WO2018162563A1 - Mr1 restricted t cell receptors for cancer immunotherapy - Google Patents
Mr1 restricted t cell receptors for cancer immunotherapy Download PDFInfo
- Publication number
- WO2018162563A1 WO2018162563A1 PCT/EP2018/055620 EP2018055620W WO2018162563A1 WO 2018162563 A1 WO2018162563 A1 WO 2018162563A1 EP 2018055620 W EP2018055620 W EP 2018055620W WO 2018162563 A1 WO2018162563 A1 WO 2018162563A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- seq
- cell receptor
- nos
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/24—Antigen-presenting cells [APC]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/32—T-cell receptors [TCR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2302—Interleukin-2 (IL-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2307—Interleukin-7 (IL-7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2315—Interleukin-15 (IL-15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the invention relates to the identification of tumour-reactive human T cell antigen receptors (TCRs) restricted to the non-polymorphic antigen-presenting molecule MR1 .
- TCRs tumour-reactive human T cell antigen receptors
- the functional TCR transcript sequences were isolated from clones representative of a novel population of human T cells (discovered by the inventors and termed MR1 T cells) reacting to MR1 - expressing tumour cells in the absence of any added foreign antigen and in MR1 -dependent manner.
- the invention also relates to the use of MR1 -restricted tumour-reactive TCR gene sequences in cancer treatment.
- T lymphocytes can detect a diverse range of non-peptide antigens including lipids and phosphorylated isoprenoids, presented by non-polymorphic cell surface molecules.
- the heterogeneous phenotypic and functional properties of these T cells support specialized roles in host protection against infections, autoimmunity, and cancer.
- the repertoire of T cells specific for non-peptide antigens recently increased to include mucosal associated invariant T (MAIT) cells, which respond to small riboflavin precursors produced by a wide range of yeasts and bacteria, and presented by the MHC class l-related protein MR1.
- MAIT cells are frequent in human blood, kidney and intestine, and comprise a major fraction of T cells resident in the liver.
- MAIT cells release an array of pro-inflammatory and immunomodulatory cytokines, and can mediate direct killing of microbe-infected cells. It remains unknown whether the role of MR1 extends beyond presentation of microbial metabolites to MAIT cells.
- MR1 is a non-polymorphic MHC class l-like protein that is expressed at low levels on the surface of many cell types. MR1 is highly conserved across multiple species, with human and mouse MR1 sharing >90% sequence homology at the protein level.
- tumour-associated antigens presented by MR1 .
- novel T cells might participate in tumour immune surveillance, thus representing novel tools for cancer immunotherapy.
- Adoptive therapy with donor- or patient-derived T cells engineered to express TCRs specific for selected tumour- associated antigens represents a promising and safe strategy to induce clinically relevant anti- tumour immune response in cancer patients.
- the majority of the so far identified tumour-associated antigens are peptides presented by polymorphic MHC molecules.
- the extreme polymorphism of MHC genes limits the application of this approach to those patients expressing unique MHC alleles.
- tumour-antigens bound to non-polymorphic antigen presenting molecules such as MR1
- MR1 -presented antigens might also have the advantage of complementing anti-tumour responses mediated by MHC-presented peptide antigens, excluding cross-competition of tumour antigens for binding to the same type of presenting molecule.
- this strategy may provide the possibility of targeting antigens of different nature on the same tumour cells, thus minimizing the potential occurrence of tumour escape variants under selective immune pressure. Therefore, the identification of MR1 -presented tumour-associated antigens and the characterization of MR1 -restricted TCRs recognizing these antigens might have important implications for cancer immunotherapy.
- the objective of the present invention is to provide novel means and methods of treatment for cancer. This objective is attained by the subject matter of the independent claims, with further advantageous solutions provided by the dependent claims, examples and figures disclosed herein.
- MR1 in the context of the present specification refers to either the MR1 gene (Entrez 3140) or the MR1 gene product (Uniprot Q95460).
- MRU cell in the context of the present specification refers to a T cell that expresses a T cell receptor capable of binding specifically to an MR1 molecule presented by a cancer cell.
- MRU cell receptor in the context of the present specification refers to a T cell receptor capable of binding specifically to an antigen presented by a cancer cell in association with an MR1 molecule.
- the term positive when used in the context of expression of a marker, refers to expression of an antigen assayed by a fluorescent labelled antibody, wherein the fluorescence is at least 30% higher ( ⁇ 30 %), particularly ⁇ 50% or ⁇ 80%, in median fluorescence intensity in comparison to staining with an isotype-matched antibody which does not specifically bind the same target.
- a marker is indicated by a superscript "plus” ( + ), following the name of the marker, e.g. CD4 + .
- the term negative when used in the context of expression of a marker, refers to expression of an antigen assayed by a fluorescent labelled antibody, wherein the median fluorescence intensity is less than 30% higher, particularly less than 15% higher, than the median fluorescence intensity of an isotype-matched antibody which does not specifically bind the same target.
- Such expression of a marker is indicated by a superscript minus ( " ), following the name of the marker, e.g. CD127 " .
- the term antibody refers to whole antibodies including but not limited to immunoglobulin type G (IgG), type A (IgA), type D (IgD), type E (IgE) or type M (IgM), any antigen binding fragment or single chains thereof and related or derived constructs.
- the term encompasses a so-called nanobody or single domain antibody, an antibody fragment consisting of a single monomeric variable antibody domain.
- the invention relates to a method of treatment of cancer, wherein TCR sequences isolated from T cells reactive to MR1 -expressing cancer cells (MR1 T cells) are expressed after gene transfer in a population of patient's T cells. These foreign, transgenically expressed TCR sequences are used for conferring specific recognition of MR1 -expressing cancer cells to T cells as a treatment for the patient's tumour.
- the invention similarly leads to a T cell, and T cell preparations comprising a plurality of T cells, transduced with MR1 T cell specific TCR genes.
- the T cells transduced with MR1 T cell TCR genes can be used for adoptive cell immunotherapy in combination with other therapeutic interventions.
- the invention also relates to a research method facilitating the identification of the TCR sequences isolated from T cells reactive to MR1 -expressing cancer cells (MR1 T cells) employed in the invention.
- This encompasses a method to isolate MR1 -restricted T cells that recognize tumour-associated antigens.
- T cells from peripheral blood of normal donors or from cancer patients are stimulated with tumor cell lines representing the same type of tumor in patient. These tumor cell lines are transfected with the MR1 gene and thus express large amounts of MR1 protein on their plasma membrane.
- Activated T cells are sorted for expression of activation markers, (e.g.
- CD137, or CD150, or CD69, or lCOS are cloned as published (De Libera, Methods for the generation of T cell clones and epithelial cell lines from excised human biopsies or needle aspirates. In MHC 123-140 (IRL, Oxford; 1997)). Individual clones are tested for their capacity to recognize tumor cells in an MR1 -restricted manner, for killing tumor cells and for release of inflammatory cytokines.
- the TCR genes of MR1 -restricted and tumor-specific T cell clones are sequenced and identified.
- the invention also relates to a method by which tumor-infiltrating T cells are prepared from the same cancer tissue biopsies according to our previously established protocol (De Libera, ibid.). Individual T cell clones are tested against a panel of tumor cell lines expressing MR1 protein. The most reactive T cell clones are studied for their MR1 restriction, tumor killing and release of inflammatory cytokines. The TCR genes of selected T cell clones are sequenced. Detailed description of the invention
- a first aspect of the invention relates to a method of identifying and/or isolating a T cell that expresses a T cell receptor capable of binding specifically to a cancer antigen presented by a cancer cell in association with a non-polymorphic MHC l-related MR1 antigen-presenting molecule. This method comprises the steps of
- MR1 in the physiological context of a non-tumour bearing patient presents bacterial riboflavin by-products (above referred to as "exogenous microbial-derived antigens”) and presents them to mucosal invariant T cells.
- the contacting step comprises an expansion step, wherein the preparation of isolated T cells is expanded in the presence of cancer cells expressing MR1 .
- the cancer cells are irradiated in order to prohibit their growth prior to being brought into contact with the T cells. This is going to be advantageous if the two cell types are meant to be kept in co-culture for extended periods of time and overgrowing of the culture by the cancer cells is to be avoided.
- the cancer cells may be used without irradiation.
- the expansion step is conducted in the presence of IL-2, IL-7 and IL- 15.
- the isolation step comprises staining with one or more ligands, in particular one or more (monoclonal) antibodies specific for a cell surface marker selected from CD3, CD69, CD137, CD150, and / or ICOS).
- the isolation step comprises selecting CD3 + CD137 + , and/or CD3 + CD69 + , and/or CD3 + CD150 + , and/or CD3 + ICOS + T cells, followed by flow cytometric analysis and cell sorting, particularly by using FACS or magnetic separation (MACS).
