WO2018119540A1 - Composicion de acido delta-aminolevulinico, oxianiones y teluro o sus derivados, util en el control de patogenos - Google Patents

Composicion de acido delta-aminolevulinico, oxianiones y teluro o sus derivados, util en el control de patogenos Download PDF

Info

Publication number
WO2018119540A1
WO2018119540A1 PCT/CL2017/050089 CL2017050089W WO2018119540A1 WO 2018119540 A1 WO2018119540 A1 WO 2018119540A1 CL 2017050089 W CL2017050089 W CL 2017050089W WO 2018119540 A1 WO2018119540 A1 WO 2018119540A1
Authority
WO
WIPO (PCT)
Prior art keywords
ala
strain
resistance
strains
composition
Prior art date
Application number
PCT/CL2017/050089
Other languages
English (en)
French (fr)
Inventor
Eduardo Morales Sierra
Camilo Pinto Bizama
Claudio Vasquez Guzman
Original Assignee
Universidad De Santiago De Chile
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad De Santiago De Chile filed Critical Universidad De Santiago De Chile
Publication of WO2018119540A1 publication Critical patent/WO2018119540A1/es

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N59/00—Biocides, pest repellants or attractants, or plant growth regulators containing elements or inorganic compounds
    • A01N59/02—Sulfur; Selenium; Tellurium; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/04—Sulfur, selenium or tellurium; Compounds thereof

Definitions

  • the present invention relates to a pathogen control composition
  • a pathogen control composition comprising delta-aminolevulinic acid (ALA) or a derivative thereof, which may be derived from ALA, ethyl-ALA, alkyl esters of ALA or methyl ester of ALA, and oxyanions and tellurium or a derivative thereof; combined use of such compounds in the control of pathogens; pharmaceutical composition; veterinary composition and pesticide composition.
  • ALA delta-aminolevulinic acid
  • a derivative thereof which may be derived from ALA, ethyl-ALA, alkyl esters of ALA or methyl ester of ALA, and oxyanions and tellurium or a derivative thereof
  • the invention can be used in the elaboration of metal surfaces for the control of pathogens, as well as in the elaboration of coatings thereof.
  • an answer could be a molecule that does not have known efflux systems, whose molecular target is sufficiently essential in the host so that it cannot be modified; or that the molecule itself cannot be altered chemically.
  • tellurite oxyanion (Te0 3 2 " ) is lethal to most microorganisms (Fleming, A. On the specific antibacterial properties of penicillin and potassium tellurite. Incorporating a method demonstrating some bacterial antagonisms. J Pathol. Bacteriol. 35, 831-842 (1932) and Franke, KW & Moxon, AL A comparison of the minimum fatal doses of selenium, tellurium, arsenic and vanadium. J. Pharmacol. Exp. Ther. 58, 454 ⁇ 459 (1936)) at concentrations as low as 1 ⁇ . (Taylor,
  • ROS reactive oxygen species
  • Te0 3 2 a less toxic metal than Te0 3 2 " in several orders of magnitude (Nies, D. Microbial heavy-metal resistance. Appl. Microbiol. Biot. 51, 730-750 (1999)), exerts a higher production of ROS in E. coli. Additionally, Te0 3 2 " remains toxic even under anaerobic conditions (Tantaleán, JC Araya, MA, Saavedra, CP., Fuentes, DE, Pérez, JM, Calderón, IL, Youderian, P.
  • the Te0 3 2 " is a metalloid of little abundance in nature, which probably explains its high level of toxicity since microorganisms lack a specific response to its presence. This high toxicity positions it as a candidate for the control of microorganisms However, it remains to know the molecular objectives of said toxicity.
  • the present application demonstrates that nanomolar concentrations (from 750 nM) of the biosynthetic precursor of heme groups delta-aminolevulinic acid (ALA) powerfully potentiates telurite toxicity in aerobic conditions or Anaerobic It is important to note that ALA is widely used as a pro-drug in photodynamic therapies (PDT) for the control of bacteria, parasites, fungi, among others (Harris, F.
  • PDT photodynamic therapies
  • Patent documents related to the invention may be mentioned WO 2005/037928 (Mallinckrodt Inc) which describes a photoactive composition comprising a pharmaceutically acceptable formulation of at least one compound that can have an EL-DYE-X-N3 formula (formula 1 ) or EL-DYE-XY (formula 2), a method of treating an animal with a photoactive therapy, based on the application of the composition described above. It also reveals a method of antimicrobial treatment based on the application of different options of a compound formed by at least five components. Among those components it is indicated that the DYE may be a tellurium salt (see page 24 of the description and claim 8), while the photosensitizing agent could be aminolevulinic acid (see page 22).
  • the composition with antimicrobial activity thus described is formed by at least five components, two of them optionally tellurite and ALA, without reference to the microbial activity of a composition that comprises them together, and hence nor to the application of only those two molecules with respect to their activity on pathogens.
  • WO 2006/089264 (Chiron Corporation) which discloses a composition comprising an immunophilin-dependent immunosuppressant and a zinc salt (NSIDI), in amounts that allow to decrease the secretion of pro-inflammatory cytokines or to treat an immune disorder; and method for the treatment of a patient diagnosed with risk of developing an immunoinflammatory disorder, based on the administration of said composition.
  • a composition that can be used in the treatment of patients consisting essentially of two components, a molecule identified as NSIDI, with a clear immunosuppressive activity, and a zinc salt, where particularly on page 32, it is indicated that one of the zinc salts may comprise as against tellurite ion.
  • compositions and kits of the invention can be used for the treatment of actinic keratosis, where agents typically used for the treatment of dermatitis can be added to the composition, including acid. aminolevulinic, used in photodynamic therapies.
  • the composition with Therapeutic activity disclosed is formed by various components, at least 3, two of them being optionally a zinc salt comprising tellurite and ALA, without reference to the microbial activity of a composition comprising them, and therefore also to the application of only those two molecules regarding their activity on pathogens.
  • WO 201 1/139904 discloses a method to improve the safety of a food based on contacting plant material with a composition in an effective amount to reduce the number of at least one pathogen in said plant material, where said composition comprises at least one lactic acid producing microorganism.
  • the document describes a procedure for the selection of particular E. coli strains, means comprising tellurite salts, which suggests their ability to control different microorganisms. However, it does not describe or refer to the combined use of tellurite and ALA for the control of microorganisms.
  • EP 2727603 discloses a composition comprising a photosensitizing agent or 5-aminolevulinic acid, and method for developing photodynamic therapy, based on the administration of the composition described above, followed by irradiation with excitation light in the range 480-550 nm.
  • D4 describes a composition for use in photodynamic therapies comprising aminolevulinic acid. However, it does not describe or refer to the compositions claimed to comprise tellurite salts. Thus, the document reports the use of ALA for therapies but does not describe or suggest its use in combination with tellurite.
  • control is developed based on what is known as photodynamic therapy, that is, the application of a light stimulus is required to generate toxicity, unlike what is included in the file under analysis where a light application does not develop. Additionally, the document does not describe or refer to the application of tellurite for the control of pathogens.
  • the present invention relates to a pathogen control composition
  • a pathogen control composition comprising delta-aminolevulinic acid (ALA) or a derivative, which may be derived from ALA, ethyl-ALA, alkyl esters of ALA or methyl ester of ALA, and oxyanions and tellurium or a derivative thereof; and its combined use of such compounds in the control of pathogens, said pathogen being a pathogen that can be selected from the human body, animal or plant species.
  • ALA delta-aminolevulinic acid
  • a derivative which may be derived from ALA, ethyl-ALA, alkyl esters of ALA or methyl ester of ALA, and oxyanions and tellurium or a derivative thereof
  • the present invention in particular relates to a pathogen control composition
  • a pathogen control composition comprising delta-aminolevulinic acid (ALA) or a derivative thereof, which may be derived from ALA, ethyl-ALA, ALA alkyl esters or ALA methyl ester., And Oxyanions and tellurium or a derivative thereof
  • ALA delta-aminolevulinic acid
  • Oxyanions and tellurium or a derivative thereof is the use of the composition described above to prepare a medicament useful for pathogen control.
  • Such a composition could be prepared using techniques widely known in the area of drug preparation.
  • Still another objective of the present invention is the use of the composition described above to prepare a pesticide useful for the control of pathogens in plants or their environment.
  • a composition could be prepared using techniques widely known in the area of agricultural preparations.
  • Still another objective of the present invention is the use of the composition described above to prepare a pesticide useful for the control of pathogens in animals.
  • a composition could be prepared using techniques widely known in the area of veterinary preparations.
  • Still another objective of the present invention is the use of the composition described above in the control of pathogens in contaminated water.
  • Such a composition could be prepared using techniques widely known in the area of chemical preparations.
  • the present invention demonstrates that mutations in the hemA and hemL genes increase resistance to TeÜ3 2 " by decreasing levels of delta-aminolevulinic acid (ALA).
  • ALA delta-aminolevulinic acid
  • deletion mutants in 377 and 130 genes showed an increase or decrease of at least 3 times of growth after exposure to Te0 3 2 " , respectively.
  • deletion mutants that presented higher levels of resistance to Te0 3 2 " enrichment of genes involved in the cofactor biosynthesis category was detected, and in the pathway of chlorophyll and porphyrin metabolism.
  • the mutants included deletions of genes involved or with a putative role in the biosynthesis of heme groups, mainly hemN, which increases resistance to Te0 3 2 " .
  • Te0 3 2 induces the accumulation of intermediates in the biosynthesis of heme groups by quantifying the levels of coproporphyrinogen III and protoporphyrin IX in cells exposed to Te0 3 2" .
  • Te0 3 2 " To demonstrate that ALA enhances the toxicity of Te0 3 2 " , it was determined whether the EM2 strain previously identified by its CChRGM deposit number acquires at least part of the resistance to Te0 3 2" via decreased ALA levels.
  • the concentration of Te0 3 2 " was increased to levels of 400 ⁇ g / mL.
  • ALA potentiates the toxic effect of Te0 3 2 " in either strains sensitive or resistant to tellurite. In fact, the amount of Te0 3 2" needed to inhibit growth was less when ALA was present.
  • Te0 3 2 kills E. coli cells due to the accumulation of heme biosynthesis intermediates, mainly proto IX, and that the addition of ALA enhances this effect.
  • the cytotoxic effect of the combination of Te0 3 2 " and ALA demonstrated was also extensive to microorganisms in general, and was also tested in strains of Salmonella typhimurium, S. typhi, Klebsiella pneumoniae and Pseudomonas aeruginosa, which were grown in minimal medium ( M9) with different concentrations of Te0 3 2 " , and in the presence or absence of ALA.
  • Figures 1 A-1 D Selection of mutants that confer increased resistance to Te0 3 2 "
  • the EM2 strain previously individualized by its CChRGM deposit number was isolated to passage 26. Representative growth curves of strains BW251 13 and EM2 in LB medium ( Figure 1 B) or M9 ( Figure 1 C) in the presence of concentrations of Te0 3 2 " indicated. The values represent the average of three biological replicates.
  • strains were grown in M9 medium at an OD 6 or nm-of approximately 0.4 and the heme and ALA content was measured in cell extracts (Figure 1 D)
  • the values represent the mean ⁇ SD of three biological replicas. *** p ⁇ 0.0001 was determined by t-test.
  • FIGs 2A-2C Genomic chemistry of Te0 3 2 " .
  • Figure 2A treatment of the E. coli collection typified with Te0 3 2" .
  • the positive or negative interactions scores represent an increased or decreased resistance to Te0 3 2 " , respectively.
  • FIGS 3A-3C Protoporphyrinogen / protoporphyrin IX intermediates accumulate in cells exposed to Te0 3 2 " .
  • Figure 3A Strains BW251 13, EM2 and AhemN were grown in M9 medium at an OD 6 or nm of ⁇ 0.4 and exposed to Te0 3 2" (25 ⁇ g mL), and the porphyrin content of the cells was extracted and quantified by HPLC. In parallel, commercially available standards were used to identify each maximum.
  • Protoporphyrin IX represents the sum of protoporphyrinogen IX and protoporphyrin IX.
  • Protoporphyrin IX and coproporphyrin III units are normalized nmoles per mg of protein.
  • the time under the graphs represents the time of porphyrin extraction with respect to exposure to Te0 3 2 " .
  • Figure 3B Representative HPLC chromatograms of samples from each strain quantified in Figure 3 A. Blue line (0 min) and red lines (180 min) in each chromatogram represents the time at which the porphyrins were extracted with respect to the addition of Te0 3 2 " .
  • the time under the graph represents the time at which the CFU / mL was determined with respect to exposure to Te0 3 2 " . ** p ⁇ 0.001 was determined by t-test.
  • Figure 4A Strains BW251 13 and EM2 were grown in M9 medium supplemented or not with 25 ⁇ g / mL ALA, and exposed or not to Te0 3 2 " and the CFU / mL were quantified at the indicated times. Strains BW251 13 and EM2 were exposed to 10 ⁇ g / mL and 400 ⁇ g / mL of Te0 3 2 " , respectively.
  • FIG 4C Representative HPLC chromatograms of samples from each strain quantified in Figure 4B.
  • the color of each chromatogram (indicated in the base of the figure) represents the time at which the porphyrins were extracted with respect to the addition of Te0 3 2 " .
  • C coproporphyrin III
  • P protoporphyrin IX.
  • Figure 4D Decrease curves representative of the strains BW251 13, EM2, AhemN and AhemF in M9 medium supplemented with 25 ⁇ g / mL ALA in the presence of the indicated Te0 3 2 " concentrations. Preinoculars were grown in M9 medium supplemented with 25 ⁇ g / mL ALA.
  • Figure 4E Representative growth curves of strain BW251 13, in M9 medium supplemented with 25 ⁇ g / mL ALA in the presence of the indicated Te0 3 2 " concentrations. Pre-circles were grown in M9 medium without ALA.
  • Figure 4F Representative growth curves of strains BW251 13 and EM2 in M9 medium with Te0 3 2 " (0.5 and 50 ⁇ g / mL, respectively) supplemented with the indicated concentrations of ALA. For all experiments, the values represent the average of 3 biological replicas.
  • FIG. 4G Cultures of the EM2 strain previously individualized by their CChRGM deposit number, were grown anaerobically overnight and inoculated in M9 medium supplemented or not with 25 ⁇ g / mL ALA, and exposed or not to Te0 3 2 " . As indicated, the CFU / mL was quantified. The EM2 strain previously individualized by its CChRGM deposit number was treated with 400 ⁇ g / mL Te0 3 2 " .
  • FIG. 1 Growth of Salmonella Typhimurium LT2, Salmonella typhi, Klebsiella pneumoniae and Pseudomonas aeruginosa in M9 medium in the presence of indicated Te0 3 2 " concentrations supplemented or not supplemented with 25 ⁇ g / mL TO.
  • the different strains were grown as indicated in methods and OD 6 or nm is shown at 16.5 h growth depending on the concentration of Te0 3 2 " .
  • Figures 7A-7E Increased levels of thiols, ROS detoxification or resistance are not required for resistance to Te0 3 2 " .
  • Figure 7 A Strains BW251 13 and EM2 were grown in M9 medium with or without 25 ⁇ g / mL ALA at one OD 6 oo nm of -0.4 and treated with 2 mM H 2 0 2 (left panel) or Te0 3 2 " (center and right panel, 25 ⁇ g / mL for strain BW251 13 and 400 ⁇ g / mL for strain) EM2) and catalase activity (left and central panels) or superoxide dismutase (SOD, right panel), was determined at the indicated times. SOD activity was normalized per mg of protein.
  • Figure 7B Overnight cultures of strains BW251 13 and EM2 were inoculated in M9 medium supplemented or not with 25 ⁇ g / mL ALA, and exposed or not at 2 mM H 2 0 2 . The CFU / mL were determined at the indicated times.
  • Figure 7C Representative growth curves of strains BW251 13, EM2, AhemN and AhemF in M9 medium with 0.3 mM H 2 0 2 . For all experiments, the value represents the mean ⁇ SD of three biological replicas.
  • Figure 7D Strains BW251 13 and EM2 were grown as in a), exposed to Te0 3 2 " and tellurite reductase (TR) activity was determined with NADH or NADPH as cofactor.
  • TR activity was defined as the amount of enzyme required for increase by 0.001 absorbance units at 500 nm min "1 normalized by mg of protein The values represent the mean ⁇ SD of three biological replicas.
  • Figure 7E Strains BW251 13 and EM2 were grown as in Figure 7A, exposed to Te0 3 2 " and the total amount of intracellular thiols was determined and normalized per mg of protein.
  • RSH ⁇ thiols. Values represent the mean ⁇ SD of three biological replicas.
  • FIG. 8 Growth of E. coli in the presence of high concentrations of Te0 3 2 " generates black precipitates of elemental tellurium. Growth curves in LB medium containing 100 ⁇ g / mL Te0 3 2" of isolated colonies of each passage during experiments of directed evolution. The numbers at the top of each well indicate the passage to which the corresponding colony was isolated. The EM2 strain previously individualized by its CChRGM deposit number, was isolated to passages 3, 13, and 26. The dark color in the cultures is due to the reduction of Te0 3 2 " to tellurium.
  • Figures 9A and 9B show the 2 resulting plasmids that were used as tempering for a PCR reaction using a third forward splitter 5 ' GATGCAAGCAGACTAACCCT 3 ' (SEQ ID NO.: 5) and a third reverse splitter 5 ' AAATGCACCCTGTAAAAAAAGAAAATGATGTACTGCATATTAQ 3 ' ID No.:6).
  • the present invention relates to a composition for the control of pathogens comprising delta-aminolevulinic acid (ALA) or a derivative thereof, which may be derived from ALA, ethyl-ALA, alkyl esters of ALA or methyl ester of ALA, and oxyanions and Tellurium or a derivative thereof or a derivative thereof and tellurium or derivatives thereof.
  • ALA delta-aminolevulinic acid
  • ALA delta-aminolevulinic acid
  • ALA delta-aminolevulinic acid
  • Still another objective of the present invention is the use of the composition described above to prepare a medicament useful for the control of pathogens.
  • a composition could be prepared using techniques widely known in the area of drug preparation.
  • Still another objective of the present invention is the use of the composition described above to prepare a pesticide useful for the control of pathogens in plants or their environment.
  • a composition could be prepared using techniques widely known in the area of agricultural preparations.
  • Still another objective of the present invention is the use of the composition described above to prepare a pesticide useful for the control of pathogens in animals.
  • a composition could be prepared using techniques widely known in the area of veterinary preparations.
  • Still another objective of the present invention is the use of the composition described above in the control of pathogens in contaminated water.
  • Such a composition could be prepared using techniques widely known in the area of chemical preparations.
  • the present invention demonstrates that mutations in the hemA and hemL genes increase resistance to TeÜ 3 2 " by decreasing levels of delta-aminolevulinic acid (ALA).
  • Targeted evolution experiments were developed to isolate spontaneous E. coli mutants resistant to Te0 3 2 " .
  • Clone strains were isolated from these cultures from evolved cultures and colonies were selected. Isolated colonies were tested for resistance to Te0 3 2 " in plates with increasing concentrations of the metal and a strain with high resistance (400 ⁇ g mL, strain EM2) was sequenced as was the wild strain BW251 13.
  • the strain EM2 was previously selected by its deposit number CChRGM, to determine the mutations affecting genes encoding proteins of various pathways, including transcription ( rpoD), membrane stress response (pspF), synthesis of delta-aminolevulinic acid (hemA and hemL), and the hypothetical YigE protein.
  • the resistance conferred by mutations in rpoD and pspF probably acts by inducing transcriptional reprogramming and by improving the effect of Te0 3 2 " on the E. coli membrane, respectively.
  • the role of the YigE protein in resistance to Te0 3 2 " was not clear. Meanwhile, the hemA and hemL modifications confer resistance to Te0 3 2" .
  • deletion mutants in 377 and 130 genes showed an increase or decrease of at least 3 times in growth after exposure to Te0 3 2 " , respectively.
  • the mutants most sensitive to Te0 3 2 " showed an enrichment of genes involved in the mobility pathway, the catalase activity decreased 5 times in the EM2 strain previously individualized by its CChRGM deposit number, relative to the wild strain and did not change with the exposure to H 2 0 2 or Te0 3 2 " , while the superoxide dismutase activity, Te0 3 2" reductase and thiol levels were similar in both strains.
  • the EM2 strain previously individualized by its CChRGM deposit number was also more sensitive to H 2 0 2 with respect to strain BW251 13.
  • deletion mutants that presented higher levels of resistance to Te0 3 2 " enrichment of genes involved in the cofactor biosynthesis category was detected, and in the pathway of chlorophyll and porphyrin metabolism. In both cases, the mutants included deletions of genes involved or with a putative role in the biosynthesis of heme groups, mainly hemN and hemY, which increases resistance to Te0 3 2 " .
  • Te0 3 2 induces the accumulation of intermediates in the biosynthesis of heme groups by quantifying the levels of copro III and protoporphyrin IX in cells exposed to Te0 3 2" .
  • ALA potentiates the toxic effect of Te0 3 2 " in either strains sensitive or resistant to tellurite.
  • the amount of Te0 3 2" needed to inhibit growth was less when ALA was present, regardless of whether the cells were grown before in the middle with ALA or if ALA and Te0 3 2 " were added at the same time.
  • Te0 3 2 kills E. coli cells due to the accumulation of heme biosynthesis intermediates, mainly proto IX, and that the addition of ALA enhances this effect.
  • the EM2 strain was selected for a more detailed study, since it tolerates high levels of Te0 3 2 " both in LB medium (up to 400 ⁇ ., Fig 1 B) and in M9 medium supplemented with 0.2% glucose (up to 100 ⁇ g mL, Fig 1 C), at levels comparable to other organisms that are considered resistant to the metalloid (Arenas, FA, Pugin B., Henr ⁇ quez, NA, Arenas-Salinas, MA, D ⁇ az-Vásquez, WA, Pozo, MF, Mu ⁇ oz, CM, Chasteen, TG, Pérez-Donoso, JM & Vásquez, CC Isolation, Identification and characterization of tellurite hyper-resistant, tellurite-reducing bacteria from Antarctica, Polar Science 8, 40-52 (2014)).
  • hemA and hemL code for a glutamyl tRNA reductase and a semi-aldehyde aminotransferase glutamate, respectively, which catalyzes the synthesis of delta-aminolevulinic acid (ALA), precursor of this route.
  • ALA delta-aminolevulinic acid
  • Deletion mutants in 377 and 130 genes (Table 3. Deleted genes that increase resistance to Te0 3 2 " are shown in bold, while those whose deletion increases sensitivity are shown in italics) showed a significant increase or decrease (corrected p-value) less than 0.05) of at least 3 times in growth after exposure to Te0 3 2 " , respectively.
  • an enrichment of genes involved in the KEGG category of scourge assembly was detected.
  • deletion mutants that presented higher levels of resistance to Te0 3 2 " , (Table 3, genes in bold), enrichment of genes involved in the cofactor biosynthesis category, and in the pathway of chlorophyll and porphyrin metabolism, was detected.
  • these mutants include deletions of genes involved or with a putative role in the biosynthesis of heme groups, mainly hemN, which increases resistance to Te0 3 2 " (Fig 2A).
  • HemN is an oxygen independent coproporphyrinogen III dehydrogenase (Troup, B., Hungerer, C. & Jahn, D. Cloning and characterization of the Escherichia coli hemN gene encoding the oxygen-independent coproporphyrinogen III oxidase.
  • E. coli encodes two enzymes that can catalyze the conversion of coproporphyrinogen III to protoporphyrinogen IX, called HemN and HemF, it can be analyzed whether the inactivation of downstream genes of hemA and hemL also increase the resistance to Te0 3 2 " .
  • the resistance of the AhemFy AhemNiue mutant strains confirmed and these could grow in medium containing up to 2 and 4 ⁇ g / mL of Te0 3 2" , respectively (Fig 2B).
  • Example of embodiment 4. ALA enhances the toxicity of Te0 3 2 " .
  • strains BW251 13 and EM2 were treated with different concentrations of Te0 3 2 " , we believe that the lowest accumulation of proto IX and slower cell death observed in strain BW251 13 with respect to strain EM2 previously individualized by its deposit number CChRGM, is due to the difference in the rate of incorporation of Te0 3 2 " . In this sense, it was observed that intracellular levels of Te0 3 2" were 20 times higher in the strain EM2 previously individualized by its CChRGM deposit number, treated with 400 ⁇ g mL, with respect to strain BW251 13 treated with 25 ⁇ g / mL for 180 min.
  • proto IX levels in cells grown with ALA were 2 and 8 times higher in strains BW251 13 and EM2 even before exposure at Te0 3 2 " (Fig 4B), with respect to strain BW251 13 treated only with Te0 3 2" (Fig 3A). This indicates that under the conditions tested, proto IX per se is not lethal to E. coli and may not be solely responsible for the observed cell death, but that the combination of proto IX and Te0 3 2 " is the cause of cell death. observed.
  • ALA enhances the toxic effect of Te0 3 2 " , and that the above occurs in sensitive strains (BW251 13) or resistant to metal (EM2) (Fig 4A).
  • the minimum amount of Te0 3 was determined. 2 " required to inhibit growth in the presence of ALA.
  • the BW251 13, AhemN, AhemF and EM2 strains were exposed to decreasing amounts of Te0 3 2 " in the presence of a fixed amount of ALA (25 ⁇ g mL).
  • the amount of Te0 3 2" needed to inhibit growth was lower when ALA was present (Fig 1 C, 2B and 4D).
  • This potentiation effect of ALA on the toxicity of Te0 3 2 " was observed both when the cells were pre-grown in the presence of ALA (Fig 4D) or when ALA and Te0 3 2" were added at the same time (Fig 4E) .
  • the cell viability of the EM2 strain previously individualized by its CChRGM deposit number, grown in aerobiosis with ALA decreases rapidly, and viable cells cannot be found after 90 minutes, while in the absence of ALA the count cell decreases, but viability is maintained (Fig 4G).
  • the EM2 strain previously individualized by its CChRGM deposit number remains viable in the presence or absence of ALA (Fig 4G).
