WO2018147620A1 - 사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물 - Google Patents

사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2018147620A1
WO2018147620A1 PCT/KR2018/001597 KR2018001597W WO2018147620A1 WO 2018147620 A1 WO2018147620 A1 WO 2018147620A1 KR 2018001597 W KR2018001597 W KR 2018001597W WO 2018147620 A1 WO2018147620 A1 WO 2018147620A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
group
cells
apo
administered
Prior art date
Application number
PCT/KR2018/001597
Other languages
English (en)
French (fr)
Inventor
이지희
Original Assignee
이화여자대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 이화여자대학교 산학협력단 filed Critical 이화여자대학교 산학협력단
Publication of WO2018147620A1 publication Critical patent/WO2018147620A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A61K31/366—Lactones having six-membered rings, e.g. delta-lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/26—Lymph; Lymph nodes; Thymus; Spleen; Splenocytes; Thymocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/31—Somatostatins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A61K9/0021—Intradermal administration, e.g. through microneedle arrays, needleless injectors

Definitions

  • the present invention relates to a pharmaceutical composition for treating pulmonary fibrosis, and in particular, to a composition for treating pulmonary fibrosis comprising a first composition comprising an apoptotic cell and a second composition comprising a statin-based compound. will be.
  • Lung fibrosis is a lethal disease caused by persistent pulmonary epithelial damage and ataxia, causing myofibroblast accumulation and excessive accumulation of extracellular matrix and connective tissue.
  • Idiopathic pulmonary fibrosis IPF
  • Idiopathic pulmonary fibrosis occurs at a frequency of 2 to 29 per 100,000 people, at about 10 per 100,000 people annually, and is on the rise ( Dtsch Artebl Int 2013; 110: 875-881).
  • apoptosis administration ameliorates LPS (Lipopolysaccharides) -induced acute lung injury or pulmonary disease ( J Immunol 2008; 180: 4978-4985).
  • death cell administration has also been used to reduce chronic inflammatory arthritis, insulin salts of type 1 diabetic mice, and autoimmune inflammation. This effect is known to occur by the release of anti-inflammatory cytokines such as TGF- ⁇ , IL-10 by macrophages recognize and eliminate apoptosis.
  • mice treated mice with bleomycin (bleomycin) two days after the death of a single cell, and the expression of pro-resolving cytokine such as IL-10 was continuously up-regulated.
  • HGF, COX-2-derived PGE2 and PPAR ⁇ are activated to produce anti-inflammatory and antifibrotic effects.
  • the effect appeared only within a limited range.
  • the administered cells may proceed to secondary cell necrosis, which may exacerbate inflammation or damage, and therefore, such side effects should also be considered when using dead cells for therapeutic purposes. Therefore, the present inventors have determined that it may be necessary for effective treatment to deliver dead cells in combination with an enhancer of efferocytosis to prevent secondary necrosis of the dead cells.
  • statin compounds are cholesterol reducing agents having a wide range of anti-inflammatory activity, the immunomodulatory effects of statin compounds are known to be largely independent of cholesterol. However, it has not been reported to date whether a statin-based compound is coadministered with the aforementioned dead cells to be effective in treating pulmonary fibrosis.
  • the present inventors have made intensive efforts to develop a pharmaceutical composition for treating pulmonary fibrosis, which is more effective and has no side effects.
  • the present invention has been completed by confirming that there is a significant effect on treatment.
  • One object of the present invention is a pharmaceutical composition for treating pulmonary fibrosis comprising a first composition comprising an apoptotic cell and a second composition comprising a statin-based compound, wherein the first composition is twice It is to be administered, the second composition is to provide a pharmaceutical composition for treating pulmonary fibrosis, which is administered together when the second administration of the first composition.
  • Another object of the present invention to provide a kit for treating pulmonary fibrosis, comprising the pharmaceutical composition for treating pulmonary fibrosis.
  • Still another object of the present invention is to first administer a first composition comprising an apoptotic cell; And it provides a method of treating pulmonary fibrosis comprising the second step of administering a second composition comprising a statin-based compound with the first composition.
  • Another object of the present invention is the use of a pharmaceutical composition
  • a pharmaceutical composition comprising a first composition comprising apoptotic cells and a second composition comprising a statin-based compound, wherein the first composition comprises It is to be administered twice, the second composition is to provide a therapeutic use for pulmonary fibrosis, which is administered together in the second administration of the first composition.
  • the present invention is a composition comprising a first composition comprising an apoptotic cell, and a second composition comprising a statin-based compound has a significantly superior effect in treating pulmonary fibrosis compared to the case of administration alone in combination Since it has, it can be usefully used as a composition for treating pulmonary fibrosis.
  • Figure 1 shows the co-administration effect of apoptosis cells and simvastatin on the phagocytosis of alveolar macrophages in bleomycin-induced lungs.
  • Killing Jurkat cells (Apo) were administered once on day 2 after bleomycin (BLM) treatment, or a total of two doses on days 2 and 7.
  • BLM bleomycin
  • simvastatin (20 mg / kg / d) was administered intraperitoneally with and without further infusion of dead cells.
  • Simvastatin was administered once daily in the same amount after the initial administration. Mice were sacrificed 7 days after bleomycin administration (2 hours after secondary killer cells or simvastatin administration) and 14 days after administration.
  • Figure 3 shows the co-administration effect of killer cells and simvastatin on PPAR ⁇ target molecule expression.
  • A CD36 and (c) MMR mRNA expression in macrophages and lung tissues was analyzed by real-time PCR.
  • B CD36 and (d) MMR proteins in lung tissue grinding were Western blot analysis. *: P ⁇ 0.05 compared to the control group, + : p ⁇ 0.05, as indicated: # : BLM + twice Apo (Apo (2)) + Simv (fifth) compared to BLM + single Apo (Apo (1)) (group 2) Group) p ⁇ 0.05, ⁇ : BLM + Apo (2) + Simv (group 5) p ⁇ 0.05 compared to BLM + Apo (2) (group 3).
  • Figure 4 shows the co-administration effect of killer cells and simvastatin on the expression of PPAR ⁇ target molecule.
  • CD36 and MMR mRNA expression was analyzed by real-time PCR in lung tissue. *: P ⁇ 0.05 compared to the control group, + : p ⁇ 0.05, as indicated: # : BLM + twice Apo (Apo (2)) + Simv (fifth) compared to BLM + single Apo (Apo (1)) (group 2) Group) p ⁇ 0.05, ⁇ : BLM + Apo (2) + Simv (group 5) p ⁇ 0.05 compared to BLM + Apo (2) (group 3).
  • FIG. 5 shows the co-administration effect of killer cells and simvastatin on neutrophil and alveolar macrophage number changes. Each figure shows the number of (a) neutrophils and (b) alveolar macrophages in BAL solution.
  • Figure 6 shows the co-administration effect of killer cells and simvastatin on the expression of pro-resolving cytokines.
  • mRNA levels of HGF in alveolar macrophages were analyzed by quantitative real time-PCR.
  • HGF levels in BAL fluids were quantified by ELISA. *: P ⁇ 0.05 compared to the control group, + : p ⁇ 0.05, as indicated: # : BLM + twice Apo (Apo (2)) + Simv (fifth) compared to BLM + single Apo (Apo (1)) (group 2) Group) p ⁇ 0.05, ⁇ : BLM + Apo (2) + Simv (group 5) p ⁇ 0.05 compared to BLM + Apo (2) (group 3).
  • Figure 7 shows the co-administration effect of killer cells and simvastatin on the expression of pro-resolving cytokines.
  • the mRNA levels of IL-10 in alveolar macrophages were analyzed by quantitative real time-PCR.
  • IL-10 levels in BAL fluids were quantified by ELISA. *: P ⁇ 0.05 compared to the control group, + : p ⁇ 0.05, as indicated: # : BLM + twice Apo (Apo (2)) + Simv (fifth) compared to BLM + single Apo (Apo (1)) (group 2) Group) p ⁇ 0.05, ⁇ : BLM + Apo (2) + Simv (group 5) p ⁇ 0.05 compared to BLM + Apo (2) (group 3).
  • Figure 8 shows the co-administration effect of killer cells and simvastatin on the expression of pro-resolving cytokines.
  • mRNA levels of TGF- ⁇ 1 in alveolar macrophages were analyzed by quantitative real time-PCR.
  • TGF- ⁇ 1 levels in BAL fluids were quantified by ELISA.
  • Figure 9 shows the co-administration effect of killer cells and simvastatin on the expression of pro-resolving cytokines.
  • A HGF, (b) IL-10 and (c) TGF- ⁇ 1 mRNA levels in alveolar macrophages were analyzed by quantitative real time-PCR.
  • FIG. 10 shows the co-administration effect of dead cells and simvastatin on EMT markers in AT II cells (primary alveolar type II epithelial cells).
  • A E-cadherin, (b) claudin-1, and (c) ⁇ -SMA were analyzed by real-time PCR in AT II cells isolated from mouse lungs.
  • Figure 11 shows the co-administration effect of dead cells and simvastatin on fibroblast activation.
  • Fibroblasts isolated from mouse lungs were analyzed by (a) type 1 collagen ⁇ 2 (Col1), (b) fibronectin (FN) and (c) ⁇ -SMA by real-time PCR.
  • Figure 12 shows the combined effect of killer cells and simvastatin on the antifibrotic effect in bleomycin-induced lung.
  • Western blot analysis confirmed the expression levels of type 1 collagen ⁇ 2, fibronectin and ⁇ -SMA.
  • Figure 13 shows the co-administration effect of apoptosis cells and simvastatin in a confocal laser micrograph by immunofluorescence.
  • FSP1 fibroblast-specific protein-1, S100A4, green
  • ⁇ -SMA red
  • DAPI ', 6-diamino-2-phenylindole
  • Figure 14 shows the co-administration effect of killer cells and simvastatin on the antifibrotic effect in bleomycin-induced lung.
  • Hydroxyproline content was measured to measure collagen deposition in the entire lung. *: P ⁇ 0.05 compared to the control group, + : p ⁇ 0.05, as indicated: # : BLM + twice Apo (Apo (2)) + Simv (fifth) compared to BLM + single Apo (Apo (1)) (group 2) Group) p ⁇ 0.05, ⁇ : BLM + Apo (2) + Simv (group 5) p ⁇ 0.05 compared to BLM + Apo (2) (group 3).
  • Figure 15 shows Ashcroft scoring of lung cross sections. *: P ⁇ 0.05 compared to the control group, +: P ⁇ 0.05, as indicated: #: BLM + twice Apo (Apo (2)) + Simv (fifth) compared to BLM + single Apo (Apo (1)) (group 2) Group) P ⁇ 0.05, ⁇ : BLM + Apo (2) + Simv (Group 5) P ⁇ 0.05 compared to BLM + Apo (2) (Group 3).
  • One aspect of the present invention for achieving the above object is a pharmaceutical composition for treating pulmonary fibrosis comprising a first composition comprising apoptotic cells and a second composition comprising a statin-based compound.
  • the first composition is administered twice, and the second composition is administered together with the second administration of the first composition.
  • the composition of the present invention has a remarkable effect which cannot be predicted by a person skilled in the art according to such specific administration mode.
  • pulmonary fibrosis refers to the development of scarred (fibrous) tissue due to the formation or development (fibrosis) of excessive fibrous connective tissue in the lung.
  • pulmonary fibrosis is a chronic disease that causes swelling and scarring of alveoli and interstitial tissue of the lungs.
  • Such scar tissue replaces healthy tissue and causes inflammation, and chronic inflammation can be identified as a precursor to fibrosis.
  • damage to lung tissue makes the lungs stiff and makes breathing more and more difficult.
  • anti-inflammatory drugs such as steroids.However, when symptoms worsen, administer steroids, azacioprine, or cyclohospamide. In the case of hypoxemia, the only treatment is oxygen therapy. Therefore, there is a continuing need for the development of a pulmonary fibrosis therapeutic agent that is unlikely to cause side effects and that can be treated for a long time and effectively.
  • Pulmonary fibrosis can be caused by a variety of causes, such as fine damage to the lungs induced by inhalation of microparticles (asbestos, stone powder, metal dust, particles present in tobacco smoke, silica dust, etc.).
  • pulmonary fibrosis can occur due to the secondary effects of other diseases (such as autoimmune diseases, viral or bacterial infections, etc.) and may be used as cytotoxic agents (eg, bleomycin, busulfan and methotrexate); Antibiotics (eg nitrofurantoin, sulfasalazine); Arrhythmia therapeutics (eg, amiodarone, tocainide); Anti-inflammatory drugs (eg gold, penicylamine); It may be caused by certain drugs such as illegal drugs (eg, drugs, cocaine, heroin).
  • idiopathic pulmonary fibrosis When the pulmonary fibrosis appears without a known cause, it is called idiopathic pulmonary fibrosis.
  • pulmonary fibrosis is related to idiopathic Pulmonary Fibrosis, Nonspecific Interstitial Pneumonia, Acute Interstitial Pneumonia, Cryptogenic Organizing Pneumonia, Respiratory bronchiolitis Respiratory Bronchiolitisassociated Interstitial Lung, Desquamative Interstitial Pneumonia, Lymphoid Interstitial Pneumonia, Interstitial Pulmonary Fibrosis, and Diffuse Pulmonary Fibrosis It doesn't happen.
  • any disease that can be caused by the occurrence of fibrosis in lung tissue It may be included in the category of pulmonary fibrosis.
  • the term "apoptotic cell” refers to a cell in which apoptosis has occurred, progressed or completed, and may be understood as a concept including a cell group in which some or all of the cells are killed.
  • the apoptotic cells further increase the phagocytic activity of alveolar macrophages and the activity of PPAR ⁇ after administration in an individual, thereby treating pulmonary fibrosis.
