'similar state of the small intestine of the adult' or 'hSI'.
- hIO co-cultured with T lymphocytes and hIO treated with IL-2 are CDX2, OLFM4 (small intestinal stem cell marker gene), DPP4, LCT (digestive function related gene), SLC5A1 (transport system) Related genes), LYZ, DEFA5, DEFA6, (immune and host defense function related genes), and other intestinal maturation related genes KRT20, MUC13, CREB3L3, etc. are expressed in a pattern similar to that of the adult small intestine control (hSI).
- Fig. 10a to 10g it was confirmed that the mature hIO can be produced in vitro.
- hIO and IL-2 treated with co-cultured with T lymphocytes have a functional pattern of the adult adult intestinal tract and expression patterns of metabolic and transport system related genes and the small intestine control (hSI) of the mature human body. It was confirmed that expression was enhanced in a similar pattern (FIGS. 11A and 11B).
- P-gp P-glycoprotein / MDR1 / ABCB1
- the activity was increased through paclitaxel assay.
- Fig. 11c, 11d it was confirmed that the mature hIO can be produced in vitro. This suggests that the drug absorption may be evaluated in a similar environment to the human body through the present invention.
- the preparation method of the present invention comprises 1) co-culture of immature enteric organoids with T-lymphocytes, 2) treating cytokines, 3) treating STAT3 and mTOR signaling pathway activators, or 4) the above 1), 2). And 3) may be performed simultaneously or sequentially.
- the mature intestinal organoid prepared by the present invention may have increased expression of any one or more of the following markers (a) to (f) as compared to immature intestinal organoids.
- transport system related markers SLC5A1 (solute carrier family 5 member 1), P-glycoprotein 1 (p-gp, multidrug resistance protein 1 (MDR1), and ATP-binding cassette sub-family B member 1 (ABCB1));
- the term "maturation of the intestine” refers to the acquisition of genomic expression and functional characteristics of the intestine of an adult. Specifically, the four intestinal cells are highly morphologically similar to the body, and the intestinal mature intestinal stem cell markers, the digestive function markers, the immune and host defense function markers, the transport system and metabolic enzyme markers, or the mature intestine Expression of differentiation marker genes and proteins is increased, which means the maturation of intestinal organoids with high similarity to the actual intestinal tract which can simulate actual functions such as nutrient and drug absorption function, mucus secretion and hormone secretion.
- hIO co-cultured with T lymphocytes and hIO treated with IL-2 were found to increase the activity of P-gp, an efflux pump transporter present in mature adult small intestinal epithelial cells, and nutrients from small intestinal epithelial cells.
- glucose sensitivity was confirmed by Fluo4-AM analysis.
- CFTR Cystic fibrosis transmembrane conductance regulator
- maturation of the intestines is characterized by the signal transducer and activator of transcription 3 (STAT3), protein kinase B (PKB), and P70S6 kinase beta-1 (S6K1), which are STAT3 and mTOR signaling markers in hIO. )) Means active.
- STAT3 signal transducer and activator of transcription 3
- PTB protein kinase B
- S6K1 P70S6 kinase beta-1
- the term "differentiation of the intestine” in the present invention has a crypt and villi structure that is intrinsic to the morphological characteristics of the intestine, and has four main special cells (enterocytes, panes cells ( Paneth cell), enteroendocrine cells (enteroendocrine cells) and goblet cells (goblet cells) means the presence of.
- the enteric organoids prepared by the method for preparing intestinal organoids matured in vitro of the present invention are not immature intestinal organoids having fetal-like characteristics, but are intestinal organoids having adult-like characteristics.
- Microarray analysis and qPCR were performed to confirm the properties of the nodoids, resulting in gut-specific markers (CDX2), mature intestinal stem cell markers (OLFM4), and Panes cell-specific components produced in mature intestines.
- the expression levels of phosphorus, human ⁇ -defensin ( DEFA5 and DEFA6 ) and lysozyme ( LYZ ), digestive function-related enzymes DPP4, LCT were upregulated in coculture or IL-2 treated hIO.
- In vitro mature intestinal organoids prepared through the method of preparing intestinal mature organoids in vitro of the present invention may be one that expresses specific markers related to activated STAT3 and mTOR signaling, in particular, STAT3, Expression of AKT or P70 S6 kinase and their phosphorylation are promoted.
- IL-2 is a potential key factor in the effect of co-culture on the in vitro maturation of hIO
- treatment with IL-2 followed by phospho-kinase array analysis
- the degree of phosphorylation was measured (FIG. 7B), which was verified by Western blot (FIG. 7C).
- STAT3 Y705
- mTOR signaling components such as AKT and P70S6 kinase
- hIO mature intestinal organoids
- the system can be used to elucidate the formation of enterocytes and the complex pathological processes that occur.
- morphologically more complex similar to the human intestine it is easy to confirm the expression of genes and proteins expressed in the adult adult intestine by qPCR and immunostaining, and confirm the acquisition of functionality.
- mature intestinal organoid (hIO) models in vitro reproduce human physiological functions and mimic their structure, allowing the intestinal development to be used for the study of all developmental processes, from fetal status to adulthood.
- an intestinal disease-related model it is similar to the environment in the human body and has the advantage of being accurately reproduced.
- Another aspect of the present invention provides intestinal organoids matured in vitro prepared by the above production method.
- the 'matured enteric organoid' is as described above.
- the hIO prepared in the present invention can be made of iPSCs of healthy controls and intestinal disease patients
- in vitro matured hIO may be human intestinal organoids for understanding the physiology and pathophysiology of the human intestine in a patient-specific manner.
- the production of functional mature cells in hPSCs is technically difficult, ultimately producing immature organoids.
- in vivo maturation after implantation of immature enteric organoids appears to promote the induction of functional mature cells, the use of these cells in the proliferative precursor state may pose additional risks to practical applications and clinical translation. Therefore, in order to reproduce the physiological function of mature adult cells, a model of in vitro maturation of hPSC-derived cells and organoids is required.
- the mature intestinal organoids according to the present invention have a configuration close to the human intestine and can be used as an alternative to the intestinal related disease model in the need for an alternative animal testing model worldwide.
- Another aspect of the invention provides a composition for in vitro maturation of immature intestinal organoids comprising T-lymphocytes, cytokines, STAT3 and mTOR signaling pathway activators or combinations thereof.
- Another embodiment of the present invention comprises incubating immature intestinal organoids in a medium comprising lymphocytes, cytokines, STAT3 and mTOR signaling pathway activators or combinations thereof. Provides a method of maturing immature intestinal organoids.
- the 'T-lymphocytes', 'cytokines', 'organoids', 'immature enteric organoids' and 'matured enteric organoids' are as described above.
- Another aspect of the present invention provides a method for preparing artificial intestines, comprising preparing mature enteric organoids according to the above method.
- the 'organoids' and 'mature enteral organoids' are as described above.
- artificial intestinal tract is used for the purpose of treating body organs with cells and tissues prepared through isolation, culture and special manipulation from an individual, and to restore the function of cells or tissues. Artificial intestine created on the basis of technology, used for therapeutic purposes.
- mature intestinal organoids prepared by the production method of the present invention are differentiated into mature intestinal organoids having adult-like properties in vitro, and thus, in vivo using animals unlike conventional intestinal organoid preparation methods. It is advantageous in that it does not go through the culturing step, and after being implanted in a patient, it can form an appropriate link (network formation) with surrounding cells. First of all, since the patient's own adult cells are used, there is no technical problem such as immunogenicity or ethical problem that impedes the future use of tissue therapy.
- transplantation of hIO into the kidneys of immunodeficient NSG mice results in transplantation. It was confirmed that the markers of all major intestinal cell types, including enterocytes, enteroendocrine cells, goblet cells, and Panes cells, were expressed in the hIO (FIG. 14B).
- vascular endothelial cells CD31-positive cells
- IL-2 treated hIO peripheral lamina ⁇ -smooth muscle actin ( ⁇ -SMA) -positive cells
- VEGF vascular endothelial growth factor
- Another aspect of the present invention provides a tissue therapy comprising intestinal organoids matured in vitro prepared according to the above method.
- Another aspect of the invention provides a method of treating intestinal related diseases comprising transplanting into a subject a mature enteric organoid prepared according to the method.
- the 'organoids' and 'mature enteral organoids' are as described above.
- the term “individual” refers to humans and / or monkeys, cows, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits or guinea pigs that may have invented or develop intestinal diseases. Means all animals, including. Types of individuals include, without limitation, if the intestinal related diseases can be effectively treated by administering the mature enteric organoids of the present invention to the individuals.
- intestinal related disease refers to inflammatory bowel disease (IBD), Crohn's disease, short bowel syndrome, enterocolitis, and hereditary bowel disease (Hirschsprung disease). hirschsprung's disease), and the like.
- treatment refers to improvement of intestinal related diseases by direct administration of cytokines or STAT3, mTOR signaling pathway activators, and combinations thereof, used for transplantation and in vitro maturation of the mature intestinal organoids. Means any action that is or is beneficially altered.
- kits for screening a therapeutic agent for intestinal related diseases comprising intestinal organoids matured in vitro.
- the kit for screening of the present invention contains mature enteric organoids specific for patients with bowel-related diseases, and thus may be usefully used for screening the disease- or derived patient-specific therapeutic agent.
- Another embodiment of the present invention comprises the steps of: (a) treating a test substance to mature intestinal organoids from patients with bowel related diseases; And (b) the amount of mRNA or protein that is increased or decreased in mature intestinal organoids derived from patients with intestinal related diseases than intestinal organoids derived from normal humans.
- a method of screening for a therapeutic agent for intestinal related diseases comprising the step of comparing in mature intestinal organoids with normal intestinal organoids not treated with a test substance.
- the 'matured intestinal organoids' and 'intestinal related diseases' are as described above.
- the screening method may be selected as a therapeutic agent that reduces or inhibits the expression of mRNA or protein whose expression is increased in mature intestinal organoids derived from patients with intestinal diseases, rather than normal mature intestinal organoids. It may further comprise the step.
- the screening method may be selected as a therapeutic agent that increases or inhibits the expression of mRNA or protein whose expression is decreased in mature intestinal organoids derived from patients related to intestinal diseases than normal mature intestinal organoids. It may further comprise the step.
- test substance may be individual nucleic acids, proteins, other extracts or natural products, or compounds that are assumed to have the potential of treating intestinal related diseases according to a conventional selection method or randomly selected. have.
- the material obtained by this screening method will act as a leading compound in the process of developing a therapeutic agent for a subsequent intestinal related disease, and by modifying and optimizing the leading substance, new prophylactic or therapeutic agents for autoimmune diseases can be developed.
- the screening method of the present invention can be usefully used for the search and development of a prophylactic or therapeutic agent for intestinal related diseases.
- Human fibroblasts CRL-2097 and IMR90
- human T lymphocytes Jurkat T cells
- ATCC American Type Culture Collection
- H9 human embryonic stem cell (hESC) lines were purchased from WiCell Research Institute, Madison, USA.
- hPSCs Human pluripotent stem cells
- hESC human embryonic stem cells
- hiPSC human induced pluripotent stem cells
- fibroblasts were plated at 1 ⁇ 10 5 per well in Matrigel (BD Biosciences, San Diego, Calif., USA) -coated 6-well plates, and E8 medium (Stem Cell Technologies , Vancouver, Canada). After 3 weeks, hiPSC colonies were selected and cell numbers were increased for passage and subsequent characterization.
- Matrigel BD Biosciences, San Diego, Calif., USA
- E8 medium Stem Cell Technologies , Vancouver, Canada
- hIOs Human intestinal organoids
- hPSCs Human intestinal organoids
- Jurkat T cells were treated with 50ng / ml phorbol myristrate acetate (PMA, Sigma-Aldrich, St. Louis, MO, USA) and 500ng / ml calcium ionophore (calcium). ionophore) A23187 (Sigma-Aldrich) was stimulated for 3 hours.
- Transwell polyester membrane inserts pore size 0.4 ⁇ m, Corning, Corning, NY, USA
- hIO inserted into Matrigel were seeded at 5 ⁇ 10 4 / cm 2 with stimulated Jurkat T cells in hIO medium.
- Interukine-2 Interukine-2, hereinafter IL-2
- IL-2 Interukine-2
- R & D Systems prepared rhIL-2 (R & D Systems) was added to hIO medium daily at a concentration of 1 ng / ml (approximately 13 U / ml).
- hIO was treated with 1 ⁇ g / ml of anti-IL-2R ⁇ monoclonal antibody (R & D Systems) to inhibit IL-2 signaling, and to block IL-2 downstream signaling, the mTOR inhibitor Rapha Mycin (10 nM, Sigma-Aldrich), STAT3 inhibitor S3I-201 (10 ⁇ M, Sigma-Aldrich) or Stattic (1 ⁇ M, Sigma-Aldrich) was added.
- Rapha Mycin 10 nM, Sigma-Aldrich
- STAT3 inhibitor S3I-201 10 ⁇ M, Sigma-Aldrich
- Stattic (1 ⁇ M, Sigma-Aldrich
- Immunofluorescence was performed according to known methods (Kwak et al., Biochemical and biophysical research communications 457, 554-560, 2015). Specifically, hPSCs and final endoderm cells were fixed with 4% paraformaldehyde (PFA) and permeated with PBS containing 0.1% Triton X-100.
- PFA paraformaldehyde
- hIO and tissues were fixed, frozen protected with sucrose and frozen using optimal cleavage temperature (OCT) compounds (Sakura Finetek, Tokyo, Japan).
- OCT cleavage temperature
- the frozen sections were then cut to 10-20 ⁇ m using a crystat microtome at ⁇ 20 ° C. and permeated with PBS containing 0.1% Triton X-100 for immunofluorescence.
- the cells were reacted with the primary antibody overnight at 4 ° C. Thereafter, the mixture was reacted with the secondary antibody for 1 hour at room temperature.
- the primary antibodies used are shown in Table 2. Paraffin sections were deparaffinized and then antigen searched and stained in a manner similar to OCT sections. DAPI was added to visualize nuclei. Slides were observed through Axiovert 200M microscope (Carl Zeiss, Gottingen, Germany) or fluorescence microscope (IX51, Olympus, Japan).
- Protein phosphorylation was quantified. Protein extracts were prepared from hIO co-cultured with human T lymphocytes and treated with 1 ng / ml rhIL-2. No untreated hIO was used as a control. After blocking the phospho-kinase array membranes were incubated with 200 ⁇ g total protein from hIO overnight at 4 ° C. and incubated with a mixture of biotin attached detection antibodies for 2 hours at room temperature.
- the signal was detected by the ECL Plus Western Blotting Detection System (GE Healthcare, Buckinghamshire, UK).
- the level of phosphorylated kinase was quantified by densitometry using Image Gauge software (Fuji Photo Film GMBH).
- Protein abundance was assessed using Western blot according to known methods. Specifically, cells were lysed with RIPA buffer and the residue was removed by centrifugation at 4 ° C. 20 ⁇ g of total protein was then electrophoresed using 4-15% gradient gels (Ready Gel, Bio-Rad Laboratories, Hercules, Calif.) And transferred to PVDF membranes.
- ELISA enzyme-immunoassay
- Microarray experiments were performed by known methods using a low RNA input linear amplification kit, a cRNA cleanup module and a one-color (Cy3) Whole Human Genome Microarray 4X44K (Agilent Technology, Santa Clara, Calif.), According to the manufacturer's instructions. Gene expression data was processed using GeneSpring software (Agilent). Data was standardized through a global scale normalization process. Separately expressed genes were selected based on more than twofold changes.
- RNA samples were first prepared with an RNA Integrity Number (RIN) value of 7.5 or higher using the Agilent 2100 Bioanalyzer system (Agilent Biotechnologies, Palo Alto, USA), and mRNA libraries were prepared through the Illumina TruSeq kit. Sequencing was performed through Illumina HiSeq2500 machines (Illumina, San Diego, CA, USA). Sequencing quality was determined through the FastQC package, and trimmed read length was excluded below 50 bases. The mapping was then performed via HISAT2 (v2.0.5) and the human genome information was hg19. Differentially expressed genes (DEGs) were analyzed using Cuffquant and Cuffnorm (Cufflinks v2.2.1).
- DEGs Differentially expressed genes
- Microarray data analysis was performed as described above in Experimental Example 9. Hierarchical clustering and heat maps were created using MeV v 4.9.0 software. Gene functions were annotated using the GeneCard database ( http://www.genecards.org ). Other bioinformatics analyzes include IPA analysis software (Ingenuity systems, Redwood City, CA, USA), Protein ANalysis THrough Evolutionary Relationships (PANTHER) database, and DAVID Bioinformatics Resource 6.7 (http: / /david.abcc.ncifcrf.gov). In addition, different phosphorylated proteins were used for analysis and visualization of the functional interaction network.
- the core path of the network was further analyzed using Reactome FI software, Version 5.0.0 beta, http://apps.cytoscape.org/apps/reactomefis .
- hIO was washed three times with HBSS and then disrupted using an ultrasonic cell grinder. The homogenate was then centrifuged at 13,000 X g at 4 ° C. for 10 minutes to collect the supernatant.
- Paclitaxel in each sample by LC-ESI / MS / MS analysis using a 3200 QTRAP LC-MS / MS system (Applied Biosystems) equipped with a Turbo VTM Ion Spray source and an Agilent 1200 series HPLC system (Agilent Technologies) The concentration of (paclitaxel) was quantified.
- Mature functional goblet cells were identified in mature intestinal organoids using a technique for staining mucin mucus released from mature goblet cells.
- First control and mature intestinal organoids were fixed with 4% para-formaldehyde and then further fixed with 10%, 20%, 30% sucrose solution. After freezing using OCT, using a cryostat microtome frozen section to a thickness of 10um and adhered to the slide glass, staining was performed.
- GIP gastric inhibitory polypeptide
- Renal capsule xenografts of hIO were performed using known methods ( Nat Med 20, 1310-1314 (2014)). Specifically, mice were anesthetized with 2% isoflurane (Butler Schein, Dublin, OH, USA) and the left side of the mice were prepared using isopropyl alcohol and povidone-iodine in a standard manner. The left pelvis was dissected to expose the kidneys. The hIO of the collagen plug was then implanted into the subcutaneous space of the kidney. Thereafter, the kidneys were transferred intraperitoneally, and mice were administered an IP flush containing Enrofloxacin (5 mg / kg; Daehan New Pharm Co.). The skin was closed with bilayers and the mice were kept warm with a heating pad until complete recovery from anesthesia. One week after transplantation, mice were humanely euthanized and xenografts were isolated for analysis.
- hIO was added to 1,1-dioctadecyl-3,3,3,3-tetramethyldotricarboxyanine iodine (1,1-dioctadecyl) for 15 minutes at 37 ° C. in a 4-well plate. -3,3,3,3-tetramethylindotricarbocyanine iodide, DiR, Invitrogen). After washing with PBS, hIO was incubated with fresh medium and then transplanted under kidney capsule.
- inhaled isoflurane Trorrell TM , Piramal Healthcare, Bethlehem, PA, USA
- kidneys of transplanted mice were detached one week after implantation and placed in a light sealed room to which a charge-coupled device camera was connected.
- the fluorescence intensity of each region of interest was measured using an in vivo imaging system (IVIS Lumina II, Xenogen Corp., Alameda, Calif., USA) with emission at 780 nm and stimulation at 750 nm.
- HiPSC digests prepared using 1 ⁇ Taq buffer (Takara, Kyoto, Japan) and proteinase K (proteinase K) at 55 ° C. for 3 hours were used for qPCR analysis as described above.
- Known concentrations of the pCXLE-hFb ⁇ 15-cont2 plasmid were used to draw the standard curve.
- Copy numbers of EBNA1 and FBXO15 in each hiPSC were calculated from the threshold cycle (Ct) values obtained from six replicates.
- STR analysis was performed using Humanpass, Inc., using genomic DNA isolated from fibroblasts and corresponding iPSC lines. (Seoul, Korea).
- hiPSCs were isolated by 1 mg / ml collagenase IV treatment, 10% knockout serum replacement, 1% non-essential amino acids, 0.1 mM ⁇ -mercaptoethanol And plated on Petri dishes with knockout DMEM EB medium supplemented with 1 mM L-glutamine. After 5 days of suspension culture, the cultures (embryoid bodies, EB) were transferred to LabTek chamber slides (Nunc International, Naperville, II, USA) coated with Matrigel and further incubated for 10 days.
- a total of 1 ⁇ 10 6 cells were mixed with Matrigel and injected subcutaneously into the dorsal-lateral region of BALB / c nude mice (Orient Bio, Inc., Seongnam, Korea). After 8-10 weeks, teratomas were dissected, fixed in 4% PFA and inserted in paraffin. Teratoma inserted in paraffin was sectioned and stained with hematoxylin and eosin solution (Sigma-Aldrich). Animal experiments were performed after approval from the Institutional Animal Care and Use Committee (IACUC) of Approval No: KRIBB-AEC-16206 (KRIBB).
- IACUC Institutional Animal Care and Use Committee
- Example One hPSC -origin on hIO Co-culture with human T lymphocytes to overcome immature patterns of intestinal gene expression
- hIO was prepared from hPSCs comprising one hESC line and two fully characterized, non-inserted-hiPSC lines (FIG. 1A) using the hIO differentiation protocol.