  • ALA is used in PDT, and various derivatives thereof, including ethyl-ALA, alkyl esters of ALA, and methyl ester of ALA, among others, have been used successfully in fungal biocontrol, parasites and bacteria (Almeida, A., Cunha, A., Faustino, MAF, Tome, A. C, & Neves, MGPMS Porphyrins as antimicrobial photosensitizing agents, Compr. Ser. Photoch. 1 1, 83-160 (201 1) ).
  • ALA derivatives The objective of the design of these ALA derivatives is to increase the lipophilicity of these compounds, increasing their permeability through membranes and physical barriers such as the skin, and therefore, their intracellular bioavailability.
  • esters thereof being most effective in PDT, such as methyl ALA and hexyl ALA (Wachowska, M., Muchowicz, A., Firczuk, M., Gabrysiak, M ., Winiarska, M., Wa ⁇ czyk, M., Bojarczuk, K. & Golab, J. Aminolevulinic acid (ALA) as a prodrug in photodynamic therapy of cancer. Molecules 16, 4140-4164 (201 1)).
  • the following detailed data should be considered:
  • the EM2 strain previously individualized by its CChRGM deposit number, was isolated after 26 serial passages under aerobic conditions (each passage equals 24 h) from strain BW251 13 in LB medium with increased concentrations of Te0 3 2 " up to 400 ⁇ g / mL (Fig. 1 A).
  • the strains were isolated by purification of individual colonies.
  • the genomes of strains BW251 13, and EM2, as well as the identification of mutations in each strain it was determined by Macrogen Inc (South Korea) using Ilumina HiSeq 2000.
  • the AhemN and AhemF strains were obtained from the Keio collection (Baba, T.
  • Strains EM42 and EM43 were generated by replacing hemA with a wild version of the hemA gene or with hemA [3 ⁇ ⁇ E] in strains EM2 or BW251 13, respectively. To achieve this, hemA was amplified from EM2 or BW251 13 strains using its own designed splitters, these are, a first 5 ' forward splitter
  • CACGTCTTGAGCGATTATGACCCTTTTAGCACTCGG 3 ' (SEQ ID No.:1) and a first 5 ' AGCTCCAGCCTACACTACTCCAGCCCGAGGCTG 3 ' reverse splitter (SEQ ID NO.:2), which were cloned into plasmid pKD3 (Datsenctivation, KA & inactive, KA & inactivity of chromosomal genes in Escherichia coli K-12 using PCR produc ⁇ s. Proc. Nati. Acad. Sci.
  • Plasmid pKD3 was amplified using a second forward splitter 5 ' GTGTAGGCTGGAGCTGCT 3 ' (SEQ ID No.:3) and a second 5 ' reverse splitter AATCGCTCAAGACGTGTAATG 3 ' (SEQ ID No .: 4), also of its own design.
  • the resulting 2 plasmids (see Figures 9A and 9B) were used as tempering for a PCR reaction using a third forward splitter 5 ' GATGCAAGCAGACTAACCCT 3 ' (SEQ ID NO.:5) and a third reverse splitter 5 ' AAATGCACCCTGTAAAAAAAGAAAATGATGTACTGCATATTAATCTATTA ' CCATTATT ' SEQ ID No.:6).
  • Strains EM42 and EM43 were constructed using the ⁇ network recombination (Datsenko, KA & Wanner, BL One-step inactivation of c romosomal genes in Escher ⁇ chia coli K-12 using PCR produc ⁇ s. Proc. Nati. Acad. Sci. USA 97, 6640 - 6645 (2000)) of the corresponding PCR products in the EM2 or BW251 strains 13. The incorporation of the desired mutation into the chromosome was confirmed by PCR and sequencing.
  • the growth curves were developed in M9 medium (Miller, JH Experiment in Molecular Genetics (Cold Spring Harbor Laboratory Press, New York, 1972)) plus 0.2% glucose containing or not potassium tellurite, supplemented H2O2 (Merck) with 25 ⁇ g / mL ALA (Sigma Aldrich), as indicated in the legend of each figure (1, 2, 4, 5, 6), in 48-well plates (NUNC). Growth began with the addition of 10 ⁇ of a saturated culture of each strain grown in M9 medium in a 990 ⁇ well (1: 100 dilution) of the medium indicated in each figure.
  • the specific barcodes of each strain were amplified using indexed splitters designed for luminum sequencing.
  • the forward splitters contain the specific sequence P5 of Illuminate, and correspond to: 5 ' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT CTTCCGATCTCGGTATGATCAATCTTCGGTAGTCCAGCG 3 ' (SEQ ID No: 7); 5 ' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTCGGATTGTCAAATCTTCGGTAGTCCAGCG 3 ' (SEQ ID No: 8); 5 ' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTAACCAGGTGTAATCTTCGGTAGTCCAGCG 3 ' (SEQ ID No: 9); 5 ' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGGATG
  • the fourth reverse splitter contains the specific P7 sequence of lllumine and 20 bp from a common E. coli site, and corresponds to: 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTTGTAGGCTGGAGCTGC TTCG 3' (SEQ ID No.:13). Bar codes were amplified by PCR, purified and quantified by qPCR as described (Piotrowski, JS Simpkins, SW, Li, SC, Deshpande, R., Mcllwain, SJ, Ong, IM, Myers, CL, Boone, C . & Andersen, RJ Chemical genomic profiling via barcode sequencing to predict compound mode of action. Methods Mol. Biol. 1263, 299-318 (2015)).
  • the samples were run in a HiSeq2500 luminum in rapid run mode for 50 cycles at a loading concentration of 15 pM.
  • the resulting Fastq file was used for the analysis of sensitive and resistant mutants (Robinson, MD, McCarthy, DJ & Smyth, GK edge R: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140 ( 2010)).
  • the standardized accounts of a control solvent (DMSO) were compared to identify specific responses for the compounds tested.
  • Porphyrins were analyzed and quantified using a "1200 series HPLC system" (Agilent Technologies) system including a degasifier (G1322A), a quaternary pump (G131 1 A), a variable wavelength detector (G1314B) and a manual sampler.
  • the injection volume was 20xL.
  • the separation was developed on an Agilent Zorbax Eclipse XDB-C18 column (4.6 x 150 mm, 5 ⁇ ) eluted for 45 min at a flow of 1 mL / min with a linear gradient from 50% solvent A (10% acetonitrile in 1 M ammonium acetate; pH 5, 1), 50% solvent B (methanol-acetic acid 10: 1, v / v) at 100% solvent B, followed by elution with 100% solvent B for 5 min.
  • the porphyrin composition of each sample was analyzed following the absorbance at 300 nm.
  • Commercially available standards of coproporphyrinogen III and protoporphyrin IX were used to identify and quantify each compound in the different samples.
  • Biochemical determinations For all biochemical determinations, saturated cultures of the strains grown in M9 medium were inoculated in 250 mL flasks containing 125 mL of M9 medium supplemented or not with 25 ⁇ g / mL ALA (indicated in each figure). The cultures were grown aerobically at 37 ° C with agitation of 250 rpm to OD 600 nm of 0.4. At this point, the cells were treated with Te0 3 2 " or H 2 0 2 , as indicated in each figure.
  • Catalan activity was determined in 200 ⁇ reactions using 10 ⁇ of cell-free extract as previously described (Jakubowski, W., Bili ⁇ ski, T. & Bartosz, G. Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radie Biol. Med. 28, 659-664 (2000)) following the consumption of H 2 0 2 at 240 nm. Catalase activity was defined as nmoles of H 2 0 2 consumed min "1 mg protein " 1 .
  • SOD Superoxide dismutase activity
  • NTB Tris-HCI buffer pH 7.4, 1 mM EDTA with 25 ⁇ nitro tetrazolium blue (NTB, Sigma Aldrich), 50 ⁇ xanthine and 0 , 25 ⁇ g ⁇ L xanthine oxidase (Sigma Aldrich).
  • SOD activity was monitored following the oxidation of NTB at 412 nm as previously described (Jakubowski, W., Bili ⁇ ski, T. & Bartosz, G. Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radie. Biol. Med. 28, 659-664 (2000)).
  • One unit of SOD activity was defined as the amount of enzyme required to inhibit by 50% the oxidation of NBT min "1 mg protein " 1 .
  • TR activity was determined in reactions of 200 ⁇ using 10 ⁇ of cell-free extract in 50mM Tris-HCI buffer pH 7.4, 1 mM Te0 3 2 " , 1 mM NAD (P) H (Sigma Aldrich) and 1 mM ⁇ - mercaptoethanol (Sigma Aldrich) TR activity was monitored following the appearance of 500nm tellurium as previously described (Calderón, IL Arenas, FA, Pérez, JM, Fuentes, DE, Araya, MA, Saavedra, CP., Tantaleán, JC, Pichuantes, SE, Youderian, PA & Vásquez CC.
  • Catalases are NAD (P) H-dependent tellurite reductases. PLoS ONE. 20, 1: e70 (2006) .A TR activity unit was defined as the amount of enzyme required to increase the OD to 500 nm in 0.001 min "1 mg protein " 1 .
  • Total content of thiols The total thiol content was quantified using Ellman's agent 5,5'-dithiobis- (2-nitrobenzoic acid) (DTNB, Sigma-Aldrich) as previously described (Turner, RJ, Weiner, JH & Taylor, DE Tellurite- mediated thiol oxidation in Escherichia coli. Microbiology. 145, 2549-2557 (1999)) following the generation of TNB "2 at 412 nm. The values were normalized per mg of protein.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Pest Control & Pesticides (AREA)
  • Chemical & Material Sciences (AREA)
  • Environmental Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Dentistry (AREA)
  • Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Agronomy & Crop Science (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Inorganic Chemistry (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

La presente invención se refiere a una composición para el control de patógenos que comprende ácido delta-aminolevulínico (ALA) o un derivado del mismo pudiendo ser dicho derivado de ALA, etil-ALA, alquilésteres de ALA o metiléster de ALA, y oxianiones y teluro o un derivado del mismo; uso combinado de tales compuestos en el control de patógenos; composición farmacéutica; composición veterinaria y composición plaguicida. La invención puede ser utilizada en la elaboración de superficies metálicas para el control patógenos, así como también en la elaboración de recubrimientos de las mismas.

Description

COMPOSICION DE ACIDO DELTA-AMINOLEVULINICO■ OXIANIONES Y TELURO O SUS DERIVADOS, UTIL EN EL CONTROL DE PATOGENOS
Campo de la invención
La presente invención se refiere a una composición para el control de patógenos que comprende ácido delta-aminolevulínico (ALA) o un derivado del mismo pudiendo ser dicho derivado de ALA, etil-ALA, alquilésteres de ALA o metiléster de ALA, y oxianiones y teluro o un derivado del mismo; uso combinado de tales compuestos en el control de patógenos; composición farmacéutica; composición veterinaria y composición plaguicida.
La invención puede ser utilizada en la elaboración de superficies metálicas para el control patógenos, así como también en la elaboración de recubrimientos de las mismas.
Antecedentes
Uno de los desafíos a los que se enfrenta la industria biomédica en la actualidad corresponde a la aparición de cepas de patógenos con elevada resistencia al tratamiento con antibióticos. En este grupo de especies resistentes podemos encontrar cepas de Escherichia coli, Salmonella typhi, Klebsiella pneumoniae, Pseudomonas aeruginosa, entre muchos otras, las que desarrollaron o adquirieron la capacidad de no ser afectadas por antibióticos incluso de última generación.
En la literatura relacionada se han comunicado una serie de mecanismos moleculares que explican la aparición de especies resistentes. Entre ellas: (a) la prevención de acceso del antibiótico a su objetivo molecular en la bacteria, por ejemplo, por una permeabilidad reducida del antibiótico o por un aumento en su eflujo al medio extracelular; (b) cambios en el objetivo del antibiótico por mutaciones, (c) modificación (y por ende protección) del objetivo molecular del antibiótico, y (d) la modificación directa del antibiótico, sea por inactivación, hidrólisis o por transferencia de un grupo químico. Más allá de lo anterior, se ha observado que muchos patógenos de relevancia clínica tienen la capacidad de formar biopelículas para protegerse de condiciones desfavorables, e incluso la formación de nanotubos en estas estructuras (tanto a nivel intra-especie o inter- especies), por donde pueden contactarse célula a célula de manera física y traspasar plasmidios o proteínas que participan en los mecanismos de resistencia a antibióticos antes descritos. Lo anterior genera que, ante la aparición de bacterias resistentes en un paciente, dicha resistencia se extienda rápidamente a la población de patógenos lo que genera que se requiera de un tratamiento rápido y efectivo para su control.
Ante la pregunta de qué características debiera tener una molécula para ser un buen agente que permita el control de patógenos y que tenga al menos una muy baja probabilidad de aparición de especies resistentes, una respuesta podría ser una molécula que no tenga sistemas de eflujo conocidos, cuyo blanco molecular sea suficientemente esencial en el huésped para que no pueda ser modificado; o que la molécula misma no pueda ser alterada de manera química.
En este contexto, es ampliamente conocido que el oxianión telurito (Te03 2") es letal para la mayoría de los microorganismos (Fleming, A. On the specific antibacterial properties of penicillin and potassium tellurite. Incorporating a method demonstrating some bacterial antagonisms. J. Pathol. Bacteriol. 35, 831-842 (1932) y Franke, K.W. & Moxon, A.L. A comparison of the mínimum fatal doses of selenium, tellurium, arsenic and vanadium. J. Pharmacol. Exp. Ther. 58, 454^459 (1936)) a concentraciones tan bajas como 1 μςΛηΙ. (Taylor,
D. E. Bacterial tellurite resistance. Trends Microbiol. 7, 1 1 1-1 15 (1999), siendo 10 veces más tóxico que el mercurio y algunos órdenes de magnitud más que otros metales (Nies, D. Microbial heavy-metal resistance. Appl. Microbiol. Biot. 51 , 730-750 (1999)). El metaloide Te03 2"(telurito) muestra una alta toxicidad en células bacterianas. No obstante, las bases moleculares que determinan dicha toxicidad son desconocidas.
Algunos determinantes de resistencia a Te03 2" han sido identificados tanto en plasmidios como en el cromosoma de bacterias, incluyendo los operones ter, kilA, tehAB, telAB y ars (Turner, R.J., Hou, Y., Weiner, J.H. & Taylor, D.E. The arsenical ATPase efflux pump mediates tellurite resistance. J. Bacteriol. 174, 3092-3094 (1992); Taylor, D.E., Hou, Y., Turner, R.J. & Weiner, J.H. Location of a potassium tellurite resistance operon (tehAtehB) within the terminus of Escherichia coli K-12. J. Bacteriol. 176, 2740-2742 (1994); Turner, R.J., Weiner, J.H. & Taylor, D.E. The tellurite resistance determinants tehA tehB and klaA klaB telB have different biochemical requirements. Microbiology 141 , 3133-3140 (1995); Goncharoff, P., Saadi, S., Chang, C.H., Saltman, L.H. & Figurski, D.H. Structural, molecular, and genetic analysis of the kilA operon of broad-host-range plasmid RK2. J. Bacteriol. 173, 3463-3477 (1991 ); Walter,
E. G., Thomas, C.M., Ibbotson, J.P. & Taylor, D.E. Transcriptional analysis, translational analysis, and sequence of the KilA-tellurite resistance región of plasmid RK2Ter. J. Bacteriol. 173, 1 1 1 1 -1 1 19 (1991 ); Kormutakova, R., Klucar, L. & Turna, J. DNA sequence analysis of the tellurite-resistance determinant from clinical strain of Escherichia coli and Identification of essential genes. Biometals 13, 135-139 (2000)), aunque el mecanismo por el que ellos actúan no se conoce. Adicionalmente, algunos estudios han sugerido que enzimas del metabolismo central son requeridas para la resistencia a Te03 2" (Chasteen, T.G., Fuentes, D.E., Tantaleán, J.C. & Vásquez, C.C. Tellurite: history, oxidative stress, and molecular mechanisms of resistance. FEMS Microbiol. Rev. 33, 820-32 (2009)). Por otro lado, algunos mecanismos de resistencia han sido descartados. Cuando se expresan en E. coli, los productos de los operones ars y tehAB no incrementan el eflujo de Te03 2" o alteran su entrada a la célula (Turner, R.J., Weiner, J.H. & Taylor, D.E. Neither reduced uptake ñor increased efflux is encoded by tellurite resistance determinants expressed in Escherichia coli. Can. J. Microbiol. 41 , 92-98 (1995)). Estudios recientes han identificado un grupo de proteínas que interactúan con TerC en E. coli (Turkovicova, L, Smidak, R., Jung, G., Turna, J., Lubec, G. & Aradska, J. Proteomic analysis of the TerC interactome: Novel links to tellurite resistance and pathogenicity. J. Proteomics. 136, 167-173 (2016)), lo cual podría ayudar a entender cómo estas proteínas incrementan la resistencia a Te03 2".
La mayoría del conocimiento respecto a la resistencia a Te03 2" deriva de la observación que dicho metal depleciona tioles importantes para el metabolismo celular, como glutatión (Turner, R.J., Aharonowitz, Y., Weiner, J.H. & Taylor, D.E. Glutathione is a target in tellurite toxicity and is protected by tellurite resistance determinants in Escherichia coli. Can. J. Microbiol. 47, 33-40 (2001 )), que altera el potencial reductor de la célula (Anaganti, N., Basu, B., Gupta, A., Joseph, D. & Apte, S.K. Depletion of reduction potential and key energy generation metabolic enzymes underlies tellurite toxicity in Deinococcus radiodurans. Proteomics 15, 89-97 (2015)), participa en la producción de especies reactivas de oxígeno (ROS) e incrementa la expresión de enzimas que se encargan de la destoxificación de ROS (Tremaroli, V., Fedi, S. & Zannoni, D. Evidence for a tellurite dependent generation of reactive oxygen species and absence of a tellurite-mediated adaptive response to oxidative stress in cells of Pseudomonas pseudoalcaligenes KF707. Arch. Microbiol. 187, 127-135 (2007); Pérez, J.M. Calderón, I.L., Arenas, F.A., Fuentes, D.E., Pradeñas, G.A., Fuentes, E.L., Sandoval, J.M., Castro, M.E., Elias, A.O. & Vásquez, C.C. Bacterial toxicity of potassium tellurite: unveiling an ancient enigma. PLoS ONE 2, e21 1 (2007)). Dichos antecedentes han guiado a que se proponga que la principal causa de la toxicidad del Te03 2" es su naturaleza oxidante (Chasteen, T.G., Fuentes, D.E., Tantaleán, J.C. & Vásquez, C.C. Tellurite: history, oxidative stress, and molecular mechanisms of resistance. FEMS Microbiol. Rev. 33, 820-32 (2009)). Apoyando lo anterior, se ha comunicado que cuando E. coli es expuesta a Te03 2" se induce la expresión de una serie de enzimas relacionadas con la destoxificación de ROS (Aradská, J., Smidák, R., Turkovicová, L, Turña, J. & Lubec, G. Proteomic differences between tellurite-sensitive and tellurite— resistant E. coli. PLoS ONE 8, e78010 (2013); Molina-Quiroz, R.C., Loyola, D.E., Díaz-Vásquez, W.A., Arenas, F.A., Urzúa, U., Pérez-Donoso, J.M. & Vásquez, C.C. Global transcriptomic analysis uncovers a switch to anaerobio metabolism in tellurite-exposed Escherichia coli. Res. Microbiol. 165, 566-70. (2014)).
Sin embargo, más allá de la evidencia que sugiere un rol central de la destoxificación de ROS y tioles en la resistencia a Te03 2", algunos estudios han desafiado esta idea. Por ejemplo, se ha observado que la inactivación de GshA o TrxA en E. coli incrementa la resistencia a Te03 2" en presencia de selenito (Vrionis, H.A., Wang, S., Haslam, B. & Turner, R.J. Selenite protection of tellurite toxicity toward Escherichia coli. Front. Mol. Biosci. 18, 2:69 (2015)), sugiriendo que niveles elevados de glutatión y tioredoxina podrían ser en realidad perjudiciales para la resistencia a Te03 2". Adicionalmente, no existe una correlación directa entre la toxicidad a un metal determinado y su habilidad para gatillar la producción de ROS. Por ejemplo, el selenito, un metal menos tóxico que el Te03 2" en varios órdenes de magnitud (Nies, D. Microbial heavy- metal resistance. Appl. Microbiol. Biot. 51 , 730-750 (1999)), ejerce una mayor producción de ROS en E. coli. Adicionalmente, el Te03 2" sigue siendo tóxico aun en condiciones anaerobias (Tantaleán, J.C. Araya, M.A., Saavedra, CP., Fuentes, D.E., Pérez, J.M., Calderón, I.L., Youderian, P. & Vásquez C.C. The Geobacillus stearothermophilus V iscS gene, encoding cysteine desulfurase, confers resistance to potassium tellurite in Escherichia coli K-12. J. Bacteriol. 185, 5831 -5837 (2003)) y organismos que son altamente resistentes a ROS como Deinococcus radiodurans muestran una muy baja resistencia a Te03 2" (Anaganti, N., Basu, B., Gupta, A., Joseph, D. & Apte, S.K. Depletion of reduction potential and key energy generation metabolic enzymes underlies tellurite toxicity in Deinococcus radiodurans. Proteomics 15, 89-97 (2015)); todo esto demostrando que ROS no explica completamente la toxicidad del Te03 2".
Un obstáculo importante en la identificación de mecanismos de resistencia a Te03 2" ha sido la ausencia de organismos resistentes. A la fecha, la mayoría de los trabajos relacionados a dichos mecanismos se han desarrollado en microorganismos que muestran una muy baja o nula resistencia a Te03 2", principalmente E. coli, haciendo difícil identificar con claridad los objetivos moleculares del Te03 2".
El Te03 2" es un metaloide de poca abundancia en la naturaleza, lo que probablemente explique su alto nivel de toxicidad ya que los microorganismos carecen de una respuesta específica a su presencia. Esta alta toxicidad lo posiciona como un candidato para el control de microorganismos; sin embargo, resta conocer los objetivos moleculares de dicha toxicidad. La presente solicitud demuestra que concentraciones a nivel nanomolar (desde 750 nM) del precursor biosintético de grupos hemo ácido delta-aminolevulínico (ALA) potencia poderosamente la toxicidad de telurito en condiciones aeróbicas o anaeróbicas. Resulta importante destacar que ALA es ampliamente utilizado como una pro-droga en terapias fotodinámicas (PDT) para el control de bacterias, parásitos, hongos, entre otros (Harris, F. & Pierpoint, L. Photodynamic therapy based on 5-aminolevulinic acid and its use as an antimicrobial agent. Med. Res. Rev. 32, 1292-1327 (2012)). De esta forma, el uso combinado de telurito y ALA mejora la eficiencia de PDT, y por ende ser utilizado en otras terapias de biocontrol.
Entre los documentos patente relacionados con la invención se pueden citar WO 2005/037928 (Mallinckrodt Inc) que describe una composición fotoactiva que comprende una formulación aceptable farmacéuticamente de al menos un compuesto que puede tener una fórmula E-L-DYE-X-N3 (fórmula 1 ) o E-L-DYE- X-Y (fórmula 2), método para tratar un animal con una terapia fotoactiva, basado en la aplicación de la composición descrita anteriormente. También revela un método de tratamiento antimicrobiano basado en la aplicación de distintas opciones de un compuesto formado por al menos cinco componentes. Entre esos componentes se indica que el DYE puede ser una sal de teluro (ver página 24 de la descripción y reivindicación 8), mientras que el agente fotosensibilizador podría ser ácido aminolevulínico (ver página 22). Sin embargo, como se indicó anteriormente, la composición con actividad antimicrobiana así descrita está formada por al menos cinco componentes, siendo opcionalmente dos de ellos telurito y ALA, sin hacer referencia a la actividad microbiana de una composición que los comprenda juntos, y por ende tampoco a la aplicación de solo esas dos moléculas respecto a su actividad sobre patógenos.
WO 2006/089264 (Chiron Corporation) que divulga una composición que comprende un inmunosupresor dependiente de inmunofilina y una sal de zinc (NSIDI), en cantidades que permiten decrecer la secreción de citoquinas proinflamatorias o tratar un desorden inmune; y método para el tratamiento de un paciente diagnosticado con riesgo de desarrollar un desorden inmunoinflamatorio, basado en la administración de la mencionada composición. Sin embargo, reivindica una composición que puede ser utilizada en el tratamiento de pacientes, formada esencialmente por dos componentes, una molécula identificada como NSIDI, con una clara actividad inmunosupresora, y una sal de zinc, donde particularmente en la página 32, se indica que una de las sales de zinc puede comprender como contra ión telurito. Adicionalmente, en la página 34 del documento, se indica que los métodos, composiciones y kits de la invención pueden ser usados para el tratamiento de keratosis actínica, donde agentes típicamente usados para el tratamiento de dermatitis pueden ser agregados a la composición, entre ellos ácido aminolevulínico, usado en terapias fotodinámicas. Así, la composición con actividad terapéutica divulgada está formada por diversos componentes, al menos 3, siendo opcionalmente dos de ellos una sal de zinc que comprende telurito y ALA, sin hacer referencia a la actividad microbiana de una composición que los comprenda, y por ende tampoco a la aplicación de solo esas dos moléculas respecto a su actividad sobre patógenos.
WO 201 1/139904 (Nutrition Physiology Company LLC) revela un método para mejorar la seguridad de un alimento basado en contactar material de una planta con una composición en una cantidad efectiva para reducir el número de al menos un patógeno en dicho material vegetal, donde dicha composición comprende al menos un microorganismo productor de ácido láctico. El documento describe un procedimiento para la selección de cepas de E. coli particulares, medios que comprenden sales de telurito, lo que sugiere su capacidad de control de distintos microorganismos. Sin embargo, no describe o hace referencia al uso combinado de telurito y ALA para el control de microorganismos.
