WO2018189186A1 - Compounds for increasing genome editing efficiency - Google Patents

Compounds for increasing genome editing efficiency Download PDF

Info

Publication number
WO2018189186A1
WO2018189186A1 PCT/EP2018/059173 EP2018059173W WO2018189186A1 WO 2018189186 A1 WO2018189186 A1 WO 2018189186A1 EP 2018059173 W EP2018059173 W EP 2018059173W WO 2018189186 A1 WO2018189186 A1 WO 2018189186A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
dna
target cell
cell
genome editing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2018/059173
Other languages
English (en)
French (fr)
Inventor
Stephan RIESENBERG
Tomislav MARICIC
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Original Assignee
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from EP17165784.4A external-priority patent/EP3388517A1/en
Priority claimed from EP17203591.7A external-priority patent/EP3489357A1/en
Priority to SG11201909432S priority Critical patent/SG11201909432SA/en
Priority to IL269887A priority patent/IL269887B2/en
Priority to KR1020237017487A priority patent/KR102778328B1/ko
Priority to CA3058697A priority patent/CA3058697A1/en
Application filed by Max Planck Gesellschaft zur Foerderung der Wissenschaften eV filed Critical Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority to US16/603,377 priority patent/US12173309B2/en
Priority to KR1020197032518A priority patent/KR102537447B1/ko
Priority to CN201880035645.5A priority patent/CN110691848B/zh
Priority to JP2019555112A priority patent/JP7319194B2/ja
Priority to EP18722407.6A priority patent/EP3610008A1/en
Publication of WO2018189186A1 publication Critical patent/WO2018189186A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/194Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53771,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • the present invention relates to compounds, compositions and kits suitable to increase precise genome editing efficiency in a eukaryotic target cell or target organism.
  • CRISPR is a bacterial nuclease immune system against viral DNA, which has been adopted to accurately cut chromosomal DNA sequences in eukaryotic cells. Such DNA breaks are repaired by two competing pathways: Non-homologous-End-Joining (NHEJ) or Homology directed Repair (HDR).
  • NHEJ Non-homologous-End-Joining
  • HDR Homology directed Repair
  • DNA-PKcs DNA protein kinase catalytic subunit
  • the kinase phosphorylates itself and other downstream effectors at the repair site. Recruitment and phosphorylation of several proteins like Artemis result in end-processing ligation by ligase IV (LIG4), X-ray repair cross-complementing protein 4 (XRCC4) and Non-homologous end-joining factor 1 (XLF) (Dueva, lliakis 2013).
  • LIG4 ligase IV
  • XRCC4 X-ray repair cross-complementing protein 4
  • XLF Non-homologous end-joining factor 1
  • A-NHEJ an alternative NHEJ pathway (A-NHEJ) becomes active (Nussenzweig, Nussenzweig 2007). It requires Poly(ADP-ribose)- Polymerase 1 (PARP-1 ), Werner syndrome ATP-dependent (WRN) helicase and DNA ligase 3 (LIG3) or DNA ligase I (LIG1 ) amongst other proteins. Binding of the MRN- complex (Mre1 1 , Rad50 and Nbs1 ) complex to the double strand break (DSB) initiates HDR (Shrivastav et al. 2008).
  • PARP-1 Poly(ADP-ribose)- Polymerase 1
  • WRN Werner syndrome ATP-dependent
  • LIG3 DNA ligase 3
  • LIG1 DNA ligase I
  • the protein kinase ataxia-telangiectasia mutated (ATM) plays a major role in HDR, as it phosphorylates at least 12 repair proteins (Shrivastav et al. 2008).
  • NHEJ of CRISPR Cas9-induced DSBs is error prone and frequently introduces insertions and deletions (indels) at the cut site. It is therefore useful for knocking out a targeted gene.
  • HDR allows precise repair of a DSB by using a homologous donor DNA sequence. If this donor sequence is provided in the experiment and carries mutations, these will be introduced into the genome.
  • a requirement for a DSB introduced by Cas9 is an NGG sequence (PAM site) in DNA.
  • Targeting of Cas9 is determined by a bound guide RNA (gRNA) which is complementary to 20 nucleotides adjacent to the PAM site.
  • gRNA bound guide RNA
  • the Cas9 nuclease may also cut the genome at sites that carry sequence similarity to those targeted by the gRNA (Fu et al. 2013). Those off-target double stranded cuts mean that unwanted mutations can appear elsewhere in the genome together with the desired mutation.
  • One strategy to reduce such off-target cuts is to use a mutated Cas9 that introduces single-stranded nicks instead of DSBs such as Cas9 D10A (Shen et al. 2014). Using two gRNAs to introduce two nicks on opposite DNA strands in close proximity to each other will result in a DSB at the desired locus while reducing the risk of two off-target nicks occurring elsewhere in the genome close enough to cause a DSB.
  • Another strategy is to use Cpf1 (Zetsche et al. 2015). This nuclease introduces a staggered cut near a T-rich PAM site and has been shown to produce less off-target effects (Kim et al. 2016)(Kleinstiver et al. 2016).
  • PGE precise genome editing
  • ssODN single stranded oligodeoxynucleotide
  • HEK293T cells from 26% to 38%)
  • human primary neonatal fibroblasts from undetectable to 0.6%)
  • human embryonic stem cells hESCs
  • dsODN double stranded oligodeoxynucleotide
  • SCR7 small molecule ligase IV inhibitor
  • SCR7 has been claimed to block NHEJ and to increase the efficiency of PGE (from 5 to 22.7%) in mouse embryos (Maruyama et al. 2015).
  • Other researchers described similar increase in HEK293 TLR cells, a marginal but significant increase in HEK293A, or found no significant effect in mouse embryos, rabbit embryos and human stem cells (Chu et al. 2015)(Pinder et al. 2015)(Song et al. 2016)( Yang et al. 2016)(Zhang et al. 2017).
  • Greco et al. reanalysed the structure and inhibitory properties of SCR7 (Greco et al. 2016). They conclude that SCR7 and its derivates are neither selective nor potent inhibitors of human LIG4.
  • RS-1 increased PGE in rabbit embryos (from 4.4 to 26.1 %), HEK293A cells (from 3.5 to 21 %) and U20S cells (from 1.9 to 2.4%)(Song et al. 2016)(Pinder et al. 2015), but not in hiPSCs (Zhang et al., 2017), all with dsODN donors. No effect of RS-1 on PGE efficiency was found in porcine fetal fibroblasts using ssODN donors (Wang et al. 2016).
  • the present inventors have found that certain compounds, particularly when applied as a combination of two or more different compounds increase precise genome editing efficiency.
  • the inventors have found that compounds selected from inhibitors of histone deacetylase (HDAC) inhibitors of NEDD8 activating enzyme (NAE), inhibitors of DNA-dependent Protein Kinase (DNA-PK) in particular of its catalytic subunit (DNA-PKcs), and inhibitors of replication protein A (RPA) and combinations of compounds selected from these different classes of inhibitors, are capable of increasing genome editing efficiency.
  • HDAC histone deacetylase
  • NAE NEDD8 activating enzyme
  • DNA-PK DNA-dependent Protein Kinase
  • DNA-PKcs catalytic subunit
  • RPA replication protein A
  • the compounds and combinations thereof are suitable both in non-medical applications, e.g. as research tool or in medical applications, e.g. for in vivo or ex vivo use.
  • DNA-PKcs which is catalytically inactive, but structurally intact, increases precise genome editing efficacy, independently from the presence of compounds as indicated above. This effect is found in a plurality of different systems for genome editing and thus is broadly applicable.
  • the invention relates to a compound which is an inhibitor of histone deacetylase (HDAC), in the following designated as compound (I), for use in genome editing.
  • HDAC histone deacetylase
  • HDAC inhibitors are known as cytostatic agents for inhibiting tumor cell proliferation by inducing cell cycle arrest, differentiation and/or apoptosis.
  • HDAC inhibitors usually act by binding to the zinc-containing catalytic domain of HDACs. They may be classified according to the chemical moiety that binds to the zinc ion. Examples of suitable classes of HDAC inhibitors are:
  • HDAC inhibitors are reviewed e.g. by Khan & La Thangue (Immunol. Cell Biol. 90 (2012), 85-94) and Falkenberg & Johnstone (Nature Rev. Drug Discovery 13 (2014) 673-691 ), herein incorporated by reference.
  • HDAC inhibitors are preferably selected from synthetic non-nucleosidic compounds, e.g. small molecules having a molecular mass of 1500 Da or less or 1000 Da or less.
  • HDAC inhibitors are selected from Trichostatin A, Vorinostat, Entinostat, Panobinostat, Mocetinostat, Belinostat, Romidepsin, MC1568, Tubastatin A HCI, Givinostat, LAQ824, CUDC-101 , Quisinostat 2HCI, Pracinostat, PCI-34051 , Droxinostat, PCI-24781 , RGFP966, AR-42, Rocilinostat, Valproic acid, CI994, CUDC-907, Tubacin, M344, Resminostat, RG2833, Divalproex Sodium, Scriptaid, Phenylbutyrate, Tubastatin A, CAY10603, Nexturastat A, BG45, LMK-235, Santa
  • a preferred compound (I) is Trichostatin A including salts and solvates thereof.
  • the present invention relates to a compound which is an inhibitor of NEDD8 activating enzyme (NAE), in the following designated as compound (II), for use in genome editing.
  • NAE NEDD8 activating enzyme
  • NAE inhibitors are known as anti-tumor agents as reviewed e.g. by Nawrocki et al. (Exp Opin Investing Drugs 21 (2012), 1564-1573) or as antiviral agents as reviewed e.g. by Le- Trilling et al. (Sci. Rep. 6 (2016), doi: 19977), herein incorporated by reference.
  • NAE inhibitors are preferably selected from synthetic non-nucleosidic compounds, e.g. small molecules having a molecular mass of 1500 Da or less or 1000 Da or less.
  • a preferred NAE inhibitor is MLN4924 (Pevonedistat) or any salt or solvate thereof, in particular any pharmaceutically acceptable salt or solvate thereof.
  • the present invention relates to a compound which is an inhibitor of DNA-dependent protein kinase (DNA-PK), in particular an inhibitor of its catalytic subunit (DNA-PKcs), in the following designated as compound (III) for use in genome editing.
  • DNA-PK inhibitors are known as chemotherapeutic agents as reviewed e.g. by Davidson et al. (Front. Pharmacol. 4(2013), doi: 13 3389), herein incorporated by reference.
  • DNA-PK inhibitors are preferably selected from synthetic non-nucleosidic compounds, e.g. small molecules having a molecular mass of 1500 Da or less or 1000 Da or less.
  • synthetic non-nucleosidic compounds e.g. small molecules having a molecular mass of 1500 Da or less or 1000 Da or less.
  • Specific examples of DNA-PK inhibitors are NU7026, NU7441 , PIK-75 and PI-103 as well as salts or solvates thereof, in particular pharmaceutically acceptable salts and solvates thereof.
  • the compound (III) is NU7026 including salts and solvates thereof.
  • the invention relates to a compound which is an inhibitor of Replication Protein A (RPA), in the following designated as compound (IV) for genome editing.
  • RPA Replication Protein A
  • RPA inhibitors are known as anti-tumor agents as reviewed e.g. by Neher et al. (Mel. Cancer Ther. 10(201 1 ), 1756-1806), herein incorporated by reference.
  • RPA inhibitors are preferably selected from synthetic non-nucleosidic compounds, e.g. small molecules having a molecular mass of 1500 Da or less or 1000 Da or less.
  • RPA inhibitors are NSC15520, TDRL-505 and NSC1 1 1847, as well as salts or solvates thereof, in particular pharmaceutically acceptable salts and solvates thereof.
  • a preferred embodiment of compound (IV) is NSC15520 including salts and solvates thereof.
  • a compound (I), a compound (II), a compound (III), or a compound (IV) increase the frequency of precise genome editing in a eukaryotic cell such as an animal, e.g. mammalian including human cell.
  • compounds (I), (II), (III), and/or (IV) have an additive effect when administered together.
  • a combination consisting of compounds Trichostatin A, MLN4924, NSC15520, and NU7026 an increase in precise genome editing of up to 6.7 fold or almost 50% edited chromosomes was achieved, the highest genome editing efficiency of human pluripotent stem cells described to date to the inventors' knowledge.
  • an almost complete correct genome editing with up to 82% edited chromosomes or a 19.2 fold increase is achieved.
  • MPGE multiplexed precise genome editing
  • hematopoietic cells e.g.T cells such as CD4 + T cells or hematopoietic precursor cells, e.g. CD34 + cells together with the use of a nuclease (e.g. Cpf1 ) or nickase enzyme system (e.g. Cas9D10A) capable of introducing a staggered cut in a DNA double strand, e.g. a chromosomal DNA, at a desired locus.
  • a nuclease e.g. Cpf1
  • nickase enzyme system e.g. Cas9D10A