- positive expression (+) of a marker means at least 30% increase of the median fluorescence intensity over staining with isotype- matched antibody which does not specifically bind the same cell.
- T cells that express CD3 and CD137, and/or CD3 and CD69, and/or CD3 and CD150, and/or CD3 and ICOS are isolated using FACS or MACS.
- FACS Fluorescence-Activated Cell Sorting
- the isolating step comprises selecting T cells that display MR1 -restricted activity.
- this step comprises isolating T cells that are activated by an antigen presented on MR1.
- the isolating step comprises selecting T cells that exhibit 2x increased expression of a cytokine selected from IFN- ⁇ and/or GM-CSF release when stimulated with cells expressing MR1 compared to stimulation with cells not expressing MR1 .
- an MR1 -expressing cancer cell presents a particular cancer antigen, or a number of particular cancer antigens, on MR1 .
- the isolating step comprises selecting T cells that exhibit 2x increased expression of a cytokine selected from IFN- ⁇ and/or GM-CSF release when stimulated with tumour cells expressing MR1 compared to stimulation with tumour cells (of the same origin, or same cell line) not expressing MR1 .
- Reactive cells are those that, in response to being contacted by an MR1 -expressing cancer cell (presenting a cancer antigen in an MR1 -restricted fashion), upregulate activation markers (particularly the markers cited in the preceding paragraphs), release cytokines and start to proliferate.
- T cells that display MR1 -restricted activity are T cells that can be activated by a tumour-associated antigen displayed by MR1 .
- FACS fluorescence activated cell sorting
- the isolating step comprises expanding individual clones of the cells sorted as a function of their activation status, and then selecting T cell clones that display MR1 - restricted activity, particularly cells that exhibit 2x increased expression of a cytokine selected from IFN- ⁇ and/or GM-CSF when stimulated with cells expressing MR1 compared to stimulation with cells not expressing MR1 .
- the method further includes determining a nucleic acid sequence encoding a T cell receptor of the T cell isolated in the isolation step. In certain embodiments, the method includes determining two nucleic acid sequences encoding both T cell receptor chains of the T cell isolated in the isolation step.
- Another aspect of the invention relates to a method of producing a preparation of transgenic MRU cells reactive to MR1 in the absence of exogenous antigens. The method encompasses firstly, determining which T cell receptors are most likely to be reactive to a particular MR1 - expressing cancer in a patient, then preparing a T cell population expressing these specific T cell receptor genes from expression constructs transferred into the cells, and administering these engineered T cells into the patient.
- This method comprising the steps of
- tumour sample a plurality of MR1 T cell receptor molecule reactive to MR1 , either
- each T cell clone is characterized by an MR1 T cell receptor molecule reactive to MR1 ; or as soluble MR1 T cell receptor molecules that are labelled, and their recognition is assayed in a non-cell-dependent fashion;
- identifying a number of T cell clone(s) specifically reactive to said tumour sample d. providing a T cell preparation, particularly a T cell preparation obtained from the same patient;
- the transgene T cell preparation to the patient could thus be administered to the patient.
- the said T cell preparation is obtained from the same patient (autologous adoptive T cell therapy).
- This method has the advantage of avoiding the risk of adverse reactions, particularly an allo-immune reaction driven by the endogenous T cell receptors of the engineered T cell preparation.
- the said T cell preparation is obtained from another subject, particularly a HLA-matched subject (allogeneic adoptive T cell therapy). While depending on the quality of the HLA match, the risk of alloimmunity may be significant, the logistics and procedural advantages of having a large selection of pre-made TC preparations to select from may facilitate this therapy to a vastly larger patient community in comparison to the far higher costs and regulatory hurdles of a bespoke, patient-individual therapy.
- Introduction of the MRU cell receptor expression construct into the T cell preparation may be achieved by lentiviral transduction, which the inventors have routinely used in their work on MRU cells, or by standard methods of DNA expression vector (plasmid) or RNA transfection. The skilled person is aware of the relevant protocols and procedures.
- the transgene T cell preparation may be kept in culture for some time prior to being administered to the patient in order to expand their number and, again optionally, to further stimulate their differentiation into a particularly desired T cell subset.
- the T cell preparation obtained from said patient is obtained from peripheral blood of the patient, particularly wherein said T cell preparation is obtained by selecting peripheral blood mononuclear cells (PBMC) for expression of one or several T cell markers selected from the group containing CD4, CD8, CD27, CD45RA and CD57.
- PBMC peripheral blood mononuclear cells
- the T cell preparation obtained from said patient is obtained from a tumour biopsy followed by subsequent expansion in-vitro.
- T cells are expanded in the presence of phytohemagglutinin, IL-2, IL-7 and IL-15.
- Proliferating T cells are isolated by magnetic sorting and used for T cell receptor engineering or for cloning and isolation of tumour-specific MR1 -restricted T cells. The isolated MRU cells are used for TCR gene cloning.
- the plurality of MR1 -specific T cell clones can be prepared in advance of the procedure and held in form of a library or panel for ad-hoc use whenever the need for rapid characterization of a tumour arises. This step is essentially an identification of the MR1 -specific T cell receptor molecules that will recognize a particular tumour entity.
- soluble MRU TCRs may be generated and multimerized (see Subbramanian et al. Nature Biotechnology, 22, 1429, (2004)). TCR multimers will be labeled with fluorochromes and used to stain tumour cells isolated from tumour biopsies. Binding of soluble MRU TCR multimers will indicate the capacity of that MRU TCR to recognize tumour cells and thus will facilitate selection of the MRU TCRs suitable for gene therapy in that patient.
- Another aspect of the invention relates to an expression vector comprising, and leading to the transcription of, a nucleic acid sequence encoding a functional T cell receptor heterodimer, or a T cell receptor a chain capable of forming a functional T cell receptor heterodimer together with a T cell receptor ⁇ chain, and/or a T cell receptor ⁇ chain capable of forming a functional T cell receptor heterodimer together with a T cell receptor a chain.
- MR1 -specific ⁇ - ⁇ heterodimers have been found by the inventors, so the same applies to these chains.
- the expression vector comprises a nucleic acid sequence encoding a T cell receptor a chain or a T cell receptor ⁇ chain (or a y or ⁇ chain)
- two different expression vectors one encoding an a chain ( ⁇ chain) and one encoding a ⁇ chain ( ⁇ chain)
- the T cell receptor heterodimer specifically binds to an MR1 molecule, wherein said MR1 molecule is expressed on a tumour cell and presents a tumour-associated antigen.
- the expression of the above mentioned nucleic acid sequences is controlled by a promoter sequence operable in a mammalian cell, particularly a human T-cell.
- the promoter is a constitutively activated promoter, for example the CMV immediate early promoter commonly used in molecular biology.
- the promoter is an inducible promoter.
- the nucleic acid sequence comprised in the expression vector is or comprises a nucleic acid sequence that is selected from SEQ ID NOs 027 to 038, and/or encodes an amino acid sequence selected from SEQ ID NOs 001 to 012 (alpha chains).
- the nucleic acid sequence comprised in the expression vector is or comprises a nucleic acid sequence that is selected from SEQ ID NOs 039 to 050 and/or encodes an amino acid sequence selected from SEQ ID NOs 013 to 024 (beta chains).
- the nucleic acid sequence encodes the T cell receptor ⁇ chain encoded by SEQ ID NO 051 or encodes the T cell receptor ⁇ chain specified by SEQ ID NO 025.
- the nucleic acid sequence encodes the T cell receptor ⁇ chain encoded by SEQ ID NO 052 or encodes the T cell receptor ⁇ chain specified by SEQ ID NO 026.
- Another aspect of the invention relates to a nucleic acid sequence encoding a functional T cell receptor heterodimer.
- the T cell receptor heterodimer specifically binds to a non-polymorphic MHC l-related (MR1 ) antigen-presenting molecule expressed on a tumour cell presenting a tumour-associated antigen.
- MR1 MHC l-related
- the nucleic acid sequence encodes a T cell receptor a chain and is selected from SEQ ID NOs 027 to 038, or encodes a T cell receptor a chain specified by an amino acid sequence selected from SEQ ID NOs 001 to 012.
- the nucleic acid sequence encodes a T cell receptor ⁇ chain and is selected from SEQ ID NOs 039 to 050 or encodes a T cell receptor ⁇ chain specified by an amino acid sequence selected from SEQ ID NOs 013 to 024.
- the MR1 T cell receptor is constituted of one alpha chain and one beta chain disclosed herein. The inventors have surprisingly found that the alpha and beta chains may be combined to render functional TCR molecules capable of recognizing MR1 .
- the MR1 T cell receptor is constituted of one alpha chain and one beta chain as specified by the sequences of the following list:
- Another aspect of the invention relates to a T cell receptor protein that binds to a non- polymorphic MHC l-related MR1 antigen-presenting molecule.