- hPSCs were efficiently differentiated into hIO mimicking complete endoderm, posterior and intestinal tissue by expression of unique morphological and step-specific markers (FIGS. 2A, B and 3A).
- enteric transcription factors his; human small intestine markers (sex determining region Y-box9) (SOX9), Caudal Type Homeobox 2 (CDX2) and Kruppel like factor 5 (KLF5) and small intestine cell types
- VIL Villin 1 for absorbing cells
- MUC2 mcin 2 for goblet cells
- LYZ lysozyme for Panes cells
- CHGA chromogranin A for enteroendocrine cells
- PCA Principal component analysis
- hPSC-derived hIO (p0, p2) is responsible for the expression of numerous genes involved in intestinal maturation, such as Paneth cell function, digestive function, and host defense by intestinal stem cell (ISC) markers (eg OLFM4). Was still reduced (FIG. 3D).
- ISC intestinal stem cell
- Panes cell function e.g. DEFA5, DEFA6
- digestive function e.g. DPP4, LCT
- intestinal stem cell ISC markers
- hIO was confirmed to be able to stably expand for more than 10 passages (150 days) while maintaining a specific structure that includes all intestinal epithelial cells (IEC) types (FIG. 3A).
- IEC intestinal epithelial cells
- mRNA levels of small intestinal cell type-specific markers VIL1, LYZ, CHGA, and MUC2 no longer increased between passage II and multiple-passed hIO (p8, p10) (FIG. 3e).
- mRNA levels of intestinal maturation markers such as ⁇ -defensin, OLFM4, DEFA5, DPP4 and LCT produced by mature Panes cells remained very low as differentiation progressed (FIG. 3E).
- IEC Intestinal epithelial cells secrete soluble factors to interact with immune cells present in the intestinal mucosa, maintaining homeostasis and promoting intestinal epithelial maturation.
- a coculture system was used that allowed crosstalk between hIO and immune cell secreted substances via soluble factors secreted from each cell (FIG. 5).
- Jurkat T cells the source of human T lymphocytes stimulated with PMA / ionophores, were embedded in Matrigel and placed in transwell inserts in 12-well plates. Co-culture with Jurkat T cells was found to significantly increase the size of hIO (FIG. 3F).
- IL-2 receptor beta IL-2 receptor beta
- IL-2R ⁇ c IL-2 receptor beta
- the beta (IL-2R ⁇ ) and gamma chain (IL-2R ⁇ c ) contribute to IL-2-mediated signaling by formation of intermediate affinity for the IL-2Rbg c receptor by dimerization.
- a phospho-kinase array was performed to detect 43 kinase activity according to environmental changes. Some kinases showed a detectable difference (> 1.2-fold change) in the phosphorylation status of the control and co-cultured groups (FIGS. 8A, 8B).
- cytokines are one of the important secretory soluble factors in coculture systems and may play a key role in in vitro intestinal maturation.
- IL-2 is a potential key factor in the effect of coculture on the in vitro maturation of hIO.
- experiments with recombinant human IL-2 (rhIL-2) were performed.
- hPSC-derived hIO cultured with IL-2 significantly increased in size and inhibited the increase in size of hPSC-derived hIO by selectively blocking IL-2 receptors (FIG. 7A).
- IL-2 by treating IL-2 at a concentration of 1 to 4ng / ml, it was confirmed that the size of hIO having a complex 3D intestinal epithelial structure was significantly increased (FIG. 9).
- phosphorylation events induced by IL-2 treatment were measured via human phospho-kinase array analysis. As a result, it was confirmed that the most modified phosphorylation molecule increased 3.3-fold after IL-2 treatment with STAT3 (Y705) (FIGS. 8C, 8D and 7B).
- hIO Proteins phosphorylated differently between the control and IL-2 treated hIO were found to be significantly enhanced in the mTOR signaling pathway (corrected FDR ⁇ 0.005).
- hIO was co-cultured with human T lymphocytes or treated with IL-2, confirming elevated phosphorylation of STAT3 and mTOR signaling components such as AKT and P70 S6 kinase (FIG. 7C, FIG. 7D).
- cytokines were found to be involved in the growth and maturation of hPSC-derived hIO by activating STAT3 and mTOR signaling.
- hIO co-linlin, another STAT3 activator, confirmed that hIO can be matured in vitro.
- the size of hIO increased when various concentrations of colivelin were used (FIG. 17A).
- colivelin Increasing the expression of the intestinal maturation marker gene was confirmed by qPCR, the overall increase in colivelin treatment compared to the control hIO (Fig. 17b).
- Treatment with colivelin also increased the expression of proliferation marker (Ki-67) and mature intestinal markers (OLFM4, MUC13 and KRT20) proteins.
- Gene expression profiling was performed to determine whether the IL-2-mediated signaling pathway is involved in the maturation of hIO in vitro in addition to its role in promoting growth of hIO. Specifically, it was confirmed that the gene expression profile of hIO when co-cultured with human T lymphocytes or treated with IL-2 shifted similarly to the expression pattern of the human adult intestinal control (hSI) (FIG. 10A). In particular, co-culture (55.9% of genes shifted to hSI's profile) was more effective than IL-2 treatment (49.8% of genes shifted to hSI's profile).
- the number of genes involved in the selected biological process in cocultured hIO was more than twice that of IL-2 treated hIO (FIG. 10D).
- expression levels of genes involved in intestinal maturation, including intestinal markers, digestive function, and protective function were somewhat lower than cocultured hIO, but higher in IL-2 treated hIO than control hIO (FIG. 10E). -g).
- FIG. 11A The expression of intestinal maturation-related genes was examined (FIG. 11A).
- hSI and human adult tissue-derived intestinal organoids hAT-IO
- in vitro maturation can be induced to have the characteristics of the adult intestine of the hPSC-derived immature hIO having fetal-like characteristics upon co-culture system or cytokine IL-2 treatment.
- Example 5 in vitro-matured hIO to mimic intestinal functionality
- hIO has a permeable intestinal epithelial barrier exhibited by the intercellular diffusion pattern of FITC-dextran (FIG. 12C).
- a prototype substrate, paclitaxel was loaded on the basal side (outside) of coculture and IL-2 treated hIO controls. After 2 hours incubation, the concentration of paclitaxel in the cross section (inside of the cell) was increased approximately 2.3-fold (p ⁇ 0.001) in co-cultured hIO compared to that in control hIO and 3-fold (p ⁇ 0.001) in IL-2 treated hIO. ⁇ 0.001) it was confirmed that the increase (Fig. 12d).
- the concentration of paclitaxel in the cross-section was co-cultured and IL-2-treated hIO compared to control hIO (27.9% ⁇ 15.6%, p> 0.05) (54.6% ⁇ 5.8%, p ⁇ 0.001 and 92.8% ⁇ 0.6%, p ⁇ 0.001, respectively).
- glucose-mediated calcium cell substrate release was quantified using Fluo4-AM calcium markers.
- Fluo4-AM calcium markers When observing the reaction of calcium ions upon influx of glucose through real-time imaging, the calcium response is clear compared to the control, and the signal is amplified (2 ⁇ 3 times, p ⁇ 0.001). In contrast, it was confirmed that glucose sensitivity was superior in the matured hIO (FIG. 12F).
- Mature absorber cells express CFTR, so to confirm this, a Paul Scoline mediated organoid expansion assay was performed. The total amount of organoids was exposed through 120 minutes of exposure to foscholine, and the size of organoids was compared and compared with the control group. inh 172, GlyH101) was completely blocked during the treatment (Fig. 12g). This suggests that in vitro-mature hIO expresses functional CFTR protein well.
- pars / mucalalmin staining was performed to identify the functional organoids of the mucous layer and mature mucin-producing goblet cells, and the pars / mucalalmin-positive mucous layer and mucin-producing goblet cells were better in vitro-matured hIO than the control group. Function was confirmed (FIG. 12H).
- the amount of GIP hormone was calculated from the control supernatant of co-culture or IL-2 treated hIO.
- the GIP gene expression patterns of the control group and the in vitro-mature hIO were confirmed by the qRT-PCR technique, it was confirmed that the expression of the GIP gene was significantly increased in the hIO co-cultured or treated with IL-2 (Fig. 12i).
- Fig. 12i As a consistent result, when confirming the amount of secreted GIP using the GIP ELISA kit, it was confirmed that about 45-fold GIP secretion when co-culture or IL-2 treatment compared to the control (Fig. 12j).
- Example 6 in vitro-matured hIO to generate functional vascular structures in vivo
- hIO was injected under kidney capsules of immunodeficient NSG mice.
- hIO was labeled with DiR, a near-infrared fluorescent lipophilic dye with low cytotoxicity.
- DiR a near-infrared fluorescent lipophilic dye with low cytotoxicity.
- hIO was inside the kidney 1 day after transplantation (FIG. 14A), and it was confirmed that a clear fluorescence signal was still found when the kidney was removed after transplantation (FIG. 13A).
- VEGF vascular endothelial growth factor
- in vitro-matured hIO can potentially induce human vascular maturation in vivo, and also that in vitro-matured hIO has a normal karyotype (FIG. 16), leading to future clinical intestinal transplantation. Suggests an alternative cell supply for
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Developmental Biology & Embryology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Nutrition Science (AREA)
- Physiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Virology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 in vitro에서 성숙된 장관 오가노이드의 제조 방법 및 상기 방법으로 제조된 장관 오가노이드에 관한 것이다.
Description
본 발명은 in vitro에서의 성숙과정을 통해 성체의 장관과 유사한 인간 장관 오가노이드의 제조 방법 및 상기 방법으로 제조된 장관 오가노이드(intestinal organoid, hIO)에 관한 것이다.
성체 소장의 성숙한 소장 상피는 다양한 생리기능, 장 상피 구조 및 항상성을 조절하고 유지해야 한다. 장 상피 세포는 신체적, 기능적 및 면역학적 장벽 역할을 하며, 4가지 주요 특수세포(흡수성 장세포(enterocyte), 파네스세포(Paneth cell), 장내 내분비세포(enteroendocrine cell) 및 배세포(goblet cell))에 의해 형성된다. 장 상피 세포의 단층(monolayer of intestinal epithelial cells, IEC)은 영양소의 소화 및 흡수에 중요한 역할을 하며 유해미생물 및 독성물질에 대한 1차 방어선을 제공한다. 소장에 있는 모든 분화된 세포 유형과 그 주변 환경은 성체(adult) 소장의 복잡한 구조와 기능의 성숙과 유지에 기여한다. 그러나, 구조적, 생리학적으로 복잡성이 높은 성숙한 성체 소장의 다양한 생리학적 과정에 관여하는 발달, 기능, 질병 및 세포 간 신호전달 경로를 연구하는 것은 어려움이 있다. 또한 기존에 사용하고 있는 동물 모델의 경우에는 인체와의 종간 변이 등의 부작용을 포함하는 한계점을 가지며, 장관 흡수모델로 널리 사용되고 있는 Caca-2 세포주의 경우 정상 세포가 아닌 암세포주이며, 인간 성체 장관에 비해 기능성 transporter 및 효소 발현이 매우 낮은 문제점이 있다. 따라서, 신약 개발과 독성 평가에서 노출되는 기존 장관 모델의 부작용과 한계점을 극복할 수 있고, 나아가 향후 조직치료제로써 활용할 수 있는 대안적 세포자원을 제공할 수 있는 기술이 필요하다. 이러한 배경은 구조적 기능적으로 성숙한 성체 소장의 특징을 가지는 in vitro 인간 장관 모델 개발의 긴급한 필요성을 강조한다.
최근에는 인간 배아 줄기세포(human embryonic stem cells; hESC)와 인간 유도 다능성 줄기세포(human induced pluripotent stem cells; hiPSC) 같은 인간 다능성 줄기세포(human pluripotent stem cells; hPSC)로 부터 직접적인 분화(directed differentiation) 프로토콜을 사용하여 3차원 인간 장관 오가노이드(human intestinal organoids; hIO)를 제작함으로써 in vitro에서 미니 장관 또는 장관 조직 제작 방법이 개발되었다 (Spence et al., Nature 2011). 그러나 이렇게 제작된 hIO와 성숙한 인체의 소장 대조군 (hSI, human small intestine)의 구조와 기능이 크게 유사함에도 불구하고, hPSC에서 유래한 hIO는 소화 기능, 면역 기능 및 OLFM4와 같은 장관 줄기세포(intestinal stem cell) 마커 유전자의 발현이 충분하지 않은 미성숙한 태아(fetus) 소장의 특성을 가진다. 이는 in vitro에서 성숙에 제한된 시간이 허여된 것과, 장내 성숙에 중요한 소장 주위의 적절한 신호 및/또는 면역, 혈관, ENS전구세포 같은 중요한 세포 유형의 부족에 의한 것으로 추정된다. 이 미성숙 hIO는 신장주머니에 이식된 후 in vivo 환경에서 배양되거나 또는 마우스의 기형종으로 성장한 경우에만 성체의 장관 구조 및 기능성을 갖춘 성숙한 소장으로 발달할 수 있다는 문제점을 가지고 있었다.
본 발명자들은 기존의 미성숙한 태아 장관의 특성(immature fetal characteristics)을 가지는 hIO를 성숙시키기 위해서 실험 과정의 변이가 심하고, 비-특성화된 in vivo 환경에서의 배양을 통한 성숙 방법의 문제점을 극복하고, 인체 내 환경과 유사한 환경을 제공할 수 있는 공배양시스템(co-culture system)및 규정된(defined) 성장인자를 통해 in vitro내에도 성체와 유사한 성숙된 인간 장관 오가노이드를 제조하였으며, 이와 같은 성숙된 장관 오가노이드는 성체 소장과 관련된 유전자를 발현하고, 기능적으로도 향상되었음을 최초로 규명 및 완성하였다. 이와 같은 모델은 in vitro에서 성숙된 성체 장관 오가노이드 및 인공 장기를 모두 포함하여, 인체 모방 장관모델 개발, 흡수모델, 질환모델링, 신약개발, 조직치료제 등의 분야에 활용될 수 있는 모델을 제공한다.
본 발명의 하나의 목적은 미성숙 장관 오가노이드(intestinal organoid)를 T-림프구, 사이토카인 또는 이들의 조합을 포함하는 배지에서 배양하는 단계를 포함하는, in vitro에서 성숙된 장관 오가노이드의 제조 방법을 제공하는 것이다.
본 발명의 다른 목적은 T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는, 미성숙 장관 오가노이드의 in vitro 성숙용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법을 사용하여 제조된, in vitro에서 성숙된 장관 오가노이드를 제공하는 것이다.
본 발명의 또 다른 목적은 미성숙 장관 오가노이드(intestinal organoid)를 T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지에서 배양하는 단계를 포함하는, in vitro에서 미성숙 장관 오가노이드를 성숙시키는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 따라 성숙된 장관 오가노이드를 제조하는 단계를 포함하는, 인공 장관의 제조방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 따라 제조된 in vitro에서 성숙된 장관 오가노이드를 포함하는 조직치료제를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법으로 제조된, 성숙된 장관 오가노이드를 포함하는, 장 관련 질환의 치료제 스크리닝용 키트를 제공하는 것이다.
본 발명의 제조방법에 따른 in vitro에서 성숙된 장관 오가노이드는 기존에 미성숙 장관 오가노이드를 성숙시키기 위해서 in vivo 환경에서 배양되어야 하는 문제점을 해결 할 수 있고, 본 발명의 성숙된 장관 오가노이드는 인공 장관, 약물 스크리닝, 세포치료 등에 유용하게 사용될 수 있다.
도 1은 야생형 섬유아세포로부터의 hiPSC 계통의 생성 및 특성을 나타내는 도이다.
도 1(a)는 리프로그래밍 프로토콜의 개략도를 나타내는 것이다. 인간 섬유아세포는 비통합 에피소말 벡터를 사용하여 iPSC로 리프로그램되었다.
도 1(b)는 다능성 마커, OCT4, NANOG, TRA-1-60, TRA-1-81, SSEA-3 및 SSEA-4에 대해 CRL2097에서 유래된 hiPSC # 1 및 IMR90에서 유래된 hiPSC # 2의 대표적인 형태 및 면역형광분석을 나타낸 것이다. 모든 hiPSC 콜로니는 알칼라인포스파타제 (alkaline phosphatase; ALP)를 발현함을 확인하였다. 스케일 바는 100 μm이다.
도 1(c)는 hiPSC 계통의 STR 프로파일을 나타내는 것이다.
도 1(d)는 hiPSC 계통의 에피솜 벡터의 복사 수를 나타내고, 계대 수는 괄호 안에 표시하였다. 섬유아세포를 전기천공 후 5일째 양성 대조군으로 분석하였다.
도 1(e)는 hiPSC 계통의 in vitro 분화 결과이다. 내배엽 표지자 FOXA2와 SOX17, 중배엽 표지자 DESMIN과 α-smooth muscle actin (α-SMA), 외배엽 표지자 TUJ1과 NESTIN의 면역 형광 분석결과이다. 핵은 DAPI (파란색)로 염색하였다. 스케일 바는 100 μm이다.
도 1(f)는 기형종 형성을 통한 in vivo 분화를 나타내는 것이다. 헤마톡실린과 에오신 염색에 의한 hiPSC에서 유래된 기형 종의 조직학적 분석을 나타낸 것이다.
도 1(g)는 hiPSC 계통의 핵형 분석을 나타낸 것이다.
도 2는 hPSC를 미성숙 장관 오가노이드로 효율적으로 직접적 분화시킴을 확인한 도이다.
도 2(a)는 최종 내배엽 (DE), 후장 (HG) 및 hIO로의 hPSC의 성공적인 분화의 대표적인 이미지이다. 스케일 바는 200 μm이다.
도 2(b)는 DE 마커 (FOXA2, SOX17) 및 HG 마커 (CDX2, KLF5, SOX3)의 면역형광염색 결과이다. 스케일 바는 200 μm이다.
도 2(c)는 미분화 hPSC (H9 hESC, CRL2097에서 유래된 hiPSC #1 및 IMR90에서 유래된 hiPSC #2을 포함하는 3 개의 독립적인 hPSC 계통), 분화된 hIO (p0, p2) 및 인간 소장에서의 장 마커의 qPCR 분석결과이다.
도 3은 면역세포와의 공배양을 통해 hPSC 유래 hIO의 in vitro 성숙을 확인한 도이다.
도 3(a)은 위 특이적 마커(SOX9, CDX2 및 KLF5), 흡수세포 마커 (VIL1), 배 세포 마커 (MUC2), 파네스 세포 마커 (LYZ), 장 내분비세포 마커 (CHGA) 및 상피 마커 (Ecad)에 대한 대표적인 형태학 및 면역형광염색, 결과이다. 스케일 바는 200 μm이다.
도 3(b)은 미분화된 hPSC, 최종 내배엽 세포, 후장세포 및 미성숙 hIO (p0, p2), 공배양을 통해 성숙 유도된 hIO, 및 성체 인간 소장(hSI) 중 차별적으로 발현된 유전자(2배 변화)의 주성분을 분석 (PCA)한 것이다.
도 3(c)은 분화의 순서대로 줄기세포주, 내배엽세포, 후장, hIO p0, hIO p2, Jurkat T와 공배양된 hIO p2, 그리고 인간 소장 조직(hSI)을 마이크로어레이를 통해 유전자 발현 수준에서 비교한 데이터를 히트맵으로 표현한 것이다. Jurkat T 세포와 공배양 시 인간 소장 조직의 유전자 발현과 더욱 유사함을 확인하였다.
도 3(d)는 공배양된 hIO의 유전자 발현 프로파일의 변화를 나타낸 것이다. 방어 반응, 소화 기능 및 장 마커에 관여하는 것으로 알려진 유전자의 히트맵으로 공배양된 hIO는 성체 인간의 소장 (hSI)과 유사하다.
도 3(e)는 hIO (p2, p8, p10) 및 hSI에서의 장 마커 및 성숙 마커의 qPCR 분석 결과이다.
도 3(f)는 Jurkat T 세포와의 공배양 또는 Jurkat T 세포-조건화 배지 (CM)로 처리한 후 hIO의 대표적인 형태학적 변화를 나타낸 것이다. 스케일 바는 1 mm 이다. 2계대 배양 후 hIO의 크기; n = 9 (대조군), n = 11 (공배양), n = 9 (CM) 그룹 당 hIO (** t-test에 따라 p <0.01, * p <0.05).
도 4는 자극의 유무에 의한 Jurkat T 세포의 사이토카인의 발현을 나타낸 것이다.
도 4(a)는 마이크로어레이 기반 히트맵 분석을 통해서 자극의 유무, 배양액의 종류, 마트리겔의 유무에 따라 Jurkat T 세포의 사이토카인 (IL-2, IL-8, TNFα, IL-22, IL-6, IL-1β, IL-11, EGF, OSM, 그리고 IL-10)의 발현을 비교한 것이다.