EP 2727603 (SBI Pharmaceuticals Co) revela una composición que comprende un agente fotosensibilizador o ácido 5-aminolevulínico, y procedimiento para el desarrollo de terapia fotodinámica, basado en la administración de la composición descrita anteriormente, seguido por irradiación con luz de excitación en el rango de 480-550 nm. D4 describe una composición para su uso en terapias fotodinámicas que comprende ácido aminolevulínico. Sin embargo, no describe o hace referencia a que las composiciones que se reivindican comprendan sales de telurito. Así, el documento reporta el uso de ALA para terapias pero no describe o sugiere su uso en combinación con telurito. Hong, D.D., Jee, W.L. & Jong, I.R. Generation of reactive oxygen species from 5-aminolevulinic acid and glutamate in cooperation with excited CdSe/ZnS QDs. Proc. SPIE 9166, Biosensing and Nanomedicine VI I, 916612 (2014); enseña el uso de quantum dots de CdSe/ZnS que participan en reacciones de oxidación de ALA o glutamato para la generación de especies reactivas de oxígeno, lo que podría tener eventualmente una actividad antimicrobiana. Sin embargo, dicho documento afirma que tal eventual actividad antimicrobiana necesariamente implica la generación de especies reactivas de oxígeno, a diferencia del expediente bajo análisis donde se demuestra que la toxicidad combinada del teluro con ALA se desarrolla aun en condiciones anaerobias, donde evidentemente no existe producción de especies reactivas de oxígeno. Taylor, D.E. Bacterial Tellurite Resistance. Trends in Microbiology 7(3): 1 1 1 -1 15 (1999); es una revisión bibliográfica referida a la resistencia a telurito en bacterias, se profundiza particularmente en la toxicidad que genera dicho ión, los tipos de determinantes de resistencia, la organización génica de los mismos, así como su presencia en distintos genomas bacterianos. El documento detalla los efectos celulares que provoca la exposición de bacterias a telurito, así como los genes que aumentan su resistencia. Sin embargo, no describe o hace referencia al ácido aminolevulínico, y por ende tampoco a que dicha molécula potencia el efecto tóxico del teluro.
Borghese, R., Marchetti, D. & Zannoni, D. The highly toxic oxyanion tellurite (Te03 2~) enters the phototrophic bacterium fíhodobacter capsulatus via an as yet uncharacterized monocarboxylate transport system. Archives of Microbiology 189: 93-100 (2008); comunica que el telurito ingresa a las células de R. capsulatus por un sistema de transporte de monocarboxilato no caracterizado, y su acumulación intracelular es inhibida por piruvato, lactato y acetato. Si bien describe la toxicidad que genera el telurito en células de R. capsulatus, no describe o hace referencia al ácido aminolevulínico, y por ende tampoco a que dicha molécula potencia el efecto tóxico del teluro.
O'Gara, T.P., Gomelsky, M. & Kaplan S. Identification and molecular genetic analysis of múltiple loci contributing to high-level tellurite resistance in Rhodobacter sphaeroides 2.4.1 . Appl. and Environ. Microbiol. 63(12): 4713- 4720 (1997); describe la identificación y caracterización de dos loci implicados en los altos niveles de resistencia a telurito. Dentro del primer locus se destaca tgrAB, siendo adyancentes a cysK; y el segundo locus está representado por telA; se indica que ambos locus otorgan los altos niveles de resistencia de R. sphaeroides. Si bien se caracterizan los mecanismos de resistencia a telurito en R. sphaeroides, no se describe o hace referencia que el ácido aminolevulínico potencie el efecto tóxico de telurito en esta bacteria.
Harris, F. & Pierpoint, L. Photodynamic therapy based on 5-aminolevulinic acid and its use as an antimicrobial agent. Med. Res. Rev. 32(6): 1292-1327 (2012); describe que el ácido 5-aminolevulínico es captado por bacterias, levaduras, hongos y parásitos, lo que genera la acumulación de protoporfirina IX (PPIX), luego de la irradiación lumínica de dichas células genera daño a diversas estructuras, lo que ha sido utilizado en el control de distintos patógenos mediante el uso de terapia fotodinámica, detallándose en este trabajo además los mecanismos por el cual dicha técnica inactiva microorganismos. El documento describe el mecanismo molecular mediante el cual el ácido 5- aminolevulínico tiene actividad antimicrobiana. Sin embargo, dicho mecanismo requiere necesariamente la aplicación de un estímulo lumínico para generar toxicidad, a diferencia de lo incluido en el expediente bajo análisis donde no se aplica luz. Adicionalmente, el documento no describe o hace referencia a la aplicación de telurito para el control de patógenos.
Fotinos, N., Convert, M., Piffaretti, J.C., Gurny, R. & Lange, N. Effects on Gram- Negative and Gram-Positive bacteria mediated by 5-aminolevulinic acid and 5- aminolevulinic acid derivatives. Antimicrob. Agents Chemother. 52(4): 1366- 1373 (2008); muestra una caracterización de las distintas moléculas (ALA o sus derivados) y su efecto celular cuando se aplica en terapia fotodinámica para el control de bacterias Gram negativo o positivo. El documento caracteriza la efectividad de ALA o sus derivados para el control de patógenos. Se describe que dicho control es desarrollado en base a lo que se conoce como terapia fotodinámica, es decir se requiere la aplicación de un estímulo lumínico para generar toxicidad, a diferencia de lo incluido en el expediente bajo análisis donde no se desarrolla una aplicación lumínica. Adicionalmente, el documento no describe o hace referencia a la aplicación de telurito para el control de patógenos.
BREVE DESCRIPCION DEL INVENTO
La presente invención se refiere a una composición para el control de patógenos que comprende ácido delta-aminolevulínico (ALA) o un derivado, pudiendo ser dicho derivado de ALA, etil-ALA, alquilésteres de ALA o metiléster de ALA, y oxianiones y teluro o un derivado del mismo; y su uso combinado de tales compuestos en el control de patógenos, siendo dicho patógeno un patógeno que puede ser seleccionado desde el cuerpo humano, animal o especies vegetales. La presente invención en particular se relaciona con una composición para el control de patógenos que comprende ácido delta-aminolevulínico (ALA) o un derivado del mismo pudiendo ser dicho derivado de ALA, etil-ALA, alquilésteres de ALA o metiléster de ALA., y oxianiones y teluro o un derivado del mismo Aún otro objetivo de la presente invención es el uso de la composición antes descrita para preparar un medicamento útil para el control de patógenos. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparación de fármacos.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita para preparar un plaguicida útil para el control de patógenos en plantas o su entorno. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparaciones agrícolas.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita para preparar un plaguicida útil para el control de patógenos en animales. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparaciones veterinarias.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita en el control de patógenos en aguas contaminadas. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparaciones químicas.
En particular, la presente invención demuestra que mutaciones en los genes hemA y hemL incrementan la resistencia a TeÜ32" mediante la disminución de los niveles de ácido delta-aminolevulínico (ALA). Lo anterior en base a experimentos realizados en mutantes espontáneas de E. coli resistentes a Te03 2". Esto permitió aislar cepas clónales y seleccionar colonias sobre las que se ensayó la resistencia a Te03 2".
De las mutantes se seleccionó la cepa EM2 (número RGM2343 de fecha 12 de Diciembre de 2016 de la colección Chilena de Recursos Genéticos Microbianos (CChRGM) para determinar las mutaciones que afectaban genes codificantes para proteínas de varias rutas, incluyendo transcripción (rpoD), respuesta al estrés de membrana (pspF), síntesis de ácido delta-aminolevulínico (hemA y hemi), y la proteína hipotética YigE.
Se observó que la complementacion de la mutación sobre hemA en la cepa EM2 antes individualizada por su numero de deposito CChRGM, con el alelo silvestre, derivado de la cepa BW251 13, redujo la resistencia a Te03 2". A la inversa, cuando se introduce el alelo hemA [31 E] en una cepa isogénica silvestre (cepa EM43), no recapitulaba la resistencia observada en la cepa EM2, indicando que el fondo genético es importante para la resistencia a Te03 2".
Respecto a las mutaciones sobre hemL, no fue posible incorporar el alelo silvestre en la cepa EM2 antes individualizada por su numero de deposito CChRGM, o introducir el alelo /rem/_[1 18V] en la cepa BW251 13; no obstante, los resultados experimentales mostraron que alterar los niveles de ALA y/o hemo resulta muy relevante para incrementar la resistencia a Te03 2".
Usando una colección de mutantes individuales de E. coli en busca de deleciones que podrían resultar en una mayor o menor resistencia a Te03 2", se encontró que mutantes de deleción en 377 y 130 genes mostraron un incremento o disminución de al menos 3 veces del crecimiento luego de la exposición a Te03 2", respectivamente. Entre las mutantes por deleción que presentaban mayores niveles de resistencia a Te03 2" se detectó enriquecimiento de genes implicados en la categoría de biosíntesis de cofactores, y en la ruta del metabolismo de clorofila y porfirina. En ambos casos, las mutantes incluían deleciones de genes involucrados o con un rol putativo en la biosíntesis de grupos hemo, principalmente hemN, lo que incrementa la resistencia a Te03 2".
Al analizar la inactivación de genes río abajo de hemA y hemL también se incrementaba la resistencia a Te03 2". La resistencia de las cepas mutantes AhemF y AhemN fue confirmada y estas pudieron crecer en medio que contenía hasta 2 y 4 μg/mL de Te03 2", respectivamente. Inactivando enzimas de la biosíntesis de grupos hemo, y limitando la disponibilidad de sustratos para los últimos pasos de dicha ruta, se incrementa la resistencia a Te03 2".
También se encontró que Te03 2" induce la acumulación de intermediarios en la biosíntesis de grupos hemo al cuantificar los niveles de coproporfirinogeno III y protoporfirina IX en células expuestas a Te03 2".
Para demostrar que ALA potencia la toxicidad de Te03 2", se determinó si la cepa EM2 antes individualizada por su numero de deposito CChRGM, adquiere al menos parte de la resistencia a Te03 2" vía disminución de los niveles de ALA. Se incrementó la concentración de Te03 2" a niveles de 400 μg/mL. La adición de concentraciones sub-letales de ALA (25 μg mL) al medio de crecimiento sensibilizó una cepa (EM2) a Te03 2" y disminuyó su viabilidad celular a niveles indetectables luego de 180 minutos de exposición. Por el contrario, las mismas células crecidas en la ausencia de ALA y expuestas a la misma cantidad de Te03 2" se mantuvieron viables aun luego de 24 h.
Luego, ALA potencia el efecto tóxico de Te03 2" ya sea en cepas sensibles o resistentes a telurito. De hecho, la cantidad de Te03 2" necesaria para inhibir el crecimiento fue menor cuando ALA estuvo presente.
También se determinó que el Te03 2" mata células de E. coli debido a la acumulación de intermediarios de la biosíntesis de hemo, principalmente proto IX, y que la adición de ALA potencia dicho efecto.
El efecto citotóxico de la combinación de Te03 2" y ALA demostrado fue también extensivo a microorganismos en general, y también se probó en cepas de Salmonella typhimurium, S. typhi, Klebsiella pneumoniae y Pseudomonas aeruginosa, que se hicieron crecer en medio mínimo (M9) con distintas concentraciones de Te03 2", y en presencia o ausencia de ALA.
BREVE DESCRIPCION DE LAS FIGURAS
Figuras 1 A-1 D. Selección de mutantes que confieren resistencia aumentada a Te03 2" Figura 1 A Experimentos de evolución dirigida en medio LB. Se indica el número de pasajes seriales (un pasaje=24 h) y la concentración de Te03 2". La cepa EM2 antes individualizada por su numero de deposito CChRGM, fue aislada al pasaje 26. Curvas de crecimiento representativas de las cepas BW251 13 y EM2 en medio LB (Figura 1 B) o M9 (Figura 1 C) en la presencia de las concentraciones de Te03 2"indicadas. Los valores representan la media de tres réplicas biológicas. Las cepas indicadas fueron crecidas en medio M9 a una OD6oo nm-de aproximadamente 0,4 y el contenido de hemo y ALA fue medido en los extractos celulares (Figura 1 D). El nivel de hemo o ALA en la cepa EM2 antes individualizada por su numero de deposito CChRGM, fue comparada con la cepa BW251 13, la que fue arbitrariamente considerada como 100%. Los valores representan la media ± SD de tres réplicas biológicas. *** p < 0,0001 se determinó por t-test.
Figuras 2A-2C. Química genómica de Te03 2". Figura 2A, tratamiento de la colección de E. coli tipificada con Te03 2". Los puntajes de interacciones positivas o negativas representan una resistencia a Te03 2" aumentada o disminuida, respectivamente. Se muestran los mutantes de genes seleccionados que codifican para proteínas requeridas para biosíntesis de hemo {hemN), metabolismo de glutatión (gor, gshB), resistencia a ROS {btuE, oxyfí, sodA, sodB, sodC, katE), y el ensamble de centros fierro-azufre {iscA, iscfí, iscU, sufA, sufB, sufC). Figura 2B Curvas de crecimiento representativas de las cepas AhemN y AhemF en medio M9 en presencia de las concentraciones de Te03 2" indicadas. Los valores representan la media de tres réplicas biológicas. SD fue removido por claridad. Figura 2C Representación esquemática de la ruta de biosíntesis de hemo en E. coli BW251 13. Las proteínas seleccionadas codificadas por genes que cuando se inactivan (caja verde) o mutan (caja negra) incrementan la resistencia a Te03 2" o los intermediarios de la ruta biosintética de hemo (caja roja) que muestran niveles alterados en EM2 fueron destacados.
Figuras 3A-3C. Los intermediarios protoporfirinógeno/protoporfirina IX se acumulan en células expuestas a Te03 2". Figura 3A Las cepas BW251 13, EM2 y AhemN fueron crecidas en medio M9 a una OD6oo nm de~0,4 y expuestas a Te03 2" (25 μg mL), y el contenido de porfirina de las células fue extraído y cuantificado por HPLC. En paralelo, estándares comercialmente disponibles fueron utilizados para identificar cada máximo. Protoporfirina IX representa la suma de protoporfirinógeno IX y protoporfirina IX. Unidades de protoporfirina IX y coproporfirina III son nmoles normalizados por mg de proteína. El tiempo bajo los gráficos representa el tiempo de extracción de porfirina respecto a la exposición a Te03 2". C = coproporfirina III (barras negras); P= protoporfirina IX (barras rojas). Los valores representan la media de tres réplicas biológicas ± SD. ND = no detectada. Figura 3B Cromatogramas representativos de HPLC de muestras de cada cepa cuantificada en Figura 3A. Línea azul (0 min) y líneas rojas (180 min) en cada cromatograma representa el tiempo al cual las porfirinas fueron extraídas respecto a la adición de Te03 2". Figura 3C Las CFU/mL fueron cuantificadas desde la misma muestra usada para la extracción de porfirina como se expuso en la Figura 3A. Ctrl = células no tratadas. El tiempo bajo el gráfico representa el tiempo al cual la CFU/mL fue determinada con respecto a la exposición a Te03 2". ** p < 0,001 se determinó por t-test. Figuras 4A-4G. ALA potencia la toxicidad del Te03 2". Figura 4A Las cepas BW251 13 y EM2 fueron crecidas en medio M9 suplementada o no con 25 μg/mL ALA, y expuesto o no a Te03 2" y las CFU/mL fueron cuantificadas a los tiempos indicados. Las cepas BW251 13 y EM2 fueron expuestas a 10 μg/mL y 400 μg/mL de Te03 2", respectivamente. El contenido de hemo y ALA fue determinado en los extractos celulares. Los niveles de hemo y ALA en las cepas BW251 13 y EM2 fueron comparados con aquellos de la cepa BW251 13 crecida sin ALA (línea roja punteada, Fig. 1 D). Figura 4B Las cepas BW251 13 y EM2 fueron crecidas en medio M9 suplementado con 25 μg/mL ALA y expuesto a Te03 2" (25 and 400 μg/mL para las cepas BW251 13 y EM2, respectivamente) y el contenido de porfirina fue cuantificado por HPLC a los tiempos indicados. Unidades de protoporfirina IX y coproporfirina III son nmoles normalizados por mg de proteína. Los valores representan la media de tres réplicas biológicas ± SD normalizado por mg de proteína. Figura 4C Cromatogramas representativos de HPLC de muestras de cada cepa cuantificada en Figura 4B. El color de cada cromatograma (indicado en la base de la figura) representa el tiempo al cual las porfirinas fueron extraídas respecto a la adición de Te03 2". C = coproporfirina III, P = protoporfirina IX. Figura 4D Curvas decrecimiento representativas de las cepas BW251 13, EM2, AhemN y AhemF en medio M9 suplementado con 25 μg/mL ALA en presencia de las concentraciones de Te03 2" indicadas. Preinóculos fueron crecidos en medio M9 suplementado con 25 μg/mL ALA. Figura 4E Curvas de crecimiento representativas de la cepa BW251 13, en medio M9 suplementado con 25 μg/mL ALA en presencia de las concentraciones de Te03 2 "indicadas. Preinóculos fueron crecidos en medio M9 sin ALA. Figura 4F Curvas de crecimiento representativas de las cepas BW251 13 y EM2 en medio M9 con Te03 2" (0,5 y 50 μg/mL, respectivamente) suplementado con las concentraciones indicadas de ALA. Para todos los experimentos, los valores representan la media de 3 réplicas biológicas. Figura 4G Cultivos de la cepa EM2 antes individualizada por su numero de deposito CChRGM, fueron crecidos anaeróbicamente toda la noche e inoculados en medio M9 suplementado o no con 25 μg/mL ALA, y expuesto o no a Te03 2". A los tiempos que se indican, se cuantificó las CFU/mL. La cepa EM2 antes individualizada por su numero de deposito CChRGM, fue tratada con 400 μg/mL Te03 2".
Figura 5. Crecimiento de Salmonella Typhimurium LT2, Salmonella typhi, Klebsiella pneumoniae y Pseudomonas aeruginosa en medio M9 en presencia de las concentraciones de Te03 2" indicadas suplementado o no con 25 μg/mL ALA. Las diferentes cepas fueron crecidas como se indicada en métodos y se muestra la OD6oo nm a las 16,5 h de crecimiento en función de la concentración de Te03 2".
Figura 6 Selección de mutantes que confieren resistencia incrementada a Te03 2". Curvas de crecimiento representativas de las cepas BW251 13, y EM2 en medio LB en presencia de las concentraciones indicadas de Te03 2". Los valores representan la media de 2 réplicas biológicas.
Figuras 7A-7E Niveles incrementados de tioles, destoxificación de ROS o resistencia no son requeridos para la resistencia a Te03 2". Figura 7 A Las cepas BW251 13 y EM2 fueron crecidas en medio M9 con o sin 25 μg/mL ALA a una OD6oo nm de -0,4 y tratadas con 2 mM H202 (panel izquierdo) o Te03 2" (panel central y derecho, 25 μg/mL para la cepa BW251 13 y 400 μg/mL para la cepa EM2) y la actividad catalasa (paneles izquierdo y central) o superóxido dismutasa (SOD, panel derecho), fue determinada a los tiempos indicados. La actividad SOD fue normalizada por mg de proteína. Figura 7B Cultivos overnight de las cepas BW251 13 y EM2 fueron inoculados en medio M9 suplementado o no con 25 μg/mL ALA, y expuesto o no a 2 mM H202. Las CFU/mL fueron determinadas a los tiempos indicados. Figura 7C Curvas de crecimiento representativas de las cepas BW251 13, EM2, AhemN y AhemF en medio M9 con 0,3 mM H202. Para todos los experimentos, el valor representa la media ± SD de tres réplicas biológicas. Figura 7D Las cepas BW251 13 y EM2 fueron crecidas como en a), expuestas a Te03 2" y la actividad telurito reductasa (TR) fue determinada con NADH o NADPH como cofactor. La actividad TR fue definida como la cantidad de enzima requerida para incrementar en 0,001 unidades de absorbancia a 500 nm min"1 normalizada por mg de proteína. Los valores representan la media ± SD de tres réplicas biológicas. Figura 7E Las cepas BW251 13 y EM2 fueron crecidas como en la Figura 7A, expuestas a Te03 2"y la cantidad total de tioles intracelulares fue determinada y normalizada por mg de proteína. RSH = μΜ tioles. Los valores representan la media ± SD de tres réplicas biológicas.
Figura 8 Crecimiento de E. coli en presencia de altas concentraciones de Te03 2" genera precipitados negros de teluro elemental. Curvas de crecimiento en medio LB conteniendo o no 100 μg/mL Te03 2"de colonias aisladas de cada pasaje durante los experimentos de evolución dirigida. Los números en la parte superior de cada pocilio indica el pasaje al cual la colonia correspondiente fue aislada. La cepa EM2 antes individualizada por su numero de deposito CChRGM, fue aislada a los pasajes 3, 13, y 26. El color oscuro en los cultivos es debido a la reducción de Te03 2"a teluro.
Figuras 9A y 9B muestran los 2 plasmidios resultantes que fueron usados como templado para una reacción de PCR utilizando un tercer partidor forward 5' GATGCAAGCAGACTAACCCT 3' (SEQ ID NO. :5) y un tercer partidor reverso 5' AAATGCACCCTGTAAAAAAAGAAAATGATGTACTGCATATGAAT ATCCTCCTTAG 3' (SEQ ID No.:6).
DESCRIPCION DETALLADA DE LA INVENCION
La presente invención se refiere a una composición para el control de patógenos que comprende ácido delta-aminolevulínico (ALA) o un dervivado del mismo, pudiendo ser dicho derivado de ALA, etil-ALA, alquilésteres de ALA o metiléster de ALA, y oxianiones y teluro o un derivado del mismoo un derivado del mismo y teluro o derivados de los mismos. La presente invención en particular se relaciona con una composición para el control de patógenos que comprende ácido delta-aminolevulínico (ALA) o un derivado del mismo, pudiendo ser dicho derivado de ALA, etil-ALA, alquilésteres de ALA o metiléster de ALA, y oxianiones y teluro o un derivado del mismo.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita para preparar un medicamento útil para el control de patógenos. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparación de fármacos.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita para preparar un plaguicida útil para el control de patógenos en plantas o su entorno. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparaciones agrícolas.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita para preparar un plaguicida útil para el control de patógenos en animales. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparaciones veterinarias.
Aún otro objetivo de la presente invención es el uso de la composición antes descrita en el control de patógenos en aguas contaminadas. Tal composición podría ser preparada usando técnicas ampliamente conocidas en el área de preparaciones químicas.
En particular, la presente invención demuestra que mutaciones en los genes hemA y hemL incrementan la resistencia a TeÜ3 2" mediante la disminución de los niveles de ácido delta-aminolevulínico (ALA). Se desarrollaron experimentos de evolución dirigida para aislar mutantes espontáneas de E. coli resistentes a Te03 2". A partir de dichos ensayos se aislaron cepas clónales desde cultivos evolucionados y se seleccionaron colonias. Las colonias aisladas fueron ensayadas respecto a su resistencia a Te03 2" en placas con concentraciones crecientes del metal y una cepa con alta resistencia (400 μg mL, cepa EM2) fue secuenciada al igual que la cepa silvestre BW251 13.
La secuenciación mostró que distintas mutaciones se acumulan y aditivamente incrementan la resistencia a Te03 2". Se seleccionó la cepa EM2 antes individualizada por su numero de deposito CChRGM, para determinar las mutaciones que afectaban genes codificantes para proteínas de varias rutas, incluyendo transcripción (rpoD), respuesta al estrés de membrana (pspF), síntesis de ácido delta-aminolevulínico (hemA y hemL), y la proteína hipotética YigE. La resistencia conferida por las mutaciones en rpoD y pspF probablemente actúan induciendo reprogramación transcripcional y mediante la mejora en el efecto del Te03 2" en la membrana de E. coli, respectivamente. El rol de la proteína YigE en la resistencia a Te03 2" no fue claro. En tanto, las modificaciones hemA y hemL confieren resistencia a Te03 2".
La complementación de la mutación sobre hemA en la cepa EM2 antes individualizada por su numero de deposito CChRGM, con el alelo silvestre, derivado de la cepa BW251 13, redujo la resistencia a Te03 2". A la inversa, cuando se introduce el alelo hemA [31 E] en una cepa isogénica silvestre, no recapitula la resistencia observada en la cepa EM2, indicando que el fondo genético es importante para la resistencia observada a Te03 2".
Respecto a las mutaciones sobre hemL, no fue posible incorporar el alelo silvestre en la cepa EM2 antes individualizada por su numero de deposito CChRGM, o introducir el alelo /rem/_[1 18V] en la cepa BW251 13; no obstante, los resultados antes expuestos muestran que alterar los niveles de ALA y/o hemo resulta muy relevante para incrementar la resistencia a Te03 2". Entonces, las mutaciones de hemA y hemL en la cepa EM2 antes individualizada por su numero de deposito CChRGM, no causan una pérdida de función, por cuanto mutantes nulas en dichos genes requieren la adición de ALA exógeno para crecer y no pueden sintetizar grupos hemo.
Sin embargo, los niveles de ALA y hemo fueron reducidos en las cepas que comprenden las versiones mutantes en dichas enzimas, lo que indica que las mutaciones en hemA, y probablemente también en hemL, son responsables de la disminución en los niveles de ALA y grupos hemo, lo que a su vez incrementa la resistencia a Te03 2".
Además, usando una colección de mutantes individuales de E. coli en busca de deleciones que podrían resultar en una mayor o menor resistencia a Te03 2", se encontró que mutantes de deleción en 377 y 130 genes mostraron un incremento o disminución de al menos 3 veces en el crecimiento luego de la exposición a Te03 2", respectivamente.
Las mutantes más sensibles a Te03 2" mostraban un enriquecimiento de genes implicados en la ruta de movilidad, la actividad catalasa disminuyó 5 veces en la cepa EM2 antes individualizada por su numero de deposito CChRGM, respecto a la cepa silvestre y no cambió con la exposición a H202 o a Te03 2", mientras que la actividad superóxido dismutasa, Te03 2" reductasa y los niveles de tioles fueron similares en ambas cepas. La cepa EM2 antes individualizada por su numero de deposito CChRGM, fue también más sensible a H202 respecto a la cepa BW251 13. Además, se observó que la adición de ALA al medio de cultivo restauró la actividad catalasa en la cepa EM2 antes individualizada por su numero de deposito CChRGM, a los niveles de la cepa silvestre, indicando que la actividad reducida fue debida a bajos niveles de grupos hemo. Entonces, no habría una correlación directa entre los niveles de tioles, ROS y la resistencia a Te03 2".
Entre las mutantes por deleción que presentaban mayores niveles de resistencia a Te03 2" se detectó enriquecimiento de genes implicados en la categoría de biosíntesis de cofactores, y en la ruta del metabolismo de clorofila y porfirina. En ambos casos, las mutantes incluían deleciones de genes implicados o con un rol putativo en la biosíntesis de grupos hemo, principalmente hemN y hemY, lo que incrementa la resistencia a Te03 2".