- the MR1 molecule is expressed on a tumour cell and presents a tumour-associated antigen.
- the T cell receptor protein that binds to a non-polymorphic MHC l-related MR1 antigen-presenting molecule is identified by the method according to the first aspect of the invention.
- the T cell receptor protein comprises a T cell receptor a chain characterized by an amino acid sequence selected from SEQ ID NOs 001 to 012 and a T cell receptor ⁇ chain characterized by an amino acid sequence selected from SEQ ID NOs 013 to 024.
- the T cell receptor protein comprises a T cell receptor ⁇ chain characterized by the amino acid sequence SEQ ID NO 25 and a T cell receptor ⁇ chain characterized by the amino acid sequence SEQ ID NOs 26.
- Another aspect of the invention relates to a recombinant cell comprising the expression vector according to the invention, and/or the T cell receptor polypeptide according to the invention as specified in the preceding paragraphs.
- the expression vector only comprises a nucleic acid sequence encoding a T cell receptor a chain (or a ⁇ chain) or a T cell receptor ⁇ chain (or a ⁇ chain), but not both, two different expression vectors (one encoding an ⁇ / ⁇ chain and one encoding a ⁇ / ⁇ chain) have to be introduced into the recombinant cell in order to enable expression of a functional T cell receptor heterodimer by said cell.
- the recombinant cell is a T cell derived from peripheral blood.
- the recombinant cell is derived from a tumour infiltrating lymphocyte.
- Yet another aspect of the invention relates to the use of the recombinant cell according to the previously specified aspect of the invention for use in a method of therapy or prevention of cancer.
- the method comprises administration of the recombinant cell.
- the cancer is characterized by MR1 expression.
- the administration is effected by adoptive T cell immunotherapy.
- the invention further relates to a method of treatment, or prevention of recurrence, of cancer, comprising administration of the recombinant cell according to the invention.
- the cancer is characterized by MR1 expression.
- the administration is achieved by adoptive T cell immunotherapy.
- the invention also relates to a collection of nucleic acid sequences, wherein each member of the collection encodes a different T cell receptor a chain, T cell receptor ⁇ chain, T cell receptor Y chain, T cell receptor ⁇ chain or a T cell receptor a chain and ⁇ chain combination, or a T cell receptor Y chain and ⁇ chain combination, wherein said combination is capable of specifically binding to an MR1 molecule presenting a cancer antigen.
- the nucleic acid sequences are capable to facilitate the expression of the T cell receptor a chain, ⁇ chain, or a and ⁇ chain combination in a mammalian cell.
- Such collection will be used to select transgene constructs for transfer into T cells collected from a patient.
- the physician will need to be able to select pre-produced expression vectors from such collection manufactured under GMP, to quickly effect the gene transfer into the patient's T cells.
- the collection comprises a sequence selected from SEQ ID NO 27 to SEQ ID NO 52 and/or the collection comprises sequences encoding a T cell receptor molecule (or a T cell receptor constituting a or ⁇ , or ⁇ or ⁇ , chain) selected from SEQ ID NO 1 to SEQ ID NO 26.
- Yet another aspect of the invention relates to a collection of recombinant T cells, wherein each member of the collection expresses as a transgene a T cell receptor capable of specifically binding to an MR1 molecule presenting a cancer antigen.
- the collection comprises a recombinant T cell comprising a T cell receptor protein heterodimer according to the respective aspect of the invention.
- the inventors identified and isolated a novel population of human MR1 -restricted T cells reactive to a variety of tumour cells in MR1 -dependent manner.
- MRU cell clones were commonly found in the blood of different healthy individuals, expressed diverse TCR genes and did not recognize previously identified microbial or folate-derived ligands of MR1 . Instead, they recognized diverse sets of yet unknown antigens isolated from tumour cells and presented by MR1 . The identification and characterization of the stimulatory antigens associated with tumour cells is currently ongoing. MRU cell clones recognized and killed different types of tumour cells, thus displaying marked anti-tumour activity in vitro.
- Th1 , Th2 and Th17 cytokines released different combinations of Th1 , Th2 and Th17 cytokines, and displayed multiple chemokine receptor expression profiles, suggesting phenotypical and functional heterogeneity.
- the recipient T cells acquired the capacity to recognize MR1 -expressing tumour cells, thus indicating that the MRU cell TCR gene transfer is sufficient for this type of tumour recognition and might be used to instruct select T cells to recognize MR1 -expressing tumour cells.
- APC antigen-presenting cell
- 32m ⁇ 2 microglobulin
- DC dendritic cell
- GM-CSF granulocyte-macrophage colony- stimulating factor
- HPLC high-pressure liquid chromatography
- IFN- ⁇ interferon- ⁇
- mAb monoclonal antibody
- MAIT cell mucosal associated invariant T cell
- MHC major histocompatibility complex
- MR1 MHC class l-related molecule
- MRU cell MR1 -restricted T cell
- PBMC peripheral blood mononuclear cell
- TCR T cell receptor
- TIL tumour-infiltrating lymphocyte.
- FIG. 1 MR1 T cells do not recognize microbial antigens.
- A Surface expression of MR1 by CCRFSB, THP-1 and A375-MR1 cells. Grey histograms indicate staining with isotype-matched control mAbs.
- the MAIT clone SMC3 was previously isolated from PBMC of a healthy donor and expresses canonical MAIT phenotype and function.
- FIG. 1 Isolation strategy of MR1 T cell clones from peripheral T cells.
- A FACS analysis of purified T cells previously expanded with irradiated A375-MR1 cells following overnight co- culture with A375-MR1 cells in the absence of exogenous antigens. Left dot plot shows CD3 and CellTrace violet (CTV) staining in live cells. Right dot plot shows CD69 and CD137 expression of CD3-positive CTV-negative gated cells. Arrows indicate gating hierarchy. Numbers indicate the percentages of cells within the gates. Cells from Donor A are illustrated as a representative donor.
- B, D Cumulative results of T cell clones screening from Donors A and B.
- T cell clones were generated from CD3 + CTV " CD137 + sorted T cells as depicted in A. Graphs show the individual clones (x axis) and their IFN- ⁇ release (y axis), expressed as ratio between the amount of cytokine secreted in response to A375-MR1 cells vs. A375 WT cells. Each dot represents a single T cell clone, tested at the same time in the indicated experimental conditions. The vertical lines indicate the number of T cell clones displaying MR1 -restricted reactivity (i.e. the clones showing an IFN- ⁇ release ratio above the arbitrary cut-off of 2). Results are representative of two independent experiments.
- C, E IFN- ⁇ release by 14 representative clones from Donor A and 1 1 clones from Donor B after stimulation with A375 WT, A375-MR1 and A375-MR1 in the presence of blocking anti-MR1 mAbs (a-MR1 ).
- Dots represent the IFN- ⁇ release (mean ⁇ SD of duplicate cultures) by each clone. Results are representative of three independent experiments. * P ⁇ 0.05 (Unpaired Student's t-test).
- MR1 T cells are common in the blood of healthy individuals.
- A Flow cytometry analysis of purified T cells from a representative donor (Donor C) after overnight co-culture with A375 WT or A375-MR1 cells. Dot plots show CD69 and CD137 expression on live CD3 + cells. Numbers indicate the percentage of cells in the gates.
- B Frequency of CD69 + CD137 + T cells from 5 different donors after overnight co-culture with A375 WT or A375-MR1 cells.
- C Cumulative results of T cell clone stimulation assays from Donor C. T cell clones were generated from CD3 + CD69 + CD137 + sorted T cells as depicted in A, right dot plot.
- the graph shows the number of tested clones (x axis) and IFN- ⁇ release (y axis) expressed as ratio between the amounts of cytokine secreted in response to A375-MR1 cells vs. A375 WT cells.
- Each dot represents a single T cell clone, tested at the same time in the indicated experimental conditions.
- the vertical line indicates the number of T cell clones displaying MR1 -restricted reactivity (i.e. the clones showing an IFN- ⁇ release ratio above arbitrary cut-off of 2). Results are representative of two independent experiments.
- MRU TCR gene transfer confers MR1 -restricted recognition of A375 cells.
- FIG. 5 Differential recognition of various types of tumour cells by MR1 T cell clones.
- A Recognition of four human cells lines expressing constitutive surface levels of MR1 by the representative SMC3 MAIT cell clone in the absence (no Ag) or presence of E. coli lysate (£. coli) with or without anti-MR1 blocking mAbs (a-MR1 ).
- B Recognition of the same cell types as in A by thirteen MR1 T cell clones with or without anti-MR1 mAbs (a-MR1 ). Graphs show IFN- ⁇ release (mean ⁇ SD of duplicate cultures).
- MR1 T cell clones do not react to microbial ligands or to 6-FP.