도 4(b)는 자극의 유무, 배양액종류, 마트리겔 유무에 따른 Jurkat T 세포의 배양 상등액에서의 사이토카인(IL-2, IL-8, TNFα, IL-22, IL-6, IL-1β, IL-11, EGF, OSM, 그리고 IL-10) 농도는 ELISA를 이용하여 분석하였다.
도 5는 hIO와 인간 T 림프구의 공배양 시스템의 개략도이다. 마트리겔 삽입된 hIO를 PMA / Ionophore 자극된 Jurkat T 세포가 있는 트랜스웰 접시에 적용시켰다.
도 6은 IL-2는 공배양 시스템의 핵심 구성 요소를 나타내는 도이다.
도 6(a)는 ELISA에 이용하여 자극의 유무에 따른 Jurkat T 세포의 배양 상등액에서의 IL-2, IL-8, TNFα, IL-22, IL-6, IL-1β, IL-11, EGF, OSM, 그리고 IL-10의 농도를 그래프로 나타낸 것이다.
도 6(b)는 공배양 또는 IL-2 처리된 hIO에서 RT-PCR로 분석한 IL-2 수용체 유전자의 발현을 나타낸 것이다.
도 6(c)는 공배양 또는 IL-2 처리하여 배양한 hIO에서 웨스턴 블롯을 통해 단백질 수준에서의 IL-2 수용체 발현을 나타낸 것이다.
도 6(d)는 대조군 및 공배양된 hIO에서 인간 포스포카이네이스 어레이 키트를 사용하여 IL-2 매개신호와 관련된 여러 단백질의 인산화 상태를 나타낸 것이다.
도 6(e)는 공배양된 hIO에서 차별적으로 인산화된 단백질의 풍부한 경로와 거짓발견률(False discovery rate; FDR)<0.001(왼쪽 패널), 공배양된 hIO에서 차별적으로 인산화된 단백질의 기능적 상호작용 (Functional interaction, FI) 네트워크 (오른쪽 패널)를 나타낸 것이다. FI 네트워크 연결은 활성화/촉매 작용을 위한 화살표, 억제를 위해 수직선으로 끝나는 실선, 복합체 또는 입력에서 추출된 FI의 실선 및 예상 FI의 파선으로 나타내었다. IL-2 매개 신호전달이 상위에 랭크됨을 확인하였다.
도 7은 hIO에 IL-2를 처리 시 공배양과 같이 hIO의 성숙유도를 나타낸 것이다.
도 7(a)는 PMA/ionophore 자극된 Jurkat T 조건화 배지(CM) 또는 IL-2를 처리와 함께 IL-2 수용체β 안티바디 (Anti-IL-2Rβ)와 IL-2 수용체γc 안티바디 (Anti-IL-2Rγc)를 처리하였을 때 hIO의 면적과 싹 구조(budding structure)의 형태학적 변화를 수치화하여 나타낸 것이다.
도 7(b)는 대조군과 IL-2 처리된 hIO (왼쪽 패널)에서 인간 포스포카이네이스 어레이 키트를 사용한 IL-2 처리에 의한 다중 단백질의 인산화 상태를 나타낸 것이다. 또한, IL-2 처리된 hIO에서 차별적으로 인산화된 단백질의 기능적 상호작용 (FI) 네트워크 (오른쪽 패널)를 나타낸 것이다. 이를 통해, mTOR 신호전달 경로와 STAT3 신호전달 경로는 FI 네트워크에서 상당히 풍부해짐을 확인하였다.
도 7(c)는 대조군과 공배양 또는 IL-2 처리 시 IL-2 매개 신호와 관련된 여러 단백질의 인산화 상태를 웨스턴 블롯을 통해 나타낸 것이다.
도 7(d)는 거짓발견률 (FDR)이 0.05 미만인 IL-2 처리된 hIO에서 인산화된 단백질의 강화된 경로를 나타내는 것이다.
도 7(e)는 대조군 및 IL-2 처리와 동시에 STAT3 신호 억제제 (S3I-201, Stattic)과 mTOR 억제제(Rapamycin)을 처리 시 hIO의 크기와 싹 구조의 변화를 나타낸 것이다. n = 14 그룹 당 hIO (** t- 테스트에 따라 p <0.01 및 * p <0.05).
도 8은 hIO에 면역세포와의 공배양 (a, b) 또는 IL-2 처리 (c, d) 후 활성화 된 단백질을 검출하기 위한 인간 포스포카이네이스 어레이 결과이다.
도 8(a), 도 8(c)는 인간 포스포카이네이스 어레이 결과이다. 각 항체는 2 중으로 평가하였다.
도 8(b), 도 8(d) 컨트롤 hIO에 대한 농도값의 배수 변화를 보여주는 그래프이다.
도 9는 IL-2의 다양한 농도로 처리한 후의 인간 장관 오가노이드의 변화를 확인한 결과이다. 다양한 농도의 rhIL-2 (1, 4 및 8 ng/ml)로 처리한 후 hIO의 대표적인 형태 (왼쪽 패널)와, hIO의 크기 (p2에서 6, 9, 12 일, 그룹당 n = 10 hIO (오른쪽 패널))를 나타내는 것이다 (** t- 테스트에 따라 p <0.01 및 * p <0.05).
도 10은 공배양 시스템과 IL-2가 장의 성숙 마커의 높은 발현 수준을 촉진하여 hIO의 in vitro 내 성숙에 영향을 미침을 확인한 도이다.
도 10(a)는 마이크로어레이 데이터로부터 유전자 발현을 조절하는 공배양 또는 IL-2 효과의 정량적 제시를 나타낸 것이다. 색은 공배양 (n=2) 또는 IL-2 처리 (n=3) (2 배 차단)에 의해 영향을 받는 유전자를 나타낸다. 구체적으로, 유전자 발현 변화의 대부분은 성숙 인체 장관 대조군(hSI) 발현과 유사한 패턴(빨간색)으로 이동됨을 나타내는 것이고, 일부분은 hSI 발현 수준과 반대 방향(파란색)으로 발현 변화를 보임을 나타내는 것이다. 흰색은 대조군과 공배양 또는 IL-2 처리된 hIO가 비슷한 수준으로 발현된 유전자를 나타낸다. 공배양 및 IL-2 처리에 의해 대부분 hSI와 유사한 발현 패턴으로 변화함을 보여준다.
도 10(b)는 Cytoscape 플러그인의 ClueGO에 의해 hSI 특이적 3,905 유전자의 선택된 용어를 기능적으로 그룹화된 주석 네트워크에서 시각화하였다. 노드(원)의 크기는 용어의 통계적 중요성을 반영한다. 가장자리는 용어간의 연결정도를 나타낸다. 각 색상은 GO 용어 그룹을 나타낸다. 미리 정의된, 그룹 선도 용어는 그룹의 가장 중요한 용어이다. 회색 영역은 공배양 및 IL-2 처리 후 유의하게 hSI와 비슷한 패턴으로 발현이 변화하는 유전자를 나타낸다.
도 10(c)는 공배양 및 IL-2 처리에 의해 조절되는 유전자 네트워크의 확대 버전이다. 괄호 안의 숫자는 IL-2 처리 및 공배양 후 hSI와 유사한 발현 양상을 보이는 유전자의 수를 나타낸다.
도 10(d)는 도 10(c)의 보라색 원으로 표시된 선택된 11 GO 용어는 연관된 유전자의 수를 막대 그래프로 표시하였다.
도 10(e)는 공배양 및 IL-2 처리된 hIO와 hSI의 유전자발현 프로파일의 변화를 나타낸다. 장 마커, 소화 기능 및 방어 반응에 관여하는 것으로 알려진 유전자의 히트맵을 나타낸 것이다.
도 11은 공배양 또는 IL-2 처리시 hIO에서 성숙한 소장 마커의 발현을 증가시킴을 확인한 도이다.
도 11(a)는 대조군, 공배양, IL-2 처리된 hIO, 니코틴아미드의 유무에 따른 인간 성체 조직 유래 장관 오가노이드 (hAT-IO) 및 hSI의 장내 성숙 관련 유전자의 qRT-PCR 분석을 나타낸 것이다. 발현 수준의 배수변화는 대조군 hIO와 관련이 있음을 확인하였다.
도 11(b)는 증식 마커 (Ki-67), 상피 마커 (ECAD) 및 성숙 장 마커 (DEFA5, OLFM4, MUC13 및 KRT20)와 장 효소 마커 (sucrase-isomaltase, SI)와 기능적 수송체 (다제 내성 단백질 1, MDR1, 펩타이드 수송체 1, PEPT1)를 대조군, 공배양 및 IL-2 처리된 hIO의 면역 형광 염색을 나타낸 것이다. 스케일 바는 100 μm이다.
도 11(d)는 미성숙 hIO (n = 4), 공배양(n = 3) 또는 IL-2 처리한 (n = 3) hIO, 태아의 소장조직 (n = 6), 및 성인의 소장 조직 (n = 6)을 MDS plot으로 표현한 것이다. 성인 소장 조직과 성숙 hIO가 비슷한 위치에 plotting 되는 것을 확인하였다.
도 11(e)는 계통도는 canberra distance와 mcquitty linkage method를 활용하여 계층적 군집 데이터를 기반으로 그려졌다. 샘플간의 유사도를 나타내며, 잔가지의 길이가 길수록 샘플간의 유사도가 낮음을 의미한다. 공배양 또는 IL-2처리한 hIO 샘플들이 성인 소장조직 (hSI #1~#2)과 원 위의 성인 소장조직 (his Dist. #1~#4)와 유사함을 의미한다.
도 11(f)는 샘플간의 히트맵은 스피어만 상관관계를 토대로 그려졌으며, 샘플간 유사도가 높을수록 적색에 가까우며 청색에 가까울수록 유사도가 낮음을 의미한다. 성숙화 과정을 거친 hIO 샘플들이 성인 소장조직샘플과 유사도가 높음을 확인하였다.
도 12은 In vitro에서 성숙된 hIO가 장 효소와 수송체의 발현과 기능을 크게 향상시킴을 확인한 도이다.
도 12(a)는 약물 대사 효소 (Ⅰ기/Ⅱ기 효소)와 장 수송체 (ABC수송체 및 SLC 수송체)의 유전자 발현의 비교를 나타낸 것이다. 그래프는 대조군 hIO와 비교하여 2배 이상 변화된 상향 조절 유전자의 수를 나타낸 것이다.
도 12(b)는 대조군, 공배양, IL-2 처리된 hIO, hAT-10, 및 hSI에서 발견되는 장 효소 및 수송체를 암호화하는 대표적인 유전자의 계층적 클러스터링을 나타낸 것이다.
도 12(c)는 4kDa의 FITC-덱스트란(왼쪽 패널) 및 40 kDa FITC-덱스트란(오른쪽 패널)으로 배양한 hIO의 세포간 투과성을 나타낸 것이다.
도 12(d)는 P-gp (MDR1, ABCB1)의 상대적인 발현을 나타내는 것으로, 발현 수준의 변화는 컨트롤 hIO에 비해 hSI와 비슷한 패턴으로 증가하였다.
도 12(e)는 hIO에서 베라파밀(verapamil)의 부재 또는 존재시 파클리탁셀(paclitaxel) 농도(그룹 당 n = 20)를 나타낸 것이다(*** t <test에 따라 p <0.001).
도 12(f)는 대조군 및 공배양 또는 IL-2 처리한 hIO에서 Fluo4AM 칼슘 형광표지자를 이용해 포도당 자극에 의한 세포 내 칼슘이온 방출을 실시간으로 나타낸 것과 (위 패널) 포도당 자극 후 형광세기의 최고점의 평균값을 나타낸 것이다 (그룹 당 ROI = 15, *** t<test에 따라 p<0.001).
도 12(g)는 CFTR(Cystic fibrosis transmembrane conductance regulator) 기능을 확인하기 위해 폴스콜린 자극과 함께 CFTR 억제제 (CFTRinh172, GlyH101) 따른 120분간의 대조군 및 공배양과 IL-2 처리 hIO에서 폴스콜린 유도 팽창 (Forskolin induced swelling, FIS) 시 형태학적 관찰 (위 패널)과 hIO의 크기를 수치화 한 그래프 (아래 패널) 이다 (그룹 당 n=4).
도 12(h)는 대조군 및 공배양이나 IL-2처리 hIO에서 배상세포(goblet cell)의 기능을 확인하기 위해 뮤신 (mucin)을 PAS/Mucicarmine 염색을 통해 나타낸 것이다.
도 12(i)는 장 내분비세포(entero-endocrine cell)가 생산하는 호르몬 중 하나인 gastric inhibitory polypeptide (GIP)의 유전자 발현 양상을 조건 별 hIO에서 나타낸 것이다.
도 12(j)는 ELISA를 통해 GIP 호르몬의 조건 별 hIO 배양 상등액으로의 방출을 나타낸 것이다.
도 13은 hIO의 in vitro에서의 성숙이 in vivo에서 숙주 혈관에 연결된 신생 혈관 증진을 촉진함을 확인한 도이다.
도 13(a)는 IVIS 이미징 시스템을 사용하여 이식 한 지 1주일 후, DiR-표지 hIO를 갖는 신장의 생체 외 형광 이미지를 나타낸 것이다(왼쪽 패널). 또한, DiR-표지 hIO (n = 3)의 평균 밝기로 표현된 형광 강도를 그래프로 나타낸 것이다(오른쪽 패널) (* t- 테스트에 따라 p <0.05 및 * p <0.01).
도 13(b)는 면역 결핍 (NSG) 마우스의 신장주머니 내로 이식 한 지 1주일 후 hIO의 H & E 염색의 결과를 나타낸 것이다.
도 13(c)는 장의 성숙 마커 (DEFA5, OLFM4, MUC13 및 KRT20)는 여전히 이식 후 공배양 및 IL-2 처리된 hIO에서 주로 발현됨을 확인한 것이다.
도 13(d)는 이식 후 공배양 및 IL-2 처리된 hIO에서 장 효소 (sucrase-isomaltase, SIM)와 기능적 수송체 (다제 내성 단백질 1, MDR1, 펩타이드 수송체 1, PEPT1)가 발견됨을 확인한 것이다.
도 13(e)는 hCD31을 가진 혈관 내피 세포 및 α-SMA를 가진 적층된 평활근 (상부 패널)을 함유한 인간 혈관에 대한 이식된 hIO의 면역 형광 염색 결과를 나타낸 것이다. α-SMA와 hCD31에 대한 공동-염색은 이러한 내피 세포가 hIO의 인접한 간충조직으로부터 유래될 수 있음을 나타낸다.
또한, VEGF의 면역형광염색 이미지(중간 패널) 및 이식 후 1주 이내에 숙주 혈관계 (마우스 특이적 mMECA-32-양성)에 연결된 공배양 및 IL-2 처리된 hIO (hCD31-양성)으로부터 유래된 혈관의 면역형광염색 이미지 (하단 패널, 백색 화살촉)를 나타낸 것이다. 세포핵 (청색)는 DAPI로 염색하였다. 모두 인간 단백질만을 선택적으로 확인할 수 있는 항체를 사용하였다. 스케일 바는 100 μm이다. 세 가지 독립적인 실험에서 유사한 결과가 얻어졌으며, 대표적인 데이터가 표시되었다.
도 14는 in vitro 성숙된 hIO의 이식결과를 나타내는 도이다.
도 14(a)는 면역 결핍 NSG 마우스의 신장 주머니에서 DiR-표지 hIO의 이식 1일 후 in vivo 형광 이미지 결과이다. DiR-표지 hIO 주사 마우스 (n = 3)의 평균 광도를 나타낸다.
도 14(b)는 장 세포 (VIL), 배상 세포 (MUC2), 장 내분비 세포 (CHGA) 및 파네스 세포(LYSO)를 포함한 이식된 hIO에는 네가지 장내 계통이 모두 존재함을 나타낸다. E-카드헤린(ECAD)은 장 상피 염색에 사용되었다. 스케일 바는 50 μm이다.
도 15는 in vitro에서 성숙된 hIO에서 유래한 혈관을 마우스 혈관계와 연결 시킨 결과이다.
도 15(a)는 in vivo 이식 전에 hIO에서 인간 특유의 내피 세포 CD31 (인간 혈관 내피 세포에 대한 hCD31)의 면역형광염색 결과를 나타낸 도이다. 스케일 바는 100 μm이다. In vitro 에서 성숙된 hIO 자체에서는 혈관 내피 세포로의 분화는 확인되지 않았다.
도 15(b)는 병합된 이미지의 노란색 라인을 따르는 형광세기의 hCD31 및 mMECA-32 프로파일을 나타낸 것이다.
도 16은 in vitro 성숙된 hIO의 핵형 분석을 나타내는 도이다.
도 17은 STAT3 활성제인 콜리베린(colivelin)에 의한 hIO의 in vitro 성숙 결과이다.
도 17(a)는 다양한 농도의 콜리베린을 사용하였을 때의 hIO의 형태학적 변화와 표면적의 크기를 수치화하여 비교한 것이다. 스케일 바는 500 ㎛이다.
도 17(b)는 장관 성숙 마커 유전자의 발현 증가를 qPCR로 확인한 결과이다. 대조군 hIO에 비해 발현이 전반적으로 증가하였다.
도 17(c)는 증식 마커 (Ki-67), 상피 마커 (ECAD) 및 성숙 장 마커 (OLFM4, MUC13 및 KRT20)와 함께 대조군, 콜리베린 처리된 hIO의 면역 형광 염색을 나타낸 것이다. 스케일 바는 50 ㎛이다.
상기 목적을 달성하기 위한 본 발명의 하나의 양태는 미성숙(immature) 장관 오가노이드(intestinal organoid)를 T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지에서 배양하는 단계를 포함하는, in vitro에서 성숙된(mature) 장관 오가노이드의 제조 방법을 제공한다.
본 발명의 용어, "오가노이드(organoid)"는 3D 입체구조를 가지는 세포덩어리를 의미하며, 동물 등에서 수집, 취득하지 않은 인공적인 배양 과정을 통하여 제조한 축소되고 단순화된 버전의 기관을 의미한다. 이를 구성하는 세포의 유래는 제한되지 않는다. 오가노이드는 조직, 배아줄기세포 또는 유도만능줄기세포에서 파생될 수 있으며, 자가재생 및 분화능력으로 인해 3차원으로 배양될 수 있다. 상기 오가노이드는 세포의 성장 과정에서 주변 환경과 상호 작용하도록 허용되는 환경을 가질 수 있다. 이에 따라 본 발명에서 3D 오가노이드는 실제로 in vivo에서 상호 작용을 하고 있는 장기를 거의 완벽히 모사하여, 질병의 치료제 개발 및 등을 관찰할 수 있는 훌륭한 모델이 될 수 있다.
본 발명에서 용어 "장관 오가노이드(human intestinal organoids; hIO)"는 창자샘세포와, 융모-유사 구조, 및 4가지 주요 특수세포(흡수성 장세포, 파네스세포, 장내 내분비세포 및 배세포)를 포함하고, 소장 상피 세포의 다양성과 구조를 재현하는 오가노이드를 의미한다. 또한 hIO는 인간 성체 소장(human adult small intestine; hSI)의 점막하층에서 일반적으로 발견되는 평활근, 근섬유아세포 및 섬유아세포로 분화할 수 있는 원시 간충조직(primitive mesenchyme)을 포함하며, hIO는 점액분비 및 아미노산 흡수 같은 hSI의 기본적인 생리기능을 수행할 수 있다.
본 발명에서 용어 "미성숙 장관 오가노이드(immature hIO)"는 장관 오가노이드의 특징인 소장 상피 세포의 다양성과 구조를 재현하고, 점막하층에서 일반적으로 발견되는 평활근, 근섬유아세포 및 섬유아세포로 분화할 수 있는 원시 간충조직을 포함하면서, 점액분비 및 아미노산 흡수 같은 hSI의 기본적인 생리기능을 수행할 수 있으나, 성숙한 장관 오가노이드(mature hIO)의 특징인 소화기능, 수송시스템, 면역기능 및 숙주방어에 필요한 다양한 유전자 및 성숙 장관 줄기세포 마커가 발현되지 않는 장관 오가노이드를 의미한다.
또한, 미성숙 장관 오가노이드는 성숙한 소장(성체 소장)으로 아직 성숙하지 않은 것으로, 태아의 소장과 유사한 상태를 의미하며, 본 발명에서 '미성숙'은 '태아의 소장과 유사한 상태'와 혼용되어 사용될 수 있다. 또한, 상기 미성숙 장관 오가노이드는 성숙한 장관 오가노이드의 특성을 갖지 않는 한 이에 제한되지 않고, 기존의 공지된 방법에 따라 인간 다능성 줄기세포로부터 분화된 장관 오가노이드를 포함한다.
구체적인 일 실시 양태로서, 상기 미성숙 장관 오가노이드는 줄기세포 또는 줄기세포에서 분화된 후장(hindgut) 스페로이드를 장관 오가노이드 배지에서 배양하여 미성숙 장관 오가노이드를 제조하는 단계를 추가적으로 포함하는, in vitro에서 성숙된 장관 오가노이드의 제조 방법을 제공한다.
본 발명에서 용어, "장관 오가노이드 배지"는 줄기세포를 장관 오가노이드로 배양시키는 배지를 의미한다. 장관 오가노이드로 배양시킬 수 있는 물질이면 상업적으로 구매가능하거나 제조한 것이든 제한 없이 포함된다.