Al analizar la inactivación de genes río abajo de hemA y hemL también se incrementaba la resistencia a Te03 2". La resistencia de las cepas mutantes AhemF y AhemN fue confirmada y estas pudieron crecer en medio que contenía hasta 2 y 4 μg/mL de Te03 2", respectivamente.
Luego, inactivando enzimas de la biosíntesis de grupos hemo, y limitando la disponibilidad de sustratos para los últimos pasos de dicha ruta, se incrementa la resistencia a Te03 2".
También se encontró que Te03 2" induce la acumulación de intermediarios en la biosíntesis de grupos hemo al cuantificar los niveles de copro III y protoporfirina IX en células expuestas a Te03 2".
Para demostrar que ALA potencia la toxicidad de Te03 2", se determinó si la cepa EM2 antes individualizada por su numero de deposito CChRGM, adquiere al menos parte de la resistencia a Te03 2" mediante la disminución de los niveles de ALA, lo que indicaría que la adición de ALA al medio de cultivo podría dejar sin efecto las mutaciones en hemA y hemL, y disminuir la resistencia a Te03 2". Para comparar de manera directa el efecto de ALA en el crecimiento de las cepas en estudio, se incrementó la concentración de Te03 2" a niveles de 400 μςΛηί. La adición de concentraciones sub-letales de ALA (25 μς/ηιί) al medio de crecimiento sensibilizó una cepa (EM2) a Te03 2" y disminuyó su viabilidad celular a niveles indetectables luego de 180 minutos de exposición. Por el contrario, las mismas células crecidas en la ausencia de ALA y expuestas a la misma cantidad de Te03 2" se mantuvieron viables aun luego de 24 h. En ambas cepas se observó lo mismo.
Con ello, ALA potencia el efecto tóxico de Te03 2" ya sea en cepas sensibles o resistentes a telurito. De hecho, la cantidad de Te03 2" necesaria para inhibir el crecimiento fue menor cuando ALA estuvo presente, independiente de si las células fueron crecidas con anterioridad en medio con ALA o si ALA y Te03 2" fueron adicionados al mismo tiempo.
También se determinó que el Te03 2" mata células de E. coli debido a la acumulación de intermediarios de la biosíntesis de hemo, principalmente proto IX, y que la adición de ALA potencia dicho efecto.
Finalmente, se determinó que el efecto citotóxico de la combinación de Te03 2" y ALA era extensivo a microorganismos en general, para ello se crecieron cepas de Salmonella typhimuríum, S. typhi, Klebsiella pneumoniae y Pseudomonas aeruginosa en medio mínimo (M9) con distintas concentraciones de Te03 2", y en presencia o ausencia de ALA. Ejemplo de realización 1. Mutaciones en los genes hemA y hemL incrementan la resistencia a Te03 2 mediante la disminución de los niveles de ácido delta-aminolevulínico.
Se desarrollaron experimentos de evolución dirigida para aislar mutantes espontáneas de E. coli resistentes a Te03 2" que presenten un crecimiento robusto en medio Luria Bertani (LB) que contiene concentraciones crecientes de Te03 2" hasta 400 μg/mL (Fig 1 A). A partir de dichos ensayos se aislaron cepas clónales desde cultivos evolucionados mediante siembra en placas LB y seleccionando colonias desde cada día para estudios adicionales. Colonias aisladas fueron ensayadas respecto a su resistencia a Te03 2" en placas con concentraciones crecientes del metal (Fig 1 B, Fig 1 D), y una cepa con alta resistencia (400 μg mL, cepa EM2) fue seleccionada para secuenciamiento (Tabla 1 ). En paralelo, la cepa silvestre BW251 13 también fue secuenciada.
Tabla 1. Cepas usadas en este estudio
Figure imgf000028_0001
K.A., Tomita, M., Wanner, B.L. & Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst Biol.2, 2006.0008 (2006). A partir de los resultados de secuenciación, se observó que distintas mutaciones se acumulan (Tabla 2). Se seleccionó para un estudio más detallado la cepa EM2, dado que tolera altos niveles de Te03 2" tanto en medio LB (hasta 400 μςΛηΙ., Fig 1 B) como en medio M9 suplementado con glucosa 0,2% (hasta 100 μg mL, Fig 1 C), a niveles comparables con otros organismos que son considerados resistentes al metaloide (Arenas, F.A., Pugin B., Henríquez, N.A., Arenas-Salinas, M.A., Díaz-Vásquez, W.A., Pozo, M.F., Muñoz, C.M., Chasteen, T.G., Pérez-Donoso, J.M. & Vásquez, C.C. Isolation, Identification and characterization of tellurite hyper-resistant, tellurite-reducing bacteria from Antárctica. Polar Science 8, 40-52 (2014)). A menos que otra cosa se indique, todos los experimentos subsecuentes fueron realizados en medio M9 suplementado con 0,2% de glucosa (referido en adelante como M9), para evitar posible quelación de Te03 2" por componentes presentes en el medio LB, lo cual podría enmascarar el efecto del metal, como se ha observado para otros metales (Macomber, L. & Imlay, J.A. The iron-sulfur clusters of dehydratases are primary intracellular targets of copper toxicity. Proc. Nati. Acad. Sci. 106, 8344-8349 (2009)). De esta manera, se observó que las mutaciones encontradas en la cepa EM2 antes individualizada por su numero de deposito CChRGM, afectan genes codificantes para proteínas de varias rutas, incluyendo transcripción (rpoD), respuesta al estrés de membrana (pspF), síntesis de ácido delta-aminolevulínico (hemA y hemL), y la proteína hipotética YigE (Tablas 1 y 2). La resistencia conferida por las mutaciones en rpoD y pspF probablemente actúan induciendo reprogramación transcripcional y mediante la mejora en el efecto del Te03 2" en la membrana de E. coli, respectivamente (Alper, H. & Stephanopoulos, G. Global transcription machinery engineering: a new approach for improving cellular phenotype. Metab. Eng. 9, 258-267 (2007); y Jovanovic, G., Weiner, L. & Model, P. Identification, nucleotide sequence, and characterization of PspF, the transcriptional activator of the Escherichia coli stress-induced psp operon. J. Bacteriol. 178, 1936-1945 (1996)). El rol de la proteína YigE en la resistencia a Te03 2" no es clara. Las otras dos modificaciones que confieren resistencia a Te03 2" están directamente relacionadas con la biosíntesis del grupo hemo: hemA y hemL codifican para una glutamil tRNA reductasa y una glutamato semi-aldehído aminotransferasa, respectivamente, los que catalizan la síntesis de ácido delta-aminolevulínico (ALA), precursor de esta ruta.
Tabla 2. Mutaciones encontradas en la cepa EM2
Figure imgf000030_0001
Se observó que la complementacion de la mutación sobre hemA en la cepa EM2 antes individualizada por su numero de deposito CChRGM, con el alelo silvestre del mismo gen, derivado de la cepa BW251 13, reduce la resistencia a Te03 2" (Fig 6B). A la inversa, cuando se introduce el alelo hemA [31 E] en una cepa isogénica silvestre no recapitula la resistencia observada en la cepa EM2 antes individualizada por su numero de deposito CChRGM, (Fig 6B), indicando que el fondo genético es importante para la resistencia observada a Te03 2". Respecto a las mutaciones sobre hemL, no fue posible incorporar el alelo silvestre en la cepa EM2 antes individualizada por su numero de deposito CChRGM, o introducir el alelo hemL 18V] en la cepa BW251 13; no obstante, los resultados antes expuestos muestran que alterar los niveles de ALA y/o hemo resulta muy relevante para incrementar la resistencia a Te03 2". Entonces, las mutaciones de hemA y hemL en la cepa EM2 antes individualizada por su numero de deposito CChRGM, no causan una pérdida de función, por cuanto mutantes nulas en dichos genes requieren la adición de ALA exógeno para crecer y no pueden sintetizar grupos hemo (Avissar, Y.J. & Beale, S.l. Identification of the enzymatic basis for delta-aminolevulinic acid auxotrophy in a hemA mutant of Escheríchia coli. J. Bacteriol. 171 , 2919-2924 (1989); llag, L.L. & Jahn, D. Activity and spectroscopic properties of the Escheríchia coli glutamate 1 -semialdehyde aminotransferase and the putative active site mutant K265R. Biochemistry 31 , 7143-7151 (1992)).
Sin embargo, los niveles de ALA y hemo fueron reducidos en las cepas que codificaban para las versiones mutantes en dichas enzimas. En la cepa EM2 antes individualizada por su numero de deposito CChRGM, y la cepa silvestre con una versión mutante del gen hemA (A31 E), los niveles de ALA fueron 13% y 55% respecto a los observados para la cepa silvestre (BW251 13), y los niveles de grupos hemo eran 40% y 60%, respectivamente (Fig 1 D, Fig 7C). Lo anterior indica que mutaciones en hemA, y probablemente también en hemL, son responsables de la disminución en los niveles de ALA y grupos hemo, lo que a su vez incrementa la resistencia a Te03 2". Ejemplo de realización 2. Análisis químico genómico de la toxicidad del Te03 2".
Como una aproximación complementaria para entender la toxicidad de Te03 2", se desarrolló un análisis usando una colección de mutantes individuales de E. coli - dicha colección se detalla en la tabla 3 siguiente (Otsuka, Y. et al. GenoBase: comprehensive resource datábase of Escheríchia coli K-12. Nucleic Acids Res. 43 (Datábase issue): D606-17 (2015)) en busca de deleciones que podrían resultar en una mayor o menor resistencia a Te03 2". De esta manera se ensayó una colección de aproximadamente 6000 mutantes por deleción en presencia de Te03 2" o de un control (DMSO) en medio LB. La secuenciación de códigos de barra específicos de cada cepa permitió seguir el desarrollo de cada cepa mutante en presencia de Te03 2" respecto al control (Fig 2A).
Nombre de Nombre de Nombre de Numero gen Número gen Numero gen b delecionado b delecionado b delecionado number yjfl b4181 yicC b3644 leuO b0076 yifE b3764 ybgK b0712 panD b0131 yifE b3764 ygeG b2851 metN b0199 hdfR b4480 panC b0133 tsr b4355 dsbC b2893 speE b0121 spy bl743 prpD b0334 yfdL #N/A ybeZ b0660 yahB b0316 smg b3284 yafM b0228 prpD b0334 mprA b2684 yjjK b4391 metN b0199 yqfE #N/A gits b3653 plsB b4041 ulaG b4192 ypjA b2647 yadD b0132 ydbK bl378 galE b0759 yqjB b3096 ynfN bl551 pflB b0903 yahJ b0324 gss #N/A xdhD b2881 prpE b0335 hcr b0872 yagW b0290 trmA b3965 rhaR b3906 cutA b4137 araG bl900 hemN b3867 yieN #N/A ydhV bl673 glnL b3869 ydbH bl381 yeiR b2173 yahG b0321 yacC b0122 yjhA #N/A hemY b3802 fepE b0587 yafL b0227 yagG b0270 ypjB #N/A yafD b0209 yahD b0318 dgsA bl594 ygcE b2776 hycG b2719 hemX b3803 ybhQ b0791 hofB b0107 ycfQ bllll agaW #N/A yieM #N/A fpr b3924 ydiO bl695 ybjT b0869 appB b0979 uspE bl333 glnG b3868 pcnB b0143 mdtH bl065 yidP b3684 pepP b2908 ycgK bll78 yhdL b4550 mtID b3600 ylbA b0515 fnr bl334 ydeH bl535 yafS b0213 bcsF b3537 yfjY b2644 ogt bl335 yadL b0137 ycfR #N/A araJ b0396 manA bl613 yfjH b2623 ugpC b3450 bacA b3057 yfdO #N/A rnhB b0183 bcp b2480 ilvE b3770 yidX b3696 ybjG b0841 sohA b3129 sdaA bl814 ydaS bl357 ygeF #N/A yg¡F b3054 yecF bl915 YjhT #N/A rfaL b3622 yjiJ b4332 yfiP b2583 bglH b3720 araE b2841 mdtH bl065 nadC b0109 kdpC b0696 ybiR b0818 prpC b0333 actP b4067 hlpA #N/A yegT b2098 xapB b2406 yodA bl973 rimJ bl066 rnk b0610 ydcA bl419 uvrY bl914 sufE bl679 acnA bl276 aroP b0112 cid b2027 yfcZ b2343 ykgL b0295 rhtB b3824 yfiF b2581 cueO b0123 yfeA b2395 ycfL bll04 yphB b2544 ¡ntF b0281 solA bl059 ppdD b0108 mazG b2781 dinJ b0226 yagS #N/A dicB bl575 yjiN b4336 yjj b4394 metF b3941 yfiH b2593 ydfZ bl541 yneG bl523 yagZ #N/A yfbS b2292 nanT b3224 speG bl584 yjeO b4158 nrfE b4074 modC b0765 yeeD b2012 yfcX #N/A sgcE b4301 yeaA #N/A dmsB b0895 ibpB b3686 wzzE b3785 ydbH bl381 flu b2000 sufC bl682 crr b2417 yafO b0233 cusR b0571 yjgJ b4251 glk b2388 aphA b4055 srmB b2576 tktB b2465 ndh bll09 yjbF b4027 pcm b2743 ansB b2957 ymjA bl295 yjiG b4329 aroM b0390 ycgZ bll64 nlpD b2742 yiaT b3584 crr b2417 slt b4392 bioB b0775 yjeB #N/A yciG bl259 yfdH #N/A exo #N/A kduD b2842 uspG b0607 ccmG b2195 glgP b3428 rstA bl608 yjcD b4064 yidl b3677 envZ b3404 tatE b0627 ydhU bl670 argG b3172 gatZ b2095 yphF b2548 chaA bl216 garR b3125 trmC #N/A yagW b0290 dadA bll89 uvrB b0779 eutT b2459 fiu b0805 yfaT b2229 yfhK #N/A nikD b3479 ybil b0803 yadC b0135 ybhl b0770 ygcH #N/A cysC b2750 ilvH b0078 frwB b3950 ykiA #N/A ebgA b3076 fsaB b3946 pdhR b0113 ydaF b4527 uidB bl616
IpxA b0181 torR b0995 cdaR b0162 yafP b0234 mrcB b0149 aldB b3588 dsdX b2365 bar A b2786 fucR b2805 yhfS b3376 yhiD b3508 yoeA #N/A cbrA b3690 ygcG b2778 yliE b0833 dmsD bl591 mobB b3856 yebW bl837 ycfX #N/A ykgl b0303 pepQ b3847 phnH b4100 yfiL b2602 yfjP b2632 fecl b4293 ybgK b0712 yjgL b4253 panB b0134 ynjF bl758 yfdC b2347 rdgC b0393 sgrR b0069 ybiS b0819 cobB bll20 rssB bl235 ilvl b0077 puuA bl297 garR b3125 asnA b3744 rfaZ b3624 gloA bl651 hofC b0106 hfID bll32 arpA b4017 yliJ b0838 yjiR b4340 mdtC b2076 ybgH b0709 prpB b0331 ycjX bl321 yadB b0144 yfaU b2245 cobT bl991 ycaP b0906
¡IvY b3773 mraW #N/A yagL b0278 yebN bl821 ygdR b2833 fadA b3845 ycgV bl202 ydfB bl572 yheO b3346 dcuR b4124 narW bl466 y¡¡Q b3920 yicS b4555 mmuM b0261 dinB b0231 trkH b3849 frwD b3953 feoA b3408 yceH bl067 recE bl350 yjhS b4309 modB b0764 feaR bl384 yhcN b3238 phnK b4097 recD b2819 yagZ #N/A ycaJ #N/A yhjC b3521 ydaT bl358 guaD b2883 actP b4067 bioA b0774 potB bll25 yqaE b2666 sbcD b0398 yjfl b4181 yg¡c b3038 hyfR b2491 cycA b4208 ya iA b0389 dld b2133 yfjW b2642 fhuB b0153 stpA b2669 yfcT #N/A ygeF #N/A ycgE bll62 yehK b4541 araF bl901 erfK bl990 bglB b3721 yagB b0266 yfjR b2634 cbrC b3717 hcr b0872 galK b0757 panD b0131 bcsE b3536 ycdG #N/A aroL b0388 yfdX b2375 yfiD b2579 dsdA b2366 IpIA b4386 yfeK b2419 yehC b2110 yahD b0318 nanE b3223 zitB b0752 ynfL bl595 ybhF b0794 tfaS #N/A hyfC b2483 dkgB b0207 eutB b2441 oppB bl244 wcaJ b2047 yjgM b4256 ligT b0147 yqgA b2966 sdiA bl916 ydhM #N/A yaiP b0363 yfdC b2347 ygcQ b2769 yjdl b4126 yobA bl841 yobG #N/A yrfG b3399 emrB b2686 sgcQ b4303 ygfF b2902 intE bll40 rfbD b2040 fhuA b0150 ykgG b0308 yfiQ b2584 yecG #N/A galF b2042 dkgB b0207 yfiC b2575 ykfl b0245 dmsC b0896 sufB bl683 yagA b0267 yafS b0213 ypdG #N/A malG b4032 tauD b0368 galS b2151 ybgA b0707 ycaJ #N/A dmsA b0894 yjaG b3999 garL b3126 tdcA b3118
ItaE b0870 pro A b0243 ilvA b3772 recN b2616 nikC b3478 yagT #N/A pepD b0237 argC b3958 ymjA bl295 dgoR b4479 hyfF b2486 modA b0763 yahO b0329 ybbD #N/A hcaB b2541 yiaO b3579 ycil bl251 dhaL bll99 betB b0312 uxuR b4324 ansA bl767 yhgE b3402 ygiN b3029 yebE bl846 pdxY bl636 tas b2834 uvrC bl913 hokD bl562 aidB b4187 xylE b4031 nirD b3366 ansB b2957 pmbA b4235 rpsT b0023 guaC b0104 hybB b2995 yiiX b3937 modC b0765 cpsB b2049 yidQ b3688 yihP b3877 gc P b2903 rnb bl286 hupA b4000 zitB b0752 intS b2349 sulA b0958 afuB #N/A yghS b2985 hha b0460 yggs b2951 cadB b4132 yqaE b2666 yfgF b2503 yajB #N/A ykgK #N/A deoA b4382 yfbG #N/A yfhB b2560 gspH b3329 mutS b2733 ilvA b3772 yedJ bl962 yecG #N/A yeaE bl781 sufD bl681 sgrR b0069 ydjR #N/A yecS bl918 ppdD b0108 moaC b0783 ygcF b2777 yifB b3765 ttdA b3061 narJ bl226 yoaC bl810 nikB b3477 ydeR bl503 tsr b4355 ymgA bll65 ybeM #N/A yihR b3879 ygbT b2755 mutS b2733 agaR b3131 yeiP b2171 yjhB b4279 eaeH #N/A yajl b0412 rstA bl608 cobB bll20 yhiQ b3497 melB b4120 ygcK #N/A ygaM b2672 yjeP b4159 php b3379 ykgH b0310 ybeL b0643 cobU bl993 ddlB b0092 yjeB #N/A ompC b2215 yaeQ b0190 envZ b3404 ybiX b0804 yajO b0419 ssnA b2879 ygeM #N/A puuR bl299 ubiG b2232 ampE bOlll wcal b2050 ybcJ b0528 treB b4240 aaeX b3242 hybF b2991 argF b0273 rhtC b3823 ycdC #N/A ydhB bl659 mdoB #N/A fucP b2801 spy bl743 yifO #N/A alsB b4088 evgA b2369 yhaL b3107 crl b0240 ytfE b4209 eutL b2439 xylH b3568 yhaO b3110 mog b0009 marR bl530 garP b3127 srIR b2707 mltD b0211 phoB b0399 fur b0683 fimZ b0535 pcm b2743 aroL b0388 NgB b3647 ykfB b0250 hyfl b2489 ybaK b0481 smf b4473 yedX #N/A ymjB #N/A hybC b2994 yibA b3594 yoeE #N/A upp b2498 gatC b2092 ykgH b0310 torl b4501 yafC b0208 yfeY b2432 ybbY b0513 csdA b2810 hsdR b4350 hdeB b3509 yfaY b2249 moaA b0781 aroM b0390 xylF b3566 ybcM b0546 gshA b2688 dgoK b3693 yjeO b4158 yedO #N/A yiaV b3586 yjdK b4128 rtcR b3422 yjgD #N/A nlpB #N/A hyfC b2483 frsA b0239 bioA b0774
IdhA bl380 gpp b3779 glcD b2979