  • the present invention is not particularly limited to the type of cells so long as the activity of the macrophages in the administered individual is increased.
  • the killing cells alone have only a limited effect when administered alone, and additionally, a significant therapeutic effect on pulmonary fibrosis can be expected when simulstatin is co-administered with second killing cells.
  • the apoptosis cells may be any one or more selected from the group consisting of T-lymphocytes, thymic cells, epithelial cells, and neutrophils, and preferably T-lymphocytes may be used, but is not limited thereto.
  • the method for killing the cells may be properly performed by those skilled in the art, for example, but may be used in the UV irradiation method used in the Examples herein, but is not limited thereto.
  • the present invention can be administered in the subject to be treated to exhibit a therapeutic effect on pulmonary fibrosis, those skilled in the art can select and administer an appropriate number of dead cells.
  • the cell number can be appropriately adjusted by those skilled in the art according to the type, condition, desired effect, etc. of the individual to be administered.
  • the apoptosis cells may be administered in 1 x 10 5 to 1 x 10 13 , specifically, in humans may be administered in about 1 x 10 12 , but is not limited thereto.
  • 1 x 10 6 cells were administered to mice treated with bleomycin to confirm the effect of treating pulmonary fibrosis.
  • the first composition is characterized in that administered twice, specifically, the first composition may be a second administration after 3 to 7 days after the first administration, but is not limited thereto. It is not.
  • the second day (primary) and the seventh day (secondary) were administered after bleomycin treatment. Taking into account the mechanism of action, the interval of administration can be adjusted appropriately.
  • statin-based compound is also called a reductase inhibitor of HMG-CoA reductase, and refers to a group of compounds (durg class) that lowers cholesterol levels by inhibiting the activity of HMG-CoA reductase.
  • the statin-based compound is lovastatin (lovastatin), somatostatin (somatostatin), nystatin (nystatin), pravastatin (pravastatin), simvastatin (cilastatin), fluvastatin (fluvastatin), atorva It may be selected from the group consisting of statin (atorvastatin), cervastatin (cervastatin), ulinastatin and rosuvastatin (rosuvastatin), preferably may be simvastatin.
  • simvastatin is used as an example of statin-based compounds as an enhancer of pheocytosis, and therefore, the case of having equivalent efficacy is not particularly limited.
  • the statin-based compound may be administered at a concentration of 10 mg / kg to 30 mg / kg per day, preferably, may be administered at a concentration of 20 mg / kg per day, but of the statin-based compound used It may be appropriately adjusted by those skilled in the art according to the type and subject of administration.
  • the second composition may be administered once a day after the administration together with the second composition of the first composition. Administration can be performed in the same amount every day, but is not limited thereto.
  • treatment refers to any action that improves or advantageously alters the symptoms of pulmonary fibrosis by administration of the pharmaceutical composition.
  • the term "administration” means introducing a pharmaceutical composition of the present invention to an individual having developed a pulmonary fibrosis disease in any suitable manner.
  • the first composition may be administered intratracheally, the second composition may be administered to the abdominal cavity, vein, muscle or subcutaneous, but is not limited thereto.
  • compositions for treating pulmonary fibrosis of the present invention may be administered in various formulations upon administration.
  • a diluent or excipient such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants may be additionally used. This is not restrictive.
  • the fifth group increased the phagocytosis of macrophages in the administered subject (FIG. 1), increased the expression, activity of PPAR ⁇ and the expression of its target substance (FIG. 2 to 4), and anti-inflammatory Increased response and expression of inflammatory cytokines (FIGS. 5-9).
  • composition comprising the first composition comprising apoptosis cells of the present invention, and the second composition comprising a statin-based compound has a significant effect on the treatment of pulmonary fibrosis compared to the case of administering the death cells alone It has been confirmed that it can be very useful as a composition for treating pulmonary fibrosis.
  • kits for treating pulmonary fibrosis comprising a first composition comprising apoptotic cells and a second composition comprising a statin-based compound.
  • the first composition, the second composition and the treatment of pulmonary fibrosis are as described above.
  • the kit is not particularly limited in kind, and may be used as a kit commonly used in the art.
  • the kit may be packaged in a form in which the first composition and the second composition are each contained in separate containers or in one container divided into one or more compartments, wherein the first composition and the second composition are each 1 It may be packaged in the form of a unit dose of a single dose.
  • the kit may further include instructions for describing the dosage, administration method and frequency of administration of each of the first composition and the second composition in the kit.
  • Another aspect of the invention is a method of treating pulmonary fibrosis, comprising administering to a subject said composition for treating pulmonary fibrosis.
  • Another aspect of the invention is the use of the composition for treating pulmonary fibrosis.
  • composition and administration for treating pulmonary fibrosis are as described above.
  • the term "individual” refers to all animals, including humans, who have or are likely to develop pulmonary fibrosis.
  • the method of treatment of the present invention comprises administering a pharmaceutically effective amount of a first composition comprising the apoptosis cells and a statin-based compound second composition to a subject having or at risk of developing pulmonary fibrosis. It includes.
  • the specific pharmaceutically effective amount of the composition for a particular animal can vary depending on the type and extent of the reaction to be achieved, the age, weight, general state of health, sex or diet of the individual, as well as the time of administration, route of administration and composition of the composition. It may be determined in consideration of the secretion rate, the duration of treatment, etc., and may vary according to various factors and similar factors well known in the medical field, including components of the drug and other compositions used simultaneously or simultaneously.
  • the first composition comprising the apoptosis cells of the present invention
  • the second composition containing a statin-based compound is administered to the subject during the second administration of the first composition to treat pulmonary fibrosis
  • the first composition Pulmonary fibrosis can be treated more effectively than when administered alone or twice, or when the first composition is administered once and the second composition is administered once.
  • mice 20-25 g of sterile male C57BL / 6 mice (Orient Bio, Sungnam, Korea) were used in all experiments. Solutions containing bleomycin were administered to the mice by pharyngeal inhalation (30 ⁇ l at 5 U / kg body weight). Two days after bleomycin treatment, 50 ⁇ l of saline containing either saline alone (group 1) or 10 ⁇ 10 6 killed Jurkat cells (group 2) intratracheally, it was administered. Seven days after bleomycin treatment, killing Jurkat cells (50 ⁇ l saline containing 10 ⁇ 10 6 killed Jurkat cells) were additionally administered into the trachea via pharyngeal inhalation (Group 3).
  • simvastatin (20 mg / kg / d) was administered intraperitoneally 7 days after bleomycin treatment in both conditions with or without additional injection of dead cells (Groups 4 and 5). Simvastatin was administered once daily in the same amount after the initial administration. Mice were sacrificed 7 days after bleomycin administration (2 hours after secondary killer cells and / or simvastatin treatment) and 14 days. To summarize the group used in the experiment is shown in Table 1 below.
  • Example 2 bronchoalveolar lavage ( Bronchoalveolar lavage ; BAL A) Cell isolation and lung Tissue recovery
  • Bronchoalveolar lavage (BAL) was performed and the cell number obtained was confirmed using an electronic Coulter Counter (Coulter Model ZBI with a channelizer 256; Coulter Electronics, Bedfordshire, UK) equipped with a cell size analyzer. The BAL cells were then evaluated for phagocytosis index. Phagocytosis index was calculated using the following formula: (apoptotic bodies) / (total macrophages) x 100. After BAL, the lungs were extracted, immediately frozen in liquid nitrogen and stored at -70 ° C. It was.
  • Example 3 induction of apoptosis
  • Human T lymphocyte Jerkat cells were purchased from the American Type Culture Collection, Rockville, MD. Apoptosis was induced by irradiating the germ cells with UV at 254 nm for 10 minutes. The cells were then used after incubation for 2 hours. Nuclear morphology was assessed by light microscopy, confirming that approximately 70-80% of the cells were killed.
  • Alveolar macrophages isolated from mice were stained with trypan blue to confirm that at least 95% were living cells. Alveolar macrophages were isolated by attachment (60 min). Primary mouse AT II (alveolar type II) cells and lung fibroblasts were also isolated and purified from mice. When evaluated using pro-SP-C immunofluorescence staining, the purity of the AT II cells was found to be typically at least 90%.
  • Target gene primer Sequence ( 5 'to 3 ') PPAR ⁇ forward GCCCTTTGGTGACTTTATGG (SEQ ID NO: 1) reverse CAGCAGGTTGTCTTGGATGT (SEQ ID NO: 2) CD36 forward TTGTACCTATACTGTGGCTAAATGAGA (SEQ ID NO: 3) reverse CTTGTGTTTTGAACATTTCTGCTT (SEQ ID NO: 4) MMR forward AGAAAATGCACAAGAGCAAGC (SEQ ID NO: 5) reverse GGAACATGTGTTCTGCGTTG (SEQ ID NO: 6) HGF forward CACCCCTTGGGAGTATTGTG (SEQ ID NO: 7) reverse GGGACATCAGTCTCATTCACAG (SEQ ID NO: 8) IL-10 forward GCTCTTACTGACTGGCATGAG (SEQ ID NO: 9) reverse CGCAGCTCTAGGAGCATGTG (SEQ ID NO: 10) TGF - ⁇ 1 forward TGGAGCAACATGTGGAACTC (SEQ ID NO: 11
  • PPAR ⁇ activity was measured in nuclear extracts of the lung tissues according to the manufacturer's instructions using the TransAM Assay Kit (Activ Motif, Carlsbad, Calif.).
  • BAL solution samples were evaluated using HGF, IL-10 and TGF- ⁇ ELISA kits (R & D Systems, Minneapolis, Minn.) According to the manufacturer's instructions.
  • Lung hydroxyproline content was measured using the Hydroxyproline Assay Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China PR) according to the manufacturer's instructions.
  • the group (second group) to which the dead cells were administered once was found to have increased macrophage phagocytosis compared to the control group (the first group), but 7 days after the bleomycin treatment.
  • the killer cells were injected once more or treated with simvastatin (third group or fourth group)
  • simvastatin third group or fourth group
  • CD36 and MMR were detected in alveolar macrophages (FIGS. 3A and 3C) and lung tissues (FIGS. 3B and 3D; 4A and 4B).
  • MRNA and / or protein expression of the same PPAR ⁇ target was further enhanced. No significant difference was observed between these parameters in the second, third and fourth groups. No significant difference ( p ⁇ 0.05) was observed in PPAR ⁇ mRNA expression and protein activity and expression of PPAR ⁇ target between the first group and the simvastatin-only group.
  • alveolar macrophages of pulmonary fibrosis animal model treated with bleomycin were compared with the case of co-administration of simvastatin at the second administration of apoptosis cells (Group 5) and the administration of apoptosis cells alone (Group 2). And / or further enhance mRNA expression and activity of PPAR ⁇ and its target protein in the lung.
  • the present inventors have previously reported an anti-inflammatory response and an increase in inflammatory cytokines such as IL-10 and HGF when a single dose of apoptosis cells in the lungs was treated two days after bleomycin treatment. Therefore, the present inventors confirmed by evaluating the number of neutrophils and alveolar macrophages in the BAL solution to see if it can improve the anti-inflammatory effect when additionally administered killer cells with or without simvastatin.
  • group 5 When secondary cells were administered with simvastatin (group 5), the number of neutrophils was further decreased at 7 and 14 days after bleomycin treatment, compared to the group that received single-killed cells (group 2). At 14 days after treatment, the number of alveolar macrophages was further reduced (FIGS. 5A and 5B).
  • additional killer cell administration Group 3
  • simvastatin treatment Group 4 alone did not significantly affect the inflammatory cell number (P ⁇ 0.05).
  • the composition includes the first composition containing the apoptotic cells of the present invention (two doses), and the second composition containing the statin-based compound (co-administered at the second dose of the first composition). Since the composition has a significant effect on the treatment of pulmonary fibrosis, it can be seen that it can be very useful as a pharmaceutical composition for treating pulmonary fibrosis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Dermatology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Endocrinology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 폐 섬유증 치료용 약학 조성물에 관한 것으로, 구체적으로 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 폐 섬유증 치료용 조성물에 관한 것이다. 본 발명은 사멸세포를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 조성물은 병용투여에 의해 단독 투여한 경우에 비하여 폐 섬유증 치료에 현저히 우수한 효과를 가지므로, 폐 섬유증의 치료용 조성물로 유용하게 이용될 수 있다.