일 예로, 줄기세포를 완전한 내배엽(definitive endoderm)으로 유도하기 위해, RPMI 1640 배지에서 배양하고, 다시 후장 스페로이드로 분화시키기 위해, FGF4(R&D Systems) 및 WNT3A(R&D Systems)를 FBS가 포함된 RPMI 1640 배지에서 배양한 뒤, 이후, 스페로이드는 1X B27(Invitrogen), R-Spondin 1(R&D Systems), EGF (R&D Systems) 및 Noggin(R&D Systems)이 포함된 DMEM/F12 배지에서 배양된 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어 "STAT3 및 mTOR 신호전달 경로 활성화제"는 STAT3 및 mTOR 신호전달 경로를 활성화시키는 물질을 의미한다. 본 발명의 목적상 상기 STAT3 및 mTOR 신호전달 경로 활성화제는 미성숙(immature) 장관 오가노이드(intestinal organoid)의 STAT3 및 mTOR 신호전달 경로를 활성화시켜, 미성숙(immature) 장관 오가노이드를 성숙시키는 물질인 한 제한되지 않는다. 구체적으로는 콜리베린(colivelin)일 수 있으나, 이에 제한되지 않는다.
구체적인 일 실시 양태로서, 상기 STAT3 및 mTOR 신호전달 경로 활성화제는 STAT3, AKT 및 P70 S6 키나제로 이루어진 군에서 선택된 하나 이상의 인산화 활성화제인, in vitro에서 성숙된 장관 오가노이드의 제조 방법을 제공한다.
본 발명의 구체적인 일 실시예에서는 T 림프구와 함께 공배양한 hIO 및 IL-2를 처리한 hIO에서 활성화된 STAT3 또는 mTOR 신호전달 저해제를 사용하면 IL-2에 의한 in vitro 성숙이 되지 않음을 확인(도 7d)하였고, 특히 IL-2에 의한 hIO의 in vitro 성숙 과정과 유사하게 STAT3 신호전달 과정을 활성화 시킬 수 있는 콜리베린(colivelin)을 처리하게 되면 in vitro에서 성숙한 hIO를 제작할 수 있음을 확인하였다 (도 17a 내지 도 17c).
기존의 미성숙 장관 오가노이드 제조방법은 T-림프구, 사이토카인 또는 STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지를 사용하지 않고, 일반적으로 공지된 방법에 의하여 분화 및/또는 배양하는 것을 포함하고, 본 발명의 목적상 성숙된 장관 오가노이드의 제조 방법은 T-림프구, 사이토카인 또는 STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지를 사용하여 배양함으로써 미성숙 장관 오가노이드를 in vitro에서 성체 장관의 특징을 가지는 성숙 장관 오가노이드를 제작할 수 있다.
또한, 구체적인 일 실시 양태로서, 상기 제조 방법은 줄기세포로부터 미성숙 장관 오가노이드를 분화시키는 단계를 추가적으로 포함하는, in vitro에서 성숙된 장관 오가노이드의 제조 방법을 제공한다.
본 발명에서 상기 줄기세포는 배아줄기세포 또는 유도만능줄기세포(iPSC)일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "유도만능줄기세포 (induced pluripotent stem cell, iPSC)"는 분화된 세포로부터 인위적인 리프로그래밍(reprogramming) 과정을 통해 전분화능(pluripotency)을 가지도록 유도된 세포를 의미한다.
본 발명의 구체적인 일 실시예에서는 공지된 방법을 이용하여 섬유아세포로부터 유도만능줄기세포(iPSCs)를 제조한 뒤, hIO 분화 프로토콜을 사용하여 hPSC로부터 미성숙된 장관 오가노이드(hIO)를 생성하였고(실시예 1), 구체적으로 장내 전자 인자 관련 마커의 발현을 확인함으로써 섬유아세포로부터 미성숙 장관 오가노이드를 잘 분화시킴을 알 수 있었다.
본 발명의 용어, "리프로그래밍 (reprogramming)"은 분화능이 없는 세포 또는 일정부분 분화능이 있는 세포 등 서로 다른 양태로 존재하는 분화된 세포로부터 최종적으로 새로운 유형의 분화잠재력을 갖는 상태로 복원 또는 전환될 수 있는 프로세스를 의미한다. 또한, 본 발명에서 상기 리프로그래밍은 역분화 (dedifferentiation)와 동일한 의미로 사용될 수 있다. 이러한 세포의 리프로그래밍 기작은 핵 내의 후생유전학 (뉴클레오타이드 서열에서의 변화없이 기능에서의 유전적 변화를 일으키는 것과 관련된 DNA 상태)적 마크가 삭제된 후, 상이한 세트의 후생유전학적 마크를 수립하는 것을 의미하는데, 다세포 생물이 분화 및 성장하는 동안, 상이한 세포 및 조직은 상이한 유전자 발현 프로그램을 획득하게 된다.
상기 리프로그래밍은 분화된 세포부터 유도만능줄기세포를 만들 수 있는 한 제한이 없으며, 당업계의 공지 방법을 이용할 수 있다.
구체적으로, 본 발명에서 상기 인위적인 리프로그래밍 과정은 비삽입형 바이러스를 이용한 바이러스-매개 또는 비삽입형 비바이러스성 벡터 이용, 단백질 및 세포 추출물 등을 이용하는 비바이러스-매개 리프로그래밍 인자의 도입에 의해 수행되거나, 줄기세포 추출물, 화합물 등에 의한 리프로그래밍 과정을 포함할 수 있다. 유도만능줄기세포는 배아줄기세포와 거의 같은 특성을 가진다. 구체적으로는 동일한 세포 모양을 보여주며, 유전자 및 단백질 발현 패턴이 유사하고, 인 비트로 (in vitro) 및 인 비보 (in
vivo)에서 전분화능을 가지며, 테라토마 (teratoma)를 형성한다. 특히, 생쥐의 유도만능줄기세포는 생쥐의 배반포 (blastocyst)에 삽입시켰을 때, 키메라 (chimera) 생쥐를 형성할 수 있으며, 유전자의 생식선 전이 (germline transmission)가 가능하다. 본 발명의 유도만능줄기세포는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐 또는 토끼 등의 모든 유래일 수 있으며, 구체적으로 인간 유래일 수 있다.
본 발명에서 상기, "리프로그래밍 인자"란 최종적으로 분화된 세포가 새로운 유형의 분화되는 잠재력을 갖는 전분화능 줄기세포 (Pluripotent stem cell)로 리프로그래밍 되도록 유도하는 물질이다. 상기 리프로그래밍 인자는 최종적으로 분화된 세포의 리프로그래밍을 유도하는 물질이면 제한 없이 포함할 수 있으며, 분화시키려는 세포의 종류에 따라 선택할 수 있다. 구체적으로, 리프로그래밍 인자는 Oct4, Sox2, Klf4, c-Myc, Nanog, Lin-28 및 Rex1로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 상기 단백질을 코딩하는 핵산분자일 수 있으나, 이에 제한되지 않는다.
상기 용어 "분화된 세포"는 특별한 제한은 없으나, 구체적으로는 생식세포, 체세포(somatic cell) 또는 전구세포(progenitor cell) 등 이미 계열(lineage)이 특정된 세포일 수 있다. 그 예로 인간에게서 유래한 세포일 수 있으나, 다양한 개체에서 유래된 세포 역시 본 발명의 범위 내에 속한다.
또한, 본 발명의 분화된 세포에는 생체내 또는 생체외의 분화된 세포가 모두 포함될 수 있으며, 구체적으로, 생체에서 분리된 분화된 세포일 수 있다.
상기 "체세포"는 생식세포를 제외한 동·식물을 구성하는 분화가 완결된 모든 세포를 뜻하며, 상기 "전구세포"는 자손에 해당하는 세포가 특정 분화 형질을 발현하는 것으로 밝혀진 경우, 분화형질을 발현하지 않으나, 그 분화운명(fate)를 가지고 있는 부모세포를 말한다. 예를 들면, 신경세포(뉴런)에 대해서는 신경아세포(뉴런간세포)가 전구세포에 해당하고, 근관세포에 대해서는 근아세포가 전구세포에 해당한다. 본 발명의 목적상 본 발명의 장관 오가노이드를 제조하는 과정에서 이용하는 분화된 세포는 특히, 인간 유래 섬유아세포일 수 있으며, 구체적으로 인간 유래 섬유아세포는 CRL-2097 세포주 또는 IMR90 일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "분화"는 세포가 분열하여 증식하며 전체 개체가 성장하는 동안에 세포의 구조나 기능이 특수화되는 현상을 의미한다. 즉, 생물의 세포, 조직 등이 각각에게 주어지는 역할을 수행하기 위해 적합한 형태 및 기능으로 변하는 과정을 말하며, 예를 들어, 배아줄기세포와 같은 전분화능 줄기세포가 외배엽, 중배엽 및 내배엽 세포로 변하는 과정뿐 아니라 조혈모세포가 적혈구, 백혈구, 혈소판 등으로 변하는 과정, 즉 전구세포가 특정 분화형질을 발현하게 되는 것도 모두 분화에 포함될 수 있다.
본 발명에서 용어 "T-림프구(T lymphocyte)"는 세포 매개 면역에 중심 역할을 하는 림프구의 하나로서 T-세포(T-cell)라고도 불려진다. T 세포는 세포 표면의 T 세포 수용체의 존재에 의해 B 세포 및 자연 살해 세포와 같은 다른 림프구와 구별된다. 본 발명에서 T-림프구는 in vivo 장내 환경을 모방하기 위해 공배양에 사용되는 것을 의미하며, in vivo 장내 환경을 모방하기 위해 공배양에 사용될 수 있는 것이면, 제한 없이 포함될 수 있다. 또한, 본 발명의 T-림프구는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등의 모든 유래의 T-림프구를 포함하나, 구체적으로는 인간 유래의 T-림프구일 수 있으며, 더욱 구체적으로 Jurkat T 세포일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 구체적인 일 실시예에서는 in vivo 장내 환경을 모방하기 위해, hIO와 Jurkat T 세포를 공배양한 결과 (도 5), 미성숙 장관 오가노이드 크기를 현저하게 증가시킴을 확인하였으며(도 3f), 성숙된 장과 관련된 마커 발현을 통해 성숙한 장관 오가노이드와 유사함을 확인하였다(도 3b, 도 3c, 도 3d). 이를 통해, hPSC-유래 미성숙 장관 오가노이드(hIO)가 본 발명에서 사용된 Jurkat T 세포와 공배양시 성숙한 인간 성체 장관 대조군(human small intestine, hSI)과 유사해짐을 알 수 있다.
본 발명의 용어 "사이토카인(cytokine)"은 세포 신호 전달에서 중요한 역할을 하는 단백질을 의미한다. 사이토카인의 방출은 사이토카인 주위의 세포의 행동에 영향을 미친다. 구체적으로, 사이토카인은 면역조절제로서 자가분비 신호, 파라크린 신호 전달 (paracrine signaling) 및 내분비 신호 전달에 관여한다. 또한, 사이토카인은 대식세포, B 림프구, T 림프구 및 비만 세포와 같은 면역세포뿐만 아니라 내피 세포, 섬유 아세포 및 다양한 기질 세포를 포함하여 광범위한 세포에 의해 생성된다. 사이토카인은 체액성 면역 반응과 세포 기반 면역 반응 사이의 균형을 조절하고 특정 세포 집단의 성숙, 성장 및 반응을 조절하는 역할을 한다.
본 발명에서 사이토카인은 in vivo 장내 환경을 모방하기 위해 공배양에 사용되거나, T-림프구 공배양에서 분비되는 사이토카인만을 처리하여 in vivo 장내 환경을 더 유사하게 제조하는데 사용될 수 있다. 본 발명의 목적상 T-림프구에 의해 분비되는 주요 사이토카인은 IL-2(interleukin-2), IL-8(interleukin-8), TNFα(Tumor Necrosis Factor-α), IL-22(interleukin-22), IL-6(interleukin-6), IL-1β(interleukin-1β), IL-11(interleukin-11), EGF(epidermal growth factor), OSM(oncostatin M), 및 IL-10(interleukin-10)으로 이루어진 군에서 선택된 하나 이상일 수 있으며, 더욱 구체적으로는 IL-2일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 구체적인 일 실시예에서는 in vivo 장내 환경을 모방하기 위해, 미성숙 장관 오가노이드(hIO)에 IL-2 처리시 오가노이드 크기가 현저하게 증가됨을 확인하였으며 (도 7a, 도 9), 성숙된 장과 관련된 마커 발현을 통해 성숙한 장관 오가노이드와 유사함을 확인하였다(도 10e, 10f, 10g). 이를 통해, hPSC-유래 장관 오가노이드가 본 발명에서 사용된 IL-2 처리시 hSI와 유사해짐을 알 수 있다.
또한, 구체적인 일 실시예에서는 T 림프구와 함께 공배양한 장관 오가노이드의 포스포-키나제 어레이를 수행하여 STAT3, c-Jun, p38α 및 ERK1/2와 같은 IL-2-매개된 신호전달 관련 단백질이 인산화됨을 확인함으로써 (도 8a, 8b), IL-2-매개된 신호전달 경로가 공배양된 hIO에서 가장 강화된 경로 중 하나임을 알 수 있었다 (도 6c, 6e). 이는 사이토카인이 공배양 시스템에서 중요한 인자 중 하나이며, in vitro에서 장관 오가노이드의 성숙 효과를 나타내는 핵심 역할을 하는 인자임을 시사한다.
더욱이, in vitro 성숙을 위한 공배양의 효과에 있어서 IL-2가 hPSC로부터 분화한 인간 장관오가노이드(hIO)의 in vitro 성숙에 대한 핵심 요소임을 확인하고자, IL-2를 처리한 한 뒤, 포스포-키나제 어레이 분석에 의해 인산화 정도를 측정하였다 (도 8c, 8d). 그 결과, 대조군에 비하여 STAT3(Y705)가 3.3배나 증가함을 확인하였고, AKT 및 P70 S6 키나제와 같은 STAT3 및 mTOR 신호전달 성분의 상승된 인산화를 확인하였다(도 7b, 7d).
또한, 구체적인 일 실시예에서는 IL-2-매개 신호전달 경로가 hIO의 성장을 촉진시키는 역할 외에도 hIO의 in vitro에서의 성숙에 관련된 것인지를 확인하기 위하여, 유전자 발현 프로파일링을 수행한 결과, 인간 T 림프구와 함께 공배양하거나 IL-2 처리시 hIO의 유전자 발현 프로파일은 hSI의 것으로 이동함을 확인하였다(도 10a). 또한, 장의 성숙과 관련하여 다르게 발현된 유전자 (differentially expressed gene, DEG)의 생물학적 의미를 쉽게 이해하기 위해, 사이토스케이프(Cytoscape)에서 ClueGO-in plug를 사용하여 기능 강화 분석을 수행한 결과, 성숙한 hSI와 대조군 hIO사이에서 서로 다르게 발현된 DEG 중, 공배양 시스템 또는 IL-2 처리시(회색으로 강조)(도 10b), 세포-세포 접착, 방어 반응, 선천적 면역 반응, 면역 시스템 과정의 조절, 자극에 대한 반응의 양성 조절, 세포-표면 수용체 신호전달 경로, 화학적 자극에 대한 세포 반응, 신호 전달, 신호 전달, 세포 커뮤니케이션 및 사이토카인에 대한 반응을 포함하는, 핵심 생물학적 과정과 관련된 유전자들이 성숙한 hSI와 유사하게 유의미하게(p <0.05) 과발현됨을 확인하였다(교점은 적색으로 강조)(도 10c).
본 발명의 구체적인 일 실시예에서는 T 림프구와 함께 공배양한 hIO 및 IL-2를 처리한 hIO에서 활성화된 STAT3 또는 mTOR 신호전달 저해제를 사용하면 IL-2에 의한 in vitro 성숙이 되지 않음을 확인(도 7d)하였고, 특히 IL-2에 의한 hIO의 in vitro 성숙 과정과 유사하게 STAT3 신호전달 과정을 활성화 시킬 수 있는 콜리베린(colivelin)을 처리하게 되면 in vitro에서 성숙한 hIO를 제작할 수 있음을 확인하였다 (도 17a 내지 도 17c).
본 발명에서 용어 "성숙(maturation)된 장관 오가노이드 (mature hIO)"는 미성숙 장관 오가노이드와 반대되는 용어로, 성체의 소장이 갖추고 있는 소화기능, 수송시스템, 면역기능 및 숙주방어에 필요한 유전자가 발현된 장관 오가노이드를 의미한다. 구체적으로 성숙한 소장은 소장 줄기세포 마커 유전자, 소화기능, 수송시스템, 광범위한 면역기능 및 숙주방어에 필요한 유전자의 발현증진을 포함한 독특한 특징을 가지고 있다. 특히, 생리학적 및 약동학적 역할에 관여하는 수송체의 적절한 발현 및 활성은 약물의 흡수, 분배 및 배설과 같은 정상적인 소장 기능의 전제 조건이다. 따라서 적절한 in vitro 장관 모델은 생리기능을 재현하고 그 구조를 모방하여 인간 장 관련 질환을 모델링하기 위한 강력하고 대안적인 도구이며 전임상 약물 발견을 위한 스크리닝 플랫폼 역할을 한다. 또한, 본 발명에서 '성숙'은 '성체의 소장과 유사한 상태' 또는 'hSI'와 혼용되어 사용될 수 있다.
본 발명의 구체적인 일 실시예에서는 T 림프구와 함께 공배양한 hIO 및 IL-2를 처리한 hIO는 CDX2, OLFM4(소장 줄기세포 마커 유전자), DPP4, LCT (소화기능 관련 유전자), SLC5A1 (수송시스템 관련 유전자), LYZ, DEFA5, DEFA6, (면역기능 및 숙주방어 기능 관련 유전자) 및 기타 장관 성숙 관련 유전자 KRT20, MUC13, CREB3L3 등의 발현이 성숙한 인체의 소장 대조군 (hSI)와 유사한 패턴으로 발현이 증진됨을 확인(도 10a 내지 도 10g)함으로써 in vitro에서 성숙한 hIO를 제작할 수 있음을 확인하였다.
본 발명의 구체적인 일 실시예에서는 T 림프구와 함께 공배양한 hIO 및 IL-2를 처리한 hIO는 성숙한 성체 장관의 기능성과 대사 및 수송시스템 관련 유전자들의 발현 패턴이 성숙한 인체의 소장 대조군 (hSI)와 유사한 패턴으로 발현이 증진됨을 확인(도 11a, 11b)하였고, 특히 약물 흡수와 관계되는 P-gp (P-glycoprotein/MDR1/ABCB1)의 발현 증가와 함께, 파클리탁셀 (paclitaxel) assay 를 통해 활성의 증가도 확인(도 11c, 11d)함으로써 in vitro에서 성숙한 hIO를 제작할 수 있음을 확인하였다. 이는 본 발명을 통해 보다 인체와 유사한 환경에서 약물 흡수도 평가가 가능할 수 있음을 시사한다.
본 발명의 제조방법은 미성숙 장관 오가노이드를 1) T-림프구와 공배양하거나, 2) 사이토카인을 처리하거나, 3) STAT3 및 mTOR 신호전달 경로 활성화제를 처리하거나 4) 상기 1), 2) 및 3)을 동시 또는 순차적으로 수행할 수 있다.
본 발명에 의해 제조된 상기 성숙된 장관 오가노이드는 미성숙 장관 오가노이드와 비교하여 하기 (a) 내지 (f) 중 어느 하나 이상의 마커의 발현이 증가할 수 있다. (a) 장의 성숙 장관 줄기세포 마커인 CDX2, 및 OLFM4(Olfactomedin-4); (b) 소화 기능 관련 마커 DPP4(Dipeptidyl peptidase-4), 및 LCT(lactase); (c) 면역기능 및 숙주방어 기능 관련 마커 DEFA5(human-defensins 5), DEFA6(human-defensins 56), 및 LYZ(lysozyme); (d) 수송 시스템 관련 마커 SLC5A1(solute carrier family 5 member 1), P-glycoprotein 1 (p-gp, multidrug resistance protein 1 (MDR1), 및 ATP-binding cassette sub-family B member 1 (ABCB1)); (e) 성숙 장관의 분화 마커인 KRT20(Keratin 20), MUC13(Mucin 13) 및 CREB3L3(Cyclic AMP-responsive element-binding protein 3; 및 (f) STAT3 및 mTOR 신호전달 마커인 인산화된 STAT3(signal transducer and activator of transcription 3), 인산화된 AKT(protein kinase B (PKB)) 및 인산화된 P70S6 키나제(Ribosomal protein S6 kinase beta-1 (S6K1))일 수 있으나, 이에 제한되지는 않으며, 본 발명의 도 3c에 표기된 defense response, intestinal marker 및 digestive function과 관계된 모든 유전자, 도 11b에 표기된 장관 대사 효소 및 수송체 관련 유전자를 포함할 수 있다.