IsrF bl517 lysC b4024 Irp b0889 malM b4037 nlpE b0192 yqiG #N/A ypjA b2647 sgbH #N/A eutP b2461 yeeR b2001 yqcB #N/A yqgE b2948 yneJ bl526 yjgF b4243 elaD b2269 ecpD b0140 cls bl249 npr b3206 yafD b0209 gltP b4077 trpL bl265 idnR b4264 ydiM bl690 yciV bl266 yidG b3675 yddH bl462 yedV bl968 rhaD b3902 mdoC #N/A mtr b3161 ybiR b0818 yaeP b4406 mpl b4233 yhdA #N/A sfmC b0531 menA b3930 ydjG bl771 frIB b3371 hchA bl967 yihU b3882 yciK bl271 yg¡Q b4469 ymfL bll47 yjiT #N/A yeaD bl780 narW bl466 entB b0595 btuD bl709 yfcX #N/A yfcG b2302 cysZ b2413 fecD b4288 yehC b2110 ydbL bl383 sufl #N/A yjgD #N/A yegU b2099 mglA b2149 codA b0337 rffG b3788 yiaM b3577 ssuB b0933 lysS b2890 yfbE #N/A ygbK b2737 ybeU b0648 yacH b0117 moeB b0826 fecE b4287 yedE bl929 nrdl b2674 mutY b2961 sbp b3917 yhfT b3377 NvG b3455 yebZ bl840 aidB b4187 frIR b3375 yhaH b3103 ynjF bl758 yoeF #N/A yahA b0315 livH b3457 ycgE bll62 yagS #N/A gloB b0212 abgR bl339 ydhL bl648 yehY b2130 ybjJ b0845 yjfY b4199 wzc b2060 sgcC b4304 yefM b2017 yidF b3674 ydfC bl573 pnp b3164 yjbB b4020 dgoT b3691 ydjQ #N/A fhuD b0152 xthA bl749 sufS bl680 hemY b3802 glvB #N/A yqaD #N/A yfgG b2504 yieG #N/A oppC bl245 ykfA b0253 ynaJ bl332 hslO b3401 yghQ #N/A gshA b2688 yjiY b4354 mltC b2963 tdcR b3119 btuR bl270 torZ bl872 dbpA bl343 yg¡T b3021 ampG b0433 yidL b3680 yicC b3644 adhE bl241 sseB b2522 yfhJ #N/A yfaY b2249 dsdA b2366 prpE b0335 ygeY b2872 yheU b3354 thiE b3993 bcsC b3530 ydiA bl703 pldA b3821 cobU bl993 kdpB b0697 ydjL bl776 ycgX bll61 mraZ b0081 yagT #N/A yjhB b4279 pppA b2972 icdC #N/A frwC b3949 kbaZ b3132 yiiT #N/A gatY b2096 rbbA b3486 ydeS bl504 gspD b3325 ymfA bll22 ycfH bllOO tdcB b3117 yieN #N/A ydhF bl647 dppB b3543 yehT b2125 yagY #N/A ilvD b3771 cvpA b2313 yegE b2067 panE b0425 yoaF bl793 nagD b0675 mgtA b4242 yagl b0272 ybcL b0545 udk b2066 yfdX b2375 yhhF #N/A xapA b2407 csgE bl039 yeiG b2154 uhpB b3668 nfsA b0851 yfcY #N/A rluB bl269 dmsB b0895 cysP b2425 ybiP b0815 phnP b4092 sgcB b4565 yhiN b3492 ynjH bl760 talA b2464 ybbC b0498 rnk b0610 ypdF b2385 dedD b2314 yidH b3676 ychJ bl233 ybgC b0736 wcaA b2059 ygcU b4463 fabF bl095 rnd bl804 glpE b3425 yfeG #N/A yahE b0319 phnF b4102 yghu b2989 pflA b0902 pcnB b0143 yqcA b2790 uxaA b3091 cspH b0989 phnM b4095 ypfG b2466 phnD b4105 gntX b3413 yaiS #N/A garP b3127 yeeO bl985 nrdl b2674 ybhN b0788 ycgY bll96 pdxK b2418 dinl bl061 paaH bl395 mntR b0817 yliB #N/A betT b0314 ydaY #N/A rcsF b0196 afuC b0262 sanA b2144 ilvB b3671 dsbG b0604 uvrA b4058 sgcE b4301 yeiC #N/A purN b2500 metB b3939 glcE b4468 yafP b0234 yqcB #N/A yjhl b4299 yahM b0327 thil b0423 phnO b4093 eutG b2453 nikC b3478 yneJ bl526 mdtF b3514 yedK bl931 pyrL b4246 rph #N/A queA b0405 dmsA b0894 ccmE b2197 yadR #N/A sgcR b4300 yibF b3592 greB b3406 yfeA b2395 mdtE b3513 stfE #N/A ygeP #N/A gudD b2787 yjgx #N/A yagR #N/A torR b0995 rhaD b3902 ybbC b0498 rtn b2176 yecE bl868 ybgE b0735 acrR b0464 yqeG b2845 yjhl b4299 znuB bl859 yqjH b3070 yadl b0129 ygeQ #N/A ybcH b0567 ygeP #N/A ybdG b0577 gidB #N/A yeiM #N/A topB bl763 yaiT #N/A kdgT b3909 kbl b3617 red bl349 ybiX b0804 dppC b3542 yjhQ b4307 ymgF b4520 yagE b0268 yafT b0217 rumA b2785 arpA b4017 phoE b0241 yqeF b2844 nrfE b4074 cytR b3934 yqiH b3047 pck b3403 gcvR b2479 grxA b0849 tpr bl229 citA #N/A yneL #N/A thiS b4407 yjfF b4231 hycC b2723 rbsK b3752 yfeT #N/A yedA bl959 priC b0467 ykgG b0308 ydeA bl528 inaA b2237 nrdF b2676 yehD b2111 yfcU #N/A yehL b2119 ybhD b0768 NvF b3454 yfgH b2505 ygiF b3054 yqaA b2689 tdcC b3116 yjgN b4257 yadN b0141 yqjc b3097 evgS b2370 yjiO #N/A ydeN bl498 nudC b3996 yahA b0315 mmuP b0260 artl b0863 icIR b4018 lysC b4024 xseB b0422 nrfG b4076 ycdR #N/A tesB b0452 yihD b3858 ycfM bll05 thiM b2104 amiB b4169 yzfA #N/A atoD b2221 ykfC #N/A yfdY b2377 ptr #N/A cysC b2750 sppA bl766 maoC bl387 yfcG b2302 ygaD b2700 cfa bl661 fixX b0044 pdxY bl636 lit bll39 yoal bl788 bglA b2901 yohH #N/A idnO b4266 citX b0614 ycgL bll79 syd b2793 betA b0311 rarD b3819 ybjM b0848 ptsG bllOl yebK bl853 ygcL #N/A ysgA b3830 yoeA #N/A btuF b0158 yrbA b3190 pflB b0903 yejL b2187 ycgl #N/A yffH #N/A yjeH b4141 ytfP b4222 yebR bl832 hybD b2993
Ion b0439 yebQ bl828 yliK #N/A yrhA #N/A mlrA b2127 pepD b0237 rpiB b4090 yejE b2179 maeB b2463 rraA b3929 ymfB #N/A yggP b4465 yhdL b4550 yfiQ b2584 ymfJ bll44 ygi b3038 yehL b2119 potF b0854 yaiV b0375 yiaM b3577 dinF b4044 ygho #N/A osmB bl283 yadC b0135 meIR b4118 ompR b3405 bolA b0435 hinT bll03 btuD bl709 yciT bl284 alID b0517 manA bl613 yqeK b2849 yfaW b2247 exoX bl844 fliT bl926 yedZ bl972 elbA #N/A maa b0459 sohB bl272 dgoR b4479 yibQ b3614 yddK #N/A artJ b0860 pncB b0931 yciF bl258 yfiP b2583 ycgB bll88 ykiA #N/A yigB b3812 yghS b2985 cobS bl992 yfiK #N/A dipZ #N/A malG b4032 cdaR b0162 dgoK b3693 aqpZ b0875 focB b2492 yjhX b4566 yaiL b0354 livG b3455 ydhX bl671 ydaE b4526 yjhV #N/A ydfC bl573 tfaD #N/A prfH #N/A rhtC b3823 dedA b2317 yhfY b3382 cobC b0638 hha b0460 cbpM b0999 nrdG b4237 uidA bl617 fecA b4291 ddlB b0092 hdhA bl619 hisD b2020 yaiW b0378 usg b2319 IsrC bl514 dsbC b2893 argF b0273 yebC bl864 yffB b2471 yecl #N/A argA b2818 yfcD b2299 ybbW b0511 ytfH b4212 yghO #N/A yiaC b3550 yehR b2123 ydhR bl667 yaiL b0354 rhaA b3903 malí bl620 ychA bl214 yiaT b3584 glf b2036 rnr b4179 ydjK bl775 ybfO #N/A yafX b0248 paaB bl389 yafW b0246 malY bl622 yeiP b2171 ybfQ #N/A cheB bl883 ygjo #N/A yiiR b3921 narJ bl226 cysN b2751 ypdH #N/A yhjY b3548 ytfA #N/A mog b0009 gatZ b2095 zupT b3040 trpR b4393 maa b0459 ccmC b2199 creA b4397 gadE b3512 ygfi b2921 yfcM b2326 yhfA b3356 yhhY b3441 yraR b3152 yejL b2187 yhdU b3263 fnr bl334 glpX b3925 yjhD #N/A exoX bl844 hcaD b2542 yagR #N/A NvM b3456 yhjD b3522 speE b0121 ynfO b4533 yifN #N/A ypdl b2376 hinT bll03 yifN #N/A yehS b2124 modB b0764 dcuR b4124 nlpD b2742 tyrP bl907 yqcC b2792 ytfQ b4227 yfhH b2561 ydeV #N/A cysl b2763 srID b2705 yjhT #N/A yeiJ #N/A yqjB b3096 astD bl746 yceB bl063 rof b0189 yceO bl058 napD b2207 yfiD b2579 ydfD bl576 dmsD bl591 ompW bl256 yejK b2186 copA b0484 setC b3659 hycB b2724 ivy b0220 trpA bl260 yhaM b4470 pfID b3951 yqjF b3101 ydaT bl358 kdpB b0697 poxB b0871 ybjS b0868 ybjR #N/A xylB b3564 ymfA bll22 ycgF bll63 rhaS b3905 rpiR b4089 ycdL #N/A mutY b2961 hycF b2720 yohM #N/A clpA b0882 ybhP b0790 yfaZ b2250 yeiS b2145 mhpR b0346 ybfB b0702 yhaB b3120 hrpA bl413 epd b2927 pfIC b3952 mraZ b0081 paaY bl400 potC bll24 ygfM b2880 gudP b2789 ybfO #N/A yhcM b3232 ygjQ b3086 yieK b3718 gadW b3515 nadC b0109 yphB b2544 zntA b3469 asnC b3743 yebV bl836 yfcV b2339 emrD b3673 yjjB b4363 yedR bl963 holC b4259 rstB bl609 rnr b4179 chaA bl216 yael b0164 ydil bl686 yaiZ b0380 yahO b0329 yjjJ b4385 ypfN b4547 ydfX #N/A yigG b3818 acs b4069 ygaX #N/A yieG #N/A tynA bl386 dem bl961 yjbR b4057 ygjF #N/A ypfl #N/A ecpD b0140 rhaS b3905 cspA b3556 deoB b4383 ynbB bl409 wcaE b2055 sieB bl353 mtgA b3208 ddpA bl487 yegP b2080 nudH #N/A guaD b2883 mhpC b0349 phnC b4106 ydhU bl670 mbhA #N/A fhuD b0152 pro A b0243 ydgJ bl624 yjaB b4012 rhsD b0497 yüQ b3920 ybdN b0602 ygj b3083 cls bl249 ygfM b2880 yfbN b2273 yagU b0287 grxA b0849 yeaB #N/A thiE b3993 yqaB b2690 yneH bl524 ybiM #N/A gltK b0653 kdpE b0694 clpX b0438 abgB bl337 ytfB b4206 ymgG bll72 red b2892 mgsA b0963 kdpA b0698 yciQ bl268 abrB b0715 mdaB b3028 ykgJ b0288 znuA bl857 gadW b3515 ompL b3875 ybdH b0599 yqeK b2849 yaiF #N/A ygel b2853 yhjB b3520 sgbU #N/A mtgA b3208 smf b4473 yidB b3698 fhuE bll02 yigA b3810 yafJ b0223 frIA b3370 yfcO b2332 yfhJ #N/A ybhH b0769 yfdO #N/A ybbV #N/A pncA bl768 yagQ #N/A yhiR b3499 yhaC b3121 kdsD b3197 yceA bl055 yhjA b3518 ybhS b0793 yrfD #N/A ymcE b0991 cysZ b2413 ydcM bl432 yhhH b3483 ycdM #N/A renD #N/A yegS b2086 ogrK b2082 yciN bl273 sanA b2144 aat b0885 ydiB bl692 sodC bl646 yg¡T b3021 ydcQ bl438 yidF b3674 yfdE b2371 ytfF b4210 ygbF b2754 ydjR #N/A mdlA b0448 ybjN b0853 pabB bl812 ybbB #N/A yjbQ b4056 ytfP b4222 yliE b0833 rtcR b3422 potH b0856 rfaK #N/A zntA b3469 uxaC b3092 yfj N #N/A yecO #N/A ygbT b2755 ychM bl206 ivbL b3672 yeeJ bl978 yg¡E #N/A ye ¡A b2147 ygiW b3024 yhjE b3523 yneE bl520 yegH b2063 fur b0683 gspG b3328 gigc b3430 ycgl #N/A yigz b3848 ydhV bl673 recE bl350 yeaA #N/A ybgE b0735 yedW bl969 yhjH b3525 ydaV bl360 asr bl597 rhIE b0797 yggJ #N/A nadB b2574 yfgD b2495 yqjH b3070 mdtA b2074 yoeF #N/A ygiU #N/A fimZ b0535 fadA b3845 yraL #N/A hcaT b2536 moaD b0784 nfo b2159 ugpQ b3449 xdhB b2867 yjdJ b4127 ygcl #N/A hlpA #N/A ybfC b0704 yhjV b3539 ykfl b0245 yjfZ b4204 puuP bl296 ygeH b2852 ybhG b0795 htgA #N/A yjjA b4360 ydgG #N/A ybhL b0786 yecR bl904 yrbB b3191 yqeH b2846 vsr bl960 damX b3388 yiaF b3554 pbl #N/A yjhR #N/A yqhG b3013 yqeC b2876 yzfA #N/A yohK b2142 gidB #N/A bcsA b3533 wzxC b2046 yaeQ b0190 ykgM b0296 yhiL #N/A yrfB #N/A entA b0596 ygaU b2665 csgE bl039 kdsC b3198 moaC b0783 rfbD b2040 hipA bl507 yagL b0278 hcaR b2537 alIR b0506 ygcB b2761 cspF bl558 cynX b0341 cspB bl557 macB b0879 yqaA b2689 cheY bl882 intF b0281 purN b2500 cysJ b2764 glvG #N/A xapR b2405 ybdR b0608 yajl b0412 ygfH #N/A uspF bl376 fruA b2167 bioF b0776 trxB b0888 gor b3500 ygdK #N/A leuD b0071 cusB b0574 cueR b0487 yehl b2118 yehZ #N/A yhdV b3267 dgoD b4478 ybaT b0486 yhbX b3173 ybiM #N/A ygeW b2870 yajB #N/A rfaY b3625 aldB b3588 glnH b0811 pdxK b2418 yhbE b3184 mobB b3856 bdm bl481 fabR b3963 yhcH b3221 ybfP b0689 yeaK bl787 ygbN b2740 yrhB b3446 yjcH b4068 gudX b2788 fbaB b2097 yoaA bl808 ugpA b3452 iadA b4328 citA #N/A ylaC b0458 ycaD b0898 yphH b2550 trmC #N/A radA b4389 yfaV b2246 glk b2388 hemN b3867 evgA b2369 yaiO b0358 ung b2580 srlB b2704 ybhL b0786 yqgc b2940 ampE bOlll yaiS #N/A phnG b4101 ya a A b0006 ptsN b3204 ydhW bl672 ydfE #N/A mlrA b2127 yegW b2101 yecR bl904 ybil b0803 menB b2262 yeiT b2146 ygjP b3085 fepE b0587 ynfO b4533 azoR bl412 sbp b3917 fimG b4319 rfbX b2037 cueR b0487 ygbF b2754 uidC bl615 ilvM b3769 ykgL b0295 yggx b2962 yohD b2136 yciE bl257 ycdB #N/A ybgL b0713 emtA bll93 ybiA b0798 ycgN bll81 ydcV bl443 hyfF b2486 ybfP b0689 yahL b0326 uxaA b3091 yoaH bl811 yaiC #N/A yfcP b2333 ycbQ b0938 smtA b0921 mdtG bl053 cutC bl874 tktB b2465 dgoA b4477 fdnG bl474 yicL b3660 eutH b2452 ygdD b2807 mntR b0817 ygcO b2767 paal bl396 yjaB b4012 emrB b2686 ygjH b3074 argA b2818 tdh b3616 yicN b3663 deaD b3162 lysU b4129 IsrG bl518 ygfs b2886 artP b0864 helD b0962 ybcM b0546 yecF bl915 ivy b0220 ydjJ bl774 hyfJ b2490 atoC b2220 fadL b2344 ansP bl453 rbsC b3750 ydaG bl355 fabR b3963 yjbO #N/A leuA b0074 pphB b2734 ydcN bl434 ybcH b0567 yagV b0289 polB b0060 ykgN #N/A yhjH b3525 yieM #N/A yneG bl523 glnP b0810 gadE b3512 dipZ #N/A ydhA #N/A trpD bl263 yghA b3003 ygjQ b3086 leuB b0073 yhiP #N/A yaiE b0391 hisC b2021 rpsT b0023 kbaZ b3132 yeaM bl790 rnhB b0183 yfjO b2631 slyA bl642 ygaT #N/A gadC bl492 deoR b0840 yfaT b2229 sfcA #N/A crcA #N/A yoaG bl796 ydhO bl655 ybcY #N/A mraW #N/A yjiN b4336 yacF b0102 ymcD #N/A ybaK b0481 yhfA b3356 yhfT b3377 ygjP b3085 hisH b2023 aroG b0754 hslO b3401 ydeJ bl537 yfjL b2628 yiaK b3575 cdh b3918 yjgW #N/A agaR b3131 yhfU b3378 ddpB bl486 gntP b4321 ylbG #N/A ypaA #N/A ynal bl330 hfq b4172 smg b3284 yhiJ b3488 ynbD bl411 pepE b4021 potE b0692 yeiA b2147 yigE b4482 eptB b3546 ygeX b2871 ygeQ #N/A atoA b2222 ycaL b0909 betB b0312 aaeR b3243 yhfX b3381 hyfG b2487 deoB b4383 ybjR #N/A ypfN b4547 yfgH b2505 hupA b4000 rseB b2571 maeB b2463 htrC #N/A ycjD bl289 yjdF b4121 yfhM b2520 apaG b0050 yibH b3597 ydhQ bl664 yfiK #N/A galK b0757 codA b0337 yfbR b2291 yheS b3352 zupT b3040 ybdD b4512 sucB b0727 yahK b0325 fruB b2169 frwD b3953 ansP bl453 upp b2498 cycA b4208 eutC b2440 yffH #N/A malP b3417 yceK bl050 dppB b3543 abgA bl338 recT bl349 yeiQ b2172 dcuB b4123 IsrD bl515 ydiB bl692 gph b3385 cybB bl418 glpG b3424 yiaU b3585 phnC b4106 yjcQ #N/A araF bl901 ccmF b2196 yihD b3858 yeaN bl791 ygbA b2732 ybgJ b0711 trpE bl264 endA b2945 yjiG b4329 zraR b4004 ygeM #N/A ycdK #N/A gatD b2091 yfgD b2495 mglA b2149 ynjC bl755 ydjE bl769 yliF b0834 ygaW b2670 yjiT #N/A trg bl421 ppx b2502 yjbB b4020 hypC b2728 gnd b2029 ymcE b0991 ybiV b0822 sgbE #N/A dinJ b0226 ydhJ bl644 ydfX #N/A yqeG b2845 ninE b0548 tag b3549 ydiL bl689 ykgJ b0288 ycaC b0897 ybhP b0790 ¡IvY b3773 ykfA b0253 yeeZ b2016 epd b2927 wbbl b2034 fliZ bl921 mppA bl329 yjhP b4306 yohK b2142 add bl623 narQ b2469 ydhK bl645 ¡IvD b3771 yg¡L b3043 mdtA b2074 ybgS b0753 ybfH #N/A smpA b2617 yiaW b3587 uhpA b3669 slyB bl641 mhpT b0353 yhgG #N/A ydiN bl691 ybgQ b0718 fixB b0042 yjbD b4023 fimG b4319 yeaW bl802 ampD bOHO pabB bl812 frdA b4154 ppdB b2825 yajO b0419 alIC b0516 yadE b0130 yqji b3071 yciH bl282 yagM b0279 yhiD b3508 evgS b2370 ydjE bl769 bcsC b3530 yjcE b4065 ypdH #N/A ¡aaA b0828 srlA b2702 ydeP bl501 rsxA bl627 aaeA b3241 ydhJ bl644 otsA bl896 cysK b2414 red b2892 argG b3172 ygjG #N/A trmH b3651 yrfC #N/A yjjM b4357 yaaJ b0007 frvA b3900 apaH b0049 yciW bl287 hsIR b3400 emtA bll93 ydfW #N/A slp b3506 frID b3374 yecN bl869 mglB b2150 ymgB #N/A yqiC b3042 soxR b4063 cysP b2425 tdcA b3118 paaF bl393 yehD b2111 spr b2175 ygjM b3082 ybjQ b0866 yaeB b0195 ybhN b0788 uxaB bl521 yigL b3826 oppC bl245 talA b2464 ybbO b0493 aegA b2468 malK b4035 yeaP bl794 pioO #N/A yhiN b3492 exbD b3005 ycaQ b0916 ybjK b0846 yjjN b4358 ybeQ b0644 argP b2916 hepA b0059 yhfX b3381 ykgl b0303 ung b2580 ydeO bl499 sstT b3089 gntR b3438 ygcS b2771 hycH b2718 ydcW #N/A xdhC b2868 nikR b3481 yiiG b3896 abgT bl336 gcd b0124 yohN b2107 qor #N/A acrE b3265 ynfP #N/A phnD b4105 yedV bl968 pepN b0932 ygdD b2807 yqhA b3002 yhjX b3547 fucl b2802 yeaB #N/A srlE b2703 bipA #N/A yebZ bl840 ampH b0376 csiR b2664 idnK b4268 rssB bl235 fadD bl805 yfcO b2332 yeiL b2163 yehW b2128 creC b4399 ybiA b0798 ycfR #N/A dcuD b3227 ygcW b2774 intB #N/A ykfH b4504 yiaW b3587 yidX b3696 wcal b2050 ytjC b4395 chaB bl217 pepQ b3847 ydaO #N/A yifK b3795 rng b3247 ygfU b2888 mgtA b4242 speC b2965 nanA b3225 ymfH #N/A hycE b2721 sgbE #N/A yaaU b0045 ya ¡Y b0379 ddlA b0381 rfbB b2041 yggM b2956 yebB bl862 yaaX b0005 ula E b4197 ymfG #N/A ybdA #N/A prpR b0330 yecO #N/A yobG #N/A xylG b3567 ycgN bll81 exuT b3093 wcaC b2057 hyfJ b2490 cobT bl991 aroG b0754 yajD b0410 yfgB #N/A cspE b0623 hisF b2025 ybfG #N/A ypjF b2646 yidP b3684 srlA b2702 ydgC bl607 yaaJ b0007 yjgR b4263 ynfD bl586 yibl b3598 gcvT b2905 srlB b2704 ykgM b0296 ymjC #N/A iadA b4328 murP b2429 cvrA bll91 mutM b3635 citB #N/A yahB b0316 eutQ b2460 mhpB b0348 mviM #N/A rfaS b3629 ybgC b0736 cspF bl558 dps b0812 metC b3008 ydjA bl765 purU bl232 ylbH #N/A icdC #N/A yafV b0219 yfdE b2371 cobS bl992 bcsZ b3531 gatC b2092 yhgA b3411 puuR bl299 deoC b4381 ebgC b3077 rcsA bl951 ycfZ bll21 yfhA #N/A ybaL b0478 ymgD bll71 gpmA b0755 yfeK b2419 wcaD b2056 prIC b3498 ptsP b2829 nudG bl759 rpll b4203 yjdL b4130 zntR b3292 betA b0311 ydjG bl771 feoB b3409 yhhJ b3485 ycjM bl309 fucP b2801 acpT b3475 dcrB b3472 yedY bl971 ygeR b2865 ydeE bl534 acnA bl276 ompT b0565 adiY b4116 kdsC b3198 yqel b2847 ybiJ b0802 yqjG b3102 yjbL #N/A yqil b3048 dsdX b2365 yphC b2545 yfeS b2420 djlC b0649 yjiS b4341 xylG b3567 yeeZ b2016 yfaO #N/A yciO bl267 kefG b3351 yqgA b2966 metA b4013 ogrK b2082 ycaO b0905 astC bl748 hyaC b0974 yiaO b3579 yhhP #N/A rlmB b4180 mntH b2392 yciO bl267 yhdX b3269 ynjB bl754 nagD b0675 ser A b2913 NvH b3457 ydiS bl699 yhaJ b3105 cspH b0989 recX b2698 frwC b3949 ygaH b2683 fhIA b2731 ycjN bl310 ydiT bl700 malY bl622 ndk b2518 yggJ #N/A yeta¬ bl340 yhcC b3211 tatB b3838 rse! b3995 dppA b3544 ycfM bll05 frdA b4154 xdhD b2881 yjbH b4029 argT b2310 yehT b2125 surE b2744 yeiQ b2172 ygcR b2770 yjbO #N/A yaiU #N/A moaE b0785 idnD b4267 treR b4241 phoH bl020 ybhF b0794 recF b3700 dinG b0799 nikE b3480 yqhD b3011 emrA b2685 hybB b2995 tap bl885 glf b2036 sapA bl294 yajR b0427 ynbC bl410 menF b2265 yebG bl848 dacD b2010 yeeS b2002 ypdC b2382 yeaL bl789 yiaY b3589 yfiL b2602 agaB b3138 ykgE b0306 basR b4113 pfIC b3952 fdx b2525 thiC b3994 ddpX bl488 yhiL #N/A yciS bl279 ybfD b0706 ygjR b3087 ykgA #N/A ybaL b0478 hypE b2730 tolC b3035 yccA b0970 ymfE bll38 edd bl851 yibG b3596 yeiT b2146 rlpA b0633 ybhR b0792 yiiF b3890 oppB bl244 ydeU #N/A tatE b0627 wzxC b2046 yegR b2085 cpsB b2049 phr b0708 fecB b4290 greB b3406 rbbA b3486 nikR b3481 fixA b0041 yfdL #N/A glvB #N/A ygbM b2739 ybhS b0793 yahC b0317 feaR bl384 dbpA bl343 hcaE b2538 yejF b2180 ackA b2296 yqjc b3097 ilvM b3769 rhaB b3904 yihG b3862 ulaE b4197 yhbX b3173 lysA b2838 hisM b2307 xseA b2509 yfjV #N/A yeiW b4502 kefC b0047 xylR b3569 yjbG b4028 tdcB b3117 yiaL b3576 dsdC b2364 gntP b4321 ybdZ b4511 hslV b3932 ymfO #N/A yfiR b2603 ybgH b0709 pppA b2972 ykiB #N/A yhhY b3441 yijF b3944 cynS b0340 yeeW #N/A metí b0198 ychJ bl233 yfcQ b2334 yggG b2936 hflK b4174 rffH b3789 xapB b2406 pepA b4260 yghW b2998 paaF bl393 yeaL bl789 tyrR bl323 potD bll23 yqeJ b2848 purK b0522 kdsD b3197 ycdG #N/A ygcG b2778 yjhX b4566 yiaG b3555 hrpB b0148 gldA b3945 hchA bl967 ynjl bl762 ybjM b0848 hdeD b3511 eutC b2440 trpA bl260 ycfT blll5 yehQ #N/A frc b2374 artM b0861 pro Y b0402 ymcA #N/A yaiP b0363 trpE bl264 rbn b2268 maIZ b0403 ycfJ blllO yejO #N/A yraM b3147 norW b2711 truD b2745 yiiS b3922 yjcZ b4110 trpC bl262 yfeC b2398 norW b2711 miaB b0661 uxuA b4322 pitB b2987 yagV b0289 rihB b2162 cpdB b4213 ybaD #N/A fdhF b4079 yebC bl864 pinH #N/A ymfl bll43 yraK b3145 eptB b3546 ycdT bl025 ksgA #N/A zur b4046 sfsB b3188 caiC b0037 yiaC b3550 yhiQ b3497 afuB #N/A yliH #N/A ybdJ b0580 hisA b2024 xthA bl749 yicG b3646 citC b0618 yraH b3142 dcuA b4138 ygjM b3082 fhuC b0151 hdeB b3509 yfiA #N/A yghY #N/A hisJ b2309 speD b0120 rhIE b0797 yjiR b4340 yebY bl839 rsuA b2183 mglC b2148 yciG bl259 allB b0512 ygcQ b2769 gst bl635 ydfP #N/A ybhJ b0771 yghQ #N/A rimL bl427 gigs b3049 ymfD bll37 yegJ b2071 hisA b2024 fucO b2799 yjiK b4333 pbpG b2134 ytfK b4217 yfeW b2430 otsA bl896 amiB b4169 yncA bl448 yedR bl963 asIB b3800 ygaY #N/A ynfP #N/A panC b0133 ppx b2502 elaC #N/A hyfE b2485 yfcH b2304 bcr b2182 tfaE bll56 yiaJ b3574 yhaK b3106 phoQ bll29 rna b0611 yicl