Description

사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물
본 발명은 폐 섬유증 치료용 약학적 조성물에 관한 것으로, 구체적으로 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 폐 섬유증 치료용 조성물에 관한 것이다.
폐 섬유증 (lung fibrosis)은 지속적인 폐 상피 손상과 회복 실조에 의한 치사성 질환으로, 근섬유세포 축적, 및 세포 외 기질과 결합 조직의 과잉 누적을 야기한다. 특발성 폐 섬유증 (idiopathic pulmonary fibrosis, IPF)은 폐에서 가장 흔하게 나타나는 간질성 질환으로, 최악의 예후로 평균적으로 3 내지 4 년의 생존 기간을 보인다. 특발성 폐 섬유증은 약 10 만명 당 2 내지 29 명의 빈도로 나타나고, 매년 10 만명 당 약 10 명에서 나타나며, 점점 증가하는 추세에 있다 (Dtsch Arztebl Int 2013; 110: 875-881). 특발성 폐 섬유증의 증상을 치료하고 진행을 느리게 하는데 일부 효과를 가지는 몇몇 약물들이 현재 사용되고 있지만, 효과적으로 입증된 치료방법은 현재까지 보고된바 없다.
사멸세포 (apoptotic cell)의 면역조절 특성을 기반으로 한 세포 치료의 가능성은 사멸세포가 다양한 급성 및 만성 염증성 동물 모델에서 증상을 회복시키거나, 면역 저항성을 유도하는 것을 통해 이미 입증되었다. 실제로, 사멸세포 투여는 LPS (Lipopolysaccharides)로 유도된 급성 폐 손상 또는 폐혈증을 개선시킨다는 것이 확인된바 있다 (J Immunol 2008; 180: 4978-4985). 나아가, 사멸세포 투여는 만성 염증성 관절염, 제1형 당뇨 마우스의 인슐린염, 및 자가면역 염증을 감소시키는데에도 사용되고 있다. 상기 효과는 대식세포가 사멸세포를 인식하고 제거함으로써 TGF-β, IL-10과 같은 항염증성 사이토카인을 방출하여 나타나는 것으로 알려져 있다.
기존에 본 발명자들은 마우스에 블레오마이신 (bleomycin)을 처리한 뒤 2 일 후 사멸세포를 1 회 투여한 결과, IL-10과 같은 염증해소성 사이토카인 (pro-resolving cytokine)의 발현이 지속적으로 상향조절되고, HGF, COX-2 유래 PGE2 및 PPARγ가 활성화되어 항염증성, 항섬유화 효과가 나타나는 것으로 보고한바 있다 (Mucosal Immunol 2015; 8: 1031-1046). 그러나 그 효과는 제한된 범위 내에서만 나타났다. 또한, 폐가 손상된 동안 사멸세포 제거능이 감소되어, 투여된 세포가 염증 또는 손상을 악화시킬 수 있는 2차 세포괴사로 진행될 수 있으므로, 사멸세포를 치료 목적으로 사용하는 경우 이러한 부작용도 함께 고려되어야 한다. 따라서, 본 발명자들은 사멸세포의 2차 괴사를 막기 위해 탐식작용 (efferocytosis)의 증강제와 함께 사멸세포를 조합하여 전달하는 것이 효과적인 치료에 필요할 수 있을 것으로 판단하였다.
한편, 스타틴 계열의 화합물은 광범위한 항염증 활성을 가지는 콜레스테롤 감소제로서, 스타틴 계열 화합물의 면역조절 효과는 대체로 콜레스테롤과는 독립적인 것으로 알려져 있다. 다만, 스타틴 계열의 화합물을 상술한 사멸세포와 병용투여하여 폐 섬유증 치료에 효과가 있는지 확인한 것은 현재까지 보고된 바 없다.
본 발명자들은 보다 더 효과적이고 부작용이 없는 폐 섬유증 치료용 약학적 조성물을 개발하기 위해 예의 노력한 결과, 탐식작용 증강제로서 스타틴 계열의 화합물을 사용하여, 사멸세포 및 스타틴 계열 화합물의 병용투여 시 폐 섬유증의 치료에 현저한 효과가 있음을 확인함으로써 본 발명을 완성하였다.
본 발명의 하나의 목적은 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 폐 섬유증 치료용 약학적 조성물로서, 상기 제1조성물은 2 회 투여되는 것이고, 상기 제2조성물은 상기 제1조성물의 2 차 투여 시 함께 투여되는 것인, 폐 섬유증 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 하나의 목적은 상기 폐 섬유증 치료용 약학적 조성물을 포함하는, 폐 섬유증 치료용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 사멸세포 (apoptotic cell)를 포함하는 제1조성물을 1 차 투여하는 단계; 및 스타틴 계열의 화합물을 포함하는 제2조성물을 상기 제1조성물과 함께 2 차 투여하는 단계를 포함하는, 폐 섬유증을 치료하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 약학적 조성물의 폐 섬유증 치료 용도로서, 여기서 상기 제1조성물은 2회 투여되는 것이고, 상기 제2조성물은 상기 제1조성물의 2 차 투여 시 함께 투여되는 것인, 폐 섬유증 치료 용도를 제공하는 것이다.
본 발명은 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 조성물은 병용투여에 의해 단독투여한 경우에 비하여 폐 섬유증 치료에 현저히 우수한 효과를 가지므로, 폐 섬유증 치료용 조성물로 유용하게 이용될 수 있다.
도 1은 블레오마이신으로 유도된 폐에서 폐포 대식세포의 탐식능에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. 사멸 저캣 세포(Apo)는 블레오마이신 (BLM) 처리 후 2 일째 1 회 투여 또는 2 일 및 7 일째 총 2회 투여되었다. 7 일째에 사멸 세포의 추가 주입이 있거나 없는 조건에서 심바스타틴 (20 mg/kg/d)을 복강 내로 투여하였다. 심바스타틴은 최초 투여 후 동일한 양으로 하루에 1 회씩 계속 투여하였다. 마우스는 블레오마이신 투여 7 일 후 (2 차 사멸세포 또는 심바스타틴 투여 후 2 시간째)와 14 일 후에 희생시켰다. (a) BAL 폐포 대식세포에서 측정한 탐식 지수이다. (b) BLM 처리 후 7 일째에 사이토핀 (cytospin)으로 염색된 BAL 세포를 보여주는 대표적인 현미경 사진이다 (scale bar = 50 ㎛). 화살표는 탐식된 사멸세포 또는 단편을 갖는 폐포 대식세포를 나타낸다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 2는 PPARγ mRNA 및 활성 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. (a) 폐포 대식세포 및 (b) 폐 조직에서 PPARγ mRNA 발현을 real-time PCR로 분석하였다. (c) 폐 조직의 핵 추출물에서 PPARγ 활성을 분석하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 3은 PPARγ 표적 분자 발현에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. 대식세포 및 폐 조직에서 (a) CD36 및 (c) MMR mRNA 발현을 real-time PCR로 분석하였다. 폐 조직 분쇄물에서 (b) CD36 및 (d) MMR 단백질을 웨스턴 블롯 분석 (Western blot analysis)하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 4는 PPARγ 표적 분자 발현에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. (a) CD36 및 (b) MMR mRNA 발현은 폐 조직에서 real-time PCR로 분석하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 5는 호중구 및 폐포 대식세포 수 변화에 대한 사멸세포 및 심바스타틴의 병용투여 효과를 나타낸 것이다. 각 도면은 BAL 용액 내 (a) 호중구 및 (b) 폐포 대식세포의 수를 나타낸다. *: 살린 대조군 대비 P < 0.05, +: 표시된 대로 P < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) P < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) P < 0.05.
도 6은 염증해소성 사이토카인 (pro-resolving cytokines) 발현에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. (a) 폐포 대식세포에서 HGF의 mRNA 수준을 quantitative real time-PCR로 분석하였다. (b) BAL 유동체에서 HGF 수준을 ELISA로 정량화하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 7은 염증해소성 사이토카인 (pro-resolving cytokines) 발현에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. (a) 폐포 대식세포에서 IL-10의 mRNA 수준을 quantitative real time-PCR로 분석하였다. (b) BAL 유동체에서 IL-10 수준을 ELISA로 정량화하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 8은 염증해소성 사이토카인 (pro-resolving cytokines) 발현에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. (a) 폐포 대식세포에서 TGF-β1의 mRNA 수준을 quantitative real time-PCR로 분석하였다. (b) BAL 유동체에서 TGF-β1 수준을 ELISA로 정량화하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 9는 염증해소성 사이토카인 (pro-resolving cytokines) 발현에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. 폐포 대식세포에서 (a) HGF, (b) IL-10 및 (c) TGF-β1 mRNA 수준을 quantitative real time-PCR로 분석하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 10은 AT II 세포 (primary alveolar type II epithelial cell)에서의 EMT 마커에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. 마우스 폐에서 분리한 AT II 세포에서 (a) E-cadherin, (b) claudin-1, 및 (c) α-SMA을 real-time PCR로 분석하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) or single Apo (Apo (1)) + Simv (제4그룹 및 제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) or single Apo (Apo (1)) + Simv (제4그룹 및 제5그룹) p < 0.05.