  • a strong effect was found when administering at least one compound (III) optionally with at least one compound (I) and/or at least one compound (IV), particularly in the absence of a compound (II) together with the use of a nuclease (e.g. Cpf1 ) or nickase enzyme system (e.g. Cas9D10A) capable of introducing a staggered cut in a DNA double strand, e.g. a chromosomal DNA, at a desired locus.
  • a nuclease e.g. Cpf1
  • nickase enzyme system e.g. Cas9D10A
  • an aspect of the invention relates to a combination, e.g. a composition or a kit comprising at least two of (a) a compound (I), (b) a compound (II), (c) a compound (III), and (d) a compound (IV).
  • a preferred embodiment is a combination wherein the compound (I) is Trichostatin A, and/or the compound (II) is MLN4924, and/or the compound (III) is NU7026, and/or the compound (IV) is NSC15520.
  • the combination of the invention is intended for use in genome editing including multiplexed genome editing on both chromosomes both in non-medical applications and in medical applications.
  • compositions comprising at least two compounds as indicated above together in admixture optionally together with a suitable carrier, e.g. a pharmaceutically acceptable carrier.
  • suitable carrier e.g. a pharmaceutically acceptable carrier.
  • kits comprising at least two compounds as indicated above in separate forms, each optionally together with a suitable carrier, e.g. a pharmaceutically acceptable carrier.
  • the present invention relates to a combination, e.g. a composition or kit comprising (i) at least one compound (I) and at least one compound (II), (ii) at least one compound (I) and at least one compound (III), (iii) at least one compound (I) and at least one compound (IV), (iv) at least one compound (I I) and at least one compound (III), (v) at least one compound (II) and at least one compound (IV), or (vi) at least one compound (III) and at least one compound (IV).
  • Preferred compounds (I), (II), (III), and/or (IV) are as indicated above.
  • the present invention relates to a combination, e.g. a composition or kit comprising (i) at least one compound (I), at least one compound (II), and at least one compound (III), (ii) at least one compound (I), at least one compound (II), and at least one compound (IV), or (iii) at least one compound (II), at least one compound (III), and at least one compound (IV).
  • a combination e.g. a composition or kit comprising (i) at least one compound (I), at least one compound (II), and at least one compound (III), (ii) at least one compound (I), at least one compound (I), and at least one compound (IV), or (iii) at least one compound (II), at least one compound (III), and at least one compound (IV).
  • Preferred compounds (I), (II), (III), and/or (IV) are as indicated above.
  • the present invention relates to a combination, e.g. a composition or kit comprising at least one compound (I), at least one compound (II), at least one compound (III), and at least one compound (IV).
  • a combination e.g. a composition or kit comprising at least one compound (I), at least one compound (II), at least one compound (III), and at least one compound (IV).
  • Preferred compounds (I), (II), (III), and/or (IV) are as indicated above.
  • the present invention relates to a combination comprising at least one compound (III) and at least one compound (I) and optionally at least one compound (II) and/or at least one compound (IV).
  • compound (II) is absent.
  • the present invention relates to a combination comprising at least one compound (III) and at least one of a compound (I) and a compound (IV).
  • compound (II) is absent.
  • the combination of the present invention as described may further include one or more additional compounds.
  • the combination may include a compound for synchronizing cells in the G2/M phase such as Nocodazole and ABT-751 (Yang et al., 2016), paclitaxel (Shu et al., Apoptosis 2 (1997), 463-470), or colchicine or vincristine (Blajeski et al., J. Clin. Invest.
  • the combination may include an Alt-NHEJ inhibitor such as NSC19630 or a salt or solvate thereof, in particular together with a catalytically inactive DNA protein kinase catalytic subunit.
  • the combination e.g. the composition or kit of the invention is suitable for use in genome editing in a eukaryotic target cell, particularly in a eukaryotic target cell as described in the following, including an animal target cell such as a mammalian target cell, e.g. a human target cell, but also target cell from non-human animals such as mice or zebrafish including a stem cell, e.g. human stem cell, for example an embryonic stem cell or a pluripotent stem cell.
  • an animal target cell such as a mammalian target cell, e.g. a human target cell
  • target cell from non-human animals such as mice or zebrafish
  • a stem cell e.g. human stem cell, for example an embryonic stem cell or a pluripotent stem cell.
  • the target cell is a stem cell of a eukaryotic target organism, including an induced or embryonic pluripotent stem cell such as a human induced or embryonic pluripotent stem cell but also an induced or embryonic pluripotent stem cell from non-human animals.
  • the target cell is a hematopoietic cell or a hematopoietic progenitor cell.
  • the target cell is an immortalized cell such as a cancer cell.
  • the combination e.g. the composition or kit of the invention is particularly suitable in a genome editing procedure which comprises introducing a staggered cut, particularly a staggered cut with 5' overhangs, into the genome of the target cell.
  • the target cell may comprise a mutated nickase version of CRISPR/Cas9 such as CRISPR/Cas9 D10A or CRISPR/Cas9 H840A enzymes which are mutated nickase versions of CRISPR/Cas9 or a CRISPR/Cpfl enzyme.
  • CRISPR/Cas9 such as CRISPR/Cas9 D10A or CRISPR/Cas9 H840A enzymes which are mutated nickase versions of CRISPR/Cas9 or a CRISPR/Cpfl enzyme.
  • other genome editing enzymes e.g.
  • CRISPRs transcription activator-like effector-based nucleases
  • TALENs transcription activator-like effector-based nucleases
  • TtAgo Thermus thermophiles
  • recombinases or meganucleases or other enzymes
  • the present invention is also suitable together with split-fusion versions of the above enzymes, e.g. split-fusion versions of Cas9 or Cas9 D10A (Zetsche et al., 2015).
  • the enzyme(s) may be introduced into the target cell as such, e.g.
  • nucleic acid molecule may be introduced as an expression vector such as a plasmid in operative linkage with appropriate expression control elements for transient or stable expression in the target cell.
  • Suitable transfection techniques for introducing proteins or nucleic acids into the eukaryotic target cells are well known in the art and include lipofection, electroporation, e.g. nucleofection, Ca-phosphate or virus-based methods.
  • the present invention relates to the use of a combination comprising at least one compound (III) and at least one compound (I) and optionally at least one compound (II) and/or at least one compound (IV) for the genome editing in a eukaryotic target cell which is a stem cell including an induced or embryonic pluripotent stem cell such as a human induced or embryonic stem cell, wherein the genome editing procedure which comprises introducing a staggered cut, particularly a staggered cut with 5' overhangs, into the genome of the target cell.
  • a staggered cut may be introduced into the genome of the target cell by enzymes as indicated supra.
  • the present invention relates to the use of a combination comprising of at least one compound (III) and at least one compound (I) and optionally at least one compound (IV) particularly in the absence of a compound (II) for genome editing in a eukaryotic target cell which is hematopoietic cell such as a T cell, e.g. a CD4 + T cell or a hematopoietic progenitor cell such as a CD34 + cell, wherein the genome editing procedure which comprises introducing a staggered cut, particularly a staggered cut with 5' overhangs, into the genome of the target cell.
  • a staggered cut may be introduced into the genome of the target cell by enzymes as indicated supra.
  • the present invention relates to the use of a combination comprising at least one compound (III) optionally with at least one of a compound (I) and/or a compound (IV) particularly in the absence of a compound (II) for the genome editing in a eukaryotic target cell which is a mammalian immortalized cell, e.g. HEK293 or K562 wherein the genome editing procedure which comprises introducing a staggered cut, particularly a staggered cut with 5' overhangs, into the genome of the target cell.
  • a staggered cut may be introduced into the genome of the target cell by enzymes as indicated supra.
  • composition or kit of the present invention may further comprise (i) a DNA protein kinase catalytic subunit (DNA-PKcs) which is catalytically inactive, but structurally intact, (ii) a nucleic acid molecule encoding the DNA protein kinase catalytic subunit of (i) and/or (iii) a eukaryotic cell comprising or capable of expressing the DNA protein kinase catalytic subunit of (i) including a split-fusion version thereof.
  • the catalytically inactive, but structurally intact mutant has an amino acid sequence identity to the corresponding wild-type sequence, e.g.
  • Suitable structurally intact and catalytically inactive mutants and tests for detecting such mutants are e.g. described by Neal et al., 2001 , herein incorporated by reference.
  • the catalytically inactive, but structurally intact DNA-PKcs subunit may be introduced into the target cell as protein or as nucleic acid encoding the respective subunit for transient or stable expression in the target cell.
  • This approach may be used in combination with a Knock-down of the endogenous DNA-PKcs gene in the target cell, e.g. by targeted homologous recombination or by use of RNA interference, e.g. siRNAs.
  • RNA interference e.g. siRNAs.
  • this approach may be used in cells without endogenous DNA-PKcs, e.g. by using a DNA-PKcs mutant from a different species, e.g. evolutionary closely related species.
  • the DNA-PKcs mutant comprises at least one mutation in the catalytic loop (amino acids 3919-3927) including the catalytic triade (N3927, D3922, H3924) or in the P- loop (amino acids 3729-3735) or in the adjacent region (amino acids 3736-3760) including amino acids F3946, T3950, and particularly K3753 based on the NCBI reference sequence NP_008835.5. It may also comprise a mutation leading to a truncation (e.g. Y4046*) based on the NCBI reference sequence NP 008835.5, which reduces or inactivates the kinase activity.
  • the position of the indicated amino acids may vary in DNA- PKcs or its orthologues in other species than humans.
  • the DNA-PKcs mutant comprises at least one mutation at position K3753, e.g. the mutation K3753R, and/or K3753H, at position D3922, e.g. the mutation D3922A, at position T3950, e.g. the mutation T3950D, and/or at position F3946, e.g. F3946D, based on the NCBI reference sequence NP_008835.5.
  • the position of the indicated amino acids may vary in DNA-PKCs or its orthologues in other species than humans.
  • the DNA-PKcs can comprise at least one mutation in the phosphorylation clusters, which are normally targets of its autophosphorylation function. These can include inactivating mutations, e.g. but not restricted to alanine, for the PQR cluster (S2023 and/or S2029 and/or S2041 and/or S2053 and/or S2056), and/or activating (phosphomimicking) mutations, e.g.
  • aspartatic acid for the ABCDE cluster (T2069 and/or S2612 and/or T2620 and/or S2624 and/or T2638 and/or T2647) and/or the N cluster (S56 and/or S72) and/or the JK cluster (T946 and/or S1003) based on the NCBI reference sequence NP 008835.5.
  • the position of the indicated amino acids may vary in DNA- PKCs or its orthologues in other species than humans.
  • the combination e.g. the composition or kit is suitable for use with all kinds of donor nucleic acid molecules including but not limited to single stranded molecules or double stranded DNA molecules whether amplified in vivo or in vitro or chemically synthesized.
  • the length of the donor nucleic acid molecules is usually in the range of about 20 to 2000 nt or more, e.g. about 80 to 120 nt, 50 to 200 nt or 500 to 2000 nt.
  • the donor nucleic acid molecules are designed to include at least one desired mutation in view of the wild type sequence which is to be introduced into the genome of the target cell by genome editing.
  • the mutation may be a single nucleotide mutation or a mutation encompassing a plurality of nucleotides.