b3656 ulaB b4194 yddA bl496 moaE b0785 yecS bl918 yahM b0327 dgkA b4042 rbsC b3750 ydgH bl604 yaeB b0195 ymfO #N/A ydcH bl426 yjcR #N/A rlmB b4180 ycgG bll68 gspC b3324 ydji bl773 ybeL b0643 ytfK b4217 hepA b0059 dppC b3542 aer b3072 thiQ b0066 chpR #N/A otsB bl897 yodC bl957 setB b2170 dnaB b4052 ycfT blll5 pphA bl838 glxR b0509 hupB b0440 frc b2374 yjbA #N/A ydeM bl497 eptA b4114 yfhA #N/A holC b4259 clpS b0881 yihN b3874 cmtB b2934 mngR b0730 yehX b2129 ddg #N/A yecl #N/A ydaL bl340 ydfA bl571 hscC b0650 focA b0904 ycaQ b0916 pbpG b2134 yeal bl785 thiG b3991 soxR b4063 wzzE b3785 ycgG bll68 fecC b4289 nirB b3365 mcrC b4345 ycjV #N/A yafU #N/A yecT bl877 ybeR b0645 moaB b0782 ychH bl205 yfgG b2504 araG bl900 recN b2616 rem bl561 holE bl842 xylA b3565 essD b0554 ybeH #N/A yeaJ bl786 apt b0469 htpX bl829 pyrl b4244 ybiS b0819 rfbC b2038 ydeA bl528 ybjT b0869 phnl b4099 argT b2310 ygbN b2740 modA b0763 ydeW #N/A galS b2151 gudX b2788 glpA b2241 lyxK b3580 ydfG bl539 yfdV b2372 zraP b4002 cysD b2752 ymgH #N/A ompG bl319 atoB b2224 bolA b0435 yiaY b3589 yjeN b4157 ybjQ b0866 pntA bl603 tyrA b2600 prIC b3498 gltD b3213 creB b4398 ynaA #N/A pncB b0931 rnb bl286 nhoA bl463 yegZ #N/A yrhA #N/A cspD b0880 ynhG bl678 ygjE #N/A ycfS blll3 ybcF b0521 gltJ b0654 yhjE b3523 dgt b0160 hyaA b0972 IdcC b0186 kdgT b3909 ykiB #N/A yjcD b4064 yael b0164 ycbR b0939 mutH b2831 yhgG #N/A nfrB b0569 feoA b3408 yicR b3638 malK b4035 yfjT b2637 recC b2822 yiaH #N/A djlB b0646 ycfH bllOO bioD b0778 yhhH b3483 hdhA bl619 sapD bl291 pldB b3825 glnE b3053 nirD b3366 hmp b2552 ykgF b0307 pncA bl768 ybcK b0544 rpoS b2741 potB bll25 moaB b0782 ynfB bl583 ybhD b0768 yjhR #N/A entA b0596 yafV b0219 yicl b3656 malQ b3416 thiF b3992 yqjE b3099 tfaD #N/A pinQ bl545 yjjP b4364 afuC b0262 rpmH b3703 yg¡E #N/A hfq b4172 ybjS b0868 agaB b3138 ydjK bl775 treA bll97 mdtK bl663 yhjK b3529 cspl bl552 yhhZ b3442 asnB b0674 fucR b2805 ynfH bl590 ymfQ bll53 ynbE bl382 yeeT b2003 yjiY b4354 yhaK b3106 yghA b3003 yegX b2102 yoaH bl811 cybC #N/A yphD b2546 yheT b3353 eutQ b2460 alsC b4086 sspB b3228 ydiF bl694 cspG b0990 mpl b4233 cbrA b3690 ahpF b0606 ycgF bll63 zur b4046 mngR b0730 marA bl531 ybcl b0527 setB b2170 ydaF b4527 eutG b2453 yfaD b2244 ydiZ bl724 yciC bl255 glnB b2553 hdeA b3510 ycgX bll61 yegJ b2071 speF b0693 yjfj b4182 yidA b3697 agaV b3133 puuE bl302 yhdJ b3262 recQ b3822 yfeW b2430 cspC bl823 yohL #N/A ygcR b2770 yafE #N/A yafU #N/A yqgc b2940 ymgG bll72 ybgo b0716 yhhT b3474 lysP b2156 frmA b0356 nrfB b4071 ygjH b3074 gltK b0653 osmB bl283 osmY b4376 glpK b3926 atoC b2220 idnT b4265 rraA b3929 nlpA b3661 ycfS blll3 yjbH b4029 rfaS b3629 leuA b0074 rhsE #N/A astA bl747 yifO #N/A umuC bll84 ybhM b0787 cadB b4132 yhaO b3110 hisH b2023 yeiB b2152 nudF b3034 ybfQ #N/A yfbL b2271 yeaC bl777 purR bl658 ydeW #N/A mrcA b3396 gspC b3324 ybeT b0647 tyrR bl323 ybiN #N/A ybcl b0527 yjfF b4231 yzgL #N/A narU bl469 chpS b4224 yliK #N/A cusA b0575 yiiL #N/A ydiD #N/A xerD b2894 cvrA bll91 ydjM bl728 oppF bl247 fumA bl612 hisQ b2308 dppF b3540 ccmA b2201 ybgL b0713 ydiU bl706 garD b3128 astE bl744 aer b3072 lacA b0342 ytfE b4209 ddpD bl484 yqcC b2792 phnO b4093 hypA b2726 ccmC b2199 tdcG b4471 ydil bl686 fdx b2525 yadS b0157 cheR bl884 slyX b3348 yphE b2547 csgF bl038 hsrA b3754 pntA bl603 ydaN bl342 pitA b3493 mhpA b0347 ykgK #N/A ydcl bl422 cstA b0598 deoA b4382 cchB #N/A yjfN b4188 mdaB b3028 ypfG b2466 pps bl702 azoR bl412 yraN b3148 rarA b0892 yfiA #N/A yghG b2971 ydcK bl428 betT b0314 cpdB b4213 wza b2062 yqiC b3042 fhIA b2731 yjfO b4189 ygaC b2671 glpC b2243 udk b2066 yjiD #N/A yfjQ b2633 yceD bl088 bcsB b3532 ydhZ bl675 yoal bl788 yecA bl908 cysU b2424 yjgz b4277 yjjN b4358 rpoZ b3649 tyrB b4054 metR b3828 otsB bl897 malí bl620 yqhC b3010 ybgQ b0718 yagF b0269 ccmH b2194 yeiR b2173 rtn b2176 yohF b2137 yiaU b3585 ygcE b2776 cdh b3918 mdlA b0448 puuD bl298 meIR b4118 yjiL b4334 panB b0134 ybiH b0796 yhdY b3270 ydaO #N/A rimL bl427 yjhD #N/A ccmG b2195 yahE b0319 yfcJ b2322 cysQ b4214 uhpA b3669 ulaC b4195 yohM #N/A yeaP bl794 yidJ b3678 tgt b0406 ypdB b2381 sspA b3229 yeaR bl797 ybbB #N/A gpp b3779 ytfJ b4216 ycfZ bll21 ycjX bl321 dmsC b0896 yegX b2102 yicL b3660 yqjK b3100 yfcQ b2334 ydaQ bl346 nhaB bll86 aceA b4015 ytfA #N/A yhjD b3522 hycE b2721 cid b2027 fumA bl612 yjbR b4057 yjfM b4185 bax b3570 yiiM b3910 hybG b2990 pstA b3726 ygcN b2766 yghG b2971 sohB bl272 arsR b3501 yqjE b3099 narQ b2469 uvrB b0779 yqfB b2900 yigi b3820 yeeX b2007 hisF b2025 ppdC b2823 yecN bl869 IsrF bl517 sodC bl646 hyi b0508 yhdW #N/A rfaB b3628 ligT b0147 ycfP bll08 kch bl250 ymgF b4520 hipB bl508 yehQ #N/A slp b3506 fsaA b0825 ycaK b0901 ykgA #N/A miaB b0661 fecC b4289 gmd b2053 alsE b4085 yncG bl454 yciK bl271 ego #N/A zraR b4004 atpl b3739 nfo b2159 yjiE b4327 ycjY bl327 ybfE b0685 bioC b0777 yehS b2124 fhuC b0151 ycfQ bllll mrp b2113 sspA b3229 ybeF b0629 degS b3235 malE b4034 wcaE b2055 eutP b2461 gudP b2789 VjiH b4330 csiE b2535 osmE bl739 rsxC bl629 puuB bl301 ycaO b0905 gmd b2053 torY bl873 yabP #N/A mhpE b0352 yjcH b4068 kptA b4331 ynjC bl755 yfcC b2298 nudC b3996 yohO b4542 yiaA b3562 ydfl bl542 yafJ b0223 mhpC b0349 atpC b3731 Ihr bl653 ygdB b2824 cbpA blOOO baeR b2079 yedA bl959 yfbB b2263 yfcT #N/A yohN b2107 npr b3206 fbaB b2097 ycdM #N/A ypjM #N/A ybcS #N/A yfiR b2603 yidE b3685 frmB b0355 metH b4019 ybhH b0769 IpcA b0222 nemA bl650 envY b0566 dgt b0160 narV bl465 hcaF b2539 mcrA bll59 iscS b2530 yfgc b2494 yeaH bl784 yiaB b3563 glcF b4467 sfmC b0531 yfcN b2331 ycgJ bll77 ygjF #N/A fsr b0479 yobA bl841 soxS b4062 yebR bl832 yjiZ #N/A glgA b3429 csgB bl041 metA b4013 puuC bl300 yfbL b2271 yohJ b2141 cyaY b3807 cheR bl884 bax b3570 yneE bl520 cybB bl418 ydfD bl576 yneL #N/A ychM bl206 yaiX #N/A yohF b2137 hslV b3932 nfrB b0569 yedZ bl972 ytfT b4230 nrfD b4073 caiA b0039 yphC b2545 yqjA b3095 gph b3385 rfbA b2039 narZ bl468 frvB b3899 ygdE b2806 fkpA b3347 gigc b3430 yccS b0960 yjhC b4280 ycjF bl322 ycdS #N/A artQ b0862 pin #N/A yhjB b3520 fucK b2803 ycjZ bl328 proP b4111 yagH b0271 ygfJ #N/A yeaH bl784 citD b0617 qseC b3026 dgoA b4477 rsmC b4371 ytjB b4387 mutL b4170 alpA b2624 sdaB b2797 yhaJ b3105 ygjE #N/A yfbR b2291 umuD bll83 mdoD #N/A adhE bl241 ynaE bl375 hypA b2726 chbA bl736 ynbA bl408 ybaA b0456 nemA bl650 ygaR #N/A rluB bl269 exo #N/A yddA bl496 ccmD b2198 yigA b3810 adhP bl478 ytfM b4220 mtIA b3599 yhaH b3103 pphA bl838 yobF bl824 tam bl519 helD b0962 recR b0472 dicC bl569 btuR bl270 rsmC b4371 yhbU b3158 yjiJ b4332 ypfH b2473 yagX b0291 fcl b2052 ccmD b2198 hscB b2527 mhpF b0351 pta b2297 cynX b0341 intD b0537 maoC bl387 pabC bl096 argP b2916 yhhM b3467 ygeY b2872 yhhN b3468 intR bl345 mbhA #N/A atoE b2223 ylbF b0520 serC b0907 entD b0583 yfcN b2331 proP b4111 ybiH b0796 nrdF b2676 xylR b3569 glcC b2980 ybbD #N/A yfjV #N/A ypdC b2382 yqjK b3100 yiaB b3563 yodA bl973 agal b3141 yihl b3866 pykA bl854 ugd b2028 moaD b0784 yfjM b2629 rlpA b0633 yeeV b2005 ddpD bl484 yfcD b2299 yehU b2126 ypeC b2390 ydiK bl688 dcp bl538 ydcT bl441 gatY b2096 ybbL b0490 ymfE bll38 entE b0594 cutA b4137 rpiR b4089 yjeJ b4145 sbcD b0398 fadB b3846 ygiV b3023 yigB b3812 cfa bl661 ytfR b4485 yeeA b2008 ygaT #N/A yeiN #N/A ymcC #N/A ydeM bl497 ynfF bl588 ypfl #N/A yjiX b4353 fkpB b0028 aspA b4139 yegQ b2081 NvJ b3460 yqhD b3011 yieF b3713 yhdY b3270 nagB b0678 nrdG b4237 ycgY bll96 dtd b3887 ygaU b2665 ycbS b0940 cpxP b4484 yfjQ b2633 yfgM b2513 yegD b2069 narL bl221 gntK b3437 dnaQ b0215 yfcV b2339 exbD b3005 topB bl763 yehU b2126 yoaD #N/A ychQ bl213 adiY b4116 wbbl b2034 focB b2492 ydgl bl605 fimE b4313 yedl bl958 rpiA b2914 ybgD b0719 atoB b2224 hemX b3803 ycdL #N/A yfeZ b2433 nirC b3367 ymfM bll48 msyB bl051 yfbO b2274 dam b3387 ykfF b0249 nagC b0676 ygeK #N/A yafQ b0225 ydgA bl614 yfcM b2326 emrE b0543 ychE bl242 yhdN b3293 yrbC b3192 yegH b2063 nanT b3224 yqiB b3033 yohG #N/A sthA b3962 yejE b2179 yjgW #N/A eptA b4114 asIA b3801 ybgP b0717 sodA b3908 yjhH b4298 ybiB b0800 mltC b2963 metH b4019 dcd b2065 srID b2705 ybhC b0772 yidR b3689 yliG #N/A ygcP b2768 yccF b0961 yfeU #N/A yfbQ b2290 ptsP b2829 agaD b3140 yhbP b3154 ynfA bl582 ychA bl214 yfcU #N/A mtIR b3601 ybdZ b4511 yjbD b4023 oxc b2373 ydaY #N/A phnE #N/A yfbU b2294 yegR b2085 gabT b2662 ypdJ #N/A yggT b2952 folM bl606 relA b2784 kefB b3350 yiiF b3890 yccF b0961 potE b0692 yegD b2069 yhhW b3439 hisB b2022 toIR b0738 osmC bl482 yedM #N/A yejB b2178 ymfB #N/A yfjT b2637 ybeM #N/A thiH b3990 dgkA b4042 yadG b0127 hscB b2527 lit bll39 yjcP #N/A trxC b2582 glpB b2242 yphF b2548 dinF b4044 ydiH bl685 hydN b2713 mdoB #N/A ygbE b2749 yccA b0970 yihM b3873 yqhC b3010 ygeO #N/A yfgc b2494 yggs b2951 yhcD b3216 yghT b2986 ygcM #N/A yafW b0246 yccZ #N/A ydjO bl730 ydiV bl707 uxuA b4322 hycC b2723 narY bl467 ydcY bl446 moaA b0781 yhbO b3153 yliC #N/A yfcA b2327 mipA bl782 yhhN b3468 rpmE b3936 glgB b3432 alr b4053 yjbE b4026 napC b2202 pflA b0902 wzc b2060 ydjO bl730 tauA b0365 yjel b4144 yjiQ #N/A cysQ b4214 ybeT b0647 yjiS b4341 pinH #N/A yedL bl932 yqjG b3102 ddpF bl483 yghR b2984 nfi b3998 yhbP b3154 hybC b2994 hisB b2022 qseB b3025 ydhD #N/A yhbG #N/A yjcF b4066 fucA b2800 sbcC b0397 elbA #N/A rihA b0651 oppD bl246 uxaC b3092 alsA b4087 torA b0997 ydcl bl422 yqcD #N/A yfeO b2389 ydjN bl729 proW b2678 betl b0313 cspA b3556 ydgD bl598 ydbJ b4529 trpR b4393 ycgK bll78 yeeF b2014 yegW b2101 ybgl b0710 ykfH b4504 csiR b2664 yfgL #N/A yffB b2471 sufC bl682 hydN b2713 ydhM #N/A yibN b3611 kil #N/A rfaF b3620 yfbJ #N/A tbpA #N/A yehl b2118 msrA b4219 eco b2209 yeaC bl777 yibH b3597 ydaW #N/A ynfM bl596 ilvE b3770 rseB b2571 yhjR b3535 gdhA bl761 yccT b0964 ybbL b0490 ybeX b0658 yedX #N/A ytfL b4218 ymgE bll95 yhhT b3474 fumC bl611 bglB b3721 yncH bl455 sdaA bl814 ampH b0376 fieF b3915 ydcF bl414 codB b0336 rluA b0058 yhiF #N/A ulaD b4196 elaA b2267 rfaC b3621 xylF b3566 kdul b2843 trmU #N/A sapB bl293 yjjw b4379 tdcC b3116 trxC b2582 tar bl886 rhtA b0813 ydcK bl428 yhjC b3521 acrF b3266 yaiU #N/A ybeA #N/A yhhW b3439 hfIC b4175 yfbW #N/A yghK #N/A yliG #N/A hycB b2724 idi b2889 yliD #N/A yncl #N/A hslU b3931 ybhJ b0771 yfhQ #N/A trkH b3849 deoC b4381 rcsA bl951 stfQ bl547 allA b0505 ybdM b0601 thiP b0067 yagX b0291 ycal b0913 acrD b2470 rbsA b3749 ypdB b2381 dinB b0231 citE b0616 yjfL b4184 ycgH #N/A rfaZ b3624 yjeJ b4145 yeaS #N/A rluC bl086 yqaB b2690 dedD b2314 thiS b4407 ybcQ #N/A proV b2677 yccZ #N/A yahF b0320 nrdD b4238 amyA bl927 ydfJ #N/A yaaH bOOlO fsr b0479 yqiB b3033 pepA b4260 htgA #N/A caiD b0036 rsxD bl630 glvC #N/A syd b2793
IdcC b0186 ycjZ bl328 mdtJ bl600 yjcQ #N/A alID b0517 yfbE #N/A pheA b2599 yhjY b3548 aphA b4055 yheS b3352 arsB b3502 cheA bl888 ycaP b0906 yjcF b4066 yedL bl932 yiiT #N/A gltl b0655 yraN b3148 yhjK b3529 bacA b3057 pitA b3493 wcaF b2054 spr b2175 zntR b3292 puuE bl302 idnO b4266 ada b2213 tag b3549 yecJ b4537 mipA bl782 yciQ bl268 pbpC b2519 dsrB bl952 treF b3519 ypeB b4546 tldD b3244 ygcH #N/A frwB b3950 yggT b2952 yaiF #N/A ygjJ b3079 yjbJ b4045 yedJ bl962 phr b0708 yjjz b4567 sprT #N/A mtID b3600 sbmC b2009 mdtD b2077 panE b0425 cbpA blOOO eutA b2451 ymcB #N/A yfhR b2534 yhcD b3216 hokB b4428 phnE #N/A fecR b4292 cysG b3368 yjbl #N/A yebT bl834 yggL b2959 hybD b2993 dhaH #N/A ygbM b2739 yebF bl847 yidl b3677 aaeR b3243 yaiZ b0380 cysA b2422 lysU b4129 ybiP b0815 alkA b2068 agp bl002 bglX b2132 yfgM b2513 gspA b3323 yafM b0228 ytfN b4221 xdhA b2866 chaB bl217 ybdB #N/A nadA b0750 ygcJ #N/A rffE b3786 frIC b4474 yedD bl928 rluC bl086 yidD b4557 wza b2062 alsA b4087 yidJ b3678 yjcO b4078 kdgK b3526 panF b3258 yjaG b3999 glpT b2240 yraP b3150 yhbV b3159 yjiO #N/A yjfC b4186 csgB bl041 uhpB b3668 aqpZ b0875 ttdB b3062 yicS b4555 ugpE b3451 stfR bl372 dacD b2010 yggD b2929 damX b3388 pqqL bl494 yddG bl473 ydeJ bl537 rem bl561 yihF b3861 tdh b3616 shiA bl981 yceJ bl057 yjfj b4182 ybaD #N/A yiiM b3910 appA b0980 gspH b3329 yqcE b2775 yggF b2930 rsxG bl631 ydcJ bl423 nhaR b0020 rpsO b3165 yrbG b3196 ygeL #N/A yecC bl917 yeaY bl806 ybgF b0742 ygeV b2869 yggL b2959 yfcC b2298 ydfW #N/A yfjD b4461 rsxG bl631 fumB b4122 yohC b2135 mppA bl329 yjgA b4234 ycjR bl314 paaB bl389 ygfF b2902 yghZ b3001 aceB b4014 uhpT b3666 ypfE #N/A xerC b3811 ybiO b0808 pstB b3725 yegU b2099 hyaE b0976 yliD #N/A pta b2297 rseC b2570 luxS b2687 yraQ b3151 dhaR bl201 yoeB b4539 mpaA bl326 menF b2265 phoE b0241 yheL b3343 rpll b4203 melA b4119 rsuA b2183 nudD #N/A arsR b3501 ydaN bl342 yehK b4541 ybgJ b0711 rmuC b3832 gpmA b0755 mdtl bl599 yihS b3880 yifL b4558 cpxR b3912 atpl b3739 ycaC b0897 maIZ b0403 pepB b2523 sseA b2521 ypdD #N/A yhiJ b3488 yfeX b2431 araH b4460 yjfZ b4204
IsrD bl515 ydel bl536 agaD b3140 ychP #N/A clpP b0437 ydhA #N/A purH b4006 yhbS b3156 yidL b3680 hcaE b2538 yeaU bl800 plsX bl090 bglF b3722 ynfL bl595 ccmH b2194 nupG b2964 udp b3831 dctA b3528 sgbH #N/A yjj K b4391 ymcA #N/A mdtB b2075 yaiW b0378 yiiX b3937 yfjR b2634 proW b2678 yjel b4144 yegV b2100 icIR b4018 gc R b2479 rfbA b2039 yeeO bl985 yqaD #N/A ygcJ #N/A yadL b0137 yliJ b0838 ymfL bll47 garL b3126 prpC b0333 yebN bl821 ydbD bl407 asmA b2064 yjhH b4298 yfeN b2408 yqcA b2790 ybjD b0876 ybaT b0486 ruvC bl863 wcaC b2057 nrdH b2673 rluD b2594 yiiL #N/A glcD b2979 ybbV #N/A yiiD b3888 htpG b0473 hcaD b2542 glgA b3429 yhbS b3156 manX bl817 fklB b4207 ygeN #N/A sufE bl679 yghZ b3001 ygiz b3027 gadC bl492 gntT b3415 ygfU b2888 emrY b2367 yebQ bl828 yjiD #N/A aroH bl704 ybcD #N/A maIT b3418 glpK b3926 ybaQ b0483 yhjG b3524 yghD b2968 yjfP b4190 paaJ bl397 yfaO #N/A dicB bl575 hslJ bl379 ydhS bl668 proX b2679 ytfG #N/A yadK b0136 gltL b0652 yncl #N/A ychF bl203 hrpA bl413 rcsF b0196 fie b3361 ydgC bl607 pro Y b0402 glmM b3176 mdtK bl663 arnT b2257 rpsU b3065 manY bl818 cpxA b3911 argO b2923 sufA bl684 yniD b4535 yliB #N/A ycfL bll04 macA b0878 msyB bl051 slyA bl642 gltL b0652 ydfP #N/A tolQ b0737 hscA b2526 yjcC b4061 tpiA b3919 thiH b3990 yibF b3592 tolB b0740 yabP #N/A yeel #N/A ybhB b0773 sixA b2340 ydiQ bl697 truB b3166 pqiB b0951 bdm bl481 bioH b3412 ydcN bl434 yfgO b2493 hupB b0440 yjdL b4130 ycfX #N/A adiC b4115 Ion b0439 ycdS #N/A flgF bl077 idnK b4268 kdul b2843 ydcR bl439 frvX b3898 ygfH #N/A fdnl bl476 yfdV b2372 glnH b0811 yejB b2178 ykgF b0307 rbsD b3748 livF b3454 aaeB b3240 yncC #N/A yeaY bl806 yjdA b4109 ygiP #N/A yhcO b3239 fdnG bl474 mfd blll4 iscA b2528 ser A b2913 ypjF b2646 hybO b2997 gloB b0212 yeiW b4502 yegl b2070 yeeY b2015 cspB bl557 yjbE b4026 ybdH b0599 yncG bl454 ydd bl423 flk b2321 chbR bl735 ycfP bll08 ypjc #N/A xseA b2509 ycjT bl316 eco b2209 yobH b4536 cyaY b3807 pdxJ b2564 rcsD b2216 slyX b3348 tesA b0494 ydeT #N/A yagQ #N/A metL b3940 ebgA b3076 sapB bl293 ftsX b3462 xylE b4031 purA b4177 dppD b3541 yaaU b0045 mdtB b2075 mqo b2210 ycbF b0944 yheN b3345 rtcB b3421 ais b2252 amn bl982 cmtA b2933 hemG b3850 yibG b3596 ydeK #N/A proB b0242 mdtl bl599 csgD bl040 nrdH b2673 yhaM b4470 abrB b0715 yegZ #N/A ysaB b4553 yebB bl862 rffD b3787 mrcA b3396 ycfN #N/A glvG #N/A napC b2202 manX bl817 sgcQ b4303 cysl b2763 gutQ b2708 sgcX b4305 potA bll26 potD bll23 alkA b2068 chiA b3338 yfjj b2626 ymfN #N/A dgsA bl594 msrA b4219 yqiH b3047 ytfB b4206 argB b3959 ygel b2853 ydcX bl445 trkD #N/A ydgH bl604 iscU b2529 recB b2820 ydiE bl705 yjjP b4364 hokB b4428 ygbE b2749 ycdQ #N/A yfbM b2272 yidR b3689 narX bl222 ulaC b4195 ycel bl056 rpml bl717 yaiC #N/A yjfY b4199 ybbO b0493 rhtA b0813 IdhA bl380 fliZ bl921 pspE bl308 gltA b0720 yedF bl930 elaA b2267 ppiB b0525