도 11은 섬유아세포 활성화에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. 마우스 폐에서 분리한 섬유아세포에서 (a) 제1형 콜라겐 α2 (Col1), (b) 피브로넥틴 (FN) 및 (c) α-SMA을 real-time PCR로 분석하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) or single Apo (Apo (1)) + Simv (제4그룹 및 제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) or single Apo (Apo (1)) + Simv (제4그룹 및 제5그룹) p < 0.05.
도 12는 블레오마이신으로 유도된 폐에서 항섬유화 효과에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. 웨스턴블랏 분석을 통해 제1형 콜라겐 α2, 피브로넥틴 및 α-SMA의 발현 수준을 확인하였다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 13은 사멸세포와 심바스타틴의 병용투여 효과를 면역형광법에 의한 컨포컬 레이저 현미경 사진으로 나타낸 것이다. (a) 블레오마이신 처리 후 14 일째에 폐 조직에서 FSP1 (fibroblast-specific protein-1, S100A4, 녹색) 또는 α-SMA (적색)에 대한 면역형광염색을 수행하였다. 이미지 배지는 DAPI (4',6-diamino-2-phenylindole)를 함유하는 Vectashield 형광 마운트 배지 (Vectashield fluorescence mounting medium)를 사용하였다 (Scale bars = 20 mm). (b) 폐 유연조직 (lung parenchyma, 창상) 내 총 S100A4 양성 세포 집단과 S100A4 및 α-SMA의 이중 양성 세포 수를 비교한 그래프이다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05.
도 14는 블레오마이신으로 유도된 폐에서 항섬유화 효과에 대한 사멸세포와 심바스타틴의 병용투여 효과를 나타낸 것이다. (a) 하이드록시프롤린 (hydroxyproline) 함량을 측정하여 전체 폐의 콜라겐 침착을 측정했다. *: 살린 대조군 대비 p < 0.05, +: 표시된 대로 p < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) p < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) p < 0.05. (b) 21 일째 메이슨 트리크롬 염색 (Masson's trichrome staining)을 통해 폐 절편을 시각화했다 (scale bar=50 ㎛).
도 15는 폐 단면의 애쉬크로프트 (Ashcroft) 스코어링을 나타낸 것이다. *: 살린 대조군 대비 P < 0.05, +: 표시된 대로 P < 0.05, #: BLM + single Apo (Apo (1)) (제2그룹) 대비 BLM + twice Apo (Apo (2)) + Simv (제5그룹) P < 0.05, §: BLM + Apo (2) (제3그룹) 대비 BLM + Apo (2) + Simv (제5그룹) P < 0.05.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
상기 목적을 달성하기 위한 본 발명의 하나의 양태는, 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 폐 섬유증 치료용 약학적 조성물이다. 특히, 본 발명에서 상기 제1조성물은 2 회 투여되는 것이고, 제2조성물은 상기 제1조성물의 2 차 투여 시 함께 투여되는 것을 특징으로 한다. 본 발명의 조성물은 이와 같은 구체적인 투여 양태에 따라 당업자가 예측할 수 없는 현저한 효과를 가지는 것이다.
본 발명에서 사용된 용어 "폐 섬유증"은, 폐에서의 과도한 섬유성 연결 조직의 형성 또는 발달 (섬유증)로 인해, 흉터가 생긴 (섬유성) 조직의 발달을 의미한다. 구체적으로, 폐 섬유증은 폐포 및 폐의 간질성 조직의 팽윤 및 흉터를 유발하는 만성 질환이다. 이와 같은 흉터 조직이 건강한 조직을 대체하여 염증을 유발하며, 만성 염증은 섬유증의 전조로 파악될 수 있다. 이와 같은 폐 조직의 손상은 폐를 뻣뻣하게 하고, 호흡을 점점 더 어렵게 만든다. 폐 섬유증의 원인을 특정할 수 있는 경우 그 원인을 제거하거나, 스테로이드제 등의 항염증제의 투여 등을 통해 치료되는 경우가 있으나, 증상 악화 시 스테로이드제나 아자치오프린, 시크로호스파미드 등을 투여하고, 저산소혈증 발생 시 산소 요법 등의 치료만 있을 뿐이다. 따라서, 부작용이 문제될 가능성이 낮고, 장기적이고 효과적으로 치료할 수 있는 폐 섬유증 치료제의 개발이 계속적으로 요구되고 있다.
폐 섬유증은 여러 가지 원인들, 예컨대 미세입자 (석면, 돌가루, 금속 분진, 담배연기에 존재하는 입자들, 실리카 분진 등)의 흡입에 의해 유도되는 폐의 미세 손상에 의해 발병할 수 있다. 또한, 폐 섬유증은 다른 질병 (자가면역질환, 바이러스 또는 박테리아 감염 등)의 부차적인 영향으로 발생할 수 있고, 세포독성 제제 (예컨대, 블레오마이신, 부설판 및 메토트렉세이트); 항생제 (예컨대, 니트로푸란토인, 술파살라진); 부정맥 치료제 (예컨대, 아미오다론, 토카이니드); 항염증 약물 (예컨대, 금, 페니실아민); 불법 약물 (예컨대, 마약, 코카인, 헤로인)과 같은 특정 약물들에 의해 유발될 수 있다. 상기 폐 섬유증이 알려진 원인 없이 나타날 경우, 특발성 폐 섬유증이라 불린다.
본 발명에서 폐 섬유증은 특발성 폐 섬유증 (Idiopathic Pulmonary Fibrosis), 비특이성 간질성 폐렴 (Nonspecific Interstitial Pneumonia), 급성간질성 폐렴 (Acute Interstitial Pneumonia), 특발성 기질화 폐렴 (Cryptogenic Organizing Pneumonia), 호흡계기관지염 관련성 간질설 폐질환 (Respiratory Bronchiolitisassociated Interstitial Lung), 박리성 간질성 폐렴 (Desquamative Interstitial Pneumonia), 임파구성 간질성 폐렴 (Lymphoid Interstitial Pneumonia), 간질성 폐 섬유증, 및 미만성 폐 섬유증 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 본 발명에서는, 폐 섬유증에 대한 대표적인 동물 모델인 블레오마이신 유발 폐 섬유증 동물모델을 이용하여 본 발명의 조성물의 치료 효과를 확인하였으므로, 본 발명에서는 폐 조직에 섬유화가 발생하여 야기될 수 있는 질환이라면 모두 폐 섬유증의 범주에 포함될 수 있다.
본 발명에서 용어 "사멸세포 (apoptotic cell)"는 세포사멸 작용이 발생, 진행 또는 완료된 세포를 의미하며, 구성된 일부 또는 모든 세포가 사멸된 세포군을 포함하는 개념으로 이해될 수 있다. 본 발명에서 사멸세포는 개체 내에 투여된 후 폐포 대식세포의 탐식능과 PPARγ의 활성을 더욱 증가시켜, 폐 섬유증 치료에 효과가 있다. 따라서, 본 발명에서는 투여된 개체 내의 대식세포의 활성을 증가시키는 한, 그 세포의 종류에 특별히 제한되지 않는다. 다만, 상기 사멸세포는 단독으로 투여 시 제한적인 효과만 나타낼 뿐이고, 추가적으로 사멸세포를 2 차 투여하면서 심바스타틴을 병용투여하는 경우에 폐 섬유증에 대한 현저한 치료 효과를 기대할 수 있다.
예컨대, 상기 사멸세포는 T-림프구, 흉선세포, 상피세포 및 호중구로 이루어진 군에서 선택된 어느 하나 이상인 것일 수 있으며, 바람직하게는 T-림프구를 사용할 수 있으나, 이에 제한되지 않는다. 세포를 사멸화시키는 방법은 당업자가 공지된 방법을 적절히 수행할 수 있으며, 예컨대 본원 실시예에서 사용된 UV 조사 방식을 사용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 치료 대상이 되는 개체 내에 투여되어 폐 섬유증에 대한 치료 효과를 나타낼 수 있다면 당업자는 적절한 수의 사멸세포를 선택하여 투여할 수 있다. 상기 세포 수는 투여되는 개체의 종류, 상태, 원하는 효과 등에 따라 당업자에 의해 적절히 조절될 수 있다. 예컨대, 상기 사멸세포는 1 x 105 내지 1 x 1013 개로 투여되는 것일 수 있으며, 구체적으로 인간에서는 약 1 x 1012 개로 투여되는 것일 수 있으나, 이에 제한되는 것은 아니다. 일례로, 본 발명의 실시예에서는 1 x 106 개의 세포를 블레오마이신이 투여된 마우스에 투여하여 폐 섬유증 치료 효과를 확인하였다.
상술한 바와 같이 본 발명에서, 상기 제1조성물은 2 회 투여되는 것을 특징으로 하는데, 구체적으로 제1조성물은 1 차 투여 후 3 내지 7 일 경과 후, 2 차 투여되는 것일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 구체적인 일 실시예에서는 사멸세포를 2 회 투여하는 경우, 블레오마이신 처리 후 2 일째 (1 차)와 7 일째 (2 차) 투여하였으나, 폐 섬유증 치료의 대상이 되는 개체의 면역반응 등의 작용 기전을 고려하여 투여 간격은 적절하게 조절될 수 있다.
본 발명에서 용어 "스타틴 계열의 화합물"은 HMG-CoA 환원 효소의 억제제(reductase inhibitor)로도 불리우며, HMG-CoA 환원 효소의 활성을 억제하여 콜레스테롤 수준을 낮추는 화합물군 (durg class)을 통칭한다.
본 발명에서 상기 스타틴 계열의 화합물은 로바스타틴(lovastatin), 소마토스타틴(somatostatin), 나이스타틴(nystatin), 프라바스타틴(pravastatin), 심바스타틴(simvastatin), 실라스타틴(cilastatin), 플루바스타틴(fluvastatin), 아토바스타틴(atorvastatin), 세르바스타틴(cervastatin), 울리나스타틴(ulinastatin) 및 로슈바스타틴(rosuvastatin)으로 이루어진 군 중에서 선택되는 것일 수 있고, 바람직하게는 심바스타틴일 수 있다. 본 발명에서 심바스타틴은 탐식작용 (efferocytosis)의 증강제로서 스타틴 계열의 화합물 중 일 예시로 사용된 것이므로, 이와 동등한 효능을 갖는 경우라면 그 종류에 특별히 제한되지 않는다.
상기 스타틴 계열의 화합물은 하루에 10 mg/kg 내지 30 mg/kg 농도로 투여되는 것일 수 있고, 바람직하게는, 하루에 20 mg/kg 농도로 투여되는 것일 수 있으나, 사용되는 스타틴 계열의 화합물의 종류 및 투여 개체에 따라 당업자에 의해 적절히 조절될 수 있다.