  • the term mutation refers to a substitution, deletion, or insertion of single nucleotides or of a plurality of nucleotides.
  • the above aspects comprise a use in vivo, e.g. in isolated cells or cell clusters, but also in vitro, in cells of a target organism.
  • the combinations can be applied in cell types and with genome editing procedures as indicated above, particularly including the use of DNA cleavage enzyme systems capable of introducing a staggered cut in a DNA double strand.
  • This aspect also includes a use in medicine including human or veterinary medicine.
  • a further aspect of the present invention relates to the use of (i) a DNA protein kinase catalytic subunit which is catalytically inactive, but structurally intact, as described above, particularly the mutated subunit K3753R, (ii) a nucleic acid molecule encoding the DNA protein kinase catalytic subunit of (i) and/or (iii) a eukaryotic cell comprising or capable of expressing the DNA protein kinase catalytic subunit of (i) for genome editing in a eukaryotic target cell, particularly in a vertebrate target cell, e.g. a mammalian target cell including a rodent, a human or non-human target cell including a human stem cell.
  • a DNA protein kinase catalytic subunit which is catalytically inactive, but structurally intact, as described above, particularly the mutated subunit K3753R
  • a nucleic acid molecule encoding the DNA protein kin
  • This aspect comprises a use in vivo, e.g. in isolated cells or cell clusters, but also in vitro, in cells of a target organism.
  • the DNA-PKcs mutants can be applied in all cell types and with all types of genome editing procedures, e.g. including the use of any DNA cleavage enzyme, e.g. enzyme systems capable of introducing a staggered cut in a DNA double strand as described above, but also other enzyme systems, e.g. enzyme systems capable of introducing a blunt ended cut.
  • This aspect also includes a use in medicine including human or veterinary medicine. Still a further aspect of the present invention is the use of the combination, e.g.
  • composition or kit comprising at least two different compounds (I), (II), (III), and (IV) in medicine including human or veterinary medicine.
  • An effective dose of the compounds according to the invention, or their salts, solvates or prodrugs thereof is used, in addition to physiologically acceptable carriers, diluents and/or adjuvants for producing a pharmaceutical composition.
  • the dose of the active compounds can vary depending on the route of administration, the age and weight of the patient, the nature and severity of the diseases to be treated, and similar factors.
  • the daily dose can be given as a single dose, which is to be administered once, or be subdivided into two or more daily doses, and is as a rule 0.001 -2000 mg. Particular preference is given to administering daily doses of 0.1 -500 mg, e.g. 0.1 -100 mg.
  • Suitable administration forms are oral, parenteral, intravenous, transdermal, topical, inhalative, intranasal and sublingual preparations. Particular preference is given to using oral, parenteral, e.g. intravenous or intramuscular, intranasal preparations, e.g. dry powder or sublingual, of the compounds according to the invention.
  • the customary galenic preparation forms such as tablets, sugar-coated tablets, capsules, dispersible powders, granulates, aqueous solutions, alcohol-containing aqueous solutions, aqueous or oily suspensions, syrups, juices or drops, can be used.
  • Solid medicinal forms can comprise inert components and carrier substances, such as calcium carbonate, calcium phosphate, sodium phosphate, lactose, starch, mannitol, alginates, gelatine, guar gum, magnesium stearate, aluminium stearate, methyl cellulose, talc, highly dispersed silicic acids, silicone oil, higher molecular weight fatty acids, (such as stearic acid), gelatine, agar agar or vegetable or animal fats and oils, or solid high molecular weight polymers (such as polyethylene glycol); preparations which are suitable for oral administration can comprise additional flavourings and/or sweetening agents, if desired.
  • carrier substances such as calcium carbonate, calcium phosphate, sodium phosphate, lactose, starch, mannitol, alginates, gelatine, guar gum, magnesium stearate, aluminium stearate, methyl cellulose, talc, highly dispersed silicic acids, silicone oil, higher mole
  • Liquid medicinal forms can be sterilized and/or, where appropriate, comprise auxiliary substances, such as preservatives, stabilizers, wetting agents, penetrating agents, emulsifiers, spreading agents, solubilizers, salts, sugars or sugar alcohols for regulating the osmotic pressure or for buffering, and/or viscosity regulators.
  • auxiliary substances such as preservatives, stabilizers, wetting agents, penetrating agents, emulsifiers, spreading agents, solubilizers, salts, sugars or sugar alcohols for regulating the osmotic pressure or for buffering, and/or viscosity regulators.
  • Preparations for parenteral administration can be present in separate dose unit forms, such as ampoules or vials.
  • Use is preferably made of solutions of the active compound, preferably aqueous solution and, in particular, isotonic solutions and also suspensions.
  • These injection forms can be made available as ready-to-use preparations or only be prepared directly before use, by mixing the active compound, for example the lyophilisate, where appropriate containing other solid carrier substances, with the desired solvent or suspending agent.
  • Intranasal preparations can be present as aqueous or oily solutions or as aqueous or oily suspensions. They can also be present as lyophilisates which are prepared before use using the suitable solvent or suspending agent.
  • inhalable preparations can present as powders, solutions or suspensions.
  • inhalable preparations are in the form of powders, e.g. as a mixture of the active ingredient with a suitable formulation aid such as lactose.
  • the preparations are produced, aliquoted and sealed under the customary antimicrobial and aseptic conditions.
  • the compounds of the invention may be administered alone or as a combination therapy with further active agents.
  • the medical use of the combination of the present invention particularly encompasses target gene therapy, e.g. the treatment of disorders associated with an undesired genotype of a patient in need of the treatment.
  • the disorder is a metabolic dysfunction or cancer.
  • cells from the patient may be subjected to a genome editing procedure in the presence of a combination as described above, thereby increasing the precise genome editing efficiency.
  • This procedure may be carried out in vivo, i.e. by administering the combination to the patient or ex vivo with cells isolated from the patients, which are - after successful genome editing - reimplanted into the patient.
  • the patient may be a vertebrate animal such as a mammal, preferably a human patient.
  • the combination of the present invention is also suitable for genome editing in plant cells or plants.
  • Fig. 1 Genome editing and analysis flowchart.
  • iCRISPR 409-B2 iPSCs are treated with 2 ⁇ 9/ ⁇ doxycycline at least for 2 days to induce Cas9 or Cas9D10A expression.
  • Reverse transfection with RNAiMAX, gRNA (7.5 nM each), ssODN (10 nM) and the small molecules to be evaluated is carried out in a 96 well plate for 1 day. The amount of cells used gives ⁇ 80% confluency. Cells are then expanded for 3 days with regular media change. After harvest follows DNA extraction, PCR amplification of targeted loci, lllumina sequencing and CRISPResso (Pinello et al. 2016) sequence analysis for amount of indels and precise genome editing.
  • Fig. 2 Design of gRNAs and ssODN for precise genome editing (PGE) of human CALD1, KATNA1 and SLITRK1 to the ancient state of the last common ancestor of human and Neanderthal. Shown are the respective loci of CALD1, KATNA1 and SLITRK1 together with the gRNAs and their efficiency score (sc) (sgRNA scorer 1 .0 Chari et al. 2015) used for DSB generation.
  • the PAM site is grey, the target sequence is blue and the base to be changed is red.
  • the point of nick by Cas9D10A (Cas9n) or DSB by Cas9 is indicated by an arrow.
  • CALD1 g1 , KATNA1 g2 and SLITRK1 g2 are used for editing with Cas9.
  • the respective ssODN for editing with both Cas9 variants are also shown. Desired mutation is marked green and additional mutations are orange. .Block' indicates a Cas9-blocking mutation to prevent re-cutting oft the locus. All Cas9D10A donors have 50nt homology arms after the nicks while all Cas9 donors are 90nt in total with the desired mutation centered in the middle. The full sequences are shown in Table 2.
  • Fig. 3 First screen for solvent effect and influence of different small molecule concentrations on genome editing of CALD1, KATNA1 and SLITRK1 with iCRISPR Cas9D10A. Shown are precise genome editing (PGE) and indels with green circles (triangles) or blue diamonds, respectively. Each symbol represents a technical replicate. The respective means are shown as a black line. Each skull indicates cell death of up to 20% determined by phase contrast light microscopy. All cells died with 1 ⁇ and 0.1 ⁇ Trichostatin A. Concentrations chosen for further experiments are marked with turquoise.
  • PGE precise genome editing
  • indels with green circles (triangles) or blue diamonds, respectively. Each symbol represents a technical replicate. The respective means are shown as a black line.
  • Each skull indicates cell death of up to 20% determined by phase contrast light microscopy. All cells died with 1 ⁇ and 0.1 ⁇ Trichostatin A. Concentrations chosen for further experiments are marked with turquoise.
  • Fig. 4 Effects of small molecules on precise genome editing (PGE) efficiency in CALD1, KATNA1 and SLITRK1 with Cas9D10A and Cas9.
  • PGE efficiency is given in relative units (RU) with the mean of controls set to 1 to account for varying efficiency in different loci. Shown are technical replicates of n independent experiments. Grey and black bars represent the mean of the control and the respective small molecule, respectively.
  • TSA Trichostatin A
  • Fig. 5 Impact of small molecule combinations on precise genome editing (PGE) efficiency in CALD1, KATNA1 and SLITRK1 with Cas9D10A and Cas9, and in HPRT and DMNT1 with Cpf1.
  • Small molecules have an additive effect on PGE efficiency with Cas9D10A (A) but not with Cas9 (B) in the 409-B2 iCRISPR iPSC lines.
  • PGE efficiency of HPRT and DMNT1 in 409-B2 hiPSCs with recombinant Cpf1 was increased using the CRISPY mix as well (C).
  • PGE efficiency was also increased in SC102A1 hiPSCs and H9 hESCs with plasmid-delivered Cas9n-2A-GFP (GFP-FACS enriched), and in chimpanzee SandraA ciPSCs with recombinant Cpf1 (D). Shown are PGE, PGE + indels, and indels with green, grey or blue bars, respectively. Error bars show the standard deviation of three technical replicates for A,B and C and two technical replicates for D.
  • Fig. 6 Impact of the CRISPY mix and small molecule combinations on Precise Genome Editing (PGE) efficiency in HPRT w ⁇ th Cp l in non-pluripotent cell types. All possible combinations for the CRISPY mix components are shown for HEK293 and K562 cells (A). While NU7026 increases PGE efficiency, TSA and NSC15520 have no clear effect, and MLN4924 has a clear disruptive effect in those cell lines with cancer characteristics. MLN4924 has a disruptive effect on PGE efficiency in primary cells as well (B). The CRISPY mix without MLN4924 has a higher effect on PGE efficiency than NU7026 alone In CD4 + T and CD34 + progenitor cells.
  • PGE Precise Genome Editing
  • CRISPY mix indicates a small molecule mix of 20 ⁇ NU7026, 0.01 ⁇ Trichostatin A (TSA), 0.5 ⁇ MLN4924 and 5 ⁇ NSC 15520.
  • TSA Trichostatin A
  • MLN4924 0.5 ⁇ MLN4924 and 5 ⁇ NSC 15520.
  • Fig. 7 Toxicity of the CRISPY mix and its components.
  • Resazurin is converted into fluorescent resorfin by cellular dehydrogenases and resulting fluorescence (Exitation: 530-570nm, Emission: 590-620nm) is considered as a marker for cell viability (O'Brien et al. 2000).
  • the CRISPY mix is highlighted with black borders and is slightly toxic with no additive toxic effect of its components. Error bars show the standard deviation of two technical replicates.
  • Fig. 8 Impact of the CRISPY mix and its component NU7026 on BFP insertion (ssODN) efficacy in human induced pluripotent stem cells.
  • the design of the mtagBFP2 (Subach et al. 201 1 ) ssODN donor and the iCRISPR system is shown in (A).
  • Representative images of the mock, NU7027, and CRISPY mix treatment, after 7 days of BFP expression are shown in (B) as phase contrast (PC), propidium iodide nuclei staining (PI), mtagBFP2 expression (BFP) and merge of PI and BFP.