본 발명에서의 용어 "장의 성숙(maturation)"은 성체(adult)가 가지는 장의 유전체적 발현 및 기능적 특징의 획득을 의미한다. 구체적으로는 4종의 장관 세포가 형태학적으로 체내유사도가 높으며, 장의 성숙 장관 줄기세포 마커, 소화 기능 관련 마커, 면역기능 및 숙주방어 기능 관련 마커, 수송 시스템 및 대사 효소 관련 마커, 또는 성숙 장관의 분화 마커 유전자 및 단백질의 발현이 증가되며, 이에 따른 영양분 및 약물 흡수기능, 점액 분비, 호르몬 분비 등 실제 기능성을 모사할 수 있는 체내 실제 장관과의 유사도가 높은 장관 오가노이드의 성숙을 의미한다.
구체적인 일 실시예에서는 T 림프구와 함께 공배양한 hIO 및 IL-2를 처리한 hIO는 성숙한 성체 소장 상피세포에 존재하는 efflux 펌프 수송체인 P-gp 의 활성이 증가됨을 확인하였고, 소장 상피세포의 영양분흡수 기능으로써 Fluo4-AM 분석을 통해 포도당 감도를 확인하였다. 또한, CFTR(Cystic fibrosis transmembrane conductance regulator) 기능을 폴스콜린 유도 팽창을 통해 확인하였고, 성숙한 배상세포에서 발현하는 점액질과 성숙한 장 내분비세포에서 발현하는 GIP 호르몬을 확인함으로써 체내 장관 분화세포의 기능을 모두 hIO에서 재현됨을 확인하였다. 이는 in vitro에서 hIO가 성숙되었음을 알 수 있는 것이다.
또한, 장의 성숙(maturation)은 hIO에서 STAT3 및 mTOR 신호전달 마커인 STAT3(signal transducer and activator of transcription 3), AKT(protein kinase B (PKB)) 및 P70S6 키나제(Ribosomal protein S6 kinase beta-1 (S6K1))가 활성화 됨을 의미한다. 실시예를 통해 STAT3 및 mTOR 신호전달 저해제를 처리하면 hIO의 성숙이 저해되고, 반대로 STAT3의 또 다른 활성제를 처리하면 hIO의 성숙이 촉진됨을 확인하였다.
본 발명에서의 용어 "장의 분화(differentiation)"는 장 고유의 형태학적 특징인 음와(crypt)와 융모(villi) 구조를 가지며, 4가지 주요 특수세포(흡수성 장세포(enterocyte), 파네스세포(Paneth cell), 장내 내분비세포(enteroendocrine cell) 및 배세포(goblet cell))가 존재하는 것을 의미한다.
본 발명의 구체적인 일 실시예에서는 본 발명의 in vitro에서 성숙된 장관 오가노이드의 제조 방법을 통해 제조된 장관 오가노이드가 태아-유사 특성을 갖는 미성숙 장관 오가노이드가 아닌 성체-유사 특성을 갖는 장관 오가노이드의 특성을 갖는지 확인하기 위해, 마이크로 어레이 분석 및 qPCR을 수행한 결과, 장-특이적 마커(CDX2), 성숙한 장의 줄기세포 마커(OLFM4), 성숙한 장에서 생산되는 파네스 세포-특이적 구성요소인, 인간 α-디펜신(DEFA5 및 DEFA6) 및 리조자임(LYZ), 소화 기능 관련 효소 DPP4, LCT의 발현수준은 공배양 또는 IL-2 처리된 hIO에서 상향 조절되었다. 또한, KRT20, MUC13, SLC5A1 및 CREB3L3을 포함하는 성숙한 장의 분화 마커는 공배양 또는 IL-2 처리된 hIO에서 상향 조절됨을 확인하였다(도 11a). 또한, qPCR 데이터에서도 일관성 있게, DEFA5, OLFM4, MUC13, KRT20, SI, PEPT1, MDR1의 단백질 발현 수준은 대조군에서 검출되지 않았지만 공배양 또는 IL-2 처리된 hIO에서 존재함을 확인하였다(도 11b, 11c). 이를 통해, 공배양 시스템 또는 IL-2 처리시 태아-유사 특성을 갖는 hPSC-유래 hIO를 in vitro에서 성체 장관의 특성을 가진 hIO로의 성숙을 유도할 수 있음을 확인하였다.
본 발명의 in vitro에서 성숙된 장관 오가노이드를 제조하는 방법을 통하여 제조된 in vitro에서 성숙된 장관 오가노이드는 활성화된 STAT3 및 mTOR 신호전달 관련 특이적 마커를 발현하는 것일 수 있으며, 특히, STAT3, AKT 또는 P70 S6 키나제의 발현 및 이들의 인산화가 촉진되어 있다.
본 발명의 구체적인 일 실시예에서는 IL-2가 hIO의 in vitro 성숙에 대한 공배양의 효과에 있어서 잠재적인 핵심 요소임을 확인하고자, IL-2를 처리한 한 뒤, 포스포-키나제 어레이 분석에 의해 인산화 정도를 측정하였고(도 7b), 이를 웨스턴 블롯에 의해 검증하였다 (도 7c). 그 결과, 대조군에 비하여 STAT3(Y705)가 3.3배나 증가함을 확인하였고, AKT 및 P70S6 키나제와 같은 STAT3 및 mTOR 신호전달 성분의 상승된 인산화를 확인하였다.
본 발명에서 유도만능 줄기세포를 3D상태의 성숙장관 오가노이드(intestinal organoid, hIO)로 분화하고 배양함으로써 기존의 동물 모델의 한계인 인간의 생리학적 및 진화적 차이를 극복할 수 있고, 2D 세포 배양 시스템을 이용할 경우 발생하는 장세포의 형성 과정 및 복잡한 병리학적 과정을 밝히는데 활용될 수 있다. 또한, 기존의 미성숙 hIO와는 다르게 형태학적으로 더욱 인체 장관과 유사한 복잡성을 가지고 있으며, 성숙한 성체의 장관에서 발현되는 유전자 및 단백질의 발현을 qPCR 및 면역염색으로 확인하기 쉽고, 기능성의 획득을 확인할 수 있다. 따라서, in vitro에서의 성숙된 장관 오가노이드는(hIO) 모델은 인간의 생리기능을 재현하고 그 구조를 모방하여 장관의 발달과정을 태아상태에서부터 성체에 이르기까지 전 발달과정의 연구에 활용할 수 있으며, 장 질환 관련 모델로서 인체내 환경과 유사하고, 정교하게 재현할 수 있는 장점이 있다.
본 발명의 다른 하나의 양태는, 상기 제조방법에 의해 제조된 in vitro에서 성숙된 장관 오가노이드를 제공한다.
상기 '성숙된 장관 오가노이드'는 전술한 바와 같다.
본 발명에서 제조된 hIO는 건강한 대조군과 장 질환 환자의 iPSC로 만들 수 있기 때문에, in vitro 성숙된 hIO는 인간 장의 생리 및 병태생리를 환자별 방식으로 이해하기 위한 인체 장관 오가노이드일 수 있다. 일반적으로 hPSC에서 기능성 성숙세포를 생성하는 것은 기술적으로 어려워 궁극적으로 미성숙한 상태의 오가노이드가 생성된다. 미성숙한 장관 오가노이드의 이식 후 in vivo 성숙이 기능성 성숙 세포의 유도를 촉진하는 것으로 보이지만 증식 전구체 상태에서 이들 세포를 사용하면 실제 응용 및 임상 번역에 추가적인 위험을 초래할 수 있다. 따라서 성숙한 성체 세포의 생리 기능을 재현하기 위해서는 hPSC 유래 세포와 오가노이드를 in vitro에서 성숙시킨 모델이 필요하다.
본 발명에 따른 성숙된 장관 오가노이드는 인간의 장에 가까운 구성을 가지고 있어 전 세계적인 동물실험 대체 모델에 대한 요구에 있어서 장 관련질환 모델에 대안으로 사용될 수 있다.
본 발명의 다른 하나의 양태는, T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는, 미성숙 장관 오가노이드의 in vitro 성숙용 조성물을 제공한다.
본 발명의 다른 하나의 양태는, 미성숙 장관 오가노이드(intestinal organoid)를 -림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지에서 배양하는 단계를 포함하는, in vitro에서 미성숙 장관 오가노이드를 성숙시키는 방법을 제공한다.
상기 'T-림프구', '사이토카인', '오가노이드', '미성숙 장관 오가노이드' 및 '성숙된 장관 오가노이드'는 전술한 바와 같다.
본 발명의 다른 하나의 양태는, 상기 방법에 따라 성숙된 장관 오가노이드를 제조하는 단계를 포함하는, 인공 장관의 제조방법을 제공한다.
상기 '오가노이드' 및 '성숙된 장관 오가노이드'는 전술한 바와 같다.
본 발명의 용어, "인공 장관"은 개체로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 신체 장기를 대용하는 치료의 목적으로 사용되는 것으로서, 세포 또는 조직의 기능을 복원시키기 위하여 생체공학 기술을 토대로 만들어진 인위적인 장관으로서, 치료 목적으로 사용되는 것을 의미한다.
본 발명의 제조방법에 의하여 제조된 성숙한 장관 오가노이드는 상기에서 살펴본 바와 같이 in vitro에서도 성체-유사 특성을 갖는 성숙한 장관 오가노이드로 분화하여 기존의 장관 오가노이드 제조방법과 달리 동물을 이용하여 in vivo배양 단계를 거치지 않는다는 점에서 장점이 있고, 환자에 이식된 뒤에 주위의 세포와 적절한 링크를 형성(네트워크 형성)할 수 있다. 무엇보다도 환자 자신의 성체 세포를 활용하기 때문에 향후 조직치료제로써의 활용에서 장애가 되는 면역원성 등의 기술적 문제, 윤리적 문제가 없다는 장점이 있다.
본 발명의 구체적인 일 실시예에서는 인간 T 림프구와의 공배양 또는 IL-2 처리에 의한 in vitro-성숙된 hIO의 이식가능성을 평가하기 위해, hIO를 면역 결핍 NSG 마우스의 신장에 이식한 결과, 이식된 hIO에서 장세포, 장 내분비 세포, 배상 세포, 및 파네스 세포를 포함하는 모든 주요 장 세포 유형의 마커가 발현됨을 확인하였다(도 14b). 또한, 이식된 hIO의 신생 혈관 변화를 측정한 결과, 공배양되고 IL-2 처리된 hIO에서 혈관 내피 세포(CD31-양성 세포)가 더 많이 존재하고, 이러한 혈관 내피 세포는 주변의 적층 인간 간엽(α-smooth muscle actin, α-SMA)-양성 세포)으로부터 분화되었음을 확인하였다(도 13e, 위쪽 패널).
이는 in vitro-성숙된 hIO는 잠재적으로 in vivo에서는 인간 혈관세포로의 분화를 유도할 수 있고, 더 많은 혈관내피성장인자(VEGF)를 발현함으로써(13e, 중간 패널)도 이식 받은 host의 혈관과 연결되어 이식의 성공확률을 높일 수 있음을 시사하며, 또한 in vitro-성숙된 hIO는 보통의 핵형을 가지고 있어(도 16) 임상의 장 이식을 위한 잠재적 대안적 세포 공급이 될 것임을 시사한다.
본 발명의 다른 하나의 양태는, 상기 방법에 따라 제조된 in vitro에서 성숙된 장관 오가노이드를 포함하는 조직치료제를 제공한다.
본 발명의 다른 하나의 양태는, 상기 방법에 따라 제조된 성숙된 장관 오가노이드를 개체에 이식하는 단계를 포함하는, 장 관련 질환의 치료 방법을 제공한다.
상기 '오가노이드' 및 '성숙된 장관 오가노이드'는 전술한 바와 같다.
본 발명의 용어 "개체"란, 장 관련 질환이 발명하였거나 발병할 수 있는 인간과, 원숭이, 소, 말, 양, 돼지, 닭, 칠면조, 메추라기, 고양이, 개, 마우스, 쥐, 토끼 또는 기니아 피그를 포함한 모든 동물을 의미한다. 본 발명의 성숙된 장관 오가노이드를 개체에게 투여함으로써 장 관련 질환을 효과적으로 치료할 수 있다면 개체의 종류는 제한없이 포함된다.
본 발명에서 사용된 용어 "장 관련 질환"은 염증성 장질환(IBD), 크론병(Crohn's disease), 단장증후군(short bowel syndrome), 장염 (enterocolitis), 및 유전적 장질환인 히르슈슈프룽 병 (hirschsprung's disease) 등을 포함하나, 이에 제한되지 않는다.
본 발명에서의 용어, "치료"란 상기 성숙된 장관 오가노이드의 이식 및 in vitro 성숙에 사용된 사이토카인 또는 STAT3, mTOR 신호전달 경로 활성화제 및 이들의 조합의 직접 투여에 의해 장 관련 질환이 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명의 또 다른 하나의 양태는, in vitro에서 성숙된 장관 오가노이드를 포함하는, 장 관련 질환의 치료제 스크리닝용 키트를 제공한다. 본 발명의 스크리닝용 키트는 장 관련 질환 환자 특이적인 성숙된 장관 오가노이드를 포함하고 있어, 상기 질환 또는 유래 환자 맞춤형 치료제를 스크리닝하는 데에 유용하게 사용될 수 있다.
상기 "성숙된 장관 오가노이드", 및 "장 관련 질환"은 전술한 바와 같다.
본 발명의 또 다른 하나의 양태는, (a) 장 관련 질환 환자 유래의 성숙된 장관 오가노이드에 시험물질을 처리하는 단계; 및 (b) 정상인 유래 장관 오가노이드보다 장 관련 질환 환자 유래의 성숙된 장관 오가노이드에서 발현이 증가 또는 감소되는 mRNA 또는 단백질의 발현량을, 상기 (a) 단계의 시험물질을 처리한 환자 유래의 성숙된 장관 오가노이드와 시험물질을 처리하지 않은 정상인 유래 장관 오가노이드에서 비교하는 단계를 포함하는, 장 관련 질환 치료제의 스크리닝 방법을 제공한다.
상기 '성숙된 장관 오가노이드', 및 '장 관련 질환'은 전술한 바와 같다.
또한, 상기 스크리닝 방법은 정상인 유래 성숙된 장관 오가노이드 보다 장 관련 질환 환자 유래 성숙된 장관 오가노이드에서 발현이 증가되는 mRNA 또는 단백질의 발현을 감소시키거나 또는 상기 증가를 억제시키는 시험물질을 치료제로 선별하는 단계를 추가로 포함할 수 있다.
또한, 상기 스크리닝 방법은 정상인 유래 성숙된 장관 오가노이드 보다 장 관련 질환 환자 유래 성숙된 장관 오가노이드에서 발현이 감소되는 mRNA 또는 단백질의 발현을 증가시키거나 또는 상기 감소를 억제시키는 시험물질을 치료제로 선별하는 단계를 추가로 포함할 수 있다.
본 발명에서 용어, "시험물질"은 통상적인 선정방식에 따라 장 관련 질환의 치료의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 기타 추출물 또는 천연물, 또는 화합물 등이 될 수 있다.
이러한 스크리닝 방법에 의하여 얻어진 물질은 이후의 장 관련 질환의 치료제 개발 과정에서 선도 물질(leading compound)로 작용하게 되며, 선도 물질을 변형시키고 최적화함으로써, 새로운 자가면역질환의 예방 또는 치료제를 개발할 수 있다.
따라서, 본 발명의 스크리닝 방법은 장 관련 질환의 예방 또는 치료제의 탐색 및 개발에 유용하게 사용될 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실험예 1. 세포 배양 및 iPSC 제조
인간 섬유아세포(CRL-2097 및 IMR90) 및 인간 T림프구(Jurkat T 세포)는 ATCC(American Type Culture Collection)에서 구입하였다. H9 인간 배아 줄기 세포(hESC)주는 WI(WiCell Research Institute, Madison, USA)에서 구입하였다.
섬유아세포 및 hESC(human embryonic stem cells), hiPSC(human induced pluripotent stem cells)를 포함하는 hPSC(human pluripotent stem cells)는 공지된 방법(Molecular
carcinogenesis 55, 387-396 (2016), Proteomics 15, 2220-2229 (2015))으로 배양하였다. 비삽입형-hiPSC는 공지된 방법에 따라 Episomal iPSC 리프로그래밍 벡터(Cat. No. A14703. Invitrogen, Carlsbad, CA, USA)로 전기천공법(electroporation)으로 트랜스팩션시켜서 리프로그래밍 되었다.
전기천공 5일 후, 섬유아세포를 마트리겔(Matrigel)(BD Biosciences, San Diego, CA, USA)-코팅된 6-웰 플레이트에 1 x 105개/웰로 플레이팅하고, E8 배지(Stem Cell Technologies, Vancouver, Canada)로 배양하였다. 3주 후, hiPSC 콜로니를 선택하고, 계대배양 및 추후 특징 설정을 위해 세포수를 증대시켰다.
실험예
2. 미성숙 장관
오가노이드
제조를 위한
hPSCs의
장관
오가노이드로(hIO)의
분화
인간 장관 오가노이드(hIOs)를 공지된 방법(Nature 470, 105-109 (2011))을 이용하여 제조하였다. 완전한 내배엽을 유도하기 위해, hPSC를 0%, 0.2% 및 2%농도의 정제된 태아 소 혈청(dFBS, HyClone, Thermo Fisher Scientific Inc., Waltham, MA, USA)을 갖는 RPMI 1640 배지에서 3일 동안 100ng/ml Activin A(R&D Systems, Minneapolis, MN, USA)로 처리하였다. 또한, 3D 후장(hindgut) 스페로이드로 분화시키기 위해, 500ng/ml FGF4(R&D Systems) 및 500ng/ml WNT3A(R&D Systems)를 2% dFBS가 포함된 RPMI 1640 배지와 함께 4일 동안 처리하였다. 이후, 스페로이드는 마트리겔(BD Biosciences)에 삽입하고, 1X B27(Invitrogen), 500ng/ml R-Spondin 1(R&D Systems), 100ng/ml EGF (R&D Systems) 및 100ng/ml Noggin(R&D Systems)이 포함된 DMEM/F12 배지와 함께 hIO 배지에서 배양하고, 2주에 한번씩 계대 배양하였다.