또한, 상기 제2조성물은 제1조성물의 2 차 투여 시 함께 투여된 후 하루 1 회씩 투여되는 것일 수 있다. 투여는 매일 동량으로 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 사용된 용어 "치료"는 상기 약학적 조성물의 투여로 폐 섬유증의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다.
본 발명에서 사용된 용어 "투여"는 어떠한 적절한 방법으로 폐 섬유증 질환이 발병된 개체에게 본 발명의 약학 조성물을 도입하는 것을 의미한다.
상기 제1조성물은 기관 내 투여되는 것일 수 있고, 상기 제2조성물은, 복강, 정맥, 근육 또는 피하에 투여되는 것일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 폐 섬유증 치료용 약학적 조성물은 투여 시에 여러 가지 제형으로 투여될 수 있다. 제제화 할 경우에는 통상 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제 및 계면활성제 등의 희석제 또는 부형제를 추가적으로 더 포함할 수 있으나. 이에 제한되지 않는다.
본 발명의 구체적인 일 실시예에서는, 사멸세포 단독 투여가 폐 섬유증 치료에 효과가 있다는 본 발명자들의 기존 연구 결과를 기반으로, 사멸세포를 추가로 투여하는 경우 폐 섬유증 치료 효과가 증진될 수 있는지를 확인하고자 하였다. 이에, 블레오마이신 처리 마우스 동물모델에 대하여 사멸세포 투여 형태 및 스타틴 계열의 화합물인 심바스타틴을 병용투여하는 형태로 다양한 실험군을 설계하였다.
그 결과, 사멸세포를 2 회 투여하거나, 혹은 사멸세포 1 회 투여와 심바스타틴을 병용투여한 경우, 사멸세포를 단독 투여한 경우에 비해 향상된 효과를 확인하지 못하였으나, 사멸세포를 2 회 투여하고, 상기 2 회 투여 시 심바스타틴을 투여한 그룹 (제5그룹; 표 1 참조)에서 폐 섬유증에 대한 치료 효과가 현저히 향상되는 것을 확인하였다.
구체적으로, 상기 제5그룹은 투여된 개체 내에서, 대식세포의 탐식능을 증가시켰고 (도 1), PPARγ의 발현, 활성 및 이의 표적 물질의 발현도 증가시켰으며 (도 2 내지 4), 항염증성 반응 및 염증해소성 사이토카인의 발현을 증가시켰다 (도 5 내지 9). 또한, EMT 및 섬유화 반응을 억제하는 것도 확인할 수 있었다 (도 10 내지 15).
결론적으로, 본원발명의 사멸세포를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 조성물은 사멸세포를 단독으로 투여하는 경우에 비하여 폐 섬유증 치료에 현저한 효과를 가지므로, 폐 섬유증 치료용 조성물로 매우 유용하게 사용될 수 있음을 확인하였다.
본 발명의 다른 하나의 양태는, 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 폐 섬유증 치료용 키트이다.
제1조성물, 제2조성물 및 폐 섬유증 치료에 대해서는 상기 설명한 바와 같다.
본 발명에서 상기 키트는 그 종류가 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용되는 형태의 키트를 사용할 수 있다.
상기 키트는 상기 제1조성물 및 제2조성물이 각각 개별 용기에 담긴 형태, 또는 하나 이상의 구획으로 나누어진 한 개의 용기 내에 담긴 형태로 포장되어 있을 수 있으며, 상기 제1조성물 및 제2조성물은 각각 1회 투여 용량의 단위 용량 형태로 포장되어 있을 수 있다.
상기 키트는 키트 내에 상기 제1조성물 및 제2조성물 각각의 투여량, 투여방법과 투여빈도를 기재한 사용설명서를 더 포함할 수 있다.
본 발명의 또 다른 양태는 상기 폐 섬유증 치료용 조성물을 개체에 투여하는 단계를 포함하는, 폐 섬유증의 치료 방법이다.
본 발명의 또 다른 양태는 상기 조성물의 폐 섬유증 치료 용도이다.
폐 섬유증 치료용 조성물 및 투여에 대해서는 상기 설명한 바와 같다.
본 발명에서 용어 "개체"는 폐 섬유증이 발병되었거나 발병할 가능성이 있는 인간을 포함한 모든 동물을 의미한다.
본 발명의 상기 치료 방법은 구체적으로, 폐 섬유증이 발병하였거나 발병할 위험이 있는 개체에 상기 사멸세포를 포함하는 제1조성물, 및 스타틴 계열의 화합물 제2조성물을 약학적으로 유효한 양으로 투여하는 단계를 포함한다.
특정 동물에 대한 상기 조성물의 구체적인 약학적 유효량은, 달성하고자 하는 반응의 종류와 정도, 해당 개체의 연령, 체중, 일반적인 건강 상태, 성별 또는 식이는 물론, 상기 조성물의 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간 등을 고려하여 결정될 수 있으며, 동시 또는 이시에 함께 사용되는 약물 기타 조성물의 성분 등을 비롯한 여러 인자 및 의약 분야에서 잘 알려진 유사 인자에 따라 다양해 질 수 있다.
본 발명의 상기 사멸세포를 포함하는 제1조성물을 2 회 투여하고, 스타틴 계열 화합물을 포함하는 제2조성물을 제1조성물의 2 차 투여 시 개체에 투여하여 폐 섬유증을 치료하는 경우, 제1조성물만 단독 혹은 2 회 투여하는 경우, 또는 제1조성물 1 회 투여 및 제2조성물을 1 회 투여하는 경우에 비하여 폐 섬유증을 효과적으로 치료할 수 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 국한되는 것은 아니다.
실시예 1: 동물 실험
모든 실험에서 20 ~ 25 g의 무균 수컷 C57BL/6 마우스 (Orient Bio, Sungnam, Korea)를 사용하였다. 블레오마이신을 함유하는 용액은 마우스에 인두 흡입 방식으로 투여하였다 (30 ㎕에 5 U/kg체중). 블레오마이신 처리 후 2 일째에, 살린 단독 (제1그룹) 또는 10 x 106 개의 사멸 저캣 (Jurkat) 세포를 포함하는 살린 50 ㎕ (제2그룹)를 인두 흡입을 통해 기관 내 (intratracheally, i.t.)로 투여하였다. 블레오마이신 처리 후 7 일째에, 인두 흡입을 통해 사멸 저캣 세포 (10 x 106 개의 사멸 저캣 세포를 포함하는 살린 50 ㎕)를 기관 내로 추가 투여하였다 (제3그룹). 또한, 심바스타틴 (20 mg/kg/d)은 사멸 세포의 추가 주입이 있거나 없는 조건 모두에서 블레오마이신 처리 후 7 일째에 복강 내로 투여하였다 (제4그룹 및 제5그룹). 심바스타틴은 최초 투여 후 동일한 양으로 하루에 1 회씩 계속 투여하였다. 마우스는 블레오마이신 투여 후 7 일째 (2차 사멸세포 및/또는 심바스타틴 처리 후 2 시간째)와 14 일째에 희생시켰다. 실험에 사용한 그룹을 정리하면 하기 표 1과 같다.
블레오마이신 처리 후 2 일째 블레오마이신 처리 후 7 일째
제1그룹 식염수 -
제2그룹 사멸세포 -
제3그룹 사멸세포 사멸세포
제4그룹 사멸세포 심바스타틴
제5그룹 사멸세포 사멸세포 + 심바스타틴
실시예 2: 기관지 폐포 세척 ( Bronchoalveolar lavage ; BAL ) 세포 분리 및 폐 조직 회수
기관지 폐포 세척 (BAL)을 수행하고, 세포 크기 분석기가 장착된 전자 Coulter Counter (Coulter Model ZBI with a channelizer 256; Coulter Electronics, Bedfordshire, UK)를 이용하여 수득된 세포 수를 확인하였다. 그 다음, 상기 BAL 세포에 대하여 식세포작용 지수를 평가하였다. 식세포작용 지수는 다음의 식을 사용하여 계산하였다: (사멸체 (apoptotic bodies) 수)/(총 대식세포 수) x 100. BAL 후, 폐를 적출하고, 액체 질소에서 바로 얼려 -70 ℃에서 보관하였다.
실시예 3: 세포사멸 유도
인간 T 림프구 저캣 세포는 ATCC (American Type Culture Collection, Rockville, MD)로부터 구입하였다. 저캣 세포에 254 nm에서 10 분 동안 UV를 조사하여 세포사멸을 유도하였다. 그 다음 상기 세포를 2 시간 동안 인큐베이션한 뒤 사용하였다. 광학 현미경으로 핵 형태를 평가하여, 상기 세포에서 대략 70 내지 80 %가 사멸된 것으로 확인되었다.
실시예 4: 초대세포의 분리 및 배양
마우스로부터 분리한 폐포 대식세포를 트립판 블루로 염색하여 95 % 이상이 살아있는 세포인 것을 확인하였다. 폐포 대식세포는 부착 (60 min)시켜 분리하였다. 또한, 초대 마우스 AT II (alveolar type II) 세포 및 폐 섬유아세포를 마우스로부터 분리, 정제하였다. pro-SP-C 면역형광 염색을 이용하여 평가하였을 때, 상기 AT II 세포의 순도는 통상적으로 90 % 이상인 것으로 확인되었다.
실시예 5: qPCR (Quantitative real-time PCR )
Step On Plus System (Applied Biosystems, Life Technologies, Carlsbad, CA)으로 real-time qPCR을 이용하여 유전자 발현을 분석하였다. 각 qPCR 분석에서, 총 50 ng의 cDNA를 사용하였다. PCR 증폭을 위한 프라이머 세트는 Primer Express 소프트웨어를 이용하여 설계하였으며, 이를 하기 표 2에 나타내었다.
타켓 유전자 (마우스) 프라이머 서열 ( 5'내지 3')
PPARγ forward GCCCTTTGGTGACTTTATGG (서열번호 1)
reverse CAGCAGGTTGTCTTGGATGT (서열번호 2)
CD36 forward TTGTACCTATACTGTGGCTAAATGAGA(서열번호 3)
reverse CTTGTGTTTTGAACATTTCTGCTT(서열번호 4)
MMR forward AGAAAATGCACAAGAGCAAGC(서열번호 5)
reverse GGAACATGTGTTCTGCGTTG(서열번호 6)
HGF forward CACCCCTTGGGAGTATTGTG(서열번호 7)
reverse GGGACATCAGTCTCATTCACAG(서열번호 8)
IL-10 forward GCTCTTACTGACTGGCATGAG(서열번호 9)
reverse CGCAGCTCTAGGAGCATGTG(서열번호 10)
TGF - β1 forward TGGAGCAACATGTGGAACTC(서열번호 11)
reverse TGCCGTACAACTCCAGTGAC(서열번호 12)
COL1A -2 (Collagen,type1,alpha2) forward CAAGAAGACATCCCTGAAGTC(서열번호 13)
reverse ACAGTCCAGTTCTTCATTGC(서열번호 14)
Fibronectin forward CACGATGCGGGTCACTTG(서열번호 15)
reverse CTGCAACGTCCTCCTCATTCTTC(서열번호 16)
E- cadherin forward GCACTCTTCTCCTGGTCCTG(서열번호 17)
reverse TATGAGGCTGTGGGTTCCTC(서열번호 18)
CLDN1 ( Claudin -1) forward ATGCCAATTACCATCAAGGC(서열번호 19)
reverse AGCACCGGGCAGATACAGT(서열번호 20)
α- SMA forward CCACCGCAAATGCTTCTAAGT(서열번호 21)