  • PC phase contrast
  • PI propidium iodide nuclei staining
  • BFP mtagBFP2 expression
  • C Two images (50x magnification, white size bar 200 ⁇ ) from each of three technical replicates for the respective treatments were used to quantify the percentage of cells with BFP insertion using ImageJ (C).
  • Fig. 9 Catalytically inactive DNA-PKcs (K3753R) promotes Homology-Directed- Repair (HDR) and blocks Non-Homologous-End-Joining (NHEJ).
  • HDR Homology-Directed- Repair
  • NHEJ Non-Homologous-End-Joining
  • DSB Double Strand Break
  • CRISPR Cas9 or Cpf1 light blue with gray gRNA
  • DNA ends are covered by Ku70/80 (orange), followed by binding of DNA-PKcs (cyan), both constituting a DNA-PK complex on each DSB end (A).
  • A Non-Homologous-End-Joining
  • DNA-PKcs is catalytically inactivated (e.g. by the K3753R mutation), autophosphorylation cannot take place and the NHEJ pathway is be blocked.
  • Kinase-inactivated DNA-PKcs leads preferential HDR repair of the DSB.
  • the organizational structure of DNA-PKcs, with its phosphorylation clusters, its kinase (purple) and the K3753R mutation (dark blue) are shown in (B)(adapted from Neal et al. 2014).
  • the 4128aa ( ⁇ 470kDa) long enzyme has following phosphorylation clusters consisting of serines/threonines: N (residues 56 and 72), JK (residues 946 and 1003), PQR (five residues between 2023 and 2056), and ABCDE (six residues between 2609 and 2647).
  • Some clusters activate DNA-PKcs when phosphorylated, while others disengage NHEJ or even inactive the kinase (Neal et al. 2014).
  • Phosphorylation of the N cluster, as well as T3950, and the K3753R mutation have been shown to inactivate the kinase activity (Neal et al. 201 1 , Shrivastav et al. 2008, Douglas et al. 2007).
  • DNA-PKcs and its sequence around K3753 are evolutionary conserved in vertebrates (C) (Kent et al. 2002).
  • Fig. 10 Catalytically inactive DNA-PKcs (K3753R) leads to almost absolute conversion of DNA double strand breaks to precise genome editing (PGE).
  • the KR mutant leads to increased PGE compared to wildtype DNA-PKcs in 409-B2 hiPSCs, regardless of the type of double strand break introduced. Shown is increased PGE of CALD1, KATNA1, SLITRK1 and PRKDC (R3753K) with Cas9n double nicking (A), and of CALD1 with Cas9 or HPRT WA Cpf1 (B). Shown are PGE, PGE + indels, and indels with green, light green or blue bars, respectively. Error bars show the standard deviation of three technical replicates for each of two independent experiments for A, and two technical replicates for B. Cells were incubated for 3 days with doxycycline to express Cas9n for double nicking of A.
  • Fig. 11 Efficient Multiplexed Precise Genome Editing (MPGE) of CALD1, KATNA1, and SLITRK1. Electroporation of gRNAs and ssODN DNA donors allows robust bulk precise genome editing (PGE) efficiencies for all three genes in 409-B2 hiPSCs with the DNA-PKcs KR mutation (A). Shown are PGE, PGE + indels, and indels with green, light green or blue bars, respectively. Error bars show the standard deviation of two technical replicates and cells were incubated for four days with doxycycline to express Cas9n for double nicking.
  • MPGE Efficient Multiplexed Precise Genome Editing
  • TNS Targeted Nucleotide Substitution
  • B Targeted Nucleotide Substitution
  • B The double nicking guide targets (blue) and the mutations (green) for the respective genes are shown in scale.
  • Heatmaps of genome editing events (TNS and/or indels) in chromosomes carrying CALD1, KATNA1, and SLITRK1 of 33 analysed clones are shown in (C). Most clones either remain wildtype or are precisely edited for all three genes.
  • Heatmaps present either two chromosomes for a single gene or six chromosomes for all three genes, with incorporation of indels and incorporation of any TNS, regardless if blocking mutation or ancient mutation (left panel), or of incorporation of at least the ancient mutation (right panel).
  • Generation of a MPGE clones is possible in less than two weeks, if single cell dilution seeding is carried out using a small portion of just electroporated cells (D). Of 56 colonies picked, 45 survived and 12 of those originated from more than one cell (based on DNA sequencing read proportions), leaving 33 clones for analysis.
  • Fig. 12 Additive effect of CRISPY mix and DNA-PKcs (K3753R) on precise genome editing (PGE) efficiency in CALD1, KATNA1 and SLITRK1 with Cas9D10A.
  • the PGE efficiency is strongly increased with the DNA-PKcs KR mutant (KR) compared to the wildtype (WT) and further increased by addition of the CRISPY mix for single genes (A), and even more for multiplexed PGE (B), where efficiencies are generally lower. Shown are PGE, PGE + indels, and indels with green, light green or blue bars, respectively. Error bars show the standard deviation of three technical replicates.
  • CRISPY mix indicates a small molecule mix of 20 ⁇ NU7026, 0.01 ⁇ Trichostatin A (TSA), 0.5 ⁇ MLN4924 and 5 ⁇ NSC 15520. Cells were incubated for 2 days (4 days for multiplexing) with doxycycline to express Cas9n for double nicking.
  • TSA Trichostatin A
  • Fig. 13 Representative karyogram of 409-B2 iCRISPR hiPSCs with the DNA-PKcs KR mutation after 3 months in culture. Of 25 metaphases, analyzed by trypsin induced giemsa staining, all show a healthy karyotype (46, XX). No numerical or large scale chromosomal aberrations were identified (band number 350, gray shades 3).
  • Stem cell lines cultured for this project included human 409-B2 hiPSC (female, Riken BioResource Center) and SC102A1 hiPSC (male, BioCat GmbH), chimpanzee SandraA ciPSC (female, Mora-Bermudez et al. 201637), as well as H9 hESC (female, WiCell Research Institute, Ethics permit AZ 3.04.02/01 18).
  • Stem cell lines were grown on Matrigel Matrix (Corning, 35248), and mTeSRI (StemCell Technologies, 05851 ) with mTeSRI supplement (StemCell Technologies, 05852) was used as culture media.
  • Non- pluripotent cell types and their respective media used were: HEK293 (ECACC, 85120602) with DMEM/F-12 (Gibco, 31330-038) supplemented with 10% FBS (SIGMA, F2442) and 1 % NEAA (SIGMA, M7145); K562 (ECACC, 89121407) with IMDM (ThermoFisher, 12440053) supplemented with 10% FBS; CD4 + T (HemaCare, PB04C-1 ) with RPMI 1640 (ThermoFisher, 1 1875-093) supplemented with 10% FBS, and activated with Dynabeads Human T-Activator (CD3/CD28) (ThermoFisher, 1 1 131 D); CD34 + progenitor (HemaCare, M34C-1 ) with StemSpan SFEM (Stemcell, 09600) supplemented with StemSpan CC1 10 (StemCell, 02697); and
  • iCRISPR-Cas9 Human 409-B2 iPSCs were used to create an iCRISPR-Cas9 line as described by Gonzalez et al. (Gonzalez et al. 2014).
  • iCRISPR-Cas9D10A line Puro-Cas9 donor was subjected to site-directed mutagenesis with the Q5 mutagenesis kit (New England Biolabs, E0554S). Primers were ordered from IDT (Coralville, USA) and are shown in Table 2.
  • Expression of the pluripotency markers SOX2, OCT-4, TRA1 -60 and SSEA4 in iCRISPR lines was validated using the PSC 4-Marker immunocytochemistry kit (Molecular Probes, A24881 ) (data not shown). Quantitative PCR was used to confirm doxycycline inducible Cas9 or Cas9D10A expression and digital PCR was used to exclude off-target integration of the iCRISPR cassettes (data no shown).
  • STL127685 is a 4-fluorophenyl analog of the non-commercially available STL127705.
  • Stocks of 15 mM (or 10 mM for NU7026) were made using dimethylsulfoxide (DMSO)(Thermo Scientific, D12345). Solubility is a limiting factor for NU7026 concentration. Suitable working solutions for different concentrations were made so that addition of each small molecule accounts for a final concentration of 0.08% (or 0.2% for NU7026) DMSO in the media. Addition of all small molecules would lead to a final concentration of 0.7% DMSO.
  • DMSO dimethylsulfoxide
  • gRNA pairs for editing with the Cas9D10A nickase were selected to cut efficiently at a short distance from the desired mutation and from the respective partnering sgRNA. The efficiency was estimated with the sgRNA scorer 1.0 tool (Chari et al. 2015) as a percentile rank score.
  • Donor ssODNs for nickase editing were designed to have the desired mutation and Cas9-blocking mutations to prevent re-cutting of the locus and had at least 30nt homology arms upstream and downstream of each nick (Fig.
  • gRNA of the nickase gRNA pair that cuts closer to the desired mutation was used for Cas9 nuclease editing together with a 90nt ssODN centered at the desired mutation and containing a Cas9-blocking mutation (Fig. 2).
  • ssODNs for editing of HPRT and DMNT1 using Cpf1 were designed to contain a blocking mutation near the PAM site and an additional mutation near the cut.
  • gRNAs (crRNA and tracR) and ssODN were ordered from IDT (Coralville, USA). ssODNs and crRNA targets are shown in Table 2.
  • RNAiMAX Invitrogen, 13778075
  • OPTI-MEM 25 ⁇ OPTI-MEM
  • RNAiMAX RNAiMAX
  • gRNAs gRNAs
  • ssODNs RNAiMAX
  • the lipofection mix was incubated for 20-30 min at room temperature. During incubation cells were dissociated using EDTA for 5 min and counted using the Countess Automated Cell Counter (Invitrogen).
  • the lipofection mix 100 ⁇ containing 25.000 dissociated cells in mTeSRI supplemented with Y-27632, 2 ⁇ g/ml doxycycline and the respective small molecule(s) to be tested were throughoutly mixed and put in one well of a 96 well covered with Matrigel Matrix (Corning, 35248). Media was exchanged to regular mTeSRI media after 24hours.
  • the recombinant A.s. Cpf1 and S.p. Cas9 protein and electroporation enhancer was ordered from IDT (Coralville, USA) and nucleofection was done using the manufacturer's protocol, except for the following alterations. Nucleofection was done using the B-16 program (or U-14 for CD4 + T cells) of the Nucleofector 2b Device (Lonza) in cuvettes for 100 ⁇ Human Stem Cell nucleofection buffer (Lonza, VVPH-5022), or Human T Cell nucleofection buffer for CD4 + T cells (Lonza, VPA-1002), and Human CD34 Cell nucleofection buffer for CD34 + progenitor cells (Lonza, VPA-1003), containing 1 million cells of the respective lines, 78 pmol electroporation enhancer, 160pmol of each gRNA (crRNA/tracR duplex for Cas9 and crRNA for Cpf1 ) (320pmol for double nicking with both gRNAs for one gene),
  • PCR was done in a T100 Thermal Cycler (Bio-Rad) using the KAPA2G Robust PCR Kit (Peqiab, 07-KK5532-03) with supplied buffer B and 3 ⁇ of cell extract in a total volume of 25 ⁇ .
  • the thermal cycling profile of the PCR was: 95°C 3 min; 34x (95° 15 sec, 65°C 15 sec, 72°C 15 sec); 72°C 60 sec.
  • P5 and P7 lllumina adapters with sample specific indices were added in a second PCR reaction (Kircher et al. 2012) using Phusion HF MasterMix (Thermo Scientific, F-531 L) and 0.3 ⁇ of the first PCR product.
  • the thermal cycling profile of the PCR was: 98°C 30 sec; 25x (98° 10 sec, 58°C 10 sec, 72°C 20 sec); 72°C 5 min. Amplifications were verified by size separating agarose gel electrophoresis using EX gels (Invitrogen, G4010-1 1 ). The indexed amplicons were purified using Solid Phase Reversible Immobilization (SPRI) beads (Meyer, Kircher 2010). Double-indexed libraries were sequenced on a MiSeq (lllumina) giving paired-end sequences of 2 x 150 bp. After base calling using Bustard (lllumina) adapters were trimmed using leeHom (Renaud et al. 2014).
  • SPRI Solid Phase Reversible Immobilization
  • CRISPresso (Pinello et al. 2016) was used to analyse sequencing data from CRISPR genome editing experiments for percentage of wildtype, targeted nucleotide substitutions (TNS), indels and mix of TNS and indels.
  • Parameters used for analysis were '-w 20', '-- min_identity_score 70' and '-ignore_substitutions' (analysis was restricted to amplicons with a minimum of 70% similarity to the wildtype sequence and to a window of 20bp from each gRNA; substitutions were ignored, as sequencing errors would be falsly characterized as NHEJ-events). Sequencing data from colonies after single cell seeding (Fig.
  • 409-B2 iCRISPR-Cas9n hiPSCs were either seeded with or without editing reagents (RNAiMax, gRNA and ssODN donor for KATNA1 editing) as described in 'Lipofection of oligonucleotides'.
  • the media was supplemented with small molecules or combinations of small molecules, and each condition was carried out in duplicate. After 24h media was aspirated and 100 ⁇ fresh media together with 10 ⁇ resazurin solution (Cell Signaling, 1 1884) was added.
  • Resazurin is converted into fluorescent resorfin by cellular dehydrogenases and resulting fluorescence (Exitation: 530-570nm, Emission: 590- 620nm) is considered as a linear marker for cell viability (O'Brien et al. 2000).
  • Cells were incubated with resazurin at 37°C.