- A Response of seven MR1 T cell clones and one control MAIT cell clone co-cultured with A375 cells expressing (A375-MR1 ) or not (A375 WT) MR1 in the presence or absence of £ coli lysate. Blocking of T cell clone reactivity by anti-MR1 mAbs (oMR1 ) is also shown.
- FIG. 7 MRU cell clones do not recognize Ac-6-FP.
- A Stimulation of three representative MRU cell clones by A375-MR1 cells in the absence or presence of acetyl-6-formyl pterin (Ac- 6-FP).
- B Stimulation of two MAIT cell clones (MRC25 and SMC3) by A375-MR1 cells pulsed with £ coli lysate in the absence or presence of Ac-6-FP.
- C A375-MR1 cells were treated with zoledronate (Zol) in the absence or presence of Ac-6-FP (25 g/ml) and used to stimulate a TCR VY9-V52 cell clone (G2B9).
- A375 cells expressing K43A mutant MR1 molecules were used to stimulate the three MRU cell clones shown in A, in the absence or presence of Ac-6-FP (25 g/ml).
- E Stimulation of the two MAIT cell clones used in B by A375-MR1 K43A cells pulsed with £. coli lysate in the absence or presence of Ac-6- FP (25 g/ml). Results are expressed as mean ⁇ SD of I FN- ⁇ release assessed in duplicate cultures and are representative of three independent experiments. * P ⁇ 0.05 (Unpaired Student's t-test).
- MRU cells recognize antigens present in tumour cells and not derived from RPMI 1640 medium. Stimulation of the DGB129 MRU cell clone by MR1 -overexpressing (A) A375 cells (A375-MR1 ) and (B) THP-1 cells (THP1 -MR1 ) grown for 4 days in RPMI 1640 or in PBS both supplemented with 5% human serum. Inhibition of T cell clone reactivity by anti-MR1 blocking mAbs (oMR1 ) is shown. DGB129 cells recognize APCs loaded with fractions isolated from (C) THP-1 cell lysate or from (D) in vivo grown mouse breast tumour EMT6.
- Fractions E1 and E2 contain hydrophobic molecules; fractions N 1 -N4 contain hydrophilic molecules.
- E DGB70 MRU cells react to N3 fraction of THP-1 lysate.
- F Stimulation of DGB129 and DGB70 T cells by THP-1 -derived fractions N3 and N4 loaded onto plastic-bound recombinant MR1 . Shown is T cell release of I FN- ⁇ or GM-CSF mean ⁇ SD of duplicate cultures (representative of three independent experiments). Total cytokine release is shown in panels A, B, F; fold increase over background is shown in panels C, D, E. * P ⁇ 0.05 (Unpaired Student's t- test).
- MRU cells display differential anti-tumour responses.
- the MR1 -expressing tumour cell lines THP-1 and A375 were cultured overnight with the MRU cell clones (A) DGB129 or (B) DGB70 at the indicated effectortarget (E:T) ratios.
- the graphs show the percentages of apoptotic target cells in individual experimental conditions, assessed by flow cytometry using Annexin V and propidium iodide staining.
- MR1 T cells were identified by staining with anti-CD3 mAbs and excluded from the analysis. Inhibition of MR1 T cell clone killing capacity by anti- MR1 (a-MR1 ) mAbs is also shown at the 1 :1 E:T ratio.
- C Recognition of Mo-DCs isolated from a healthy individual by thirteen MR1 T cell clones with or without anti-MR1 mAbs (a-MR1 ). Graphs show IFN- ⁇ release (mean ⁇ SD of duplicate cultures).
- D Recognition of Mo-DCs from three donors by the representative DGB129 MR1 T cell clone in the absence or presence of anti-MR1 (a-MR1 ) mAbs. IFN- ⁇ release in the supernatants is shown and expressed as mean ⁇ SD.
- E Flow cytometry analysis of co-stimulatory molecules CD83 and CD86 on Mo- DCs after co-culture with DGB129 MR1 T cells with or without anti-MR1 mAbs (a-MR1 ).
- F Stimulation of JMAN MR1 T cell clone by LS 174T and HCT1 16 gastrointestinal tumour cell lines and by normal gut epithelial cells (GEC) in the presence or not of anti-MR1 mAbs (a-MR1 ). Columns show IFN- Y release (mean ⁇ SD of duplicate cultures). All the results are representative of at least three independent experiments. * P ⁇ 0.05 (Unpaired Student's t-test).
- FIG. 10 Functional heterogeneity of MR1 T cell clones.
- A IFN- ⁇ released by 7 selected MR1 T cell clones stimulated with A375-MR1 cells.
- ELISA results are expressed as mean ⁇ SD of IFN- ⁇ release measured in duplicate cultures.
- B Analysis of 16 additional cytokines by multiplex cytokine assay performed on the same supernatants for which IFN- ⁇ is shown in A. Results are representative of two independent experiments.
- MR1 T cell clones display multiple chemokine-receptor expression profiles.
- Graphs show the relative fluorescence intensity calculated by dividing the median fluorescence intensity (MFI) of specific mAb staining by the MFI of the corresponding isotype control. Data are representative of two independent experiments.
- MFI median fluorescence intensity
- MR1 T cells reduce the number of human melanoma lung nodules in mice.
- Immunocompromised NSG mice were injected with the human melanoma A375 cells expressing MR1 (A375-MR1 ) and with MR1 T cells. On day 14, mice were sacrificed and lung nodules were counted after India ink perfusion.
- Table 2 List of tumour cell lines recognized by MR1T cells.
- THP-1 myelomonocytic leukemia
- J.RT3-T3.5 TCR3-deficient T cell leukemia
- LS 174T colon adenocarcinoma
- HCT1 16 colon carcinoma
- Huh7 hepatocellular carcinoma
- HEK 293 human embryonic kidney
- CCRF-SB acute B cell lymphoblastic leukemia
- T cells purified by negative selection (EasySepTM Human T Cell Enrichment Kit, StemCell) were stimulated with irradiated (80 Gray) A375-MR1 cells (ratio 2:1 ) once a week for three weeks.
- Human rlL-2 (5 U/ml; Hoffmann-La Roche), rlL-7 and rlL-15 (both at 5 ng/ml, Peprotech) were added at day +2 and +5 after each stimulation. Twelve days after the last stimulation cells were washed and co-cultured overnight with A375-MR1 cells (ratio 2:1 ).
- CD3 + CD69 + CD37 + cells were then sorted and cloned by limiting dilution in the presence of PHA (1 ⁇ g/ml, Wellcome Research Laboratories), human rlL-2 (100 U/ml, Hoffmann-La Roche) and irradiated PBMC (5x10 5 cells /ml).
- MR1 T cells clones were generated using the same protocol from sorted CD3 + CD69 + CD137 + upon a single overnight stimulation with A375-MR1 cells (ratio 2:1 ). T cell clones were periodically re-stimulated following the same protocol (Lepore et al., ibid.).
- Monocytes and B cells were purified (>90% purity) from PBMCs of healthy donors using EasySep Human CD14 and CD19 positive selection kits (Stemcell Technologies) according to the manufacturer instructions.
- Mo-DCs were differentiated from purified CD14 + monocytes by culture in the presence of GM-CSF and IL-4 as previously described (Lepore et al., ibid.).
- Human normal gut epithelial cells (GEC) were isolated from gut biopsies of tumour-free individuals according to a published protocol (Graves et al., Journal of immunological methods 414, 20-31 (2014)).
- a human MR1 A cDNA construct linked to 32m via a flexible Gly-Ser linker was generated by PCR as previously described (Lepore et al., ibid.).
- the K43A substitution in the MR1A cDNA was introduced into the fusion construct using the following primers: MR1 K43A_f 5'- CTCGGCAGGCCGAGCCACGGGC (SEQ ID 53) and MR1 K43A_r 5'GCCCGTGGCTCGGCCTGCCGAG (SEQ ID 54).
- Resulting WT and mutant constructs were cloned into a bidirectional lentiviral vector (LV) (Lepore et al., ibid.).
- HEK 293 cells were transfected with individual LV-MR1A-32m constructs together with the lentivirus packaging plasmids pMD2.G, pMDLg/pRRE and pRSV-REV (Addgene) using Metafectene Pro (Biontex) according to manufacturer instructions. A375, and THP-1 , cells were transduced by spin- infection with virus particle containing supernatant in the presence of 8 ⁇ g ml protamine sulfate. Surface expression of MR1 was assessed by flow cytometry and positive cells were FACS sorted.
- Soluble recombinant 32m-MR1 -Fc fusion protein Soluble recombinant 32m-MR1 -Fc fusion protein.
- 32m-MR1 -Fc fusion construct was obtained using human MR1A-32m construct described above as template.