reverse GGCAGGAATGATTTGGAAAGG(서열번호 22)
HPRT forward CCAGTGTCAATTATATCTTCAAC(서열번호 23)
reverse CAGACTGAAGAGCTACTGTAATG(서열번호 24)
모든 데이터는 HPRT (hypoxanthine-guanine phosphoribosyltransferase)로 표준화하였고, 대조군 대비 발현 비율로 나타내었다.
실시예 6: 웨스턴 블롯 ( Wstern blot) 분석
폐 조직 분쇄물 샘플을 10 % SDS-폴리아크릴아마이드 겔에서 분리하였다. 그 다음 분리된 단백질을 니트로셀룰로스지에 옮겼다. 상기 멤브레인에 CD36, MMR, 제1형 콜라겐 α2, 피브로넥틴, α-SMA 또는 α-튜블린 항체를 붙이고, 화학발광으로 시각화하였다.
실시예 7: PPARγ 활성 측정
TransAM 분석 키트 (Activ Motif, Carlsbad, CA)를 이용하여 제조사의 지침에 따라 상기 폐 조직의 핵 추출물에서 PPARγ 활성을 측정하였다.
실시예 8: ELISA (Enzyme-Linked Immunosorbent Assay)
HGF, IL-10 및 TGF-β ELISA 키트 (R&D Systems, Minneapolis, MN)를 이용하여 제조사의 지침에 따라 BAL 용액 샘플을 평가하였다.
실시예 9: 하이드록시프롤린 ( hydroxyproline ) 측정
하이드록시프롤린 분석 키트 (Nanjing Jiancheng Bioengineering Institute, Nanjing, China PR)를 이용하여 제조사의 지침에 따라 폐 하이드록시프롤린 함량을 측정하였다.
실시예 10: 면역조직분석
FFPE (formaline-fixed, paraffin-embedded) 조직으로부터 4 ㎛ 두께의 섹션을 수득하였다. 슬라이드를 자일렌 (xylene)으로 2 회 탈파라핀화시키고, 에탄올에서 증류수까지 점진적으로 재수화 (rehydration)시켰다. 콜라겐 축적을 평가하기 위해 Mason's trichrome을 이용하여 염색하였다. 면역형광분석을 위해, 섹션을 상온에서 30 분 동안 각각 α-SMA, FSP1 또는 대조군 래빗 IgG에 대한 일차 항체와 함께 인큐베이션하였다. 모든 과정 사이에 섹션을 TBS (Tris-buffered saline) 용액으로 세척하였다. 상기 섹션을 DAPI와 함께 Vectashield Mounting Medium에 봉입하였다. 모든 슬라이드는 컨포컬 현미경을 사용하여 사진을 찍었다.
실험예 1: 폐포 대식세포의 탐식능에 대한 사멸세포와 심바스타틴의 병용투여 효과
사멸세포 및 심바스타틴 병용투여로 인한 폐 섬유증 치료 효과를 알아보기 위해, 블레오마이신 처리한 폐 섬유증 질환 동물모델 마우스에 대한 다양한 실험군을 설계한 후 (표 1), 각 실험군에 대하여 폐포 대식세포의 탐식능을 확인하였다.
그 결과, 본 발명자들이 기존에 보고했던 것과 같이 사멸세포를 1 회 투여한 그룹 (제2그룹)은 대조군 (제1그룹)에 비하여 대식세포 탐식능이 증가하는 것을 확인하였으나, 블레오마이신 처리 후 7 일째 사멸세포를 한번 더 주입하거나 또는 심바스타틴을 처리한 경우 (제3그룹 또는 제4그룹), 제2그룹과 별다른 차이를 보이지 않았다 (도 1a 및 도 1b). 이는 단순히 사멸세포를 2 회 투여하거나, 사멸세포 1 회 투여 후 심바스타틴을 처리하더라도 사멸세포를 1 회 투여한 경우 보다 폐포 대식세포의 탐식 작용에 대한 상승효과를 가져오지 않는 다는 것을 의미한다.
그러나 심바스타틴과 함께 추가적으로 사멸세포를 주입한 경우 대식세포의 탐식작용 지수가 증가하는 것을 확인하였다 (제5그룹). 이러한 결과로부터, 단순히 사멸세포를 추가적으로 투여하는 경우에는 폐 섬유화에 유리한 효과가 없으나, 2 차 사멸세포 투여 시 심바스타틴을 함께 투여하는 경우 사멸세포 단독 투여보다 현저한 효과가 나타난다는 것을 알 수 있었다.
실험예 2: PPARγ 발현 및 활성에 대한 사멸세포와 심바스타틴의 병용투여 효과
다음으로, 상기 사멸세포와 심바스타틴의 병용투여 (제5그룹)의 효과가 대식세포의 탐식능을 향상시키는 작용기전을 확인하기 위하여, 탐식 작용에서 중요한 역할을 하는 것으로 알려진 PPARγ의 발현 및 활성을 확인하고자 하였다.
그 결과, 블레오마이신 처리 7 일 후 사멸세포의 추가 주입 (제3그룹)은 사멸세포를 단독 투여한 경우 (제2그룹)와 비교하여, 폐포 대식세포 및 폐 조직에서 PPARγ의 mRNA 발현 및 폐 조직에서 PPARγ의 활성을 증가시키지 못했다 (도 2a 내지 도 2c).
그러나 2 차로 사멸세포 투여와 함께 심바스타틴을 병용투여 하는 경우 (제5그룹), 제2그룹, 제3그룹, 또는 제4그룹에 비하여, 폐포 대식세포 및 폐 조직에서의 PPARγ의 mRNA 발현 및 폐 조직에서 PPARγ의 활성이 더 향상되었다.
또한, 이와 함께, 블레오마이신 처리 후 7 일 및 14 일째에 제5그룹에서는 폐포 대식세포 (도 3a 및 도 3c)와 폐 조직 (도 3b 및 도 3d; 도 4a 및 도 4b)에서 CD36 및 MMR과 같은 PPARγ 표적의 mRNA 및/또는 단백질 발현이 더 향상되었다. 제2그룹, 제3그룹 및 제4그룹에서 상기 파라미터 간의 유의적 차이는 관찰되지 않았다. 제1그룹과 심바스타틴만을 처리한 그룹 사이의 PPARγ mRNA 발현 및 단백질 활성, 그리고 PPARγ 표적의 발현은 유의적 차이 (p < 0.05)가 관찰되지 않았다.
상기 결과로부터, 사멸세포 2 차 투여 시 심바스타틴을 병용투여한 경우 (제5그룹), 사멸세포를 단독으로 투여한 경우 (제2그룹)에 비해 블레오마이신으로 처리 된 폐 섬유증 동물모델의 폐포대식세포 및/또는 폐에서 PPARγ 및 그 표적 단백질의 mRNA 발현 및 활성 또한 더욱 증진시킴을 확인하였다.
실험예 3: 염증해소성 사이토카인 발현에 대한 사멸세포 및 심바스타틴의 병용투여의 효과
본 발명자들은 앞서 블레오마이신 처리 2 일 후 폐에 사멸세포를 단일 투여한 경우, 항염증 반응을 나타내고 IL-10 및 HGF와 같은 염증해소성 사이토카인이 증가함을 보고한바 있다. 따라서, 본 발명자들은 심바스타틴과 함께, 또는 심바스타틴 없이 추가적으로 사멸세포를 투여하는 경우 항염증 효과를 향상시킬 수 있는지를 BAL 용액에서 호중구 및 폐포 대식세포의 수를 평가하여 확인하였다. 심바스타틴과 함께 2 차로 사멸세포를 투여한 경우 (제5그룹), 사멸세포를 1 회 투여한 그룹 (제2그룹)에 비하여 블레오마이신 처리 후 7 일 및 14 일째에 호중구 수가 더 감소하였고, 블레오마이신 처리 후 14 일째에 폐포 대식세포의 수가 더 감소하였다 (도 5a 및 도 5b). 그러나 추가적인 사멸세포 투여 (제3그룹) 또는 심바스타틴 처리 (제4그룹)만으로는 상기 염증성 세포 수에 유의적으로 영향을 미치지 않았다 (P < 0.05).
다음으로, 사멸세포와 심바스타틴의 병용투여가 면역 세포의 염증해소성 사이토카인 발현에 영향을 미치는지 확인하고자 하였다. 그 결과, 제2그룹, 제3그룹 또는 제4그룹과 비교하여, 추가적으로 사멸세포 및 심바스타틴을 투여한 경우 (제5그룹), 폐포 대식세포 및 폐 조직에서 HGF 및 IL-10의 mRNA (도 6a 및 도 7a), 그리고 BAL 용액에서 단백질 (도 6b 및 7b)의 발현이 더 증가하는 것을 확인하였다. TGF-β의 경우 실험 그룹 간에 큰 차이를 나타내지 않았다 (도 8a 및 8b; 도 9c).
상기 결과로부터, 제5그룹과 제1그룹 내지 제4그룹과 대비할 때, 사멸세포 2 회 투여시 심바스타틴을 투여 한 제5그룹에서 HGF 및 IL-10과 같은 염증해소성 사이토카인의 생산이 현저히 증가하여, 폐 손상에 대한 치료 효과를 유도할 것으로 생각되었다.
실험예 4: EMT (epithelial- mesenchymal transition) 및 섬유화 반응에 대한 사멸세포 및 심바스타틴 병용투여 효과
최근 폐포 상피세포의 EMT가 섬유화 폐 및 IPF (idiopathic pulmonary fibrosis) 환자에서 근섬유아세포 형성에 기여한다는 연구 결과들이 있었으므로, 본 발명의 투여 방법이 폐포 상피세포의 EMT에 영향을 미치는지를 확인하고자 하였다.
심바스타틴과 함께 사멸세포의 2차 투입 (제5그룹)은 E- cadherin 및 claudin-1 등의 상피 마커 (epithelial markers)의 mRNA를 더욱 증가시켰고, 블레오마이신 처리 후 14 일째에 AT II 세포 (primary alveolar type II epithelial cell)에서 제2그룹, 제3그룹 또는 제4그룹과 비교하여 근섬유아세포 분화 마커인 α-SMA를 감소시켰다 (도 10a 내지 10c). 한편, 초기 사멸세포 주입 후 심바스타틴 단독 투여 (제4그룹)는 E- cadherin 및 claudin -1 등의 상피 마커를 더욱 증가시켰으나, AT II 세포의 유전자 수준에서 제2그룹 또는 제3그룹과 비교했을 때 α-SMA 의 추가 감소는 확인되지 않았다.
또한, 심바스타틴과 함께 사멸세포를 추가 투여한 경우 (제5그룹), 제2그룹, 제3그룹 또는 제4그룹과 비교하여 분리된 섬유아세포에서 제1형 콜라겐 α2, 피브로넥틴, 및 α-SMA와 같은 섬유 증식 마커의 mRNA가 더 많이 감소되었다(도 11a 내지 11c). 마찬가지로, 이러한 양상은 단백질 수준에서도 확인되었다 (도 12). 그러나, 사멸세포 2 회 투여 (제3그룹) 또는 심바스타틴 단독 투여 그룹에서는 이러한 마커에 대한 변화를 확인할 수 없었다.
나아가, 블레오마이신 처리 후 14 일째에 폐 조직에서 α-SMA 및 FSP1 (fibroblast-specific protein-1)에 대한 이중 면역 염색을 수행하여, 본원발명의 병용투여 방법 (제5그룹)이 사멸세포 단독 투여에 비해 상기 마커 및 이중 양성 세포의 수를 더욱 억제한다는 것을 확인하였다 (도 13). 또한, 하이드록시프롤린 (hydroxylproline) 함량 (도 14a) 및 메이슨 트리크롬 염색 (Masson's trichrome staining)(도 14b)을 통해 본원발명의 병용투여 방법 (제5그룹)이 폐 조직에서 콜라겐 축적을 더 약화시킨다는 것을 확인하였다.
또한, 애쉬크로프트 (Ashcroft) 스코어링 방법 (Ashcroft T et al., J Clin Pathol 1988; 41: 467-470)을 이용해 폐 섬유화의 조직병리학적 평가를 추가적으로 수행하였다. 그 결과 섬유화 점수는 제2그룹 내지 제4그룹과 비교하여, 제5그룹에서 더 감소된 것을 확인하였다 (도 15).
상기 결과를 모두 종합하면, 본원발명의 사멸세포를 포함하는 제1조성물 (2 회 투여), 및 스타틴 계열의 화합물을 포함하는 제2조성물 (상기 제1조성물의 2 차 투여시 함께 투여)을 포함하는 조성물은 폐 섬유증 치료에 현저한 효과를 가지므로, 폐 섬유증 치료용 약학적 조성물로 매우 유용하게 사용될 수 있음을 알 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (12)