ItaE b0870 yneF #N/A yfaP b2225 pgm b0688 pheP b0576 hisP b2306 ydcF bl414 wcaA b2059 ydhR bl667 ompF b0929 yfjZ b2645 hyuA b2873 yhdW #N/A tauA b0365 ybgo b0716 yfcZ b2343 ygeG b2851 gntT b3415 yfcR b2335 exbB b3006 kefG b3351 ydeS bl504 fiml b4315 frmA b0356 yegl b2070 tfaS #N/A yfjD b4461 ytjB b4387 ybfF b0686 pntB bl602 pykA bl854 cheW bl887 yfhB b2560 yigE b4482 agal b3141 fdhD b3895 ugpE b3451 ppiB b0525 sthA b3962 ymgD bll71 puuP bl296 glcC b2980 xapR b2405 yjdA b4109 tyrB b4054 wbbJ b2033 ygcW b2774 yjiZ #N/A alIC b0516 ycdH #N/A yedD bl928 hypC b2728 fxsA b4140 yadH b0128 chpB b4225 yddL #N/A yhcF b3219 atpG b3733 hcaR b2537 flxA bl566 ygaC b2671 phnL b4096 yjhQ b4307 ppdB b2825 fecl b4293 lar #N/A rumA b2785 ycjR bl314 hypF b2712 narY bl467 yeaW bl802 ydcD bl457 yrfF b3398 yaiT #N/A yhdJ b3262 ybhB b0773 ycdU bl029 ycbJ b0919 ybbA b0495 cspE b0623 yebG bl848 paaA bl388 ybbW b0511 yiaN b3578 gltA b0720 rfaF b3620 ddpC bl485 yoaE bl816 poxB b0871 yfdT b2363 plsX bl090 ydcC bl460 ykgB b0301 rnd bl804 eutA b2451 pfs #N/A appB b0979 fliY bl920 ydeH bl535 sseB b2522 norR b2709 yiaF b3554 ybjl b0844 creD b4400 yoaE bl816 blr b4409 pgm b0688 yfdM #N/A marA bl531 hisL b2018 ¡aaA b0828 maIT b3418 nhoA bl463 ycdO #N/A narX bl222 ypjc #N/A ybjX b0877 torS b0993 yail b0387 yegT b2098 ygfQ b4464 ygeV b2869 pal b0741 basS b4112 yfbN b2273 ycaM b0899 yeiU #N/A ytfN b4221 ycgM bll80 bcsB b3532 grxC b3610 ydjQ #N/A yjbF b4027 proV b2677 ygj b3080 sdhD b0722 yagN b0280 ydcC bl460 hemF b2436 ya ¡Y b0379 cmtA b2933 yg¡L b3043 yjeM b4156 yodB bl974 ygaD b2700 ynfH bl590 gltF b3214 cysE b3607 ydiZ bl724 psiF b0384 araJ b0396 erfK bl990 kdgR bl827 ydfT #N/A ymfG #N/A basS b4112 tonB bl252 yfgL #N/A phoP bll30 yraK b3145 ybeH #N/A malP b3417 yjeK b4146 ybjH b0843 eutH b2452 ypeA b2434 rhaT b3907 citE b0616 livM b3456 yiaN b3578 mviM #N/A talB b0008 ycbQ b0938 yjjG b4374 yniA bl725 yicH b3655 ychN bl219 hyfH b2488 yneF #N/A yedW bl969 uraA b2497 bioH b3412 yobD bl820 gntU b4476 yggE b2922 mutH b2831 yieH b3715 melA b4119 dnaQ b0215 nikA b3476 yniB bl726 ydgD bl598 eutE b2455 ybiY b0824 ybfA b0699 ygfB b2909 ydfR bl555 yccX b0968 ymfl bll43 yfcL b2325 ybeX b0658 cheB bl883 norV b2710 agaS b3136 yoeB b4539 sufl #N/A setC b3659 torA b0997 yfeS b2420 clpA b0882 aceF b0115 nrfG b4076 IldP b3603 yhdX b3269 pspC bl306 cysN b2751 cspl bl552 pspE bl308 paaX bl399 fiu b0805 yejA b2177 glnQ b0809 mepA b2328 yhcF b3219 sufB bl683 yghR b2984 yejG b2181 yhbQ b3155 yrhB b3446 yehM b2120 yncD bl451 sra bl480 yciS bl279 yoaF bl793 sdhB b0724 gmhB b0200 yceH bl067 napB b2203 ydcE #N/A ssnA b2879 guaA b2507 yicR b3638 yhbT b3157 ygcF b2777 yqcD #N/A caiA b0039 mdtC b2076 hyfR b2491 uspA b3495 intD b0537 phoP bll30 yeaK bl787 yefM b2017 puuD bl298 tauB b0366 gltP b4077 araC b0064 rbsR b3753 ygbA b2732 yeeU b2004 eutT b2459 yjbl #N/A yojl b2211 yicE #N/A galU bl236 ygaP b2668 yiaV b3586 csdA b2810 torY bl873 yggR b2950 ydiP bl696 yfiM b2586 ydcR bl439 pmrD b2259 yihX b3885 treF b3519 sbcB b2011 umuD bll83 yjdF b4121 nrdE b2675 ynaJ bl332 abgR bl339 pbl #N/A nrfC b4072 ydgK bl626 fklB b4207 napD b2207 yqiJ b3050 ydfH bl540 yibJ #N/A nac bl988 yaaY b0024 tam bl519 yddE bl464 adiC b4115 ybeQ b0644 gapA bl779 ydeO bl499 alsC b4086 hyfA b2481 ruvA bl861 yeiS b2145 ybiJ b0802 ydeU #N/A aas b2836 yibK b3606 creA b4397 ydjJ bl774 norR b2709 ylcE #N/A ppdA b2826 yibA b3594 ompN bl377 yceP #N/A dadX bll90 ucpA b2426 tyrA b2600 ygcS b2771 uhpC b3667 ddg #N/A chiA b3338 yciN bl273 yzcX #N/A fcl b2052 mhpR b0346 recB b2820 yieK b3718 yiaG b3555 NgB b3647 hokD bl562 ydcA bl419 ygdB b2824 torT b0994 sucC b0728 cor A b3816 hyaB b0973 phnJ b4098 amn bl982 yfjO b2631 kefF b0046 yjhV #N/A ilvN b3670 fruK b2168 argH b3960 chbC bl737 yicG b3646 ydhL bl648 yihG b3862 yaiX #N/A yfbB b2263 mutM b3635 yebV bl836 smtA b0921 ycjD bl289 yejA b2177 trmA b3965 cysE b3607 pabC bl096 yegV b2100 yhcG b3220 katE bl732 yfaE b2236 ycdY bl035 thiF b3992 hyfl b2489 nudF b3034 yohL #N/A yagY #N/A ¡ap b2753 ygaM b2672 rsxB bl628 rumB b0859 yjbJ b4045 mltB b2701 yliH #N/A ybcF b0521 pphB b2734 yfbM b2272 solA bl059 ydeV #N/A pspD bl307 racC bl351 hyfE b2485 ilvL b3766 aceB b4014 fadR bll87 yfcS b2336 ycgL bll79 tauC b0367 purT bl849 aaeB b3240 yggR b2950 yecA bl908 yihX b3885 ytfQ b4227 yhfW b3380 cyoB b0431 yebO bl825 alx b3088 potl b0857 phoQ bll29 yhaC b3121 tdcG b4471 napB b2203 yciE bl257 modE b0761 yfhK #N/A ugpB b3453 ascG b2714 ulaF b4198 purH b4006 ybcD #N/A yiiS b3922 yfdF b2345 ackA b2296 ydeE bl534 ybaS b0485 yhcN b3238 ydaQ bl346 yraO #N/A ydfl bl542 fdrA b0518 ygiW b3024 dld b2133 yjcZ b4110 fliM bl945 yeaM bl790 ascF b2715 yfjF b2618 stfR bl372 glcF b4467 ygfx b2896 yadM b0138 btuB b3966 yggv #N/A ydaW #N/A ytfT b4230 trxA b3781 yfbH #N/A yraM b3147 rsmB b3289 citT b0612 yheU b3354 yfaE b2236 aceK b4016 yhjG b3524 adiA b4117 hcp b0873 bcsZ b3531 idnD b4267 ygcP b2768 yddB bl495 qor #N/A ulaG b4192 mdoD #N/A ruvB bl860 gadX b3516 araH b4460 yddK #N/A yfdH #N/A ygjR b3087 dacA b0632 sapD bl291 sdhC b0721 ybeY b0659 sapF bl290 ycjP bl312 uhpC b3667 ybbJ b0488 rffG b3788 rfal b3627 fhuF b4367 ygeN #N/A ebgC b3077 yeil b2160 yphA b2543 ybhE #N/A csgA bl042 yedK bl931 ompX b0814 paaY bl400 yfgA #N/A agaV b3133 yeeR b2001 fabF bl095 riml b4373 yeeJ bl978 ybgS b0753 ycjO bl311 yggF b2930 yfhG #N/A ybhT b0762 yiiU #N/A intB #N/A yhjV b3539 ydhD #N/A bglG b3723 yegK b2072 ykgE b0306 ymfP #N/A yhhL b3466 ddpF bl483 dsbG b0604 ydjM bl728 ydhK bl645 pqqL bl494 ybcN b0547 ymbA b0952 rfaC b3621 cpxR b3912 ykfF b0249 yeaN bl791 fliL bl944 ulaR b4191 yhjJ b3527 dos bl489 tsgA b3364 ygcL #N/A aroB b3389 ydbK bl378 yohD b2136 ybjL b0847 yidK b3679 ynjE bl757 sdaB b2797 yodB bl974 yeaE bl781 glvC #N/A yehM b2120 fliT bl926 prmB b2330 folM bl606 ykgC b0304 amiA b2435 yoaB bl809 yjeK b4146 yrbC b3192 nac bl988 yrdA b3279 fumB b4122 setA b0070 ydhT bl669 ybcL b0545 yejH b2184 fiml b4315 citF b0615 gutM b2706 eamA bl533 hisl b2026 elcA b0155 caiB b0038 yrbL b3207 yqgB b2939 dcuB b4123 sufS bl680 abgB bl337 yihF b3861 ycdH #N/A ydgG #N/A hisC b2021 yjgi b4249 ynjH bl760 ydfR bl555 ybbN b0492 fecD b4288 ycdK #N/A yhhP #N/A atoS b2219 yjhS b4309 yqiK b3051 yfjU #N/A astC bl748 chbF bl734 yfbQ b2290 yncD bl451 ygfJ #N/A cspD b0880 yjeT b4176 hycF b2720 hypB b2727 cchA #N/A ypaA #N/A yccS b0960 yraP b3150 yebS bl833 speF b0693 yjeN b4157 tus bl610 ompN bl377 yfdP b2359 nrfF b4075 tdk bl238 alkB b2212 yjcR #N/A ydhT bl669 btuE bl710 pdxA b0052 ccmB b2200 dksA b0145 ccmF b2196 nudB bl865 yncA bl448 gaIR b2837 sfmH #N/A ytjC b4395 pal b0741 dos bl489 yifK b3795 hofC b0106 yodD bl953 yajL b0424 ydhS bl668 prkB b3355 crcB b0624 ysdC #N/A acnB b0118 yjj b4378 mdoC #N/A uspA b3495 wbbK b2032 rpe b3386 ugpB b3453 rihC b0030 thrB b0003 yejO #N/A ampD bOHO icd bll36 pykF bl676 asnA b3744 ftsB b2748 ybgD b0719 yhal b3104 ydfV bl565 yacF b0102 phnN b4094 trmH b3651 tolA b0739 bglF b3722 chpB b4225 guaB b2508 rob b4396 chbR bl735 phnP b4092 yebO bl825 hsrA b3754 yedF bl930 PgpB bl278 yphD b2546 cysW b2423 citG b0613 yjhA #N/A yhjX b3547 yihl b3866 ysaB b4553 yjbM #N/A sapA bl294 ypjK b2635 yfjH b2623 yiaK b3575 yfaL b2233 yeeY b2015 ydiM bl690 nanR b3226 ompG bl319 paaC bl390 ygbJ b2736 gcvH b2904 ydgl bl605 yicH b3655 fdnH bl475 sgcC b4304 ygfi b2921 modF b0760 ybjl b0844 dusB b3260 kdpA b0698 ycdY bl035 fhiA #N/A yigi b3820 xylA b3565 prkB b3355 rsd b3995 relE bl563 gst bl635 tiaE #N/A glpA b2241 yjgz b4277 rbsB b3751 mngA b0731 yahl b0323 ais b2252 sbcB b2011 rhoL #N/A fecA b4291 yraJ b3144 cbl bl987 xdhB b2867 pdxJ b2564 ymgA bll65 pyrF bl281 yecE bl868 atpC b3731 ydiD #N/A btuF b0158 glxR b0509 yhfG b3362 pfkB bl723 exuR b3094 tig b0436 inaA b2237 rarD b3819 yehY b2130 ynbA bl408 abgA bl338 gmhB b0200 ydcE #N/A ypdD #N/A yeiG b2154 yjeS b4166 surE b2744 kefB b3350 ybhC b0772 ycjQ bl313 bioC b0777 gadX b3516 cynT b0339 ygdQ b2832 yjgA b4234 yhcM b3232 dcd b2065 yoaC bl810 yjjz b4567 glgx b3431 mazG b2781 yrbD b3193 grxB bl064 yehX b2129 sucB b0727 ydfQ #N/A wzb b2061 deoD b4384 nagE b0679 kbaY b3137 yccK b0969 yjaH b4001 rof b0189 usg b2319 hycA b2725 kduD b2842 cpdA b3032 leuC b0072 ymjC #N/A ydiV bl707 dnaB b4052 hisQ b2308 yfhD #N/A mhpF b0351 yjfP b4190 glts b3653 ybcW b0559 rsmB b3289 potG b0855 yhcC b3211 y ral b3143 aroF b2601 yg¡Q b4469 envY b0566 yeiE b2157 mdtG bl053 metE b3829 yacL b0119 astE bl744 purF b2312 pmbA b4235 panF b3258 nikE b3480 ygcl #N/A yicO b3664 rob b4396 nanR b3226 yqfB b2900 glnQ b0809 paaA bl388 ybfN b0682 ybhK b0780 avtA b3572 hsdS b4348 ptsA b3947 cusB b0574 yjiK b4333 yeaG bl783 stfQ bl547 ygd L b2812 ybiV b0822 yfjl b2625 yajL b0424 hybA b2996 ydcZ bl447 cysD b2752 yfbS b2292 tesB b0452 atoD b2221 yheT b3353 aceA b4015 pheP b0576 poxA b4155 ompT b0565 cmk b0910 elaD b2269 nrdE b2675 cheZ bl881 nirC b3367 entC b0593 yhbE b3184 yhaL b3107 ptsl b2416 ypjJ b4548 xylH b3568 thiP b0067 mreD b3249 ycjS bl315 zapA b2910 mutL b4170 marR bl530 emrE b0543 bcr b2182 ycdX bl034 treR b4241 hyuA b2873 yceK bl050 yieH b3715 flhE bl878 yidG b3675 yfbF #N/A yeeV b2005 ggt b3447 ¡ap b2753 yfdG #N/A ydcW #N/A ydfH bl540 purE b0523 cobC b0638 fucU b2804 yceO bl058 frIR b3375 ya ¡1 b0387 ybfA b0699 ynel #N/A recG b3652 alr b4053 wzb b2061 ydcY bl446 clpB b2592 tehB bl430 fruA b2167 dinG b0799 yfjP b2632 sdaC b2796 flgN bl070 yfdP b2359 IldR b3604 xerC b3811 frvB b3899 hisJ b2309 trpL bl265 yggw b2955 soxS b4062 ymfD bll37 ydiU bl706 manZ bl819 yijP b3955 iscA b2528 ymgH #N/A uvrA b4058 tdcF b3113 yibK b3606 rzpD b0556 yjeF b4167 hipB bl508 fsaB b3946 pbpC b2519 ydcT bl441 astB bl745 ycjP bl312 ycbU b0942 kch bl250 fimA b4314 pepT bll27 uxuR b4324 ccmA b2201 pfID b3951 yihL b3872 yagG b0270 pioO #N/A ytfF b4210 ompW bl256 yfbJ #N/A tdcF b3113 yjeH b4141 fecR b4292 htrC #N/A yhaV b3130 potC bll24 ydiP bl696 ydcS bl440 yliF b0834 gpt b0238 sapC bl292 glpF b3927 yiiG b3896 metE b3829 rph #N/A eutE b2455 yneK bl527 yafO b0233 ydhY bl674 dppF b3540 yfcF b2301 cspC bl823 abgT bl336 ybgl b0710 yfeZ b2433 fhuE bll02 speB b2937 yodD bl953 glpF b3927 tauB b0366 yecC bl917 glnD b0167 yfdl #N/A mscL b3291 ydgR #N/A essD b0554 rtcA b4475 lysR b2839 hda b2496 pntB bl602 yojl b2211 ybdG b0577 idnR b4264 frIC b4474 lipA b0628 malQ b3416 mpaA bl326 cbpM b0999 hscC b0650 yfdF b2345 ybhO b0789 yfhM b2520 yeaQ bl795 ftsE b3463 yidQ b3688 glpC b2243 argO b2923 prpB b0331 rep b3778 pabA b3360 yiiU #N/A yfcS b2336 djIA b0055 aroF b2601 pqiA b0950 ypjM #N/A yqeJ b2848 ynfB bl583 yeaS #N/A pepN b0932 yddW bl491 glxK b0514 ydeN bl498 yhdE b3248 ydgR #N/A yfeN b2408 purC b2476 xylB b3564 atpE b3737 etp b0982 ycbL b0927 kgtP b2587 yhiK #N/A ylil b0837 ynfD bl586 ssuD b0935 glyA b2551 nudD #N/A yfbV b2295 bioB b0775 yddE bl464 Ihr bl653 treC b4239 yecP #N/A ynjA bl753 sseA b2521 ynfK bl593 yadK b0136 nupG b2964 pdxB b2320 alkB b2212 ybjL b0847 ycjO bl311 yghF #N/A purT bl849 ydgK bl626 ydcM bl432 cysK b2414 gcvP b2903 ydhY bl674 gss #N/A cynR b0338 yobF bl824 ycjM bl309 ampG b0433 flhE bl878 yeeE b2013 yhgE b3402 mtIR b3601 yebK bl853 ybgF b0742 yeeF b2014 nmpC #N/A yqeF b2844 bcsE b3536 ybhO b0789 hcaC b2540 uspE bl333 fimH b4320 yfcA b2327 dppD b3541 gntY #N/A wcaB b2058 cysW b2423 yhiP #N/A yfjX b2643 yebW bl837 yohG #N/A yjiA b4352 yadM b0138 nhaR b0020 yhdN b3293 rffM b3794 yddW bl491 yhhK b3459 nrfC b4072 yehB b2109 gshB b2947 ddpA bl487 zraP b4002 yddJ #N/A malS b3571 yagA b0267 yqiA b3031 trmU #N/A yacL b0119 ydhl bl643 gspE b3326 ydaU bl359 yjjG b4374 speG bl584 gpt b0238 yaaH bOOlO phoU b3724 djlB b0646 yhjJ b3527 yijF b3944 ydhW bl672 ygiH #N/A araE b2841 yncJ bl436 appC b0978 yjdJ b4127 yihL b3872 yjiX b4353 yhbH #N/A yeeP #N/A eda bl850 yjgL b4253 mdtE b3513 nagB b0678 nuoJ b2280 yqiJ b3050 php b3379 atpF b3736 ygfA b2912 ynaA #N/A glpX b3925 ydhB bl659 rpmF bl089 rfaH b3842 ygdL b2812 hisP b2306 yicN b3663 ybcW b0559 ydfJ #N/A ynjE bl757 yqeC b2876 mfd blll4 asnB b0674 yncN b4532 atoE b2223 ddpC bl485 fecE b4287 ygiP #N/A ybcV b0558 trpB bl261 sucD b0729 ymbA b0952 ygeO #N/A fldB b2895 ilvB b3671 yedQ bl956 yjiE b4327 ydiO bl695 ydfU bl560 znuA bl857 rng b3247 mngA b0731 yfdN b2357 udp b3831 fruK b2168 yfeC b2398 yeiC #N/A ulaR b4191 ydiN bl691 gspD b3325 gaIT b0758 htpX bl829 ydcO bl433 rsxC bl629 sfsB b3188 yfhQ #N/A ksgA #N/A creC b4399 gldA b3945 pmrD b2259 rbsK b3752 rpmJ b3299 lar #N/A fliH bl940 ftsE b3463 baeS b2078 ybaB b0471 pnuC b0751 yaiO b0358 glcG b2977 ycbL b0927 ybfD b0706 cusR b0571 ylil b0837 yicO b3664 ppdC b2823 glyA b2551 ygg b2928 metB b3939 bioB b0775 cysJ b2764 ycbV b0943 treC b4239 ydcH bl426 pyrD b0945 sseA b2521 yeaG bl783 ygg b2962 nupG b2964 ybaE b0445 flxA bl566 ybjL b0847 yecM bl875 ydiY bl722 purT bl849 yajD b0410 ynbB bl409 cysK b2414 creD b4400 yeaO bl792 gss #N/A rbsB b3751 yoaD #N/A ycjM bl309 acpT b3475 cusS b0570 yeeE b2013 ptsA b3947 apaG b0050 yebK bl853 folX b2303 elaC #N/A nmpC #N/A flgB bl073 ydiR bl698 ybhO b0789 ydiR bl698 yhfY b3382 fimH b4320 yecP #N/A fldB b2895 gntY #N/A yqiK b3051 ychQ bl213 yhiP #N/A nikA b3476 galU bl236 yohG #N/A hsdM b4349 yfbU b2294 nhaR b0020 argC b3958 cusC b0572 yddW bl491 racC bl351 narG bl224 yehB b2109 ygfG #N/A yjgx #N/A zraP b4002 aceK b4016 fdnl bl476 yagA b0267 Ipd b0116 vacJ b2346 yacL b0119 ydiQ bl697 pepP b2908 ydaU bl359 alsB b4088 poxA b4155 gpt b0238 mngB b0732 hokA b4455 djlB b0646 yeaX bl803 fepA b0584 ydhW bl672 nuoM b2277 pheA b2599 yncJ bl436 ybcJ b0528 yeeN bl983 yihL b3872 glpR b3423 bcp b2480 yeeP #N/A carB b0033 yzgL #N/A mdtE b3513 ppiA b3363 purL b2557 yqiJ b3050 ycel bl056 yjeT b4176 ygfA b2912 gmr bl285 mhpT b0353 ydhB bl659 fsaA b0825 fadR bll87 ygdL b2812 yihQ b3878 yfbG #N/A ybcW b0559 bcsG b3538 yhdE b3248 yqeC b2876 ygiH #N/A ybdL b0600 yncN b4532 ogt bl335 stpA b2669 fecE b4287 yihT b3881 alIR b0506 trpB bl261 ygeL #N/A yjiA b4352 ygeO #N/A ydfZ bl541 yjhC b4280 yedQ bl956 yjdK b4128 ybhE #N/A ydfU bl560 yeaT bl799 ydbC bl406 mngA b0731 wcaL b2044 wbbJ b2033 fruK b2168 gcd b0124 yjjY b4402 ulaR b4191 proQ bl831 yijP b3955 gaIT b0758 feaB bl385 yliC #N/A rsxC bl629 torC b0996 tonB bl252 ksgA #N/A nth bl633 fepA b0584 pmrD b2259 fadB b3846 yggP b4465 lar #N/A glcB b2976 ygiV b3023 baeS b2078 ycaN b0900 add bl623 yaiO b0358 nusB b0416 hmp b2552 ybfD b0706 rimJ bl066 rrmA #N/A yicO b3664 proC b0386 ychE bl242 ygg b2928 hflX b4173 yraJ b3144 cysJ b2764 yciM bl280 acnB b0118 ydcH bl426 ymdF b4518 ypdG #N/A yeaG bl783 hycl b2717 fucO b2799 ybaE b0445 ynal bl330 astA bl747 yecM bl875 ynaK bl365 icd bll36 yajD b0410 yccK b0969 sucD b0729 creD b4400 speA b2938 gsk b0477 rbsB b3751 rumB b0859 ivbL b3672 acpT b3475 yadS b0157 yahC b0317 ptsA b3947 sfmA b0530 yieF b3713 folX b2303 metC b3008 yhfG b3362 flgB bl073 ydbL bl383 ychF bl203 ydiR bl698 ygcB b2761 fimB b4312 yecP #N/A ybaQ b0483 ygfB b2909 yqiK b3051 ybcK b0544 yhfK b3358 nikA b3476 ygfY b2897 brnQ b0401 hsdM b4349 ybjJ b0845 fumC bl611 argC b3958 smpB b2620 rpsU b3065 racC bl351 nrfA b4070 napG b2205 ygfG #N/A rffE b3786 yahJ b0324 aceK b4016 rnc b2567 osmY b4376 Ipd b0116 yegL b2073 yibQ b3614 ydiQ bl697 tehB bl430 rfbB b2041 alsB b4088 queA b0405 yjgM b4256 mngB b0732 yqgE b2948 gntX b3413 yeaX bl803 rnhA b0214 ycjS bl315 nuoM b2277 yhal b3104 yfcE b2300 ybcJ b0528 ymcC #N/A ycjN bl310 glpR b3423 manY bl818 tldD b3244 carB b0033 rzoD b4510 ycjW bl320 ppiA b3363 mdoG #N/A yrbB b3191 ycel bl056 ulaD b4196 ugpC b3450 gmr bl285 ybcV b0558 yedO #N/A fsaA b0825 oxyR b3961 hisL b2018 yihQ b3878 cbrC b3717 ycgJ bll77 bcsG b3538 cyoC b0430 rfaQ b3632 ygiH #N/A nlpA b3661 chbG bl733 ogt bl335 yeeN bl983 yaiE b0391 yihT b3881 macA b0878 ftn #N/A ygeL #N/A yphG b2549 rffM b3794 ydfZ bl541 hybE b2992 cadC b4133 yjdK b4128 rep b3778 ruvA bl861 yeaT bl799 yfeG #N/A ygdH b2795 wcaL b2044 ypdl b2376 paaX bl399 gcd b0124 flu b2000 napH b2204 proQ bl831 mhpD b0350 yfdZ b2379 feaB bl385 hokE b4415 malX bl621 torC b0996 pspB bl305 fimF b4318 nth bl633 mhpA b0347 entE b0594 fadB b3846 yibN b3611 yohC b2135 glcB b2976 ydhl bl643 yfeO b2389 argE b3957 hpt b0125 ymfJ bll44 ypdA b2380 pyrD b0945 lipA b0628 yjfK b4183 yegS b2086 ycaN b0900 alx b3088 yeiM #N/A ycbT b0941 puuA bl297 truB b3166 torS b0993 mdtF b3514 paaK bl398 ygaV b2667 apaH b0049 ymfM bll48 purM b2499 dcp bl538 yciF bl258 gshB b2947 ycbY #N/A serC b0907 malE b4034 eutl #N/A ydcQ bl438 ada b2213 yeeW #N/A recG b3652 ymcD #N/A ynbD bl411 yjcP #N/A hlyE bll82 yrdB b3280 seID bl764 ygjJ b3079 cmtB b2934 nadR b4390 rsxE bl632 priC b0467 yfaQ b2226 yddJ #N/A yqfE #N/A yniB bl726 rpmB b3637 uxaB bl521 thiD b2103 cadA b4131 yeaV #N/A hfID bll32 ydjY bl751 tbpA #N/A yeaU bl800 yeaX bl803 tauC b0367 rnhA b0214 miaA b4171 ynfN bl551 ycbT b0941 yjgH b4248 glpD b3426 yagU b0287 yhhL b3466 fliD bl924 cyoD b0429 ushA b0480 yqeB b2875 hrpB b0148 yfiH b2593 brnQ b0401 yggw b2955 yncM #N/A argH b3960 artQ b0862 nrfB b4071 ycbB b0925 fadD bl805 yrbD b3193 yecT bl877 malM b4037 intA b2622 yoaG bl796 ydfG bl539 paaC bl390 mscL b3291 yfdQ b2360 yceF bl087 flil bl941 fliN bl946 ftsB b2748 csgD bl040 rpe b3386 yigF b3817 ibpB b3686 yjgB b4269 yeeX b2007 tdcR b3119 yjju b4377 yahG b0321 wbbH #N/A yrfC #N/A thil b0423 recX b2698 flgD bl075 ybdM b0601 rimK b0852 pheL b2598 rssA bl234 chbA bl736 flgE bl076 ybhQ b0791 pykF bl676 pabA b3360 yijD b3964 ygfO #N/A yedQ bl956 yiiD b3888 argB b3959 serB b4388 yijD b3964 rbsR b3753 yegP b2080 napH b2204 clpP b0437 yhbU b3158 slt b4392 ymjB #N/A asmA b2064 yhbH #N/A ytfH b4212 fliK bl943 hypB b2727 fucU b2804 hcaT b2536 rseC b2570 yrfA #N/A ydiF bl694 hdeD b3511 mcrC b4345 wcaB b2058 ybjE b0874 yfeX b2431 nlpB #N/A yhgN b3434 recA b2699 serB b4388 ycjT bl316 fimE b4313 slyD b3349 cyoE b0428 ybbN b0492 exbB b3006 napA b2206 entC b0593 codB b0336 yfaW b2247 cheY bl882 yeiE b2157 yggE b2922 hyfD b2484 yijE b3943 yfbO b2274 yihV b3883 sdhD b0722 yfcR b2335 rzpD b0556 ydiS bl699 puuC bl300 purR bl658 fbp b4232 ydjX bl750 ybaN b0468 rpoD b3067 prmB b2330 hdeA b3510 ygfO #N/A ypdF b2385 yafK b0224 ybeB b0637 cirA b2155 yheN b3345 cysG b3368 ynjA bl753 tar bl886 nuoN b2276 hns bl237 cyoA b0432 nuoE b2285 aes b0476 bcsA b3533 rbsA b3749 cyoD b0429 ybbK #N/A yiaA b3562 ybcC #N/A toIR b0738 yagM b0279 uidA bl617 ybaO b0447 alpA b2624 rsxE bl632 yciW bl287 yddG bl473 ubiC b4039 fdnH bl475 yfdZ b2379 ynbE bl382 IpIA b4386 motB