  • the redox reaction was measured every hour by absorbance readings using a Typhoon 9410 imager (Amershamn Biosciences). After 5h the absorbance scan showed a good contrast without being saturated, and was used to quantify the absorbance using ImageJ and the 'ReadPlate' plugin. Duplicate wells with media and resazurin, but without cells, were used a blank.
  • 409-B2 iCRISPR-Cas9n hiPSCs were nucleofected with gRNAs and the Blue Fluorescent Protein (BFP) single stranded oligo (Fig. (8A, 330ng) in two technical replicates for either mock, NU7026, and CRISPY mix treatment. Media was supplemented with 2pg/ml doxycycline (Clontech, 63131 1 ) for 7 days, to allow expression of nuclear imported BFP in precisely edited cells.
  • BFP Blue Fluorescent Protein
  • a fluorescent microscope Axio Observer Z was used to aquire two images (50x magnification), from each of three technical replicates for the respective treatments, consisting of: phase contrast, HcRed channel (BP 580-604nm, BS 615nm, BP 625-725nm, 10.000ms), and DAPI channel (BP 335-383nm, BS 395nm, BP 420-470nm, 20.000ms). Images were blinded and BFP positive nuclei were counted using the Adobe Photoshop CS5 counting tool. Propidium iodide positive nuclei were quantified using ImageJ by dividing the area of nuclei (default threshold) with the mean area of a single nucleus.
  • Table 1 Overview of the small molecules evaluated in this study. The protein targeted, its function, as well as its respective pathway and the function of the small molecule are shown. Literature references with an asterisk indicate the small molecule as a CRISPR-Cas effector. Abbreviations: alternative NHEJ (Alt-NHEJ), damage dependent signaling (DDS).
  • DNA-PKcs DNA-PKcs
  • DNA-PK phosphorylates itself and NU7026 DNA-PK inhibitor
  • gRNA crRNA target
  • ssODNs single stranded DNA donors
  • KATNA1 11 AAATGATGACCCTTCCAAAA (SEQ ID NO.3)
  • KATNA1 12 CAACACCTAAAATAAGGGTA (SEQ ID NO. )
  • SLITRK1 11 GCTAACAGTTTACCCTGCCC (SEQ ID NO.5)
  • SLITRK1 11 ACCCGTCGCTATCGCTGCTG (SEQ ID NO.6 )
  • PRKDC t1 GGTCCTCGCCACCCTTCACC (SEQ ID NO.11)
  • CALD1 Cas9D10A CTCCAAGATTGACAGCAGACTGGAGCAGTATACCAGTGCTATTGAGGTGAGAATTGTCCTCA
  • AAGATATTAAGTTGGATTATACCAAATG (SEQ ID NO .16)
  • KATNA1 Cas9D10A CATTTTCAGAGGCGCCTCCAACACCTAAAATAACGGTAAGGGGAGAGTGAAAAAGATATTAA
  • KATNA1 Cas9D10A 2 CATTTTCAGAAGCACCTCCAACACCTAAAATAACGGTAAGGGGAGAGTGAAAAAGATATTAA
  • ATCTGCCAGTTGCCTGGGATCTTTGTAC SEQ ID NO .19
  • SLITRK1 Cas9D10A TTAGCTAAGGGTTTGTTCCTGGCACTGCCCGTCGCTATCGCTGCGGTGGGTCTGATTTTGAT
  • CTGCCAGTTGCCTGGGATCTTTGTACCTCCG SEQ ID NO.20
  • SLITRK1 Cas9D10A 2 TTAGCTAAGGGTTTGTTCCTGGCGCTACCCGTCGCTATCGCAGCTGTGGGTCTGATTTTGAT
  • CTGCCAGTTGCCTGGGATCTTTGTACCTCCG SEQ ID N0.21
  • ATCCTGGCCCAAG (SEQ ID NO .26)
  • Small molecules that we chose to test for their ability to block NHEJ are SCR7, STL127685, which is a 4-fluorophenyl analog of the Ku70/80 inhibitor STL127705 (Weterings et al. 2016), and DNA-PK inhibitor NU7026 (Suzuki et al. 2016).
  • WRN helicase inhibitor NSC 19630 Alkarine et al. 201 1 .
  • the NEDD8 activating enzyme (NAE) inhibitor MLN4924 has been shown to inhibit the neddylation of CtIP, which is increasing the extend of DNA end resection at strand breaks, and therefore regulates DNA double strand break repair pathway choice to preferentially undergo HDR (Jimeno et al. 2015).
  • DNA resection leaves ssDNA which is coated and stabilized by RPA, before undergoing homology search and recombination.
  • RPA Fumaropimaric acid
  • NSC15520 prevents the association of RPA to p53 and RAD9 (Glanzer et al. 201 1 )(Glanzer et al. 2013), possibly increasing the abundance of available RPA for ssDNA.
  • RAD51 is critical for homologous recombination with double stranded DNA (dsDNA), while RAD52 is needed for annealing of ssDNA (Grimme at al. 2010).
  • dsDNA double stranded DNA
  • RAD52 is needed for annealing of ssDNA
  • AICAR Sullivan et al. 2016
  • RAD51 inhibitor B02 Huang et al. 201 1
  • RAD51 enhancer RS-1 Long et al. 2016
  • small molecules that have been described to enhance the repair protein kinase ATM. Resveratrol has been described to have a direct stimulatory effect on the catalytic efficiency of purified ATM in vitro (Lee et al. 2014).
  • Trichostatin A actives an ATM-dependent DNA damage signaling pathway and has been described to increase HR (Lee 2007)(Jimeno et al. 2015). Lastly, we included ⁇ 3- adrenergic receptor agonist L755507 in the screen.
  • NU7026 treatment increased PGE for all three loci with Cas9D10A (Fig. 4A) and Cas9 (Fig. 4B).
  • the mean change was 1 .5-fold for CALD1, 2.6-fold for KATNA1 and 2.5-fold for SLITRK1 with Cas9D10A, and 1 .5-fold for CALD1, 1 .6-fold for KATNA1 and 1.2-fold for SLITRK1 with Cas9.
  • TSA and MLN4924 we found TSA and MLN4924 to have an enhancing effect on PGE frequency with Cas9D10A.
  • TSA increased PGE 1 .5-fold for CALD1, 2.2-fold for KATNA1 and 1 .8-fold for SLITRK1 with Cas9D10A; interestingly no enhancing effect was found with Cas9.
  • MLN4924 increased PGE 1.2-fold for CALD1, 1.1 - fold for KATNA1 and 1.3-fold for SLITRK1 with Cas9D10A. With Cas9 there is a slight diminishing effect of MLN4924 on PGE.
  • Treatment with NSC 15520 increased PGE of CALD1 with Cas9D10A and Cas9 1 .4 fold and 1 .3 fold, respectively. However, there was no effect on PGE of KATNA1 and SLITRK1.
  • NSC 19630, AICAR, RS-1 , Resveratrol, SCR7, L755507 and STL127685 showed no clear effect on PGE frequency over the three genes CALD1, KATNA1 and SLITRK1 compared to the respective controls with Cas9D10A and no effect or a diminishing effect with Cas9.
  • the impact of the CRISPY mix and its components on targeted nucleotide substitution efficiency was tested in a plurality of non -pluripotent cell types including the immortalized human embryonic kidney cell line HEK293, the immortalized leukemic cell line K562, hematopoietic CD4 + T cells and CD34 + hematopoietic progenitor cells as well as primary human keratinocytes (HEKa) by electroporation of Cpf1 .
  • the results are shown in Fig. 6. It was found that the component NU7026 of the CRISPY mix is effective in the tested cell lines except in HEKa cells.
  • NU7026 strongly increases PGE efficiency
  • TSA and NSC15520 moderately increase efficiency
  • MLN4924 has a clear disruptive effect in those cell lines with cancer characteristics.
  • MLN4924 has a disruptive effect on PGE efficiency in primary cells as well.
  • the CRISPY mix without MLN4924 has a higher effect on PGE efficiency than NU7026 alone in hematopoietic CD4 + T and CD34 + progenitor cells.
  • primary human keratinocytes HEKa
  • NU7026 and NSC15520 have a disruptive effect on PGE efficiency.
  • iPSC induced pluripotent stem
  • iCRISPR-D10A doxycycline inducible Cas9 nickase
  • FIG. 1 1 B shows a heatmap of chromosomes with incorporation of indels and incorporation of any TNS, regardless if blocking mutation or ancient mutation (left panel), or of incorporation of at least the ancient mutation (right panel). Most clones either remain wildtype or are precisely edited for all three genes. Strikingly, one third of clones has a TNS without any additional indel on both chromosomes for all three genes.
  • DNA-PKcs KR hiPSCs maintained a healthy karyotype with no numerical or large scale chromosomal aberrations after 26 passages (corresponding to 3 months), as shown by trypsin induced giemsa banding (Fig. 13).
  • the PGE efficiency in the presence of the mutated DNA-PKcs may be further enhanced by the CRISPY mix with Cas9D10A as we show in a further experiment.
  • the DNA-PKcs mutant had a 2.8-fold, 4,3-fold and 12.4-fold increase of PGE for CALD1, KATNA1 and SLITRK1, respectively (see Figure 12).
  • the efficiency of PGE compared to the DNA-PKcs wildtype without small molecule treatment was increased even further.
  • the PGE efficiency was 48% (3.7-fold increase), 82% (4.7-fold increase) and 57.5% (19.2-fold increase) for CALD1, KATNA1 and SLITRK1, respectively.
  • NU7026 Small molecules that increased PGE in pluripotent stem cells with Cas9D10A and ssODN donor both alone (Fig. 4A) and in a mix (Fig. 5A) are NU7026, TSA, MLN4924 and NSC 15520. The mix also shows an additional increasing effect on PGE with Cpf1 but not with Cas9 compared to single treatment with NU7026.
  • NU7026 inhibits DNA-PK, a major complex in NHEJ pathway (Shrivastav et al. 2008) and has been previously shown to increase PGE efficiency in hiPSCs (Suzuki et al. 2016).
  • TSA can activate an ATM- dependent DNA damage signaling pathway (Lee 2007).
  • the Nedd8 activating enzyme (NAE) inhibitor MLN4924 has been shown to inhibit the neddylation of CtIP which is increasing the extent of DNA end resection at strand breaks thereby promoting HDR (Jimeno et al. 2015). DNA resection leaves ssDNA which is coated and stabilized by RPA before undergoing homology search and recombination. NSC15520 prevents the association of RPA to p53 and RAD9 (Glanzer et al. 201 1 )(Glanzer et al. 2013), possibly increasing the abundance of available RPA for ssDNA which could favor HDR.
  • RS-1 , SCR7 and L755507 for which there are conflicting reports on their capacity to increase PGE showed no clear effect in our hands on PGE neither with Cas9 nor with Cas9D10A.
  • the negative effect of MLN4924 with Cas9 editing might be due to shorter ssODN used compared to longer Cas9D10A ssODN. If extensive DNA resection triggered by MLN4924 takes place, there are is no homology left for ssODN annealing if short donors are used. Since long 5'overhangs are present in Cas9D10A editing, homologous DNA is provided, even after extensive resection. Therefore, usage of longer donors might render MLN4924 effective in enhancing precise genome editing also when using Cas9.
  • RAD51 is obviously important for classical homologous recombination with dsDNA (Shrivastav et al. 2008) we wanted to examine if RAD52, rather than RAD51 , could be the driving force behind HDR of ssODN since RAD52 is needed for annealing of ssDNA (Grimme et al. 2010).
  • Our results of the effect of RAD52 inhibitor AICAR, RAD51 inhibitor B02, and RAD51 enhancer RS-1 on PGE efficiency suggests that RAD51 and not RAD52 is important for precise editing with ssODN, since inhibition of RAD51 by B02 halved and inhibition of RAD52 had no effect on PGE efficiency.
  • stimulation of RAD51 with RS-1 had no beneficial effect on PGE.
  • HDR in CHOV3 KR cells has been shown to be 4- to 7-fold above cells expressing wildtype DNA-PKcs (Shrivastav et al. 2008 and 2009).
  • the increase in HDR in CHOV3 KR cells was higher than in CHOV3 DNA-Pkcs knockout cell, suggesting that the protein structure is needed for further enhanced HDR.
  • Phosphorylation of its ABCDE or JK cluster been shown to promote end processing, or inhibit NHEJ, respectively (see Fig. 9B).
  • DNA-PKcs deficiency results in reduced levels of the important repair kinase ATM in cultured cell lines and mice (10).
  • c-NHEJ factors Ku70/80, XRCC4, and LIG4 together with XLF are sufficient to repair low levels of damage (Gu et al., 2000), and a-NHEJ is anyway independent of DNA-PKcs.
  • Prufer, K. et al. The complete genome sequence of a Neanderthal from the Altai Mountains. Nature 505, 43-49 (2014).
  • DNA-PKcs and ATM co-regulate DNA double-strand break repair.
  • Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR- Cas system. Ce// 163, 759-771 (2015).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Pyrane Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Management, Administration, Business Operations System, And Electronic Commerce (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/EP2018/059173 2017-04-10 2018-04-10 Compounds for increasing genome editing efficiency Ceased WO2018189186A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP18722407.6A EP3610008A1 (en) 2017-04-10 2018-04-10 Compounds for increasing genome editing efficiency
JP2019555112A JP7319194B2 (ja) 2017-04-10 2018-04-10 ゲノム編集効率を増大させるための化合物
IL269887A IL269887B2 (en) 2017-04-10 2018-04-10 Compounds to increase genome editing efficiency
KR1020237017487A KR102778328B1 (ko) 2017-04-10 2018-04-10 유전체 편집 효율 증가를 위한 화합물
CA3058697A CA3058697A1 (en) 2017-04-10 2018-04-10 Use of a dna protein kinase inhibitor, a histone deacetylase inhibitor, a nedd8 activating enzyme inhibitor and/or a replication protein a inhibitor for increasing genome editing efficiency
SG11201909432S SG11201909432SA (en) 2017-04-10 2018-04-10 Compounds for increasing genome editing efficiency
US16/603,377 US12173309B2 (en) 2017-04-10 2018-04-10 Compounds for increasing genome editing efficiency
KR1020197032518A KR102537447B1 (ko) 2017-04-10 2018-04-10 유전체 편집 효율 증가를 위한 화합물
CN201880035645.5A CN110691848B (zh) 2017-04-10 2018-04-10 用于提高基因组编辑效率的化合物