실험예 3. 성숙된 장관 오가노이드(mature hIO)로 제조를 위한 hIO의 배양
인간 T 림프구와 공배양하기 위해, Jurkat T 세포는 50ng/ml 포르볼 미리스테이트 아세테이트(phorbol myristrate acetate; PMA, Sigma-Aldrich, St. Louis, MO, USA) 및 500ng/ml 칼슘 이오노포어(calcium ionophore) A23187(Sigma-Aldrich)로 3시간 동안 자극시켰다. 마트리겔 내에 삽입된 hIO 위에 트랜스웰 폴리에스테르 막 인서트(Transwell polyester membrane insert, 구멍 크기 0.4㎛, Corning, Corning, NY, USA)는 hIO 배지안에 자극된 Jurkat T 세포가 5X104/cm2으로 씨딩되어 있는 12-웰 플레이트에 넣었다.
hIO에 대한 인터루킨 2(Interukine-2, 이하, IL-2)의 효과를 평가하기 위해, 준비된 rhIL-2(R&D Systems)를 1ng/ml(대략 13U/ml) 농도로 매일 hIO 배지에 추가하였다. 또한, IL-2 신호전달을 억제하기 위해, hIO를 1㎍/ml의 항-IL-2Rα 단클론 항체(R&D Systems)로 처리하였고, IL-2 다운스트림 신호전달을 차단하기 위해, mTOR 억제제인 라파마이신(10nM, Sigma-Aldrich), STAT3 억제제인 S3I-201(10μM, Sigma-Aldrich) 또는 Stattic(1μM, Sigma-Aldrich)를 추가하였다. hIO 크기를 측정하기 위해, hIO 수평 단면의 표면적을 측정하였다
실험예 4. 정량적 실시간 RT-PCR(qRT-PCR)
전체 RNA는 RNeasy 키트 (Qiagen)를 이용해 세포로부터 추출하였고 Superscript III cDNA 합성 키트(Invitrogen)를 이용해 역전사 시켰다. qRT-PCR은 7500 Fast Real-time PCR 시스템 (Applied Biosystems, Foster City, CA, USA)에서 공지된 방법으로 수행하였다 (Cho et al., Oncotarget 6, 23837-23844, 2015). 모든 실험들은 3 번 반복했고, 각 타겟 유전자의 CT 값은 제조사가 제공한 소프트웨어를 이용해 계산하였다. 사용된 프라이머의 염기서열은 표 1과 같다.
| Gene | 프라이머 (Forward) | 서열번호 | 프라이머 (Reverse) | 서열번호 |
| GAPDH | GAAGGTGAAGGTCGGAGTC | 1 | GAAGATGGTGATGGGATTTC | 2 |
| CDX2 | CTGGAGCTGGAGAAGGAGTTTC | 3 | ATTTTAACCTGCCTCTCAGAGAGC | 4 |
| SOX9 | GGAGAGCGAGGAGGACAAGTTC | 5 | TTGAAGATGGCGTTGGGGG | 6 |
| LYZ | AAAACCCCAGGAGCAGTTAAT | 7 | CAACCCTCTTTGCACAAGCT | 8 |
| VIL1 | AGCCAGATCACTGCTGAGGT | 9 | TGGACAGGTGTTCCTCCTTC | 10 |
| CHGA | TGACCTCAACGATGCATTTC | 11 | CTGTCCTGGCTCTTCTGCTC | 12 |
| MUC2 | TGTAGGCATCGCTCTTCTCA | 13 | GACACCATCTACCTCACCCG | 14 |
| ISX | CAGGAAGGAAGGAAGAGCAA | 15 | TGGGTAGTGGGTAAAGTGGAA | 16 |
| LGR5 | TGCTCTTCACCAACTGCATC | 17 | CTCAGGCTCACCAGATCCTC | 18 |
| SI | GGTAAGGAGAAACCGGGAAG | 19 | GCACGTCGACCTATGGAAAT | 20 |
| VIM | AGAACGTGCAGGAGGCAGAAGAAT | 21 | TTCCATTTCACGCATCTGGCGTTC | 22 |
| OLFM4 | ACCTTTCCCGTGGACAGAGT | 23 | TGGACATATTCCCTCACTTTGGA | 24 |
| DEFA5 | CCTTTGCAGGAAATGGACTC | 25 | GGACTCACGGGTAGCACAAC | 26 |
| DEFA6 | GCCTAGACACTGATGACCCC | 27 | GCATGCTGTATTGCGCCTC | 28 |
| KRT20 | TGGCCTACACAAGCATCTGG | 29 | TAACTGGCTGCTGTAACGGG | 30 |
| SLC5A1 | GTGCAGTCAGCACAAAGTGG | 31 | ATGCACATCCGGAATGGGTT | 32 |
| MUC13 | CGGATGACTGCCTCAATGGT | 33 | AAAGACGCTCCCTTCTGCTC | 34 |
| CREB3L3 | ATCTCCTGTTTGACCGGCAG | 35 | GTCGTCAGAGTCGGGGTTTG | 36 |
| IL-2Rα | TCTTCCCATCCCACATCCTC | 37 | TCTGCGGAAACCTCTCTTGC | 38 |
| IL- 2Rβ | GGCTTTTGGCTTCATCATCT | 39 | CTTGTCCCTCTCCAGCACTT | 40 |
| IL-2Rγc | ACGGGAACCCAGGAGACAGG | 41 | AGCGGCTCCGAACACGAAAC | 42 |
| P-GP | GCCAAAGCCAAAATATCAGC | 43 | TTCCAATGTGTTCGGCATTA | 44 |
실험예 5. 세포 및 면역형광검사
면역형광검사는 공지된 방법에 따라 수행하였다 (Kwak et al., Biochemical and biophysical research communications 457, 554-560, 2015). 구체적으로, hPSC 및 최종 내배엽 세포를 4% 파라포름알데하이드(PFA)로 고정시키고, 0.1% 트리톤 X-100을 함유하는 PBS로 투과시켰다.
hIO 및 조직을 고정시키고, 수크로오스로 동결 보호한 뒤, 최적 절단 온도(OCT) 화합물(Sakura Finetek, Tokyo, Japan)을 이용하여 동결시켰다. 이 후, -20℃에서 크라이스탯 마이크로톰을 사용하여 냉동 절편을 10-20㎛로 절단하고, 면역형광검사를 위해 0.1% 트리톤 X-100을 함유하는 PBS로 투과시켰다.
구체적으로, 4% BSA로 블로킹 후 세포를 4℃에서 하룻밤 동안 1차 항체와 반응시켰다. 이후, 상온에서 1시간 동안 2차 항체와 반응시켰다. 사용된 일차 항체는 표 2와 같다. 파라핀 절편을 탈 파라핀화한 뒤, 항원 검색을 실시하고, OCT 절편과 유사한 방식으로 염색을 하였다. DAPI는 핵을 시각화하기 위해 추가하였다. 슬라이드는 Axiovert 200M 현미경 (Carl Zeiss, Gottingen, Germany) 또는 형광 현미경(IX51, Olympus, Japan)을 통해 관찰하였다.
| 항체 | Catalog No. | 회사 | 희석 | |
| Pluripotency markers | ||||
| anti-OCT4 | sc-9081 | Santa Cruz | 1:100 for IF | |
| anti-NANOG | AF1997 | R&D systems | 1:40 for IF | |
| anti-SSEA-3 | MAB1434 | Millipore | 1:30 for IF | |
| anti-SSEA-4 | MAB1435 | Millipore | 1:30 for IF | |
| anti-TRA-1-60 | MAB4360 | Millipore | 1:100 for IF | |
| anti-TRA-1-81 | MAB4381 | Millipore | 1:100 for IF | |
| In vitro differentiation markers | ||||
| anti-TUJ1 | PRB-435P | Covance | 1:500 for IF | |
| anti-NESTIN | MAB5326 | Millipore | 1:100 for IF | |
| anti-FOXA2 | 07-633 | Millipore | 1:100 for IF | |
| anti-SOX17 | MAB1924 | R&D systems | 1:50 for IF | |
| anti-DESMIN | AB907 | Chemicon | 1:50 for IF | |
| Intestinal organoid differentiation markers | ||||
| anti-CDX2 | ab15258 | abcam | 1:100 for IF | |
| anti-KLF5 | ab137676 | abcam | 1:100 for IF | |
| anti-SOX9 | sc-7314 | Santa Cruz | 1:50 for IF | |
| anti-Villin | sc-7672 | Santa Cruz | 1:50 for IF | |
| anti-Mucin2 | sc-7314 | Santa Cruz | 1:50 for IF | |
| anti-Chromogranin A | MA5-14536 | Thermo Scientific | 1:200 for IF | |
| anti-Lysozyme | ab76784 | abcam | 1:200 for IF | |
| anti-E-Cadherin | 610182 | BD Biosciences | 1:200 for IF | |
| anti-E-Cadherin | AF648 | R&D systems | 1:500 for IF | |
| anti-α-SMA | A5228 | Sigma | 1:500 for IF | |
| Intestine maturation markers | ||||
| anti-alpha 5 Defensin | ab90802 | abcam | 1:50 for IF | |
| anti-OLFM4 | ab85046 | abcam | 1:100 for IF | |
| anti-MUC13 | ab124654 | abcam | 1:100 for IF | |
| anti-Cytokeratin 20 | ab76126 | abcam | 1:400 for IF | |
| anti-Ki67 | AB9296 | Chemicon | 1:100 for IF | |
| Intestinal transporter markers | ||||
| anti-SI (Sucrase-isomaltase) | HPA011897 | Sigma | 1:100 for IF | |
| anti-PEPT1 | sc-20653 | Santa Cruz | 1:100 for IF | |
| anti-MDR-1 | MAB4120 | Chemicon | 1:100 for IF | |
| Vasculature markers | ||||
| anti-hCD31 | MA5-15336 | Thermo Scientific | 1:400 for IF | |
| anti-PECAM-1 | sc-8306 | Santa Cruz | 1:50 for IF | |
| anti-MECA-32 | NB100-77668 | Novus Biologicals | 1:400 for IF | |
| anti-VEGF | sc-152 | Santa Cruz | 1:50 for IF | |
| STAT3 signaling markers | ||||
| anti-STAT3 | #9132 | Cell Signaling | 1:2000 for WB | |
| anti-phospho-STAT3(Tyr707) | #9131S | Cell Signaling | 1:2000 for WB | |
| anti-AKT | #9272S | Cell Signaling | 1:1000 for WB | |
| anti-phospho-AKT(Ser473) | #9271S | Cell Signaling | 1:1000 for WB | |
| anti-P70-S6-kinase | #2708 | Cell Signaling | 1:1000 for WB | |
| anti-phospho-P70-S6-kinase(Thr389) | #9205 | Cell Signaling | 1:1000 for WB | |
| anti-β-Actin | sc-81178 | Santa Cruz | 1:2000 for WB | |
| IL-2 receptor antibody | ||||
| anti-IL-2 receptor α | ab61777 | abcam | 1:2000 for WB | |
| anti-IL-2 receptor β | ab197934 | abcam | 1:2000 for WB | |
| anti-IL-2 receptor γ | ab180698 | abcam | 1:2000 for WB | |
| IL-2 receptor blocker | ||||
| anti-IL-2 receptor β | AF-224-NA | R&D systems | 3ug/ml for cell treatment | |
| anti-IL-2 receptor γ | MAB2842 | R&D systems | 100ng/ml for cell treatment | |
*IF: Immunofluorescence*WB: Western blotting
실험예 6 . 인간 포스포-키나제 ( Human phospho-kinase) 어레이
제조사의 지침 및 공지된 방법(Human molecular genetics 23, 1802-1816 (2014))에 따라 단백질체 프로파일러 인간 포스포-키나제 어레이 키트(Proteome Profiler Human Phospho-Kinase Array Kit, ARY003, R&D Systems)를 이용하여 단백질 인산화를 정량화하였다. 단백질 추출물은 인간 T 림프구와 공배양하고 1ng/ml rhIL-2가 처리된 hIO로부터 준비되었다. 아무 처리되지 않은 hIO가 대조군으로 사용되었다. 포스포-키나제 어레이 멤브레인을 블로킹 후, 4℃에서 하룻밤 동안 hIO로부터의 전체 단백질 200㎍과 함께 인큐베이션시키고, 실온에서 2시간 동안 비오틴이 부착된 검출 항체의 혼합제로 인큐베이션시켰다. 신호는 ECL Plus 웨스턴 블랏 검출 시스템(Western Blotting Detection System, GE Healthcare, Buckinghamshire, UK)에 의해 검출되었다. 인산화된 키나제의 수준은 Image Gauge 소프트웨어(Fuji Photo Film GMBH)를 사용하여 농도계로 정량화하였다.
실험예 7. 웨스턴 블롯(Western blotting)
단백질 존재비는 공지된 방법에 따라 웨스턴 블랏을 이용하여 평가되었다. 구체적으로, 세포는 RIPA 완충제로 융해시키고, 잔여물은 4℃에서 원심분리에 의해 제거되었다. 이 후, 전체 단백질의 20㎍을 4-15% 구배 겔(Ready Gel, Bio-Rad Laboratories, Hercules, CA)을 이용하여 전기영동하고, PVDF 막으로 옮겼다.
실험예 8. 사이토카인 분비(cytokine secretion)의 측정
자극되거나 자극되지 않은 Jurkat T 세포를 2일 동안 배양시켰다. 각 배양 배지를 수집한 뒤, 인간 TNFα, IL-8, IL-1β 및 IL-2 수준은 효소-면역 분석법(ELISA, all from R&D Systems)을 사용하여 측정하였다. ELISA는 제조사의 지침 및 공지된 방법에 의해 수행되었고, Spectra Max M3 마이크로플레이트 리더(Spectra Max M3 microplate reader, Molecular Devices, Sunnyvale, CA, USA)로 정량화되었다.
실험예 9. 마이크로어레이(Microarray) 분석
마이크로어레이 실험은 제조사의 지침에 따라 Low RNA input linear amplification kit, cRNA cleanup module 및 one-color(Cy3) Whole Human Genome Microarray 4X44K (Agilent Technology, Santa Clara, CA)를 이용해 공지된 방법에 의해 수행하였다. 유전자 발현 데이터는 GeneSpring 소프트웨어 (Agilent)를 이용하여 처리되었다. 데이터는 전체적인 수준의 표준화과정(global scale normalization)을 통해 표준화 시켰다. 별도로 발현된 유전자는 2 배 이상의 변화에 기초하여 선택하였다.
실험예 10. RNA 시퀀싱 및 RNA 정량
RNA 염기순서 결정과 정량을 위해 우선 RNA 샘플은 Agilent 2100 Bioanalyzer system (Agilent Biotechnologies, Palo Alto, USA)을 통해 RNA Integrity Number (RIN) 값이 7.5 이상으로 준비되었으며, mRNA 라이브러리는 Illumina TruSeq 키트를 통해 준비되었고, Illumina HiSeq2500 machines (Illumina, San Diego, CA, USA)을 통해 시퀀싱을 수행하였다. FastQC package를 통해 시퀀싱 퀄러티를 결정하고, 트림된 길이(trimmed read length)가 50염기 이하는 제외하였다. 그 후 HISAT2 (v2.0.5)를 통해 맵핑을 수행하였고, 인간 유전체 정보는 hg19를 활용하였다. Cuffquant와 Cuffnorm (Cufflinks v2.2.1)를 통해 샘플간 차별적으로 발현된 유전자 (DEG: differentially expressed gene)를 분석하였다.
실험예 11. 생물정보학적 분석
마이크로어레이 데이터 분석은 실험예 9에서 전술한 바와 같이 수행하였다. 계층적 클러스터링 및 히트 맵은 MeV v 4.9.0 소프트웨어를 이용해 만들었다. 유전자 기능은 GeneCard 데이터베이스 (http://www.genecards.org)를 사용하여 주석을 달았다. 다른 생물정보학적 분석은 IPA 분석 소프트웨어(Ingenuity systems, Redwood City, CA, USA), PANTHER(Protein ANalysis THrough Evolutionary Relationships, http://www.pantherdb.org) 데이터베이스 및 DAVID 생물정보학 리소스 6.7 (http://david.abcc.ncifcrf.gov)를 사용하여 진행하였다. 또한, 기능적 상호 작용 네트워크의 분석 및 시각화를 위해 다르게 인산화된 단백질이 사용되었다. 네트워크의 핵심 경로는 리엑톰(Reactome FI software, Version 5.0.0 beta, http://apps.cytoscape.org/apps/reactomefis)을 사용하여 추가로 분석하였다. 기능적으로 그룹화된 유전자 온톨로지(GO)/경로는 ClueGO plug-in (Version 2.2.5, http://apps.cytoscape.org/apps/cluego)와 함께 사이토스케이프 소프트웨어 플랫폼(Cytoscape software platform, version 3.3.0, http://www.cytoscape.org/what_is_cytoscape.html)을 사용하여 분석하였다.
실험예 12. P-당단백(P-gp, P-glycoprotein)/MDR1 수송 어세이
P-당단백 수송 활성을 밝히기 위해, 3 반복으로 적어도 그룹 당 20개의 hIO가 사용되었다. hIO는 4-웰 플레이트에 플레이팅 한 후, 25mM HEPES를 포함하는 Hank's balanced 염용액(Hank's balanced salt solution, 칼슘 및 마그네슘을 포함하는 HBSS, pH = 7.4, Invitrogen)으로 3번 세척하고, 37℃에서 30분 동안 인큐베이션시켰다. DMSO에서 P-gp 기질 파클리탁셀(paclitaxel, 10μM, Sigma-Aldrich)에 hIO 배양물을 추가한 뒤, PBS(50μM, Sigma-Aldrich)에 P-gp 억제제인 베라파밀의 존재 또는 부재 하에서, 쉐이커(50rmp, 2시간)를 이용하여 인큐베이션 시켰다. 인큐베이션 후에, hIO는 HBSS로 3번 세척한뒤, 초음파 세포 분쇄기를 이용하여 파쇄하였다. 이 후, 균질액은 10분 동안 4℃에서 13,000 X g로 원심분리 하여 상층액을 모았다. Turbo VTM Ion Spray source 및 an Agilent 1200 series HPLC system(Agilent Technologies)가 장착된 3200 QTRAP LC-MS/MS 시스템(Applied Biosystems)을 사용하여 LC-ESI/MS/MS 분석에 의해, 각 샘플의 파클리탁셀(paclitaxel)의 농도를 정량화하였다.
실험예 13. Fluo4-AM 칼슘 표지자를 활용한 포도당매개 칼슘 이미징
성숙 소장 상피세포의 포도당 수송체(Glucose transporter)의 기능을 밝히기 위해, 포도당-매개 세포기질 내 칼슘 분비 유도기법 사용하였다. 대조군 또는 성숙된 hIO를 hIO 배지에 Fluo4-AM (5μM, Molecular Probes)를 첨가한 뒤 37℃에서 1시간 동안 인큐베이션시켰다. hIO는 칼슘(ca2
+)이 없는 완충액 (140 mM NaCl, 5 mM KCl, 10 mM HEPES, 5.5 mM D-Glucose, 2 mM MgCl2)로 5회 세척한 뒤 칼슘(ca2
+)이 없는 완충액을 채운 후, 컨포칼 현미경 (FV1000 Live, Olympus)을 이용하여 실시간 이미징 (real time imaging)을 수행하였다. 50mM 포도당으로 세포 기질 내 칼슘 방출을 유도하여 이에 따른 형광신호를 실시간 기록하였다. 15개의 관심영역(region of interest, ROI)을 설정한 후 그래프를 도출하였다.
실험예 14. 폴스콜린(forskolin)을 이용한 CFTR 기능성 분석
성숙한 장관 상피세포에 존재하는 CFTR의 기능을 오가노이드모델에서 확인하기 위해 폴스콜린-매개 오가노이드 팽창실험을 수행하였다. 현미경 (IX83, Olympus)의 실시간 이미징 기능을 통해 대조군과 공배양 또는 IL-2를 처리한 hIO (n=4)에 폴스콜린(25uM, Merckmillopore)처리 이후 20분 간격 총 120분간 형태학적 관찰을 진행하였으며, CFTR 억제제 (CFTRinh172, GlyH101)를 동시에 처리하여 동일한 시간 동안 형태학적 관찰을 수행하였다. 매 시간의 오가노이드의 크기를 계산하여 평균값을 이용해 그래프를 도출하였다.
실험예 15. 파스(PAS)/뮤시칼민(Mucicarmine) 염색 실험
성숙한 배상세포에서 방출하는 뮤신 점액질을 염색하는 기법을 이용하여 성숙 장관오가노이에서 성숙한 기능성 배상세포를 확인하였다. 먼저 대조군 및 성숙 장관 오가노이드는 4% 파라포름알데히드 (para-formaldehyde)로 고정된 후 10%, 20%, 30% 수크로오스 용액으로 추가 고정시켰다. 이후 OCT를 이용하여 동결하였고, 크라이스탯 마이크로톰을 이용하여 10um두께로 냉동절편하고 슬라이드 글라스에 접착시킨 후 염색을 진행하였다.
실험예 16. 호르몬 분비 확인 실험
성숙한 장 내분비세포의 기능성을 확인하기 위해 장 내분비세포가 발현하는 가스트린 억제 폴리펩티드 (Gastric inhibitory polypeptide, GIP)호르몬의 분비를 확인하였다. 먼저 15개의 조건 별 오가노이드를 배양접시에 위치시키고 PBS를 이용하여 5회 세척한 후 hIO 배양액을 첨가해준 후 48시간 동안 37℃ 인큐베이션 하였다. 이후 배양상등액을 수득하여 Total GIP ELISA kit (Merckmillopore)를 이용하여 배양액상에 존재하는 GIP의 양을 확인한 후 실험에 사용한 hIO 전량의 gDNA를 DNeasy kit(Qiagen)을 이용하여 추출하였고, DNA 대비 GIP 호르몬의 양을 산출하여 도식화하였다.
실험예 17. 이식(Transplantation)
이식을 위한 모든 실험에는 8주 내지 12주령 NOD-SCID IL-2Rγnull (NSG) 마우스를 사용하였다(Jackson Laboratories, Bar Harbor, ME, USA). 모든 마우스는 12:12시간 낮:밤 일정 하에 일정한 온도(20-22℃)의 표준 동물 유지 시설에 보관하였다. 모든 실험은 KRIBB(Approval No: KRIBB-AEC-16206)의 기관 동물관리 및 사용 위원회(Institutional Animal Care and Use Committee, IACUC)로부터 승인을 받은 후에 수행하였다.
hIO의 신장 캡슐 이종 이식은 공지된 방법(Nat
Med 20, 1310-1314 (2014))을 이용하여 수행하였다. 구체적으로, 마우스는 2% 이소플루란(Butler Schein, Dublin, OH, USA)으로 마취시켰고, 마우스의 좌측면은 표준 방식으로 이소프로필 알콜 및 포비돈-요오드를 사용하여 준비하였다. 신장을 노출시키기 위해 좌측 골반을 절개하였다. 그런 다음 콜라겐 플러그의 hIO를 신장의 피하 공간으로 이식하였다. 이 후, 신장을 복강 내로 옮긴 뒤 마우스에 엔로플락신(Enrofloxacin, 5mg/kg; Daehan New Pharm Co.)이 포함된 IP 플러쉬(IP flush)를 투여하였다. 피부를 이중층으로 봉합하고 마취로부터 완전히 회복될 때까지 마우스를 가열 패드로 따뜻하게 유지시켰다. 이식한 지 일주일 후, 마우스를 인도적으로 안락사시키고 이종이식편을 분석용으로 분리하였다.
실험예 18. in vivo 형광이미징(
In vivo
fluorescence imaging)
hIO의 이식을 확인하기 위해, hIO는 4-웰 플레이트에서 37℃, 15분 동안 1,1-디옥타데실-3,3,3,3-테트라메틸도트리카복시아닌 요오드(1,1-dioctadecyl-3,3,3,3-tetramethylindotricarbocyanine iodide, DiR, Invitrogen)와 함께 인큐베이션시켰다. PBS로 세척한 후, hIO를 새로운 배지로 배양한 다음, 신장 캡슐 하에 이식하였다. in vivo 형광 이미징을 위해, 이식한지 하루 후에, 이식 받은 마우스(n=3)를 2% 흡입된 이소플루란(TerrellTM, Piramal Healthcare, Bethlehem, PA, USA)으로 마취시키고, 전하-결합 소자 카메라가 연결된 가볍게 밀봉된 방에 놓았다.