  1. 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 폐 섬유증 치료용 약학적 조성물로서,
    상기 제1조성물은 2회 투여되는 것이고,
    상기 제2조성물은 상기 제1조성물의 2 차 투여 시 함께 투여되는 것인, 조성물.
  2. 제1항에 있어서, 상기 사멸세포는 T-림프구, 흉선세포, 상피세포 및 호중구로 이루어진 군에서 선택된 어느 하나 이상인 것인, 조성물.
  3. 제1항에 있어서, 상기 사멸세포는 1 x 105 내지 1 x 1013 개인, 조성물.
  4. 제1항에 있어서, 상기 제1조성물은 1 차 투여 후 3 내지 7 일 경과 후, 2 차 투여되는 것인, 조성물.
  5. 제1항에 있어서, 상기 스타틴 계열의 화합물은 로바스타틴 (lovastatin), 소마토스타틴 (somatostatin), 나이스타틴 (nystatin), 프라바스타틴 (pravastatin), 심바스타틴 (simvastatin), 실라스타틴 (cilastatin), 플루바스타틴 (fluvastatin), 아토바스타틴 (atorvastatin), 세르바스타틴 (cervastatin), 울리나스타틴 (ulinastatin) 및 로슈바스타틴 (rosuvastatin)으로 이루어진 군 중에서 선택되는 것인, 조성물.
  6. 제1항에 있어서, 상기 제2조성물은 제1조성물 2 차 투여 시 함께 투여된 후 하루 1회씩 투여되는 것인, 조성물.
  7. 제6항에 있어서, 상기 제2조성물은 하루에 10 mg/kg 내지 30 mg/kg 농도로 투여되는 것인, 조성물.
  8. 제1항에 있어서, 상기 제1조성물은 기관 내에 투여되는 것인, 조성물.
  9. 제1항에 있어서, 상기 제2조성물은 복강, 정맥, 근육 또는 피하에 투여되는 것인, 조성물.
  10. 제1항의 조성물을 포함하는, 폐 섬유증 치료용 키트.
  11. 사멸세포 (apoptotic cell)를 포함하는 제1조성물을 1 차 투여하는 단계; 및
    스타틴 계열의 화합물을 포함하는 제2조성물을 상기 제1조성물과 함께 2 차 투여하는 단계를 포함하는, 폐 섬유증을 치료하는 방법.
  12. 사멸세포 (apoptotic cell)를 포함하는 제1조성물, 및 스타틴 계열의 화합물을 포함하는 제2조성물을 포함하는 약학적 조성물의 폐 섬유증 치료 용도로서,
    여기서 상기 제1조성물은 2회 투여되는 것이고,
    상기 제2조성물은 상기 제1조성물의 2 차 투여 시 함께 투여되는 것인, 폐 섬유증 치료 용도.
PCT/KR2018/001597 2017-02-07 2018-02-06 사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물 WO2018147620A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170017006A KR101833666B1 (ko) 2017-02-07 2017-02-07 사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물
KR10-2017-0017006 2017-02-07