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP17165784.4A EP3388517A1 (en) 2017-04-10 2017-04-10 Compounds for increasing genome editing efficiency
EP17165784.4 2017-04-10
EP17203591.7 2017-11-24
EP17203591.7A EP3489357A1 (en) 2017-11-24 2017-11-24 Compounds for increasing genome editing efficiency

Publications (1)

Publication Number Publication Date
WO2018189186A1 true WO2018189186A1 (en) 2018-10-18

Family

ID=62116381

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/059173 Ceased WO2018189186A1 (en) 2017-04-10 2018-04-10 Compounds for increasing genome editing efficiency

Country Status (9)

Country Link
US (1) US12173309B2 (https=)
EP (1) EP3610008A1 (https=)
JP (2) JP7319194B2 (https=)
KR (2) KR102537447B1 (https=)
CN (1) CN110691848B (https=)
CA (1) CA3058697A1 (https=)
IL (1) IL269887B2 (https=)
SG (1) SG11201909432SA (https=)
WO (1) WO2018189186A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020127738A1 (en) 2018-12-21 2020-06-25 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Dna-pkcs inhibitors for increasing genome editing efficiency
US20210060028A1 (en) * 2018-01-17 2021-03-04 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
EP4095246A1 (en) 2021-05-27 2022-11-30 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Novel crispr grnas
WO2022251836A3 (en) * 2021-05-24 2023-02-16 New York Genome Center, Inc. Compositions and methods for increasing efficiency of precise editing repair
US12269804B2 (en) 2018-01-17 2025-04-08 Vertex Pharmaceuticals Incorporated Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200299729A1 (en) * 2017-09-08 2020-09-24 Life Technologies Corporation Methods for improved homologous recombination and compositions thereof
JP7235153B2 (ja) * 2017-12-29 2023-03-08 株式会社三洋物産 遊技機
JP7235154B2 (ja) * 2018-02-15 2023-03-08 株式会社三洋物産 遊技機
JP7231076B2 (ja) * 2018-03-08 2023-03-01 株式会社三洋物産 遊技機
JP2020103418A (ja) * 2018-12-26 2020-07-09 株式会社三洋物産 遊技機
JP2020130466A (ja) * 2019-02-15 2020-08-31 株式会社三洋物産 遊技機
JP7234740B2 (ja) * 2019-03-28 2023-03-08 株式会社三洋物産 遊技機
JP7234741B2 (ja) * 2019-03-28 2023-03-08 株式会社三洋物産 遊技機
JP7234761B2 (ja) * 2019-04-11 2023-03-08 株式会社三洋物産 遊技機
JP7234760B2 (ja) * 2019-04-11 2023-03-08 株式会社三洋物産 遊技機
JP2021186294A (ja) * 2020-05-29 2021-12-13 株式会社三洋物産 遊技機
CN112359065B (zh) * 2020-09-21 2023-04-07 中国医学科学院血液病医院(中国医学科学院血液学研究所) 一种提高基因敲入效率的小分子组合物
KR102545913B1 (ko) * 2021-02-02 2023-06-22 재단법인 아산사회복지재단 히스톤 탈아세틸화 억제제를 포함하는 염기교정 기술의 효율성 및 정확도 향상용 조성물 및 이의 용도
CN113403309B (zh) * 2021-05-24 2022-08-16 珠海舒桐医疗科技有限公司 非同源双链寡聚核苷酸片段在基因敲除系统中的应用
US20230070047A1 (en) * 2021-07-06 2023-03-09 Regents Of The University Of Minnesota Method to enhance gene editing
JP2023105111A (ja) * 2021-10-27 2023-07-28 株式会社三洋物産 遊技機
JP2023105108A (ja) * 2021-10-27 2023-07-28 株式会社三洋物産 遊技機
JP2023105110A (ja) * 2021-10-27 2023-07-28 株式会社三洋物産 遊技機
JP2023063369A (ja) * 2022-01-07 2023-05-09 株式会社三洋物産 遊技機
JP2023053387A (ja) * 2022-02-04 2023-04-12 株式会社三洋物産 遊技機
JP2023060269A (ja) * 2022-04-01 2023-04-27 株式会社三洋物産 遊技機
JP2023060270A (ja) * 2022-04-01 2023-04-27 株式会社三洋物産 遊技機
CN114717207B (zh) * 2022-04-25 2023-03-07 苏州泓迅生物科技股份有限公司 一种酵母细胞同源重组酶系、dna体外组装试剂及其应用
WO2025212548A1 (en) 2024-04-02 2025-10-09 Sigma-Aldrich Co. Llc Methods and compositions for improvement of base editor and homology directed repair genome editing outcomes
WO2026005012A1 (ja) * 2024-06-28 2026-01-02 学校法人自治医科大学 インビトロ及びインビボのゲノム編集における相同組換えの効率を高める方法

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013188881A1 (en) 2012-06-15 2013-12-19 President And Fellows Of Harvard College Compounds, compositions and methods for treating or preventing neurodegenerative disorders
US10227610B2 (en) * 2013-02-25 2019-03-12 Sangamo Therapeutics, Inc. Methods and compositions for enhancing nuclease-mediated gene disruption
MX2015017312A (es) * 2013-06-17 2017-04-10 Broad Inst Inc Suministro y uso de composiciones, vectores y sistemas crispr-cas para la modificación dirigida y terapia hepáticas.
ES2730378T3 (es) * 2014-08-27 2019-11-11 Caribou Biosciences Inc Procedimientos para incrementar la eficiencia de la modificación mediada por Cas9
CA2963820A1 (en) * 2014-11-07 2016-05-12 Editas Medicine, Inc. Methods for improving crispr/cas-mediated genome-editing

Non-Patent Citations (69)

* Cited by examiner, † Cited by third party
Title
AGGARWAL, M.; SOMMERS, J.A.; SHOEMAKER, R.H.; BROSH, R.M., JR.: "Inhibition of helicase activity by a small molecule impairs Werner syndrome helicase (WRN) function in the cellular response to DNA damage or replication stress", PROC NATL ACAD SCI U S A, vol. 108, 2011, pages 1525 - 1530
BLAJESKI ET AL., J. CLIN. INVEST., vol. 110, 2002, pages 91 - 95
BLANPAIN, C.; MOHRIN, M.; SOTIROPOULOU, P.A.; PASSEGUE, E.: "DNA-damage response in tissue-specific and cancer stem cells", CELL STEM CELL, vol. 8, 2011, pages 16 - 29
CHARI, R.; MALI, P.; MOOSBURNER, M.; CHURCH, G.M.: "Unraveling CRISPR-Cas9 genome engineering parameters via a library-on-library approach", NAT METHODS, vol. 12, 2015, pages 823 - 826
CHU, V.T. ET AL.: "Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells", NAT BIOTECHNOL, vol. 33, 2015, pages 543 - 548, XP055290254, DOI: doi:10.1038/nbt.3198
DATABASE Protein [O] retrieved from NCBI Database accession no. NP_008835.5
DAVIDSON ET AL., FRONT. PHARMACOL., vol. 4, 2013
DORE, A.S.; DRAKE, A.C.; BREWERTON, S.C.; BLUNDELL, T.L.: "Identification of DNA-PK in the arthropods. Evidence for the ancient ancestry of vertebrate non-homologous end-joining", DNA REPAIR (AMST, vol. 3, 2004, pages 33 - 41
DOUGLAS, P. ET AL.: "The DNA-dependent protein kinase catalytic subunit is phosphorylated in vivo on threonine 3950, a highly conserved amino acid in the protein kinase domain", MOL CELL BIOL, vol. 27, 2007, pages 1581 - 1591
FALKENBERG; JOHNSTONE, NATURE REV. DRUG DISCOVERY, vol. 13, 2014, pages 673 - 691
FIELD, A: "Discovering Statistics using SPSS", 2005, SAGE PUBLICATIONS
FU, Y. ET AL.: "High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells", NAT BIOTECHNOL, vol. 31, 2013, pages 822 - 826, XP055153951, DOI: doi:10.1038/nbt.2623
G., D.R.I.: "Alternative pathways of non-homologous end joining (NHEJ) in genomic instability and cancer", TRANSL CANCER RES, vol. 2, 2013
GLANZER, J.G. ET AL.: "A small molecule directly inhibits the p53 transactivation domain from binding to replication protein A", NUCLEIC ACIDS RES, vol. 41, 2013, pages 2047 - 2059
GLANZER, J.G.; LIU, S.; OAKLEY, G.G.: "Small molecule inhibitor of the RPA70 N-terminal protein interaction domain discovered using in silico and in vitro methods", BIOORG MED CHEM, vol. 19, 2011, pages 2589 - 2595
GONZALEZ, F. ET AL.: "An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells", CELL STEM CELL, vol. 15, 2014, pages 215 - 226, XP055278540, DOI: doi:10.1016/j.stem.2014.05.018
GRECO, G.E. ET AL.: "SCR7 is neither a selective nor a potent inhibitor of human DNA ligase IV", DNA REPAIR (AMST, vol. 43, 2016, pages 18 - 23, XP029617740, DOI: doi:10.1016/j.dnarep.2016.04.004
GRIMME, J.M. ET AL.: "Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes", NUCLEIC ACIDS RES, vol. 38, 2010, pages 2917 - 2930
GU, Y. ET AL.: "Defective embryonic neurogenesis in Ku-deficient but not DNA-dependent protein kinase catalytic subunit-deficient mice", PROC NATL ACAD SCI U S A, vol. 97, 2000, pages 2668 - 2673
HUANG, F. ET AL.: "Identification of specific inhibitors of human RAD51 recombinase using high-throughput screening", ACS CHEM BIOL, vol. 6, 2011, pages 628 - 635
JIMENO, S. ET AL.: "Neddylation inhibits CtlP-mediated resection and regulates DNA double strand break repair pathway choice", NUCLEIC ACIDS RES, vol. 43, 2015, pages 987 - 999
KEIICHIRO SUZUKI ET AL: "In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration", NATURE, vol. 540, no. 7631, 16 November 2016 (2016-11-16), GB, pages 144 - 149, XP055414804, ISSN: 0028-0836, DOI: 10.1038/nature20565 *