또한, 이식된 hIO의 정확한 사이즈를 확인하기 위해, 이식한 일주일 후 이식받은 마우스의 신장을 분리하여 전하-결합 소자 카메라가 연결된 가볍게 밀봉된 방에 놓았다. 780nm에서의 방출 및 750nm에서의 자극을 갖는 in vivo 이미징 시스템(IVIS Lumina II, Xenogen Corp., Alameda, CA, USA)을 사용하여 각 관심 영역의 형광 강도를 측정하였다.
실험예 19. 통계 분석(Statistical analysis)
모든 결과는 평균에 대한 평균 ± 표준 오차(s.e.m)로 표현되며, 모든 실험은 최소 3회 반복되었다. P값은 양측 t-검정을 사용하여 결정하였다. 통계적 유의성에 대한 모든 분석은 달리 명시하지 않는 한 대조군과 비교하여 계산하였다.
실험예 20. 에피소말 카피 넘버(episomal copy-number) 측정
1 X Taq 완충제(Takara, Kyoto, Japan) 및 프로티나아제 K(proteinase K) 를 55℃에서 3 시간동안 사용하여 준비한 hiPSC 분해물은 전술한 바와 같이 qPCR 분석에 사용하였다. pCXLE-hFb Х 15-cont2 플라스미드의 알려진 농도는 표준 곡선을 그리는데 사용하였다. 각 hiPSC에서의 EBNA1 및 FBXO15의 카피넘버는 6회 반복하여 수득한 역치 사이클(Ct) 값으로부터 계산하였다.
실험예 21. STR (Short tandem repeat)분석 및 핵형(karyotype)분석
STR 분석은 섬유아세포 및 상응하는 iPSC 라인으로부터 분리된 게놈 DNA을 사용하여, Humanpass, Inc. (서울, 한국)에 의뢰하여 수행하였다. 또한, G-밴딩 핵형 분석은 GenDix, Inc. (서울, 한국)에 의뢰하여 수행하였다. 데이터는 평균값 ± SD (n=3)로 표시하였다 (***p < 0.001 (Unpaired student's t-test).
실험예 22. 배양체(EB)의 형성을 통한
In vitro
분화
삼배엽으로의 자연스러운 분화를 위해, hiPSC는 1mg/ml 콜라게나아제(collagenase) IV 처리에 의해 분리시켰고, 10%의 녹아웃 세럼 대체제, 1%의 비필수 아미노산들, 0.1mM의 β-머캅토에탄올 및 1mM의 L-글루타민이 보충된, 녹아웃 DMEM EB 배지가 있는 페트리접시 위에 플레이팅 하였다. 현탁 배양 5일 후, 배양체(embryoid bodies, EB)는 마트리겔으로 코팅된 LabTek 챔버 슬라이드(Nunc International, Naperville, II, USA)로 옮기고, 10일간 추가로 배양시켰다.
실험예 23. 기형종(
teratoma
) 형성을 통한
In vivo
분화
총 1 X 106개의 세포를 마트리겔과 혼합하여 BALB/c 누드 마우스(Orient Bio, Inc., Seongnam, Korea)의 배측-외측 영역에 피하 주사하였다. 8 내지 10주 후에, 기형종을 해부하고, 4% PFA에 고정시키고 파라핀에 삽입하였다. 파라핀에 삽입된 기형종을 절편화한 다음, 헤마톡실린과 에오신 용액(Sigma-Aldrich)으로 염색하였다. 동물 실험은 KRIBB(Approval No: KRIBB-AEC-16206)의 기관 동물관리 및 사용 위원회(Institutional Animal Care and Use Committee, IACUC)로부터 승인을 받은 후에 수행하였다.
실시예
1.
hPSC
-유래
hIO에서의
장내 유전자 발현의 미성숙한 패턴을 극복하기 위한 인간 T 림프구와의 공배양
전술한 바와 같이, hIO 분화 프로토콜을 사용하여, 하나의 hESC 라인 및 두 개의 완전히 특성 분석이 완료된, 비삽입형-hiPSC 라인(도 1a)을 포함하는 hPSC로부터 hIO를 제조하였다.
hPSC는 특유의 형태학적 및 단계-특이적 마커의 발현에 의해 완전한 내배엽, 후장 및 장내 조직을 모방한 hIO로 효율적으로 분화됨을 확인하였다(도 2a, b 및 도 3a). 또한, 인간 소장(his; human small intestine)마커인 장내 전사 인자(SOX9(SRY (sex determining region Y)-box9), CDX2(Caudal Type Homeobox 2) 및 KLF5(Kruppel like factor 5)) 및 소장 세포 유형-특이적 마커(VIL (흡수세포를 위한 Villin 1), MUC2 (배상 세포용 mcin 2), LYZ (파네스 세포용 lysozyme) 및 CHGA (장 내분비 세포용 chromogranin A))가 계대 배양 횟수가 증가할수록 그에 따른 발현도 증가됨을 확인하였다(도 2c).
각 단계에서의 마이크로어레이 결과의 주성분 분석(principal component analysis; PCA)에서 계대 2(p2)의 hIO의 전체 유전자 발현 프로필이 계대 0(p0)의 hIO와 비교하였을 때, hSI 대조군과 더 비슷한 것으로 나타났다(도 3b). 이를 통해, 기존에 공지된 바와 같이 hIO가 일련의 계대 후에, 장 세포 유형-특이적 유전자의 발현 및 모양이 더 분화된 표현형을 가짐을 확인하였다.
그러나, hPSC-유래 hIO(p0, p2)는 파네스(Paneth) 세포 기능, 소화 기능 및 장 줄기 세포(ISC) 마커(예: OLFM4)에 의한 숙주 방어와 같은, 장 성숙과 관련된 수많은 유전자의 발현은 여전히 감소되어 있음을 확인하였다(도 3d).
이를 통해, 성숙된 장관 오가노이드에서 공지된 바와 같이 파네스(Paneth) 세포 기능 (예: DEFA5, DEFA6), 소화 기능(예: DPP4, LCT) 및 장 줄기 세포(ISC) 마커(예: OLFM4)에 의한 숙주 방어와 같은, 장 성숙과 관련된 수많은 유전자의 발현은 감소함을 확인함으로써 hPSC-유래 hIO가 태아 소장과 매우 유사하다는 사실을 알 수 있었다.
또한, hIO는 모든 IEC(intestinal epithelial cells) 유형을 포함하는 특정 구조를 유지하면서 10개 이상의 계대(150일)동안 안정적으로 확장 할 수 있음을 확인하였다(도 3a). 그러나, 계대 2의 hIO와 여러번-계대된 hIO(p8, p10)사이에서 소장 세포 유형-특이적 마커(VIL1, LYZ, CHGA, 및 MUC2)의 mRNA 수준은 더 이상의 증가하지 않음을 확인하였다(도 3e). 특히, 성숙한 파네스 세포에 의해 생성된 α-defensin, OLFM4, DEFA5, DPP4 및 LCT와 같은 장 성숙 마커의 mRNA 수준은 분화가 진행됨에 따라 매우 낮게 유지됨을 확인하였다(도 3e).
IEC(intestinal epithelial cell)는 가용성 인자를 분비함으로써 장 점막에 존재하는 면역 세포와 상호 작용하여 항상성을 유지하고 장 상피의 성숙을 촉진한다. in vivo 장내 환경을 모방하기 위해, 각 세포에서 분비된 가용성 인자를 통해 hIO와 면역 세포가 분비하는 물질 간의 혼선을 가능하게 하는 공배양 시스템을 사용하였다(도 5). 구체적으로, hIO를 매트리젤에 embedding하여 트랜스웰 삽입물에 위치시키고 PMA/이오노포어로 자극한 인간 T 림프구의 공급원인 Jurkat T 세포는 12-웰 플레이트에 놓았다. Jurkat T 세포와의 공배양은 hIO의 크기를 현저하게 증가시킴을 확인하였다(도 3f).
유사하게, Jurkat T 세포를 갖는 조건화 배지(CM)에서의 인큐베이션은 hIO의 크기를 증가시켰고(도 3f), 이는 hIO가 Jurkat T 세포와의 직접적인 접촉없이도 분비된 측분비인자에 의해 영향을 받음을 시사한다. 또한, PCA는 공배양된 hIO의 전체적인 전사가 hSI와 매우 유사하다는 것을 확인하였다(도 3b).
이를 통해, 방어 반응, 장 마커 및 소화 기능의 발달과 같은 장의 성숙과 관련된 유전자에 기초한 샘플의 계층적 클러스터링은 공배양된 hIO가 성숙한 hSI와 매우 유사하다는 것을 알 수 있었다(도 3d). 이러한 결과는 hPSC-유래 hIO가 본 발명에서 사용된 실험 조건에서 배양시킬 때 성숙된 장관 오가노이드로 분화됨을 시사한다.
실시예
2. 인간 T 림프구와 함께
공배양하는
동안 방출되는 주요 기여 인자의 분석
공배양 시스템에서 주요 분비 인자를 결정하기 위해, 가용성 단백질의 발현 수준을 ELISA를 통해서 측정했다. 자극된 Jurkat T 림프구는 종양 괴사 인자 알파(TNFα), IL-8 및 IL-1β를 포함하는 다른 사이토카인보다 현저히 많은 양의 IL-2를 분비하였다(도 6a). 또한, hIO에서 자극된 인간 T 림프구와 함께 hIO 공배양 한 후에 IL-2 수용체 베타(IL-2Rβ) 및 감마쇄 (IL-2Rγc)의 mRNA 발현 수준이 증가됨을 확인하였다(도 6b). 상기 베타(IL-2Rβ) 및 감마쇄 (IL-2Rγc)는 이량화에 의해 IL-2Rbgc 수용체에 대한 중간의 친화력 형성에 의한 IL-2-매개된 신호전달에 기여한다. 또한, 인간 T 림프구와 함께 공배양한 hIO의 신호 전달 경로를 분석하기 위해, 환경 변화에 따라 43개의 키나제 활성을 탐지하는 포스포-키나제 어레이를 수행하였다. 몇몇 키나제는 대조군과 공배양된 군의 인산화 상태에서 검출 가능한 차이를 나타냈다(>1.2-배 변화)(도 8a, 8b). 특히, 고도로 인산화된 단백질의 대부분은 STAT3, c-Jun, p38α 및 ERK1/2와 같은 IL-2-매개된 신호전달과 관련이 있음을 확인하였다(도 6c). 또한, 경로 강화 분석을 통해 IL-2-매개된 신호전달 경로가 공배양된 hIO에서 가장 강화된 경로 중 하나임을 알 수 있었다(보정된 FDR < 0.001)(도 6d).
이러한 결과는 사이토카인이 공배양 시스템에서 중요한 측분비 가용성 인자 중 하나이며, in vitro 장내 성숙 효과를 나타내는 핵심 역할을 할 수 있음을 시사한다.
실시예
3.
hIO의
성장을 증가시키고
STAT3
및
mTOR
경로를
활성화시키는
IL-2
IL-2가 hIO의 in vitro 성숙에 대한 공배양의 효과에 있어서 잠재적인 핵심 요소임을 확인하고자, 재조합 인간 IL-2(rhIL-2)를 이용한 실험을 수행하였다.
구체적으로, IL-2로 배양한 hPSC-유래 hIO는 크기가 크게 증가하였고, IL-2 수용체를 선택적으로 차단함으로써 hPSC-유래 hIO의 크기 증가를 억제시켰다(도 7a). 또한, 1 내지 4ng/ml의 농도의 IL-2를 처리함으로써 복합 3D 장내 상피 구조를 가진 hIO의 크기가 유의하게 증가함을 확인하였다(도 9). 또한, 인간 포스포-키나제 어레이 분석을 통해 IL-2 처리에 의해 유도된 인산화 이벤트를 측정하였다. 그 결과, 가장 많이 변형된 인산화 분자는 STAT3(Y705)로 IL-2 처리 후, 3.3배나 증가함을 확인하였다(도 8c, 8d 및 도 7b).
대조군과 IL-2 처리된 hIO 사이에서 다르게 인산화된 단백질은 mTOR 신호전달 경로에서 유의적으로 강화됨을 확인하였다(보정된 FDR < 0.005). hIO를 인간 T 림프구와 공배양하거나, IL-2를 처리한 결과, AKT 및 P70 S6 키나제와 같은 STAT3 및 mTOR 신호전달 성분의 상승된 인산화를 확인하였다(도 7c, 도 7d).
특히, STAT3(S3I-201 또는 Stattic) 또는 mTOR(rapamycin)의 특이적인 억제제를 첨가함으로써 IL-2 처리에 의한 hIO 성장 자극이 멈추는 것을 확인하였고, 억제제-처리된 hIO의 대부분이 그들의 형태학적 특성을 잃어버리는 결과가 나타남을 확인하였다(도 7e).
이를 통해, 사이토카인은 STAT3 및 mTOR 신호전달을 활성화시킴으로써 hPSC-유래 hIO의 성장 및 성숙에 관여함을 알 수 있었다.
또한, 또 다른 STAT3 activator인 colivelin에 의해서 hIO가 in vitro 성숙이 가능한지 확인하였다. 다양한 농도의 colivelin을 사용하였을 때의 hIO의 크기가 증가하였다 (도 17a). 장관 성숙 마커 유전자의 발현 증가를 qPCR로 확인한 결과, 대조군 hIO에 비해 colivelin을 처리했을 때 발현이 전반적으로 증가하였다 (도 17b). colivelin을 처리했을 때 증식 마커 (Ki-67) 및 성숙 장 마커 (OLFM4, MUC13 및 KRT20) 단백질의 발현도 증가하였다.
실시예 4. hIO의 in vitro 성숙에 영향을 미치는 공배양 시스템과 성장인자
IL-2-매개 신호전달 경로가 hIO의 성장(growth)을 촉진시키는 역할 외에도 hIO의 in vitro에서의 성숙(maturation)에 관련된 것인지를 확인하기 위하여, 유전자 발현 프로파일링을 수행하였다. 구체적으로, 인간 T 림프구와 함께 공배양하거나 IL-2 처리시 hIO의 유전자 발현 프로파일은 전반적으로 인간 성체 장관 대조군(hSI)의 발현 패턴과 유사하게 이동함을 확인하였다(도 10a). 특히, 공배양(55.9%의 유전자가 hSI의 프로파일로 이동됨)시 IL-2 처리시보다 더 효과적임을 알 수 있었다(49.8%의 유전자가 hSI의 프로파일로 이동됨).
또한, 장의 성숙과 관련하여 다르게 발현된 유전자 (differentially expressed gene, DEG)의 생물학적 의미를 쉽게 이해하기 위해, 사이토스케이프 (Cytoscape)에서 ClueGO-in plug를 사용하여 기능 강화 분석을 수행하였다.
그 결과, 성숙한 hSI와 대조군 hIO사이에서 과도하게 부각된 DEG 중, 공배양 시스템 또는 IL-2 처리시(회색으로 강조)(도 10b), 세포-세포 접착, 방어 반응, 선천적 면역 반응, 면역 시스템 과정의 조절, 자극에 대한 반응의 양성 조절, 세포-표면 수용체 신호전달 경로, 화학적 자극에 대한 세포 반응, 신호 전달, 신호 전달, 세포 커뮤니케이션 및 사이토카인에 대한 반응을 포함하는, 핵심 생물학적 과정과 관련된 유전자들이 유의미하게(p <0.05) 인간 성체 장관 대조군(hSI)에서의 발편패턴과 유사하게 발현됨을 확인하였다(교점은 적색으로 강조)(도 10c).
공배양된 hIO에서 선택된 생물학적 과정에 관여하는 유전자의 수는 IL-2 처리된 hIO의 2배 이상이었다(도 10d). 또한, 장 마커, 소화 기능, 및 방어 기능을 포함하는 장의 성숙에 관련된 유전자의 발현 수준은, 공배양된 hIO보다는 다소 낮았지만, 대조군 hIO보다 IL-2가 처리된 hIO에서 높음을 확인하였다(도 10e-g).
마이크로어레이 분석으로부터 얻은 발현의 변화를 확인하기 위해, 장의 성숙-관련 유전자의 발현을 조사하였다(도 11a). 장-특이적 마커인, CDX2 및 성숙한 장의 ISC 마커인, OLFM4의 발현은 공배양 또는 IL-2 처리시 상향 조절되었지만, 상기 발현 수준은 hSI 및 인간 성체 조직-유래 장 오가노이드(hAT-IO) 보다는 낮았다. 다만, 숙주-방어 기전의 선천적인 면역 조절에 관여하는 유전자의 발현은 공배양 또는 IL-2 처리시 명백하게 증가됨을 확인하였다.
성숙한 장에서 생산되는 파네스 세포-특이적 구성요소인, 인간 α-디펜신(DEFA5 및 DEFA6) 및 리조자임(LYZ)의 발현수준은 공배양 또는 IL-2 처리된 hIO에서 상향 조절되었다. 성숙한 장에서의 소화 기능과 관계하는 DPP4, LCT의 발현은 공배양 또는 IL-2 처리된 hIO에서 상향 조절되었다. 또한, KRT20, MUC13, SLC5A1 및 CREB3L3을 포함하는 성숙한 장의 분화 마커의 상승된 발현은 공배양 또는 IL-2 처리된 hIO에서 관찰되었다. 공배양 또는 IL-2 처리된 hIO에서는 hAT-IO와 비교하여 이들 유전자의 발현에는 유의한 차이가 없었다. qPCR 데이터에서도 일관성 있게, OLFM4, MUC13 및 KRT20의 단백질 발현 수준은 대조군에서 검출되지 않았지만 공배양 또는 IL-2 처리된 hIO에서 존재함을 확인하였다(도 11b). 기능성에 관련하여 수크레이즈-이소말타아제(SI)와, MDR1 및 펩티드 수송체 1(PEPT1)의 단백질 발현 또한 대조군에 대비하여 공배양이나 IL-2 처리된 hIO에서 존재함을 확인하였다 (도 11c).
이를 통해, 공배양 시스템 또는 사이토카인 IL-2 처리시 태아-유사 특성을 갖는 hPSC-유래 미성숙 hIO를 성체 장관이 가지는 특성을 가지도록 in vitro에서 성숙을 유도할 수 있음을 알 수 있었다.
실시예 5. 장의 기능성을 모사하는 in vitro-성숙된 hIO
성숙한 소장이 전사 및 전사-후 수준에서 수송체 및 약물-대사 효소의 발현을 조절함으로써 약물 흡수 및 대사에 역할을 한다는 것을 확인하기 위해, 수송체 및 대사 효소와 관련된 다양한 유전자의 발현 패턴을 분석하였다.
그 결과, 주요 장내 사이토크롬 p450 효소, 접합 효소 및 흡수(용질 담체(SLC) 계열) 및 배출(ATP-결합 카세트(ABC) 계열) 수송체는 hSI에서 높게 발현되었다(도 12a). 또한, 대조군 hIO와 비교하여 공배양된 hIO에서 40개의 효소 및 수송체 중 27개(67.5%)가 2배 상향 조절되었고, IL-2 처리된 hIO에서는 25개(62.5%)가 상향 조절되었다. 이는 hAT-IO보다 훨씬 높은 결과임을 확인할 수 있었다(도 12b). 계층형 클러스터링은 공배양 또는 IL-2 처리된 hIO가 우선적으로 대조군 hSI로 크러스터한 것을 나타낸다. 특히, 몇몇 SLC 및 ABC 수송체와 설포트랜스퍼레이즈(SULT) 효소의 발현은 hAT-IO에서 상대적으로 낮음을 확인하였다(도 12b).
또한, 유전자 발현 수준에서 hIO의 in vitro 성숙이 hIO의 기능적 상태에 영향을 미칠 것인지 여부를 확인하기 위하여, 공배양되고 IL-2 처리된 hIO에서 광범위한 약물 및 제노바이오틱스 (xenobiotics)의 약동학에 영향을 미치는 주요 배출 수송체인 P-당단백(P-gp, MDR1, ABCB1)의 발현 수준을 관찰한 결과 공배양 또는 IL-2 처리된 hIO에서 상향 조절되었다 (도 12d). 이 후, in vitro-성숙된 hIO의 기능적 품질을 평가하기 위해 hIO의 배출 수송체 기능을 측정하였다. hIO는 FITC-덱스트란의 세포간 확산 패턴에 의해 나타나는 투과성 장 상피 장벽을 가진다(도 12c).