Publications (1)

Publication Number Publication Date
WO2018147620A1 true WO2018147620A1 (ko) 2018-08-16

Family

ID=61401185

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/001597 WO2018147620A1 (ko) 2017-02-07 2018-02-06 사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR101833666B1 (ko)
WO (1) WO2018147620A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113768953A (zh) * 2021-09-02 2021-12-10 中国人民解放军空军军医大学 凋亡小体用于制备治疗急性肺损伤药物的应用

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JANSSEN, W. J.: "Apoptotic cell clearance and fibrotic lung disease", EUROPEAN RESPIRATORY SOCIETY, vol. 40, 2012, pages 289 - 290, XP055537325 *
LEE, Y.-J.: "Apoptotic cell instillation after bleomycin attenuates lung injury through HGF induction", ERJ EXPRESS, vol. 40, no. 2, 22 March 2012 (2012-03-22), pages 424 - 435, XP055537328 *
LEE, Y.-J.: "Simvastatin treatment boosts benefits of apoptotic cell infusion in murine lung fibrosis", CELL DEATH AND DISEASE, vol. 8, no. 6, 8 June 2017 (2017-06-08), pages e2860-1 - e2860-12, XP055537332 *
MORIMOTO, K .: "Lovastatin enhances clearance of apoptotic cells (efferocytosis) with implications for chronic obstructive pulmonary disease", THE JOURNAL OF IMMUNOLOGY, vol. 176, no. 12, 15 June 2006 (2006-06-15), pages 7657 - 7665, XP003020325 *
YOON, Y.-S.: "PPARy activation following apoptotic cell instillation promotes resolution of lung inflammation and fibrosis via regulation of efferocytosis and proresolving cytokines", MUCOSAL IMMUNOLOGY, vol. 8, no. 5, September 2015 (2015-09-01), pages 1031 - 1046, XP055537317 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113768953A (zh) * 2021-09-02 2021-12-10 中国人民解放军空军军医大学 凋亡小体用于制备治疗急性肺损伤药物的应用
CN113768953B (zh) * 2021-09-02 2023-10-13 中国人民解放军空军军医大学 凋亡小体用于制备治疗急性肺损伤药物的应用

Also Published As

Publication number Publication date
KR101833666B1 (ko) 2018-02-28

Similar Documents

Publication Publication Date Title
Lee et al. Therapeutic effects of human mesenchymal stem cells in ex vivo human lungs injured with live bacteria
Yuan et al. Receptor activator of nuclear factor kappa B ligand antagonists inhibit tissue inflammation and bone loss in experimental periodontitis
US20040224981A1 (en) Antibacterial methods and compositions
WO2006108354A1 (fr) 5-méthyl-2-(1h)-pyridone substituée en 1 par un groupement phényle dans la fabrication de médicaments pour le traitement de la fibrose d&#39;organes ou de tissus
KR20200136980A (ko) 리신-항미생물 펩타이드(amp) 폴리펩타이드 작제물, 리신, 이를 인코딩하는 단리된 폴리뉴클레오타이드 및 이의 용도
Zheng et al. Specific probiotic dietary supplementation leads to different effects during remission and relapse in murine chronic colitis
WO2019124666A2 (ko) 인터류킨-17 억제제 및 종양괴사인자-알파 억제제를 유효성분으로 포함하는 호중구성 폐 염증질환의 예방 또는 치료용 약학적 조성물
CN112218659A (zh) 用于治疗葡萄球菌感染的治疗性噬菌体组合物
Fang et al. The role of interleukin-22 in lung health and its therapeutic potential for COVID-19
Li et al. Clevudine attenuates bleomycin-induced early pulmonary fibrosis via regulating M2 macrophage polarization
CN114732818A (zh) 一种抗特发性肺纤维化药物尼达尼布在结核病治疗中的应用
WO2018147620A1 (ko) 사멸세포 및 스타틴 계열 화합물을 포함하는 폐 섬유증의 치료용 약학적 조성물
WO2014152437A2 (en) Methods of use for an antimicrobial peptide
CN111867678B (zh) 治疗黑色素瘤的方法
KR20120118596A (ko) Ｎｕｔｌｉｎ?３ａ 화합물을 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
Wang et al. KW2449 ameliorates collagen-induced arthritis by inhibiting RIPK1-dependent necroptosis
Ikegaya et al. Azithromycin reduces tumor necrosis factor-alpha production in lipopolysaccharide-stimulated THP-1 monocytic cells by modification of stress response and p38 MAPK pathway
WO2022245089A1 (ko) 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 코로나바이러스감염증-19(covid-19) 치료용 조성물
RU2327454C2 (ru) Средства для превентивной терапии после острого инсульта
US7015202B2 (en) Use of glycyrrhizin and its derivatives as MCP-1 production inhibitors
CA2976062A1 (en) Thymosin alpha 1 for use in treatment of cystic fibrosis
Wang et al. The effects of aerosolized STAT1 antisense oligodeoxynucleotides on rat pulmonary fibrosis
KR101976633B1 (ko) 폐 섬유증의 예방 또는 치료용 약학적 조성물
EP3405214B1 (en) Anti-neutrophil activity on innate immune response
KR101894097B1 (ko) 폐 염증 및 폐 섬유증 치료용 물질을 스크리닝하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18751643

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18751643

Country of ref document: EP

Kind code of ref document: A1