- DNA complementary to 32m-MR1A gene was amplified by PCR using primers: 32mXhol_f 5'- CTCGAGATGTCTCGCTCCGTGGCCTTA (SEQ ID 55) and MR1 -lgG1_r 5 - GTGTGAGTTTTGTCGCTAGCCTGGGGGACCTG (SEQ ID 56), thus excluding MR1 transmembrane and intracellular domains.
- the DNA complementary to the hinge region and CH2- CH3 domains of human lgG1 heavy chain was generated using the following primers: Nhel- hinge-f 5'-CAGGTCCCCCAGGCTAGCGACAAAACTCACAC (SEQ ID 57) and lgG1 Notl_r 5 - G C G G C C G CTC ATTTAC C C G G AG ACAG G GAGA (SEQ ID 58) from pFUSE-hlgG1 -Fd (InvivoGen).
- the 32m-MR1A and lgG1 PCR products were joined together using two-step splicing with overlap extension PCR and the resulting construct subcloned into the Xhol/Notl sites of the BCMGSNeo expression vector.
- CHO-K1 cells were transfected with the final construct using Metafectene Pro (Biontex), cloned by limiting dilutions and screened by ELISA for the production of 32m-MR1 -Fc fusion protein.
- Selected clones adapted to EX-CELL ACF CHO serum-free medium (Sigma), were used for protein production and 32m-MR1 -Fc was purified using Protein-A-Sepharose (Thermo Fisher Scientific) according to manufacturer instructions. Protein integrity and purity were verified by SDS-PAGE and Western Blot using anti-MR1 mAb 25.6 (Biolegend).
- CD86-FITC (2331 ), CCR4-PECy7 (1 G1 ) and CCR6-PE (1 1A9) mAbs were from BD Pharmingen. All these mAbs were used at 5 ⁇ g ml. Biotinylated mAbs were revealed with streptavidin-PE, -Alexa Fluor 488, or -Brilliant violet 421 (2 ⁇ g ml, Biolegend). Samples were acquired on LSR Fortessa flow cytometer (Becton Dickinson). Cell sorting experiments were performed using an Influx instrument (Becton Dickinson). Dead cells and doublets were excluded on the basis of forward scatter area and width, side scatter, and DAPI staining. All data were analyzed using FlowJo software (TreeStar).
- TCR gene analysis of MRU cell clones TCRa and ⁇ or gene TCRy and ⁇ expression by MRU cell clones was assessed either by RT-PCR using total cDNA and specific primers, or by flow cytometry using the lOTest® Beta Mark TCR ⁇ Repertoire Kit (Beckman Coulter) according to the manufacturers' instructions or panv5 TCR-specific monoclonal antibodies (B1 , Biolegend).
- RNA was prepared using the NucleoSpin RNA II Kit (Macherey Nagel) and cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen).
- TCRa, ⁇ , Y and ⁇ cDNAs were amplified using sets of Va, ⁇ , Vy and V5 primers as directed by the manufacturer (TCR typing amplimer kit, Clontech). Functional transcripts were identified by sequencing and then analyzed using the ImMunoGeneTics information system (http://www.imgt.org).
- TCR gene transfer TCRa and ⁇ functional cDNA from the MAIT cell clone MRC25 were cloned into the Xho ⁇ /Not ⁇ sites of the BCMGSNeo expression vector (Karasuyama and Melchers Eur. J. Immunol. 1988 18:97-104) and the resulting constructs were used to co- transfect J.RT3-T3.5 cells by electroporation according to standard procedure. Transfectants expressing TRAV1 -2 and CD3 were FACS sorted.
- TCRa and ⁇ or TCRy and ⁇ functional cDNAs from MRU clones were cloned into the Xma ⁇ /BamHI sites of a modified version of the plasmid 52962 (Addgene) expression vector.
- SKW-3 cells were transduced with virus particle- containing supernatant generated as described above. Cells were FACS sorted based on CD3 expression.
- Bound material was eluted in batch with 75% (fraction E1 ) and 100% methanol (fraction E2).
- the E-FT material was re-suspended in acetonitrile/water (9:1 vol/vol) and loaded onto a Nh Sep-Pak cartridge (Waters Corporation). Unbound material (fraction N-FT) and 4 additional fractions were eluted with increasing quantities of water.
- Fraction N1 was eluted with 35% H2O, fraction N2 with 60% H 2 0, fraction N3 with 100% H 2 0, and fraction N4 with 100% H 2 0 and 50 mM ammonium acetate (pH 7.0). All fractions were dried and then re-suspended in 20% methanol (fractions E1 , E2 and N-FT) or 100% H 2 0 (all other fractions) prior to being stored at -70°C.
- the pellet was further extracted with 9 ml of HPLC-grade methanol for 5 min at room temperature by vortexing, centrifuged (5,1 OOg) for 10 min at 4°C, and supernatant collected. The three supernatants were pooled, dried, and resuspended in water:methanol (10:1 ). Material was fractionated using C18 and NH 2 Sep-Pak cartridges as above.
- T cell activation assays MR1 -restricted T cells (5 ⁇ 10 4 /well unless otherwise indicated) were co-cultured with indicated target cells (5*10 4 /well) in 200 ⁇ total volume in duplicates or triplicates. T cells were cultured with indicated APCs for 24 h. In some experiments, anti-MR1 mAbs (clone 26.5) or mouse lgG2a isotype control mAbs (both at 30 g/ml) were added and incubated for 30 min prior to the addition of T cells. E. coli lysate was prepared from the DH5a strain (Invitrogen) grown in LB medium and collected during exponential growth.
- APCs Bacterial cells were washed twice in PBS and then lysed by sonication. After centrifugation (15,000g for 15 min), the supernatant was collected, dried, and stored at -70°C. APCs were pulsed for 4 h with E. coli lysate equivalent to 10 8 CFU/ml (unless otherwise indicated) before addition of T cells. In some experiments, APCs were pre-incubated with 6-FP or Ac-6-FP (Schircks Laboratories) for 4 h before co-culture with T cells. In control experiments with TCR ⁇ cells expressing TCR Vy9 and V52 chains, the APCs were first treated for 6 h with zoledronate (10 g/ml) prior to T cell addition.
- Activation experiments with plate-bound recombinant human 32m-MR1 -Fc were performed by coating 32m-MR1 -Fc onto 96 well plates (4 ⁇ g ml) and loading with cartridge- purified cell lysates for 4 h at 37°C before washing twice and adding T cells.
- Supernatants were collected after 24 h and IFN- ⁇ or GM-CSF were assessed by ELISA.
- Multiple cytokines and chemokines in cell culture supernatants were analyzed using the Milliplex MAP human cytokine/chemokine magnetic bead panel - Premixed 41 plex (HCYTMAG-60K-PX41 ; Merck Millipore) according to the manufacturer's instructions. Samples were acquired on a Flexmap 3D system (Merck Millipore) and Milliplex analyst software was used to determine mean fluorescence intensity and analyte concentration.
- Killing of tumour cells were performed using target cell lines (2x10 4 cells/ml) incubated either alone or with T cells at different E/T ratios for 24 h, in the presence or absence of anti-MR1 mAb (30 ⁇ 9/ ⁇ " ⁇ , clone 26.5).
- the target cells were stained with PE- Annexin V (BD) and propidium iodide (PI) (Sigma-Aldrich), as previously described (2).
- T cells were identified by staining with anti-CD3 mAbs and excluded from the analysis.
- the inventors detected an atypical MR1 -restricted T cell clone that did not react to microbial ligands during earlier studies on the repertoire of human MAIT cells.
- This T cell clone (DGB129) recognized cell lines constitutively displaying surface MR1 (CCRF-SB lymphoblastic leukemia cells, or THP-1 monocytic leukemia cells; Figure 1A) or transfected with the MR1 gene (A375 melanoma cells; A375-MR1 ; Figure 1A) in the absence of any exogenously added antigens (Figure 1 B).
- Purified T cells from two healthy donors were labelled with the proliferation marker CellTrace violet (CTV) and stimulated with irradiated A375-MR1 cells in the absence of exogenous antigens.
- Proliferating cells were re-challenged with A375-MR1 cells and those expressing high levels of the activation marker CD137 were sorted and cloned by limiting dilution (Figure 2A).
- T cell clones were then interrogated for their capacity to recognize A375-MR1 and A375 cells lacking MR1 (A375-WT).
- A375-WT A375-WT
- the inventors found that a major fraction of T cell clones (126/195 and 37/57, respectively) displayed specific recognition of A375-MR1 cells ( Figure 2B,D), which was inhibited by anti-MR1 blocking mAbs ( Figure 2C,E).
- Staining with TCR ⁇ -specific mAbs of 12 MR1 -reactive T cell clones revealed that they expressed 7 different TRBV chains (TRBV4-3, 6-5/6-6/6-9, 9, 18, 25-1 , 28, 29-1 ) with some of the clones sharing the same TRBV gene.