KENT, W.J. ET AL.: "The human genome browser at UCSC", GENOME RES, vol. 12, 2002, pages 996 - 1006, XP007901725, DOI: doi:10.1101/gr.229102. Article published online before print in May 2002
KHAN; LA THANGUE, IMMUNOL. CELL BIOL., vol. 90, 2012, pages 85 - 94
KIM, D. ET AL.: "Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells", NAT BIOTECHNOL, vol. 34, 2016, pages 863 - 868, XP055369699, DOI: doi:10.1038/nbt.3609
KIRCHER, M.; SAWYER, S.; MEYER, M.: "Double indexing overcomes inaccuracies in multiplex sequencing on the lllumina platform", NUCLEIC ACIDS RES, vol. 40, 2012, pages e3, XP055476349, DOI: doi:10.1093/nar/gkr771
KLEINSTIVER, B.P. ET AL.: "Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells", NAT BIOTECHNOL, vol. 34, 2016, pages 869 - 874, XP055487999, DOI: doi:10.1038/nbt.3620
LEE, J.H.; GUO, Z.; MYLER, L.R.; ZHENG, S.; PAULL, T.T.: "Direct activation of ATM by resveratrol under oxidizing conditions", PLOS ONE, vol. 9, 2014, pages e97969
LEE, J.S.: "Activation of ATM-dependent DNA damage signal pathway by a histone deacetylase inhibitor, trichostatin A", CANCER RES TREAT, vol. 39, 2007, pages 125 - 130
LE-TRILLING ET AL., SCI. REP., vol. 6, 2016
LIN, S.; STAAHL, B.T.; ALIA, R.K.; DOUDNA, J.A.: "Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery", ELIFE, vol. 3, 2014, pages e04766, XP055294945, DOI: doi:10.7554/eLife.04766
MARUYAMA, T. ET AL.: "Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining", NAT BIOTECHNOL, vol. 33, 2015, pages 538 - 542, XP055290186, DOI: doi:10.1038/nbt.3190
MEENA SHRIVASTAV ET AL: "Regulation of DNA double-strand break repair pathway choice", CELL RESEARCH - XIBAO YANJIU, vol. 18, no. 1, 1 January 2008 (2008-01-01), GB, CN, pages 134 - 147, XP055439121, ISSN: 1001-0602, DOI: 10.1038/cr.2007.111 *
MEYER, M.; KIRCHER, M.: "Cold Spring Harb Protoc", 2010, article "Illumina sequencing library preparation for highly multiplexed target capture and sequencing"
MILANOWSKA, K. ET AL.: "REPAIRtoire--a database of DNA repair pathways", NUCLEIC ACIDS RES, vol. 39, 2011, pages D788 - D792, XP055156971, DOI: doi:10.1093/nar/gkq1087
NAWROCKI ET AL., EXP OPIN INVESTING DRUGS, vol. 21, 2012, pages 1564 - 1573
NEAL, J.A. ET AL.: "Inhibition of homologous recombination by DNA-dependent protein kinase requires kinase activity, is titratable, and is modulated by autophosphorylation", MOL CELL BIOL, vol. 31, 2011, pages 1719 - 1733, XP055483636, DOI: doi:10.1128/MCB.01298-10
NEAL, J.A. ET AL.: "Unraveling the complexities of DNA-dependent protein kinase autophosphorylation", MOL CELL BIOL, vol. 34, 2014, pages 2162 - 2175
NEAL, J.A.; XU, Y.; ABE, M.; HENDRICKSON, E.; MEEK, K.: "Restoration of ATM Expression in DNA-PKcs-Deficient Cells Inhibits Signal End Joining", J IMMUNOL, vol. 196, 2016, pages 3032 - 3042
NEHER ET AL., MEL. CANCER THER., vol. 10, 2011, pages 1756 - 1806
NUSSENZWEIG, A.; NUSSENZWEIG, M.C.: "A backup DNA repair pathway moves to the forefront", CELL, vol. 131, 2007, pages 223 - 225
O'BRIEN, J.; WILSON, I.; ORTON, T.; POGNAN, F.: "Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity", EUR J BIOCHEM, vol. 267, 2000, pages 5421 - 5426, XP002968559, DOI: doi:10.1046/j.1432-1327.2000.01606.x
PINDER, J.; SALSMAN, J.; DELLAIRE, G.: "Nuclear domain 'knock-in' screen for the evaluation and identification of small molecule enhancers of CRISPR-based genome editing", NUCLEIC ACIDS RES, vol. 43, 2015, pages 9379 - 9392, XP055342317, DOI: doi:10.1093/nar/gkv993
PINELLO, L. ET AL.: "Analyzing CRISPR genome-editing experiments with CRISPResso", NAT BIOTECHNOL, vol. 34, 2016, pages 695 - 697
PRUFER, K. ET AL.: "The complete genome sequence of a Neanderthal from the Altai Mountains", NATURE, vol. 505, 2014, pages 43 - 49
QUINN, G.P.K., M.J.: "Experimental Designs and Data Analysis for Biologists", 2002, CAMBRIDGE UNIVERSITY PRESS
RENAUD, G.; STENZEL, U.; KELSO, J.: "leeHom: adaptor trimming and merging for Illumina sequencing reads", NUCLEIC ACIDS RES, vol. 42, 2014, pages e141
ROBERT F ET AL: "Pharmacological inhibition of DNA-PK stimulates Cas9-mediated genome editing", GENOME MEDICINE,, vol. 7, no. 1, 27 August 2015 (2015-08-27), pages 1 - 11, XP002769169, ISSN: 1756-994X, DOI: 10.1186/S13073-015-0215-6 *
ROBERT, F.; BARBEAU, M.; ETHIER, S.; DOSTIE, J.; PELLETIER, J.: "Pharmacological inhibition of DNA-PK stimulates Cas9-mediated genome editing", GENOME MED, vol. 7, 2015, pages 93
ROCHA, C.R.; LERNER, L.K.; OKAMOTO, O.K.; MARCHETTO, M.C.; MENCK, C.F.: "The role of DNA repair in the pluripotency and differentiation of human stem cells", MUTAT RES, vol. 752, 2013, pages 25 - 35
SHEN, B. ET AL.: "Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects", NAT METHODS, vol. 11, 2014, pages 399 - 402, XP055227888, DOI: doi:10.1038/nmeth.2857
SHRIVASTAV M ET AL: "DNA-PKcs and ATM co-regulate DNA double-strand break repair", DNA REPAIR, ELSEVIER, AMSTERDAM, NL, vol. 8, no. 8, 6 August 2009 (2009-08-06), pages 920 - 929, XP026348816, ISSN: 1568-7864, [retrieved on 20090616] *
SHRIVASTAV, M. ET AL.: "DNA-PKcs and ATM co-regulate DNA double-strand break repair", DNA REPAIR (AMST, vol. 8, 2009, pages 920 - 929, XP026348816
SHRIVASTAV, M.; DE HARO, L.P.; NICKOLOFF, J.A.: "Regulation of DNA double-strand break repair pathway choice", CELL RES, vol. 18, 2008, pages 134 - 147, XP055439121, DOI: doi:10.1038/cr.2007.111
SHU ET AL., APOPTOSIS, vol. 2, 1997, pages 463 - 470
SONG, J. ET AL.: "RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency", NAT COMMUN, vol. 7, 2016, pages 10548
SUBACH, O.M.; CRANFILL, P.J.; DAVIDSON, M.W.; VERKHUSHA, V.V.: "An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore", PLOS ONE, vol. 6, 2011, pages e28674
SULLIVAN, K. ET AL.: "Identification of a Small Molecule Inhibitor of RAD52 by Structure-Based Selection", PLOS ONE, vol. 11, 2016, pages e0147230
SUPRIYA V. VARTAK ET AL: "Inhibition of nonhomologous end joining to increase the specificity of CRISPR/Cas9 genome editing", FEBS JOURNAL, vol. 282, no. 22, 9 September 2015 (2015-09-09), GB, pages 4289 - 4294, XP055342300, ISSN: 1742-464X, DOI: 10.1111/febs.13416 *
SUZUKI, K. ET AL.: "In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration", NATURE, vol. 540, 2016, pages 144 - 149, XP055414804, DOI: doi:10.1038/nature20565
TAKESHI MARUYAMA ET AL: "Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining", NATURE BIOTECHNOLOGY (ADVANCE ONLINE PUBLICATION), vol. 33, no. 5, 20 April 2015 (2015-04-20), pages 538 - 542, XP055290186, ISSN: 1087-0156, DOI: 10.1038/nbt.3190 *
WANG, K. ET AL.: "Efficient Generation of Orthologous Point Mutations in Pigs via CRISPR-assisted ssODN-mediated Homology-directed Repair", MOL THER NUCLEIC ACIDS, vol. 5, 2016, pages e396
WETERINGS, E. ET AL.: "A novel small molecule inhibitor of the DNA repair protein Ku70/80", DNA REPAIR (AMST, vol. 43, 2016, pages 98 - 106, XP029617734, DOI: doi:10.1016/j.dnarep.2016.03.014
YANG, D. ET AL.: "Enrichment of G2/M cell cycle phase in human pluripotent stem cells enhances HDR-mediated gene repair with customizable endonucleases", SCI REP, vol. 6, 2016, pages 21264, XP055379621, DOI: doi:10.1038/srep21264
YU, C. ET AL.: "Small molecules enhance CRISPR genome editing in pluripotent stem cells", CELL STEM CELL, vol. 16, 2015, pages 142 - 147, XP055394403, DOI: doi:10.1016/j.stem.2015.01.003
ZAR, J.H.: "Biostatistical Analysis", 1999, PRENTICE HALL
ZETSCHE, B. ET AL.: "Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system", CELL, vol. 163, 2015, pages 759 - 771, XP055267511, DOI: doi:10.1016/j.cell.2015.09.038
ZHANG, J.P. ET AL.: "Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage", GENOME BIOL, vol. 18, 2017, pages 35, XP055399694, DOI: doi:10.1186/s13059-017-1164-8
ZHOU, Y. ET AL.: "Regulation of the DNA Damage Response by DNA-PKcs Inhibitory Phosphorylation of ATM", MOL CELL, vol. 65, 2017, pages 91 - 104, XP029876893, DOI: doi:10.1016/j.molcel.2016.11.004