P-gp 수송체 활성을 평가하기 위해, 프로토타입 기질인, 파클리탁셀 (paclitaxel)은 공배양 및 IL-2 처리된 hIO 대조군의 기저 측 면(외부)에 로딩하였다. 2시간 인큐베이션한 후, 정단면(세포의 내부)의 파클리탁셀의 농도가 대조군 hIO에서와 비교해서 공배양된 hIO에서 대략 2.3배(p <0.001) 증가되고 IL-2 처리된 hIO에서 3배(p <0.001) 증가됨을 확인하였다(도 12d). 칼슘 채널 차단제인, 베라파밀(verapamil)에 의한 P-gp 억제시, 정단면에서 파클리탁셀의 농도는 대조군 hIO(27.9% ± 15.6%, p > 0.05)와 비교해서 공배양되고 IL-2-처리된 hIO(54.6% ± 5.8%, p < 0.001 및 92.8% ± 0.6%, p < 0.001, 각각)에서 유의하게 감소함을 확인하였다.
성숙한 흡수세포의 포도당 감도를 평가하기 위해, 포도당-매개 칼슘 세포기질 방출을 Fluo4-AM 칼슘 표지자를 이용하여 정량화하였다. 실시간 이미징(real-time imaging)을 통해 포도당 유입시 칼슘이온의 반응을 관찰하면 대조군에 대비하여 칼슘 반응이 뚜렷하며, 큰 폭으로 신호가 증폭되는 것을 (2~3배, p < 0.001) 확인함으로써 대조군 대비하여 성숙화 hIO에서 포도당 감도가 월등함을 확인하였다 (도 12f).
성숙한 흡수세포는 CFTR을 발현하므로 이를 확인하기 위해, 폴스콜린 매개 오가노이드 팽창 분석을 진행하였다. 폴스콜린에 총 120분간 노출되어 실시간 이미징을 통해 오가노이드의 크기를 수치화하여 비교하였으며, 대조군 대비 성숙화 오가노이드 실험군에서 폴스콜린 반응이 뚜렷한 것을 확인하였으며 (n=4) 이 팽창효과는 CFTR 억제제 (CFTRinh172, GlyH101)처리 시 완전히 차단되는 것을 확인하였다(도 12g). 이는 in vitro-성숙 hIO가 기능성 CFTR 단백질을 잘 발현함을 시사하는 것이다.
또한, 점액질층과 성숙한 뮤신 생산 배상세포의 기능 오가노이드에서 확인하기 위해 파스/뮤시칼민 염색을 진행하였으며, in vitro-성숙 hIO에서 대조군 대비 파스/뮤시칼민 양성의 점액질층과 뮤신 생산 배상세포가 잘 기능함을 확인하였다(도 12h).
장 내분비세포의 호르몬 분비기능을 확인하기 위해, 대조군과 공배양 또는 IL-2 처리한 hIO의 배양상등액에서 GIP 호르몬의 양을 산출하였다. 먼저 대조군과 in vitro-성숙 hIO의 GIP 유전자 발현양상을 qRT-PCR기법을 통해 확인하였을 때, 대조군 대비 공배양하거나 IL-2를 처리한 hIO에서 GIP 유전자의 발현이 크게 증가한 것을 확인하였고 (도 12i), 일관성 있는 결과로서 GIP ELISA 키트를 이용하여 분비된 GIP의 양을 확인하였을 때 대조군 대비 공배양 또는 IL-2 처리 시 약 45배 GIP를 분비하는 것을 확인하였다 (도 12j).
이를 통해, in vitro-성숙된 hIO에서 P-gp 발현에 의한 약물 반응성뿐만 아니라, 각 장관세포의 대표적 기능이 증가됨을 알 수 있었다.
실시예 6. in vivo에서 기능적 혈관 구조를 생성하는 in vitro-성숙된 hIO
인간 T 림프구와의 공배양 또는 IL-2 처리에 의한 in vitro-성숙된 hIO의 이식가능성을 평가하기 위해, hIO를 면역 결핍 NSG 마우스의 신장 캡슐 하에 주사하였다. 이식된 hIO의 in vivo 정량적 검출을 위해, hIO를 낮은 세포 독성을 갖는 근-적외선 형광 친유성 염료인, DiR로 표지하였다. hIO는 이식 1일 후에 신장 내부에 있었으며(도 14a), 이식 후 신장을 꺼냈을 때 명확한 형광 신호가 여전히 발견됨을 확인하였다(도 13a). DiR-표지된 hIO의 in vivo IVIS 이미징과 조직학적 검사에서 공배양 및 IL-2 처리된 hIO는 이식 후 1주일간 대조군과 비교하여 크기가 유의하게 증가함을 확인하였다(p < 0.01 및 p < 0.05 공배양 및 IL-2 처리된 hIO에서 DiR의 형광강도)(도 13a 및 도 13b). 이식된 hIO에서 장세포, 장 내분비 세포, 배상 세포, 및 파네스 세포를 포함하는 모든 주요 장 세포 유형의 마커가 발견되었다(도 14b). 특히, 이식된 in vitro-성숙된 hIO에서 성숙한 장 분화 마커의 발현을 조사한 결과, in vivo에서 DEFA5, OLFM4, MUC13, 및 KRT20 양성 세포가 지속적으로 존재함을 확인하였다(도 13c). 또한, 수크레이즈-이소말타아제(SIM)와 같은 기능적 미소 융모 효소, 및 MDR1 및 펩티드 수송체 1(PEPT1) 같은 기능적 장 수송체는 단기 이식 후 in vitro-성숙된 hIO에서만 오직 발현됨을 확인하였다(도 13d).
hPSC-유래 세포 및 오가노이드의 조직 치료제로서의 적용에 대한 주된 장애물 중 하나가 숙주 혈관계와 이식된 유세포 사이에 혈관 접점을 제공하는 것이기 때문에, in vivo 이식된 hIO의 신생 혈관 변화를 측정하였다. 구체적으로, 대조군 hIO와 비교했을 때 공배양되거나, IL-2 처리된 hIO에서 혈관 내피 세포(CD31-양성 세포)가 더 많이 존재하고, 이는 적층 인간 간엽(α-smooth muscle actin, α-SMA)-양성 세포)로부터 유래됨을 확인하였다(도 13e, 위쪽 패널). In vitro-성숙된 hIO더라도 이식되기 전에는 CD31의 발현은 발견되지 않았다(도 15a). 더욱이, 공배양되고 IL-2-처리된 hIO의 간엽은 인접한 조직으로부터 혈관을 끌어온다고 알려져 있는 혈관 내피 성장 인자(VEGF)의 발현 수준이 대조군 hIO보다 더 높음을 나타낸다(도 13e, 중간 패널). 실제로, 공배양되거나 IL-2 처리된 hIO는 이식 후 1주일 만에 숙주 혈관계로부터 mMECA-32-양성 혈관을 끌어옴을 확인하였다(도 13e, 아래쪽 패널). 인접한 hIO의 간엽으로부터 유래된 혈관 내피 세포를 포함하는 혈관은 대조군 hIO 보다 공배양 되거나 IL-2-처리된 hIO에서 고유판(lamina propria)이 더 풍부하고, 마우스의 혈관계를 연결시킴을 알 수 있었다(도 13e, 아래쪽 패널의 화살표 및 도 15b),
이는 in vitro-성숙된 hIO는 잠재적으로 in vivo에서 인간 혈관 성숙을 유도할 수 있다는 것을 시사하며, 또한 in vitro-성숙된 hIO는 보통의 핵형을 가지고 있어(도 16), 향후 임상의 장 이식을 위한 대안적 세포 공급이 될 것임을 시사한다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Claims (12)
- 미성숙(immature) 장관 오가노이드(intestinal organoid)를 T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지에서 배양하는 단계를 포함하는, in vitro에서 성숙된(mature) 장관 오가노이드의 제조 방법.
- 제1항에 있어서,상기 제조 방법은 줄기세포로부터 미성숙 장관 오가노이드를 분화시키는 단계를 추가적으로 포함하는, in vitro에서 성숙된 장관 오가노이드의 제조 방법.
- 제2항에 있어서,상기 줄기세포는 배아줄기세포 또는 유도만능줄기세포(iPSC)인 것인, in vitro에서 성숙된 장관 오가노이드의 제조 방법.
- 제1항에 있어서,상기 사이토카인은 TNFα(Tumor necrosis factor-α), IL-8(Interleukin 8), IL-1β(Interleukin 1β), 및 IL-2(Interleukin 2)로 이루어진 군에서 선택된 하나 이상인 것인, in vitro에서 성숙된 장관 오가노이드의 제조 방법.
- 제1항에 있어서,상기 STAT3 및 mTOR 신호전달 경로 활성화제는, STAT3, AKT 및 P70 S6 키나제로 이루어진 군에서 선택된 하나 이상의 인산화 활성화제인, in vitro에서 성숙된 장관 오가노이드의 제조 방법.
- 제1항에 있어서, 상기 성숙된 장관 오가노이드는 미성숙 장관 오가노이드와 비교하여 하기 (a) 내지 (f) 중 어느 하나 이상의 마커의 발현이 증가하는 것을 특징으로 하는, in vitro에서 성숙된 장관 오가노이드의 제조 방법:(a) 장의 성숙 장관 줄기세포 마커인 CDX2, 및 OLFM4(Olfactomedin-4);(b) 소화 기능 관련 마커 DPP4(Dipeptidyl peptidase-4), 및 LCT(lactase);(c) 면역기능 및 숙주방어 기능 관련 마커 DEFA5(human-defensins 5), DEFA6(human-defensins 56), 및 LYZ(lysozyme);(d) 수송 시스템 관련 마커 SLC5A1(solute carrier family 5 member 1), P-glycoprotein 1 (p-gp, multidrug resistance protein 1 (MDR1), 및 ATP-binding cassette sub-family B member 1 (ABCB1));(e) 성숙 장관의 분화 마커인 KRT20(Keratin 20), MUC13(Mucin 13) 및 CREB3L3(Cyclic AMP-responsive element-binding protein 3; 및(f) STAT3 및 mTOR 신호전달 마커인 인산화된 STAT3(signal transducer and activator of transcription 3), 인산화된 AKT(protein kinase B (PKB)) 및 인산화된 P70S6 키나제(Ribosomal protein S6 kinase beta-1 (S6K1)).
- T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는, 미성숙 장관 오가노이드의 in vitro 성숙용 조성물.
- 제1항 내지 제6항 중 어느 한 항의 방법으로 제조된, in vitro에서 성숙된 장관 오가노이드.
- 미성숙 장관 오가노이드(intestinal organoid)를 T-림프구, 사이토카인, STAT3 및 mTOR 신호전달 경로 활성화제 또는 이들의 조합을 포함하는 배지에서 배양하는 단계를 포함하는, in vitro에서 미성숙 장관 오가노이드를 성숙시키는 방법.
- 제1항 내지 제6항 중 어느 한 항의 방법에 따라 성숙된 장관 오가노이드를 제조하는 단계를 포함하는, 인공 장관의 제조방법.
- 제8항의 in vitro에서 성숙된 장관 오가노이드를 포함하는 조직치료제.
- 제8항의 in vitro에서 성숙된 장관 오가노이드를 포함하는, 장 관련 질환의 치료제 스크리닝용 키트.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/598,425 US12180508B2 (en) | 2017-04-12 | 2019-10-10 | Method of preparing in vitro-matured human intestinal organoids and use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2017-0047215 | 2017-04-12 | ||
| KR20170047215 | 2017-04-12 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/598,425 Continuation-In-Part US12180508B2 (en) | 2017-04-12 | 2019-10-10 | Method of preparing in vitro-matured human intestinal organoids and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018190656A1 true WO2018190656A1 (ko) | 2018-10-18 |
Family
ID=63792903
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2018/004301 Ceased WO2018190656A1 (ko) | 2017-04-12 | 2018-04-12 | In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US12180508B2 (ko) |
| KR (1) | KR102026418B1 (ko) |
| WO (1) | WO2018190656A1 (ko) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020132133A1 (en) * | 2018-12-18 | 2020-06-25 | Beth Israel Deaconess Medical Center, Inc. | Generation of organoid-primed t (opt) cells with memory phenotype |
| EP3968767A4 (en) * | 2019-05-15 | 2023-07-26 | The Cleveland Clinic Foundation | ORGANOIDS OF INDUCED HUMAN COLITIS |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102237425B1 (ko) * | 2018-12-26 | 2021-04-08 | 주식회사 넥스트앤바이오 | 암을 가진 대상체의 항암제 및/또는 방사선 내성 진단에 필요한 정보를 제공하는 방법 |
| KR102146274B1 (ko) * | 2019-05-21 | 2020-08-24 | 주식회사 마이크로바이오틱스 | 장관 오가노이드의 제조 방법 및 이의 용도 |
| KR102218303B1 (ko) * | 2019-08-26 | 2021-02-23 | 연세대학교 산학협력단 | 혈관 조직을 포함하는 오가노이드의 제조 방법 및 이의 용도 |
| KR102285600B1 (ko) * | 2019-10-30 | 2021-08-05 | 가톨릭대학교 산학협력단 | 3차원 뇌 오가노이드를 이용한 뇌신경계질환 치료용 줄기세포 스크리닝 방법 |
| KR102333275B1 (ko) * | 2020-02-25 | 2021-12-03 | 고려대학교 산학협력단 | 환자 맞춤형 약물 선택을 위한 정보 제공 방법 |
| EP4253516A3 (en) | 2020-06-25 | 2023-12-06 | Next & Bio Inc. | Method for mass proliferation of stem cells without using hydrogel |
| US20220276225A1 (en) * | 2020-06-25 | 2022-09-01 | Next & Bio Inc. | Method for providing information necessary for diagnosing cancer patient's resistance to anti-cancer agent and/or radiation |
| US12606783B2 (en) | 2020-06-25 | 2026-04-21 | Next & Bio Inc. | Well plate and 3D culture plate comprising the same |
| KR102746473B1 (ko) | 2021-07-09 | 2024-12-26 | 주식회사 넥스트앤바이오 | 가상 오가노이드를 이용한 촬영 이미지 데이터 생성 방법 |
| KR102746470B1 (ko) | 2021-07-09 | 2024-12-26 | 주식회사 넥스트앤바이오 | 가상 오가노이드 생성 방법 |
| WO2023043278A1 (ko) * | 2021-09-17 | 2023-03-23 | 오가노이드사이언스 주식회사 | 항암제 효능 평가 또는 스크리닝 방법 |
| KR20250058951A (ko) | 2023-10-24 | 2025-05-02 | 한국화학연구원 | 환자유래 장 오가노이드를 이용한 염증성 장질환 모델 제작 및 이의 용도 |
| KR20250123299A (ko) | 2024-02-07 | 2025-08-18 | 사회복지법인 삼성생명공익재단 | 환자유래 켈로이드 섬유아세포와 내피세포를 이용한 켈로이드 스페로이드 모델 제작 및 이의 용도 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160287670A1 (en) * | 2013-11-07 | 2016-10-06 | Memorial Sloan-Kettering Cancer Center | Methods of use for il-22 in the treatment of gastrointestinal graft vs. host disease |
| WO2017048193A1 (en) * | 2015-09-15 | 2017-03-23 | Agency For Science, Technology And Research (A*Star) | Derivation of liver organoids from human pluripotent stem cells |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014182601A1 (en) * | 2013-05-08 | 2014-11-13 | Children's Medical Center Corporation | A method of preventing and treating type 1 diabetes, allograft rejection and lung fibrosis (by targeting the atp/p2x7r axis) |
| US10557124B2 (en) * | 2015-04-22 | 2020-02-11 | The Regents Of The University Of Michigan | Compositions and methods for obtaining stem cell derived lung tissue, and related uses thereof |
-
2018
- 2018-04-12 WO PCT/KR2018/004301 patent/WO2018190656A1/ko not_active Ceased
- 2018-04-12 KR KR1020180042820A patent/KR102026418B1/ko active Active
-
2019
- 2019-10-10 US US16/598,425 patent/US12180508B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160287670A1 (en) * | 2013-11-07 | 2016-10-06 | Memorial Sloan-Kettering Cancer Center | Methods of use for il-22 in the treatment of gastrointestinal graft vs. host disease |
| WO2017048193A1 (en) * | 2015-09-15 | 2017-03-23 | Agency For Science, Technology And Research (A*Star) | Derivation of liver organoids from human pluripotent stem cells |
Non-Patent Citations (5)
| Title |
|---|
| FINKBEINER, STACY R. ET AL.: "Generation of Tissue-engineered Small Intestine Using Embryonic Stem Cell -derived Human Intestinal Organoids", BIOLOGY OPEN, vol. 4, no. 11, 2015, pages 1462 - 1472, XP055559201, Retrieved from the Internet <URL:doi:10.1242/bio.013235> * |
| HIBIYA, SHUJI ET AL.: "Long-term Inflammation Transforms Intestinal Epithelial Cells of Colonic Organoids", JOURNAL OF CROHN'S AND COLITIS, vol. 11, no. 5, 11 October 2016 (2016-10-11), pages 621 - 630, XP055559203, Retrieved from the Internet <URL:https://doi.org/10.1093/ecco-jcc/jjw186> * |
| KRETZSCHMAR, KAI ET AL.: "Organoids: Modeling Development and the Stem Cell Niche in a Dish", DEVELOPMENTAL CELL, vol. 38, 2016, pages 590 - 600, XP029749729 * |
| LINDEMANS, CAROLINE A. ET AL.: "Interleukin-22 Promotes Intestinal-stem- cell -mediated Epithelial Regeneration", NATURE, vol. 528, 2015, pages 560 - 564, XP055559195 * |
| LIU, FANGKUN ET AL.: "Drug Discovery via Human-derived Stem Cell Organoids", FRONTIERS IN PHARMACOLOGY, vol. 7, no. 334, 22 September 2016 (2016-09-22), pages 1 - 12, XP055559200, Retrieved from the Internet <URL:doi:10.3389/fphar.2016.00334> * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020132133A1 (en) * | 2018-12-18 | 2020-06-25 | Beth Israel Deaconess Medical Center, Inc. | Generation of organoid-primed t (opt) cells with memory phenotype |
| EP3968767A4 (en) * | 2019-05-15 | 2023-07-26 | The Cleveland Clinic Foundation | ORGANOIDS OF INDUCED HUMAN COLITIS |
Also Published As
| Publication number | Publication date |
|---|---|
| US12180508B2 (en) | 2024-12-31 |
| KR102026418B1 (ko) | 2019-09-27 |
| KR20180115236A (ko) | 2018-10-22 |
| US20200115683A1 (en) | 2020-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018190656A1 (ko) | In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도 | |
| WO2011043591A2 (en) | Method for differentiation into retinal cells from stem cells | |
| WO2011043592A2 (en) | Compositions for inducing differentiation into retinal cells from retinal progenitor cells or inducing proliferation of retinal cells comprising wnt signaling pathway activators | |
| WO2017179767A1 (ko) | 지방줄기세포에서 신경줄기세포, 신경세포 및 가바성 신경세포로의 분화 유도 방법, 및 인간 골수 유래 중간엽 줄기세포로부터 성장인자를 다량 분비하는 인간 줄기세포의 분화 유도 방법 | |
| WO2016111546A2 (ko) | 혈액 응고인자 viii 유전자를 타겟으로 하는 엔도뉴클레아제 및 이를 포함하는 혈우병 치료용 조성물 | |
| WO2021045373A1 (ko) | 증식 가능한 간 오가노이드 | |
| WO2018135902A1 (ko) | 줄기 세포로부터 분화 유도된 연골세포의 제조방법 | |
| WO2016032263A1 (en) | Method for differentiation into retinal ganglion cells from stem cells | |
| WO2014163425A1 (ko) | Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법 | |
| WO2022250406A1 (ko) | 비알코올성 지방간 인공 조직 모델 | |
| WO2011142514A1 (ko) | Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물 | |
| WO2013180395A1 (ko) | 다능성 줄기세포의 제작, 유지, 증식을 증진하는 대사산물 및 이를 포함하는 조성물과 배양방법 | |
| WO2020139041A1 (ko) | 전신경화증 질환 모델 및 이의 용도 | |
| WO2022025559A1 (ko) | 줄기세포 유래 엑소좀을 포함하는 조성물 및 이의 제조방법 | |
| WO2023043278A1 (ko) | 항암제 효능 평가 또는 스크리닝 방법 | |
| WO2018135907A1 (ko) | 슈반 세포 전구체 및 이로부터 분화된 슈반 세포의 제조 방법 | |
| WO2021256668A1 (ko) | 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법 | |
| WO2024063531A1 (ko) | 생착 및 재생능 강화를 위한 장 오가노이드 주변 기질 세포층 및 이의 용도 | |
| WO2022086257A1 (ko) | 항암제를 포함한 미토콘드리아 및 이의 용도 | |
| WO2019132547A1 (ko) | Chi3l1 억제제를 유효성분으로 하는 암의 폐 전이 예방 또는 치료용 약학 조성물 | |
| WO2022005023A1 (ko) | 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법 | |
| WO2022098052A1 (en) | Human intestinal epithelium model and method for preparing same | |
| WO2023128659A1 (ko) | 운동성 신경세포 직접교차 분화용 인자 | |
| WO2020085563A1 (ko) | 인간 순수 만능줄기세포에 특이적인 단일클론항체 n16-f2 | |
| WO2024063533A1 (ko) | 전분화능 줄기세포 유래 고성능의 성숙 장 오가노이드 재생치료제 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18783777 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18783777 Country of ref document: EP Kind code of ref document: A1 |