- TRBV4-3 TRBV4-3, 6-5/6-6/6-9, 9, 18, 25-1 , 28, 29-1
- Detailed analysis of representative T cell clones derived from three donors confirmed that they displayed diverse TCRa and ⁇ chains and indicated differential expression of CD4, CD8 and CD161 (Table 1 ).
- tumour-reactive MR1 - restricted T cells are a novel yet common polyclonal population of lymphocytes in the blood of healthy human individuals (hereafter termed MR1T cells).
- MR1 T cell TCR gene transfer confers MR1 -restricted recognition of tumour cells
- MR1 T cell clones reacting to MR1 -expressing A375 melanoma cells
- the inventors next investigated whether they could also recognize other types of tumour cells constitutively expressing surface MR1 , including THP-1 myelomonocytic cells, Huh7 hepatoma cells, HCT1 16 colon carcinoma cells and LS 174T goblet-like colon adenocarcinoma cells. All these cell types supported MAIT cell activation in the presence of microbial antigens and in an MR1 -dependent manner ( Figure 5A). The same cells were able to induce sterile activation of select MR1 T cell clones to various extents.
- THP-1 cells were recognized by the majority of the tested MR1 T cell clones, followed by the Huh7 hepatoma cells, the LS 174T goblet-like cells and the HCT1 16 colon carcinoma cells (Figure 5B). Importantly, all responses were blocked by anti-MR1 mAbs.
- MR1 T cells are a novel and heterogeneous population of tumour-reactive T cells restricted to the non-polymorphic antigen-presenting molecule MR1 .
- MR1 T cells recognize MR1 -bound antigens present in tumour cells
- the inventors next studied the basis of MR1 T cell reactivity to tumour cells. First, they sought to definitively rule out the possibility that MR1 T cell clones could recognize microbial antigens, in analogy to MAIT cells. While a control MAIT cell clone reacted to A375-MR1 cells only in the presence of £ coli lysate, activation of different MR1 T cell clones was not enhanced by the £. coli lysate ( Figure 6A).
- MR1 T cell stimulation was impaired in the presence of 6-FP or Ac-6-FP ligands, which also impaired £ coli stimulation of control MAIT cells, but did not disrupt control TCR ⁇ cell responses to cognate antigen presented by the same APCs, thus excluding compound toxicity ( Figure 6B,C and 7A-C).
- 6-FP or Ac-6-FP failed to inhibit the activation of MRU cells or MAIT cells when the target A375 cells were transduced to express mutant MR1 molecules with defective ligand binding capacity (blockade of Schiff base formation with ligands by mutation of Lysine 43 into Alanine, A375-MR1 K34A; Figure 6B,C and 7D,E).
- the specific inhibition observed with 6-FP or Ac-6-FP indicated that MRU cells i) do not recognize 6-FP and Ac-6-FP, ii) react to MR1 -bound cellular antigens, and iii) are stimulated by ligands that do not require the formation of a Schiff base with MR1 .
- MR1 ligands e.g. 6-FP
- RPMI 1640 medium used for cell culture.
- Both THP-1 and A375-MR1 cells were extensively washed and cultivated 4 days in phosphate buffered saline solution (PBS) supplemented exclusively with 5% human serum. Cells were washed daily before being used to stimulate DGB129 MRU cells and the T cell activation assays were performed in PBS.
- PBS phosphate buffered saline solution
- THP-1 and A375-MR1 cells grown in RPMI 1640 or in PBS showed the same stimulatory capacity ( Figure 8A,B), thus indicating that medium constituents are not responsible for MRU cell activation.
- the inventors then performed T cell activation assays using as source of antigen two types of tumour lysates. The first lysate was obtained from in vitro cultured THP-1 cells, while the second one was prepared from mouse breast tumours immediately after resection. Two hydrophobic and four hydrophilic fractions were obtained and tested using as APCs THP-1 cells that constitutively express low levels of MR1.
- MR1 T cells recognized and killed the myelomonocytic tumour cell line THP-1 , the inventors next addressed whether they could also recognize normal myeloid cells including monocytes and monocyte-derived dendritic cells (Mo-DC) from different donors. Monocytes were not recognized by any of the tested MR1 T cell clones (not shown). By contrast, some MR1 T cell clones reacted to Mo-DC in MR1 dependent manner ( Figure 9C). Interestingly, experiments performed with the representative DGB129 MR1 T cell clone revealed that recognition of Mo-DC did not result in Mo-DC killing (not shown), but promoted up-regulation of CD83 and CD86 activation markers by Mo-DC ( Figure 9D).
- GEC gut epithelial cells
- MR1 T cells To further assess the specificity of tumour recognition by MR1 T cells, the inventors finally investigated whether they could react to other types of normal cells including neutrophils, NK cells, B cells and T cells. None of these cells were recognized by the tested MR1 T cells (not shown).
- MR1 T cells are functionally heterogeneous populations of human MR1 -restricted T lymphocytes that i) differently react to various types of tumour cells, ii) display cytotoxic activity against tumour cells, iii) do not recognize normal cells with exception of in v/ ' iro-differentiated Mo-DC, and iv) do not kill Mo-DC but instead induce their activation.
- MR1 T cells display important anti-tumour properties and deserve to be exploited for their immunotherapeutic potential.
- MR1 T cells are functionally heterogeneous
- the inventors finally analyzed the cytokine secretion profile of representative MRU cell clones upon stimulation by A375-MR1 tumour cells. All clones tested released IFN- ⁇ (Figure 10A). However, the inventors also observed diverse expression profiles of Th1 (IL-2, TNF-a and TNF- ⁇ ), Th2 (IL-3, IL-4, IL-5, IL-6, IL-10, IL-13) and Th17 cytokines (IL-17A, G- CSF, GM-CSF), and other soluble factors ( ⁇ -1 ⁇ , soluble CD40L PDGF-AA and VEGF; Figure 10B). The variable combinations and quantities of cytokines expressed by MRU cells suggested considerable functional plasticity within this population.
- clone DGA4 secreted large quantities of IL-17A, IL-6, TNF-a and GM-CSF, but failed to secrete the prototypic Th2 cytokines IL-4, IL-5, IL-10 or IL-13, and thus displayed an 'atypical' Th17-like phenotype.
- clone TC5A87 released substantial amounts of VEGF and PGDF-AA, but only little Th1 or Th2 cytokines, and no IL-17A.
- the inventors next investigated the expression of three selected chemokine receptors known to be differentially expressed by T cell subsets with distinct functions and whose alternative combined expression regulates T cell recirculation and migration to diverse homing sites. All MRU cell clones but DGA4 displayed high levels of CXCR3 ( Figure 11 ). In addition, the inventors observed divergent expression patterns of CCR4 and CCR6 ( Figure 11 ), which further suggested that MRU cells are heterogeneous.
- tumour MR1 -reactive T clones tested here are phenotypically and functionally diverse, thus suggesting that MRU cells include multiple subsets with distinct recirculation patterns and tissue homing capacity and likely different roles in tumour immunity.
- these data identify MRU cells as a novel population of human T lymphocytes that recognize MR1 :tumour-associated-antigen complexes and may participate in anti-tumour immune responses with multiple effector functions. Table 1. Phenotype of select MR1 -reactive T cell clones.
- a cancer patient's tissue fresh or fresh-frozen tissue biopsies are analyzed for MR1 expression using mAbs specific for human MR1 and PCR amplification of MR1 mRNA.
- Cancer therapy Example 1 : Selection of best MRT1 TCR genes for recognition of primary MR1 -expressing cancer cells.
- Primary MR1 + cancer cells isolated ex vivo are used to stimulate a library of previously characterized MRU cell clones. Each clone expresses different TCR genes and recognizes different types of cancer cells.
- the MRU cells clones best responding to the cancer cells of the patient are selected and their TCR genes are used for TCR gene therapy.
- Response is assayed as a function of cytokine release and / or surface marker expression.
- Cells are assayed by internal (cytokine) or surface marker staining with antibodies reactive to the assayed activation markers, exemplified but not restricted to CD3, CD69, CD137, CD150, and / or ICOS (surface markers) and INF- ⁇ and GM-CSF (cytokine).
- MRU TCR When available soluble MRU TCR will be multimerized and used to stain tumor cells isolated from tumour biopsies. The MRU TCR multimers binding to tumour cells will allow rapid selection of MRU TCRs suitable for gene therapy in that patient.
- circulating patient T cell populations may be used as recipient T cells (naive, central memory, effector memory, CD4 + , CD8 + , or CD4, CD8 double negative T cells).
- Naive T cells are selected to allow unprimed T lymphocytes to mature in the presence of tumor cells when they are transduced with TCR genes recognizing MR1 - tumor antigens.