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210060028A1 (en) * 2018-01-17 2021-03-04 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
US12121524B2 (en) * 2018-01-17 2024-10-22 Vertex Pharmaceuticals Incorporated DNA-PK inhibitors
US12269804B2 (en) 2018-01-17 2025-04-08 Vertex Pharmaceuticals Incorporated Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency
WO2020127738A1 (en) 2018-12-21 2020-06-25 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Dna-pkcs inhibitors for increasing genome editing efficiency
WO2022251836A3 (en) * 2021-05-24 2023-02-16 New York Genome Center, Inc. Compositions and methods for increasing efficiency of precise editing repair
EP4095246A1 (en) 2021-05-27 2022-11-30 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Novel crispr grnas
WO2022248454A1 (en) 2021-05-27 2022-12-01 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Novel crispr grnas

Also Published As

Publication number Publication date
CN110691848B (zh) 2024-04-02
JP7795493B2 (ja) 2026-01-07
CN110691848A (zh) 2020-01-14
KR102537447B1 (ko) 2023-05-30
US20200392540A1 (en) 2020-12-17
JP2023093479A (ja) 2023-07-04
EP3610008A1 (en) 2020-02-19
IL269887B1 (en) 2024-09-01
CA3058697A1 (en) 2018-10-18
KR102778328B1 (ko) 2025-03-11
JP2020516258A (ja) 2020-06-11
US12173309B2 (en) 2024-12-24
KR20190139239A (ko) 2019-12-17
SG11201909432SA (en) 2019-11-28
JP7319194B2 (ja) 2023-08-01
IL269887B2 (en) 2025-01-01
IL269887A (en) 2019-11-28
KR20230084312A (ko) 2023-06-12

Similar Documents

Publication Publication Date Title
JP7795493B2 (ja) ゲノム編集効率を増大させるための化合物
EP3388517A1 (en) Compounds for increasing genome editing efficiency
EP3911330B1 (en) Dna-pkcs inhibitors for increasing genome editing efficiency
Ben Jehuda et al. Genome editing in induced pluripotent stem cells using CRISPR/Cas9
Liu et al. One-step biallelic and scarless correction of a β-thalassemia mutation in patient-specific iPSCs without drug selection
EP3489357A1 (en) Compounds for increasing genome editing efficiency
Zhang et al. A high-throughput small molecule screen identifies farrerol as a potentiator of CRISPR/Cas9-mediated genome editing
US11459586B2 (en) Methods for increasing efficiency of nuclease-mediated gene editing in stem cells
US20250122538A1 (en) Compounds for Increasing Genome Editing Efficiency
Tennant et al. Fluorescent in vivo editing reporter (FIVER): a novel multispectral reporter of in vivo genome editing
Riesenberg Methods to increase the efficiency of precise CRISPR genome editing
AU2024334482C1 (en) Methods and compositions for engineered da neuronal cells
US20240010991A1 (en) Materials and methods for bioengineered ipsc populations
Ionasz Elucidating the role of transcription in recurrent DNA break formation
Xuemeng Characterizing the Regulation and Function of Endogenous Retroviruses in Mammalian Pluripotent Cells
Trovato The role of histone H3. 3 K9 and K27 residues in transcriptional regulation in mouse embryonic stem cells
Geisinger Advanced Genome Engineering of Induced Pluripotent Stem Cells for Therapeutic Purposes
Hay et al. Investigation of mechanisms of DNA methylation maintenance regulation in pluripotency
Gnocchi Understanding the impact of replication stress on the expression of early genes in mouse embryonic stem cells
Dial Disrupting Somatic Maintenance of X-Chromosome Inactivation to Reactivate the Inactive X Chromosome
Shy Genome Editing and Differentiation of Embryonic Stem Cells
Ng The Regulation of Cd4 in T Cells: Lineage Commitment and Heritable Silencing of Cd4 Expression in CD8+ Cytotoxic T Cells
Vilhjálmsson Þöggun á ALKBH3 og ALKBH9 (FTO) og áhrif þess á viðgerð erfðaefnis og frumulifun
Lee The Essential Roles of DNA Resection AND The Impact of Loss of Function NHEJ Mutations on DSB Repair In Human Somatic Cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18722407

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3058697

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019555112

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20197032518

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018722407

Country of ref document: EP

Effective date: 20191111