- Central and effector memory cells are used because they provide immediate proliferation and effector functions (tumor killing) upon recognition of tumor cells expressing MR1.
- CD4 cells are selected to provide sufficient numbers of T helper cells that facilitate recruitment and expansion of other cells with anti-tumor functions.
- CD8 T cells are selected to facilitate killing of tumor cells.
- CD4-CD8 double negative T cells are selected for their innate-like functions such as immediate release of large amounts of killer effector molecules (TNFa, granzymes and granulysin).
- T cells expressing the transduced TCR genes and with selected effector functions are used for adoptive cell therapy (ACT).
- ACT adoptive cell therapy
- T cells from peripheral blood of patients are stained with monoclonal antibodies specific for surface markers (CD4, CD8, CD27, CD45RA, CD57) and sorted. Each sorted population is activated with Dynabeads® Human T-Activator CD3/CD28 (ThermoFisher) and 24 h later transfected with the TCR genes encoding the MRU TCR selected for the individual patient. This yields a modified T cell preparation (recipient T cells). In some cases, recipient T cells are also modified by gene-editing methods to inactivate PD1 , ILT2 and ILT4 inhibitory genes or were transduced with CD137 and CD134 genes to promote cell survival, cell expansion and to enhance anti-cancer effector function.
- Lymphodepletion is made in recipient cancer patients using a non-myeloablative
- exogenous TCR genes (the modified T cell preparation) are transferred into recipient.
- TCR genes are cloned in safe recombinant lentivirus vectors (see for example Provasi et al., Nat Med 18, 807-815 (2012)), which contain suicide genes and cannot produce mature viral particles in the absence of other helper viruses.
- TCR genes are cloned in vectors containing suicide genes (for examples, see Greco et al., Front Pharmacol 6, 95 (2015)), thus reducing the risks derived from unwanted gene insertion.
- RNA encoding the TCR MR1 T genes is transfected in recipient cells (see for example Zhao et al. Molecular therapy 13, 151 , 2006)).
- Example 2 Isolation of MR1 T cells from tumor-infiltrating lymphocytes (TILs) of patient to be treated.
- TILs tumor-infiltrating lymphocytes
- T cells are expanded in vitro for 2-3 weeks using medium supplemented with IL-2, IL- 7, and IL-15.
- T cells are tested for reactivity against autologous MR1 + cancer cells.
- T cells that increase surface expression of activation markers are considered cancer-specific and if they are inhibited by the presence of anti-MR1 monoclonal antibodies, they are considered MR1 -dependent.
- Cancer-reactive T cells are sorted according to the expression of one of above activation markers and expanded and used for ACT, as outlined above.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Developmental Biology & Embryology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2018231405A AU2018231405B2 (en) | 2017-03-07 | 2018-03-07 | MR1 restricted T cell receptors for cancer immunotherapy |
| KR1020197027180A KR20190126332A (ko) | 2017-03-07 | 2018-03-07 | 암 면역치료요법을 위한 mr1 제한된 t 세포 수용체 |
| EP18708695.4A EP3592839B1 (en) | 2017-03-07 | 2018-03-07 | Mr1 restricted t cell receptors for cancer immunotherapy |
| EP23181086.2A EP4273233A3 (en) | 2017-03-07 | 2018-03-07 | Mr1 restricted t cell receptors for cancer immunotherapy |
| JP2019572845A JP7233103B2 (ja) | 2017-03-07 | 2018-03-07 | 癌免疫療法用mr1制限t細胞受容体 |
| CA3054758A CA3054758A1 (en) | 2017-03-07 | 2018-03-07 | Mr1 restricted t cell receptors for cancer immunotherapy |
| CN201880016990.4A CN110462024B (zh) | 2017-03-07 | 2018-03-07 | 用于癌症免疫疗法的mr1限制性t细胞受体 |
| IL26881319A IL268813A (en) | 2017-03-07 | 2019-08-21 | Mr1 restricted t cell receptors for cancer immunotherapy |
| ZA2019/05579A ZA201905579B (en) | 2017-03-07 | 2019-08-23 | Mr1 restricted t cell receptors for cancer immunotherapy |
| US16/563,987 US11702459B2 (en) | 2017-03-07 | 2019-09-09 | MR1 restricted T cell receptors for cancer immunotherapy |
| JP2023020851A JP7515209B2 (ja) | 2017-03-07 | 2023-02-14 | 癌免疫療法用mr1制限t細胞受容体 |
| US18/353,119 US20240002465A1 (en) | 2017-03-07 | 2023-07-17 | Mr1 restricted t cell receptors for cancer immunotherapy |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP17159754.5 | 2017-03-07 | ||
| EP17159754 | 2017-03-07 | ||
| EP17179309.4 | 2017-07-03 | ||
| EP17179309 | 2017-07-03 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/563,987 Continuation-In-Part US11702459B2 (en) | 2017-03-07 | 2019-09-09 | MR1 restricted T cell receptors for cancer immunotherapy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018162563A1 true WO2018162563A1 (en) | 2018-09-13 |
Family
ID=61563412
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2018/055620 Ceased WO2018162563A1 (en) | 2017-03-07 | 2018-03-07 | Mr1 restricted t cell receptors for cancer immunotherapy |
Country Status (9)
| Country | Link |
|---|---|
| EP (2) | EP4273233A3 (enExample) |
| JP (2) | JP7233103B2 (enExample) |
| KR (1) | KR20190126332A (enExample) |
| CN (1) | CN110462024B (enExample) |
| AU (1) | AU2018231405B2 (enExample) |
| CA (1) | CA3054758A1 (enExample) |
| IL (1) | IL268813A (enExample) |
| WO (1) | WO2018162563A1 (enExample) |
| ZA (1) | ZA201905579B (enExample) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019081902A1 (en) * | 2017-10-26 | 2019-05-02 | University College Cardiff Consultants Ltd | NEW LYMPHOCYTE RECEPTOR T |
| WO2020053312A1 (en) * | 2018-09-12 | 2020-03-19 | Universität Basel | Mr1 restricted t cell receptors for cancer immunotherapy |
| US20210363215A1 (en) * | 2018-04-19 | 2021-11-25 | Board Of Regents, The University Of Texas System | T cell receptors with mage-b2 specificity and uses thereof |
| US20210369776A1 (en) * | 2018-12-06 | 2021-12-02 | Guangdong Tcrcure Biopharma Technology Co., Ltd. | Combinational tcr-t cell therapy targeting tumor antigens, tgf-beta, and immune checkpoints |
| WO2022118043A1 (en) | 2020-12-03 | 2022-06-09 | Enara Bio Limited | Novel protein-ligand complex |
| WO2022248881A1 (en) | 2021-05-28 | 2022-12-01 | Enara Bio Limited | Novel protein-ligand complex |
| EP4099015A1 (en) * | 2016-06-10 | 2022-12-07 | Gadeta B.V. | Novel method for identifying deltat-cell (or gammat-cell) receptor chains or parts thereof that mediate an anti-tumour or an anti-infective response |
| WO2023148494A1 (en) * | 2022-02-03 | 2023-08-10 | University College Cardiff Consultants Limited | Novel t-cell receptor |
| US12161669B2 (en) | 2017-05-18 | 2024-12-10 | Umc Utrecht Holding B.V. | Compositions and methods for cell targeting therapies |
| CN119587561A (zh) * | 2024-12-09 | 2025-03-11 | 新乡医学院 | THP在制备增强Vγ9Vδ2 T细胞抗肿瘤疗效的药物中的应用 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023106894A1 (ko) * | 2021-12-10 | 2023-06-15 | 주식회사 유틸렉스 | Mr1 제한적 panck t 세포 및 이의 제조방법 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014160030A2 (en) * | 2013-03-13 | 2014-10-02 | Health Research, Inc. | Compositions and methods for use of recombinant t cell receptors for direct recognition of tumor antigen |
| EP2899269A1 (en) * | 2012-07-25 | 2015-07-29 | National University Corporation University Of Toyama | Method for cloning t cell receptor |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2089229C (en) * | 1992-02-14 | 2010-04-13 | Alejandro A. Aruffo | Cd40cr receptor and ligands therefor |
| US7829289B2 (en) * | 2002-05-14 | 2010-11-09 | Institut National De La Sante Et De Recherche Medicale | T cell subpopulation regulating gut immunity |
| US10245262B2 (en) * | 2014-04-01 | 2019-04-02 | The University Of Queensland | Immunological reagents and uses therefor |
-
2018
- 2018-03-07 JP JP2019572845A patent/JP7233103B2/ja active Active
- 2018-03-07 CN CN201880016990.4A patent/CN110462024B/zh active Active
- 2018-03-07 KR KR1020197027180A patent/KR20190126332A/ko active Pending
- 2018-03-07 EP EP23181086.2A patent/EP4273233A3/en not_active Withdrawn
- 2018-03-07 EP EP18708695.4A patent/EP3592839B1/en active Active
- 2018-03-07 AU AU2018231405A patent/AU2018231405B2/en active Active
- 2018-03-07 WO PCT/EP2018/055620 patent/WO2018162563A1/en not_active Ceased
- 2018-03-07 CA CA3054758A patent/CA3054758A1/en active Pending
-
2019
- 2019-08-21 IL IL26881319A patent/IL268813A/en unknown
- 2019-08-23 ZA ZA2019/05579A patent/ZA201905579B/en unknown
-
2023
- 2023-02-14 JP JP2023020851A patent/JP7515209B2/ja active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2899269A1 (en) * | 2012-07-25 | 2015-07-29 | National University Corporation University Of Toyama | Method for cloning t cell receptor |
| WO2014160030A2 (en) * | 2013-03-13 | 2014-10-02 | Health Research, Inc. | Compositions and methods for use of recombinant t cell receptors for direct recognition of tumor antigen |
Non-Patent Citations (14)
| Title |
|---|
| EUN JEONG WON ET AL: "Clinical relevance of circulating mucosal-associated invariant T cell levels and their anti-cancer activity in patients with mucosal-associated cancer", ONCOTARGET, vol. 7, no. 46, 15 November 2016 (2016-11-15), United States, XP055469874, ISSN: 1949-2553, DOI: 10.18632/oncotarget.11187 * |
| GOBER ET AL., THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 197, 2003, pages 163 - 168 |
| GRAVES ET AL., JOURNAL OF IMMUNOLOGICAL METHODS, vol. 414, 2014, pages 20 - 31 |
| GRECO ET AL., FRONT PHARMACOL, vol. 6, 2015, pages 95 |
| KARASUYAMA; MELCHERS, EUR. J. IMMUNOL., vol. 18, 1988, pages 97 - 104 |
| LARS KJER-NIELSEN ET AL: "MR1 presents microbial vitamin B metabolites to MAIT cells", NATURE, 10 October 2012 (2012-10-10), XP055433997, ISSN: 0028-0836, DOI: 10.1038/nature11605 * |
| LEPORE ET AL., NAT COMMUN, vol. 5, 2014, pages 3866 |
| LUCAS ET AL., J VIROL, vol. 78, pages 7284 - 7287 |
| MARCO LEPORE ET AL: "Functionally diverse human T cells recognize non-microbial antigens presented by MR1", ELIFE, vol. 6, 18 May 2017 (2017-05-18), XP055434063, DOI: 10.7554/eLife.24476 * |
| PROVASI ET AL., NAT, vol. 18, 2012, pages 807 - 815 |
| SU ET AL., IMMUNITY, vol. 38, pages 373 - 383 |
| SUBBRAMANIAN ET AL., NATURE BIOTECHNOLOGY, vol. 22, 2004, pages 1429 |
| ZHAO ET AL., MOLECULAR THERAPY, vol. 13, 2006, pages 151 |
| ZIPPELIUS ET AL., CANCER IMMUNOL RES, vol. 3, 2015, pages 236 - 244 |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4099015A1 (en) * | 2016-06-10 | 2022-12-07 | Gadeta B.V. | Novel method for identifying deltat-cell (or gammat-cell) receptor chains or parts thereof that mediate an anti-tumour or an anti-infective response |
| US12297274B2 (en) | 2016-06-10 | 2025-05-13 | Umc Utrecht Holding B.V. | Method of cell therapy |
| US12161669B2 (en) | 2017-05-18 | 2024-12-10 | Umc Utrecht Holding B.V. | Compositions and methods for cell targeting therapies |
| US11078252B2 (en) | 2017-10-26 | 2021-08-03 | University College Cardiff Consultants Ltd. | T-cell receptor |
| WO2019081902A1 (en) * | 2017-10-26 | 2019-05-02 | University College Cardiff Consultants Ltd | NEW LYMPHOCYTE RECEPTOR T |
| US11725039B2 (en) | 2017-10-26 | 2023-08-15 | University College Cardiff Consultants Ltd. | α/β t-cell receptor and methods of using it |
| EP4039700A1 (en) * | 2017-10-26 | 2022-08-10 | University College Cardiff Consultants Ltd | Novel t-cell receptor |
| US20210363215A1 (en) * | 2018-04-19 | 2021-11-25 | Board Of Regents, The University Of Texas System | T cell receptors with mage-b2 specificity and uses thereof |
| US12202877B2 (en) * | 2018-04-19 | 2025-01-21 | Board Of Regents, The University Of Texas System | T cell receptors with mage-B2 specificity and uses thereof |
| WO2020053312A1 (en) * | 2018-09-12 | 2020-03-19 | Universität Basel | Mr1 restricted t cell receptors for cancer immunotherapy |
| US20210369776A1 (en) * | 2018-12-06 | 2021-12-02 | Guangdong Tcrcure Biopharma Technology Co., Ltd. | Combinational tcr-t cell therapy targeting tumor antigens, tgf-beta, and immune checkpoints |
| WO2022118043A1 (en) | 2020-12-03 | 2022-06-09 | Enara Bio Limited | Novel protein-ligand complex |
| WO2022248881A1 (en) | 2021-05-28 | 2022-12-01 | Enara Bio Limited | Novel protein-ligand complex |
| WO2023148494A1 (en) * | 2022-02-03 | 2023-08-10 | University College Cardiff Consultants Limited | Novel t-cell receptor |
| CN119587561A (zh) * | 2024-12-09 | 2025-03-11 | 新乡医学院 | THP在制备增强Vγ9Vδ2 T细胞抗肿瘤疗效的药物中的应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3054758A1 (en) | 2018-09-13 |
| CN110462024A (zh) | 2019-11-15 |
| JP7515209B2 (ja) | 2024-07-12 |
| EP4273233A2 (en) | 2023-11-08 |
| JP2020527036A (ja) | 2020-09-03 |
| IL268813A (en) | 2019-10-31 |
| AU2018231405B2 (en) | 2024-02-08 |
| ZA201905579B (en) | 2024-08-28 |
| JP7233103B2 (ja) | 2023-03-06 |
| EP3592839C0 (en) | 2023-07-05 |
| KR20190126332A (ko) | 2019-11-11 |
| EP3592839A1 (en) | 2020-01-15 |
| EP3592839B1 (en) | 2023-07-05 |
| CN110462024B (zh) | 2024-08-09 |
| JP2023058659A (ja) | 2023-04-25 |
| EP4273233A3 (en) | 2023-11-15 |
| AU2018231405A1 (en) | 2019-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3592839B1 (en) | Mr1 restricted t cell receptors for cancer immunotherapy | |
| US20250136940A1 (en) | Nk cells with an increased antibody-dependent cellular toxicity (adcc) against tumors | |
| ES2951552T3 (es) | Polipéptidos inmunomoduladores y composiciones y métodos relacionados | |
| ES2992909T3 (en) | Methods and compositions for preparing genetically engineered cells | |
| CN104780939B (zh) | 用于细胞免疫治疗的方法和组合物 | |
| US11702459B2 (en) | MR1 restricted T cell receptors for cancer immunotherapy | |
| US20170313759A1 (en) | Novel chimeric antigen receptors | |
| US20220339271A1 (en) | Mr1 restricted t cell receptors for cancer immunotherapy | |
| KR20170068598A (ko) | 입양 세포 치료에서 복용을 위한 방법 및 조성물 | |
| AU2014259675A1 (en) | CS1-specific chimeric antigen receptor engineered immune effector cells | |
| US11634498B2 (en) | Chimeric antigen receptors and uses thereof | |
| WO2019119822A1 (en) | Pharmaceutical chimeric receptor composition and method thereof | |
| US20240002465A1 (en) | Mr1 restricted t cell receptors for cancer immunotherapy | |
| CA3228635A1 (en) | Modulation of bcl-2 to enhance chimeric antigen receptor cancer immunotherapy efficacy | |
| CA3141210A1 (en) | Modified nk-92 cells, and therapeutic and diagnostic uses thereof | |
| Stringhini | Direct and Indirect Harnessing of Cytotoxic CD8+ T Lymphocytes for Cancer Therapy: Adoptive Cell Therapy Versus Immunocytokines | |
| US20230374104A1 (en) | Methods and compositions comprising pd1 chimeric polypeptides | |
| WO2024179518A1 (zh) | 具有优化的itam结构域及cd28与4-1bb双共刺激分子的双靶点car-t | |
| JP2025512781A (ja) | 自然様リンパ球を操作するための方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18708695 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3054758 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019572845 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20197027180 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018231405 Country of ref document: AU Date of ref document: 20180307 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018708695 Country of ref document: EP Effective date: 20191007 |