bl889 ypfH b2473 rluD b2594 frmR b0357 ggt b3447 btuE bl710 cor A b3816 carA b0032 yfaH #N/A hypD b2729 yfhL b2562 ybcQ #N/A yjiM b4335 yfjL b2628 ygfx b2896 pfs #N/A gnd b2029 rihC b0030 hisl b2026 idi b2889 minD bll75 ygaV b2667 sodB bl656 mmuM b0261 pps bl702 yphA b2543 ycbZ b0955 yifL b4558 ybfM b0681 cedA bl731 yeiJ #N/A ybaA b0456 modF b0760 pspA bl304 htrE b0139 entD b0583 citT b0612 gcl b0507 fliC bl923 envC b3613 wcaJ b2047 flgF bl077 gudD b2787 yejG b2181 nfrA b0568 yfiN b2604 trpC bl262 ykfG b0247 yedP bl955 nudG bl759 paaG bl394 yfcE b2300 torC b0996 dgoT b3691 manZ bl819 yejK b2186 gabP b2663 kefC b0047 y ral b3143 yfiC b2575 ygfr b2887 glcB b2976 ycbR b0939 mgsA b0963 yfcP b2333 pfkB bl723 uspF bl376 cusC b0572 cysH b2762 yfhH b2561 secB b3609 feaB bl385 fdhE b3891 ydel bl536 ytfL b4218 yhbV b3159 dcm bl961 rbsD b3748 ccmB b2200 hisD b2020 hyaF b0977 oppF bl247 nrfD b4073 yohO b4542 yfiF b2581 yhhK b3459 cof b0446 djIA b0055 yhcO b3239 fimC b4316 ybhM b0787 dksA b0145 uvrC bl913 ypeC b2390 ydfT #N/A copA b0484 ygdR b2833 sfmF b0534 menD b2264 yhbY b3180 asr bl597 yeeT b2003 mmuP b0260 eutL b2439 tus bl610 fliY bl920 yfjM b2629 tolQ b0737 fliC bl923 thrC b0004 ybjD b0876 ydgJ bl624 ompA b0957 fdhE b3891 idnT b4265 astB bl745 yfjj b2626 IsrC bl514 cedA bl731 frmR b0357 yihM b3873 ycbS b0940 sdaC b2796 ygaF #N/A ycbB b0925 flil bl941 intQ #N/A purC b2476 hfIC b4175 citX b0614 rffD b3787 yjiM b4335 yjju b4377 ndk b2518 yfaA b2230 paaJ bl397 yfjl b2625 dtd b3887 ybdD b4512 ymdF b4518 hyaB b0973 fimC b4316 yjgF b4243 flhB bl880 ydhC bl660 ysgA b3830 wbbH #N/A yncJ bl436 dsrB bl952 yfjW b2642 galM b0756 ptsl b2416 rfaG b3631 aro A b0908 ydfV bl565 hscA b2526 dsbB bll85 speA b2938 ydaG bl355 ibpA b3687 yncN b4532 degQ b3234 ykfJ #N/A mngB b0732 rfaG b3631 yciV bl266 purU bl232 dcuA b4138 yggM b2956 ssuE b0937 relA b2784 ydcU bl442 yhfK b3358 ssuB b0933 rimM b2608 pyrl b4244 sgcB b4565 visC b2906 yebT bl834 speB b2937 tolB b0740 ulaB b4194 paaE bl392 ydjX bl750 malX bl621 greA b3181 yniA bl725 nlpC bl708 cyoE b0428 yqfA b2899 cpxA b3911 cadA b4131 yhgA b3411 yebS bl833 yjbA #N/A mioC b3742 fliS bl925 lepA b2569 yedY bl971 ydhF bl647 yjjQ b4365 yjbL #N/A rsxD bl630 fkpA b3347 cadC b4133 yfhR b2534 ompA b0957 dsbB bll85 sbmC b2009 ycjF bl322 galM b0756 ygeX b2871 sucC b0728 gltl b0655 fliS bl925 fliR bl950 hpt b0125 yfcJ b2322 IsrG bl518 treC b4239 ycjG bl325 ycgH #N/A pspC bl306 clcB bl592 rhoL #N/A yhbW b3160 ylaC b0458 yfeY b2432 ugpQ b3449 rnt bl652 ybaS b0485 ybfH #N/A mcrA bll59 yqeH b2846 ulaF b4198 paaD bl391 dnaK b0014 yfdN b2357 tatA b3836 ydgT #N/A gidA #N/A rspB bl580 fucA b2800 yfaP b2225 yihU b3882 hyfB b2482 napA b2206 yedM #N/A flgc bl074 gntK b3437 ibpA b3687 yjeP b4159 ybaJ #N/A pqiB b0951 ppiA b3363 baeS b2078 hycG b2719 yjgi b4249 ssuD b0935 yifB b3765 ylaB b0457 yieP b3755 ppk b2501 agaW #N/A rfe b3784 yraQ b3151 ydeK #N/A ybhl b0770 yheM b3344 ynfF bl588 ulaA b4193 vacJ b2346 yoaA bl808 hokE b4415 flhA bl879 dcrB b3472 yjfK b4183 seID bl764 yqcE b2775 ygcU b4463 yadl b0129 yjbG b4028 rsxA bl627 narU bl469 livJ b3460 yhiK #N/A flgH bl079 hycA b2725 yhbY b3180 fliP bl948 ycjU bl317 yfcL b2325 yecJ b4537 yheM b3344 ugpA b3452 yjiP #N/A frID b3374 cpdA b3032 lepA b2569 yfbV b2295 yaeF b0193 yfbP b2275 ynel #N/A phoR b0400 pnuC b0751 flk b2321 ybeD b0631 yfcF b2301 ndh bll09 ygaQ #N/A ppc b3956 ybaY b0453 yiaL b3576 ydgT #N/A ushA b0480 fliG bl939 yjgH b4248 mltB b2701 appA b0980 yohJ b2141 yegL b2073 yibJ #N/A intR bl345 rusA b0550 tyrP bl907 aroC b2329 yfjU #N/A fliA bl922 selB b3590 ybfE b0685 hsdM b4349 fliE bl937 glpQ b2239 rcsD b2216 tatA b3836 yegK b2072 seqA b0687 dadX bll90 caiF b0034 ylbG #N/A atpA b3734 yejH b2184 barA b2786 yahl b0323 yjbM #N/A tig b0436 ymfN #N/A sgcX b4305 trmE #N/A sgbU #N/A flhA bl879 ycaR b0917 tsgA b3364 yqgB b2939 fliG bl939 fpr b3924 ygaX #N/A clpB b2592 flgH bl079 ynfG bl589 ycjW bl320 glnK b0450 dctA b3528 zwf bl852 cheZ bl881 uup b0949 gltD b3213 yfbF #N/A mhpE b0352 qseC b3026 yehA b2108 rhsE #N/A yiaH #N/A fliQ bl949 proQ bl831 ykgC b0304 ubiF b0662 rfaK #N/A pqiA b0950 ybgA b0707 kdpF b4513 yceG bl097 yeiB b2152 ugd b2028 yaiB #N/A grxB bl064 glgx b3431 gntR b3438 recC b2822 flgK bl082 tgt b0406 nirB b3365 rimK b0852 ydfQ #N/A mdoH #N/A rnt bl652 flgD bl075 yfcl b2305 ftn #N/A cyoA b0432 ylbF b0520 chpS b4224 nadR b4390 cusA b0575 menD b2264 yncC #N/A yidK b3679 ybiW b0823 hflX b4173 speC b2965 phnK b4097 rmf b0953 yiiR b3921 kdgR bl827 fliF bl938 nuoH b2282 yodC bl957 flgL bl083 yobD bl820 fucK b2803 katE bl732 hisM b2307 gloA bl651 greA b3181 menB b2262 lipB b0630 ybjO b0858 ycbX b0947 sppA bl766 nlpC bl708 ilvN b3670 ydbJ b4529 hsIR b3400 ybjO b0858 qseB b3025 ycdO #N/A metR b3828 deoD b4384 yabl b0065 fecB b4290 aas b2836 ybhR b0792 rsxB bl628 ybdA #N/A metí b0198 narV bl465 nhaA b0019 yijO b3954 yigL b3826 yhbO b3153 glcE b4468 fucl b2802 rffA b3791 yrdA b3279 motA bl890 ygfz b2898 ynjB bl754 adiA b4117 ydhO bl655 secD b0408 rpsO b3165 fliO bl947 fhuF b4367 mak b0394 acrB b0462 ycjQ bl313 yihT b3881 seqA b0687 yedE bl929 flgG bl078 pstA b3726 ydjF bl770 flhB bl880 tpr bl229 ygbJ b2736 sixA b2340 yfjX b2643 hns bl237 yciH bl282 rfaD b3619 ssuE b0937 ftsN b3933 ynfM bl596 rhaB b3904 yciM bl280 oxyR b3961 hsdS b4348 yoeE #N/A fliE bl937 ynjD bl756 ygeR b2865 glnE b3053 fliM bl945 gspA b3323 pspD bl307 ypfE #N/A yafK b0224 ascG b2714 aroD bl693 nadB b2574 gdhA bl761 yobH b4536 rbfA b3167 fliP bl948 yidH b3676 flgG bl078 rspA bl581 zapA b2910 narG bl224 tiaE #N/A trkA b3290 ddpX bl488 yahK b0325 iscR b2531 holE bl842 yfgA #N/A ybcO b0549 nrdD b4238 yeaR bl797 agaS b3136 yqhG b3013 proX b2679 kdpC b0696 acrE b3265 appC b0978 yjcO b4078 yfjF b2618 rarA b0892 yeel #N/A yeeS b2002 ycaL b0909 fabH bl091 metL b3940 selB b3590 yajQ b0426 yehB b2109 blr b4409 yihW b3884 flgl bl080 yfdG #N/A dadA bll89 ydiJ bl687 acrR b0464 hypD b2729 yigG b3818 ypjB #N/A yniD b4535 fliO bl947 yfjK b2627 fre b3844 minE bll74 ybaW #N/A ydcU bl442 hslU b3931 ybbM b0491 yjiP #N/A ydhP bl657 ptr #N/A ulaA b4193 ynjD bl756 yqeB b2875 ucpA b2426 ydcX bl445 narL bl221 ppiD b0441 yigz b3848 yjgK #N/A rfbX b2037 minE bll74 ybhT b0762 dcuD b3227 sbcC b0397 ypjK b2635 minD bll75 yeeU b2004 yadB b0144 ybhK b0780 ygbK b2737 napF b2208 rbfA b3167 fie b3361 sieB bl353 yghT b2986 basR b4113 hyaF b0977 ybgP b0717 ygfQ b4464 ygcO b2767 ycaK b0901 rrmA #N/A pek b3403 hofQ b3391 gabT b2662 bioF b0776 flgE bl076 ybfB b0702 yeaV #N/A mioC b3742 yieL b3719 crcA #N/A fimH b4320 yacG bOlOl yejF b2180 yncH bl455 fhuB b0153 ygiN b3029 rusA b0550 yhdT b3257 fliH bl940 paaK bl398 ydeQ bl502 ybcO b0549 rihB b2162 aroC b2329 yhhX b3440 ade b3665 iscR b2531 yeiL b2163 trkG bl363 fliJ bl942 dinD b3645 ycbW b0946 yfaZ b2250 ycfJ blllO ykgM b0296 ylaB b0457 emrY b2367 pspA bl304 intA b2622 dacA b0632 trmE #N/A btuC bl711 flgJ bl081 fliK bl943 fimA b4314 envR b3264 caiD b0036 hyfB b2482 hcaC b2540 yciB bl254 yfbH #N/A priA b3935 sbmA b0377 etp b0982 fliD bl924 apt b0469 yfgB #N/A ynbC bl410 yfaL b2233 ybcC #N/A tauD b0368 yeal bl785 flgc bl074 lysA b2838 aaeX b3242 gatD b2091 paaG bl394 frvX b3898 yncM #N/A allA b0505 narZ bl468 ydiT bl700 yfdl #N/A ybaM b0466 ydhX bl671 yhcH b3221 hypE b2730 cybC #N/A nuoG b2283 nfsA b0851 recD b2819 yhbC #N/A rpmB b3637 yecM bl875 fxsA b4140 aegA b2468 yqil b3048 yfjN #N/A fliA bl922 ymfP #N/A slyB bl641 cynS b0340 renD #N/A yniC bl727 yhcG b3220 minC bll76 rzoD b4510 trkA b3290 yfjK b2627 car A b0032 yfdY b2377 prpR b0330 pfkA b3916 phnG b4101 ygj b3080 ppk b2501 ycbJ b0919 mdlB b0449 nlpl b3163 nuoC b2286 yhhM b3467 wrbA bl004 ygaQ #N/A yfcl b2305 yedP bl955 nuoG b2283 rpml bl717 acrD b2470 ade b3665 fixC b0043 ymdC bl046 ddpB bl486 ybeA #N/A napG b2205 yrbF b3195 ymcB #N/A yfiB b2605 lacA b0342 kefF b0046 paaH bl395 yheO b3346 yjfC b4186 ybbY b0513 talB b0008 narH bl225 emrD b3673 pyrB b4245 pstB b3725 yafE #N/A kil #N/A yebY bl839 zwf bl852 yeaQ bl795 yagK b0277 znuB bl859 arnT b2257 purB bll31 phoR b0400 glgP b3428 speD b0120 ycaR b0917 artl b0863 ydiH bl685 aat b0885 ybbP b0496 flgJ bl081 sbmA b0377 sodA b3908 yhbT b3157 ycbC b0920 gspE b3326 flgK bl082 metJ b3938 nuoA b2288 yceB bl063 macB b0879 yceF bl087 chbF bl734 yaeR b0187 motA bl890 rpoZ b3649 cchA #N/A yfjY b2644 yfbW #N/A arcB b3210 cynT b0339 hyfD b2484 yjjA b4360 yhdH b3253 ycal b0913 pyrC bl062 amyA bl927 aroB b3389 galE b0759 hyaE b0976 gaIT b0758 pfkA b3916 gsk b0477 fliR bl950 priA b3935 glnK b0450 yeiN #N/A yajR b0427 yhdV b3267 rfaQ b3632 glpB b2242 gltJ b0654 truA b2318 ygg #N/A ydjY bl751 fruB b2169 yecD bl867 yrfD #N/A ygdl b2809 fliQ bl949 fliF bl938 gcvT b2905 yihO b3876 tas b2834 ybaX #N/A crcB b0624 rfaJ b3626 mntH b2392 ycil bl251 yhfW b3380 caiB b0038 ycaM b0899 yqiG #N/A visC b2906 gaIR b2837 ddlA b0381 mrcB b0149 ylcG b4509 ybeU b0648 endA b2945 hflK b4174 cysA b2422 nrfF b4075 cutC bl874 narK bl223 hybO b2997 ypfj b2475 yjhG b4297 napF b2208 ymfC #N/A rffC b3790 nmpC #N/A eutl #N/A intS b2349 ygiz b3027 yigF b3817 yacG bOlOl yjeS b4166 edd bl851 ygeW b2870 yahF b0320 ydfA bl571 trkG bl363 fliN bl946 yajC b0407 yjjY b4402 ybeZ b0660 ygfG #N/A ubiH b2907 ycjY bl327 kbaY b3137 leuC b0072 ygcM #N/A ompL b3875 dhaL bll99 nikB b3477 tdk bl238 frsA b0239 nadA b0750 ybeD b0631 yfeT #N/A glnB b2553 yphG b2549 trpB bl261 clcB bl592 yhaV b3130 riml b4373 pepB b2523 asIA b3801 yghK #N/A
IdcA bll92 yicE #N/A ubiB b3835 ygh D b2968 ycbF b0944 fimF b4318 yqfA b2899 ygeD #N/A prfC b4375 yoaB bl809 srlE b2703 atpF b3736 chbC bl737 ybfM b0681 glnL b3869 cyaA b3806 recO b2565 ygfA b2912 fixA b0041 aro A b0908 dinl bl061 purD b4005 yggH #N/A IldR b3604 ydcS bl440 relE bl563 hybG b2990
IdcA bll92 secB b3609 yrbG b3196 ybdL b0600 melB b4120 yaeF b0193 yaal b0013 ydcO bl433 thrA b0002 hca F b2539 hycH b2718 ilvH b0078 yadH b0128 artJ b0860 ycdX bl034 yccU b0965 cysB bl275 kdpD b0695 yihN b3874 yjfM b4185 alsE b4085 cusS b0570 ylcG b4509 yidA b3697 pyrF bl281 yphE b2547 leuL b0075 ybcN b0547 btuB b3966 fdrA b0518 yibD b3615 yidE b3685 citG b0613 hokA b4455 hcaB b2541 yhbC #N/A thiC b3994 pyrC bl062 menE b2260 glnG b3868 livK b3458 hyfG b2487 yehZ #N/A phnF b4102 ygbl b2735 gcvA b2808 yihO b3876 cyaA b3806 ygfY b2897 ybaB b0471 rpoS b2741 smpB b2620 fadL b2344 guaC b0104 eutJ b2454 recQ b3822 yciC bl255 ydfB bl572 ynfK bl593 cof b0446 ydjL bl776 selA b3591 cyoC b0430 paaD bl391 bglA b2901 ydiJ bl687 wca L b2044 dam b3387 ybjX b0877 yraR b3152 ygjv b3090 yhiF #N/A betl b0313 cchB #N/A rimM b2608 eutJ b2454 Ipp bl677 degP b0161 ydaE b4526 leuL b0075 rffT b4481 ych H bl205 yihP b3877 ygaZ b2682 rplU b3186 acrB b0462 hofQ b3391 btuC bl711 prc bl830 narH bl225 sstT b3089 leuD b0071 yjgJ b4251 frvA b3900 ypdA b2380 eda bl850 yhhZ b3442 ygaY #N/A ynhG bl678 nlpl b3163 ybaO b0447 rstB bl609 artP b0864 rffH b3789 rffA b3791 adhP bl478 ygaZ b2682 yfjz b2645 yneK bl527 ybaP b0482 yfjG b2619 purK b0522 Ipp bl677 rpmJ b3299 artM b0861 rtcA b4475 hokC b4412 yddH bl462 acrA b0463 ego #N/A flgN bl070 lysP b2156 ygaF #N/A ptsN b3204 ypjD b2611 yjgR b4263 ydjF bl770 zraS b4003 ppdA b2826 ygfs b2886 pspB bl305 sapF bl290 ydeT #N/A uup b0949 fis b3261 ymgB #N/A nagA b0677 ycbX b0947 ynfE bl587 zraS b4003 yggH #N/A cysU b2424 ihfA bl712 yafX b0248 ypdJ #N/A ypjD b2611 gutQ b2708 yhcB b3233 ihfA bl712 pstS b3728 yfhD #N/A pdxA b0052 selA b3591 purF b2312 ihfB b0912 glyA b2551 thrC b0004 ihfB b0912 hyfH b2488 ppiD b0441 mcrB b4346 htrE b0139 arcA b4401 pspF bl303 yc¡B bl254 yhhX b3440 htrG #N/A ya a A b0006 pspF bl303 purL b2557 pstS b3728 yrfA #N/A citF b0615 glxK b0514 recA b2699 fis b3261 ygeK #N/A yieP b3755 prfC b4375 yfhG #N/A wzxE b3792 ygaH b2683 prc bl830 yihQ b3878 phnl b4099 ycdT bl025
rffT b4481
#N/A = función no definida
Mutantes de deleción en 377 y 130 genes (Tabla 3. Genes delecionados que aumentan la resistencia a Te03 2" se muestran en negrita, mientras aquellos cuya deleción aumenta la sensibilidad se muestran en cursiva) mostraron un incremento o disminución significativo (valor p corregido menor a 0,05) de al menos 3 veces en el crecimiento luego de la exposición a Te03 2", respectivamente. Entre las cepas que fueron más sensibles a Te03 2" se detectó un enriquecimiento de genes implicados en la categoría de KEGG de ensamble de flagelo. Inesperadamente, no se detectó genes mutados implicados en la degradación o respuesta a ROS {btuE, oxyfí, sodA, sodB, sodC, katE), centros hierro-azufre {iscA, iscfí, iscU, sufA, sufB, sufC) o metabolismo del glutatión {gor, gshB) (Fig 2A). Apoyando estos resultados, la actividad catalasa disminuyó 5 veces en la cepa EM2 antes individualizada por su numero de deposito CChRGM, respecto a la cepa silvestre y no cambió con la exposición a H202 o a Te03 2", mientras que la actividad superóxido dismutasa, Te03 2" reductasa y los niveles de tioles fueron similares en ambas cepas (Fig 8A, Fig 8D, Fig 8E). Consistente con los bajos niveles de actividad catalasa, la cepa EM2 antes individualizada por su numero de deposito CChRGM, fue más sensible a H202 respecto a la cepa BW251 13 (Fig 8B, Fig 8C). Además, se observó que la adición de ALA al medio de cultivo restauró la actividad catalasa en la cepa EM2 antes individualizada por su numero de deposito CChRGM, a los niveles de la cepa silvestre, indicando que la actividad reducida fue debida a bajos niveles de grupos hemo (Fig 8A). Previamente, se propuso que las ROS son intermediarios centrales en la toxicidad del Te03 2", y que disminuir sus niveles junto con mantener el pool de glutatión reducido son requeridos para la resistencia a Te03 2" (Turner, R.J., Aharonowitz, Y., Weiner, J.H. & Taylor, D.E. Glutathione is a target in tellurite toxicity and is protected by tellurite resistance determinants in Escherichia coli. Can. J. Microbiol. 47, 33→40 (2001 ), Pérez, J.M. Calderón, I.L., Arenas, F.A., Fuentes, D.E., Pradeñas, G.A., Fuentes, E.L., Sandoval, J.M., Castro, M.E., Elias, A.O. & Vásquez, C.C. Bacterial toxicity of potassium tellurite: unveiling an ancient enigma. PLoS ONE 2, e21 1 (2007)). Sin embargo, los resultados proveen evidencia de que no existe una correlación directa entre los niveles de tioles, ROS y la resistencia a Te03 2".
Entre las mutantes por deleción que presentaban mayores niveles de resistencia a Te03 2", (Tabla 3, genes en negrita) se detectó enriquecimiento de genes implicados en la categoría de biosíntesis de cofactores, y en la ruta del metabolismo de clorofila y porfirina. En ambos casos, estas mutantes incluyen deleciones de genes implicados o con un rol putativo en la biosíntesis de grupos hemo, principalmente hemN, lo que incrementa la resistencia a Te03 2" (Fig 2A). HemN es una coproporfirinógeno III deshidrogenasa independiente de oxígeno (Troup, B., Hungerer, C. & Jahn, D. Cloning and characterization of the Escherichia coli hemN gene encoding the oxygen-independent coproporphyrinogen III oxidase. J. Bacteriol. 177, 3326-3331 (1995)). No es sorprendente que otras cepas de deleción para genes de la ruta de biosíntesis de grupos hemo no se encontraran en el análisis, dado que las enzimas de esta vía son esenciales para el crecimiento aeróbico en medio LB (Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K.A., Tomita, M., Wanner, B.L. & Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst Biol.2, 2006.0008 (2006)).
Más allá de lo anterior y teniendo en cuenta que E. coli codifica dos enzimas que pueden catalizar la conversión de coproporfirinógeno III a protoporfirinógeno IX, denominadas HemN y HemF, se puede analizar si la inactivación de genes río abajo de hemA y hemL también incrementan la resistencia a Te03 2". La resistencia de las cepas mutantes AhemFy AhemNiue confirmada y estas pudieron crecer en medio que contenía hasta 2 y 4 μg/mL de Te03 2", respectivamente (Fig 2B). HemN y HemF catalizan la descarboxilación de coproporfirinógeno III (copro III) a protoporfirinógeno IX, sugiriendo que limitando la acumulación de intermediarios río abajo de coproporfirinógeno III incrementa la resistencia a Te03 2".
En resumen, el análisis genómico y las aproximaciones de evolución dirigida indican que inactivando enzimas de la biosíntesis de grupos hemo, y limitando la disponibilidad de sustratos para los últimos pasos de dicha ruta incrementan la resistencia a Te03 2" (Fig 2C). Basado en estos resultados se puede proponer que el Te03 2" podría interactuar con metabolitos río abajo de copro III o causar su acumulación, lo que podría causar la muerte celular. Ejemplo de realización 3. El Te03 2" induce la acumulación de intermediarios en la biosíntesis de grupos hemo.
Siguiendo la lógica que la exposición a Te03 2" podría conllevar a la acumulación de intermediarios de hemo río abajo de la reacción catalizada por HemN y HemF, los niveles de copro III y protoporfirina IX fueron cuantificados en células expuestas a Te03 2". Estándares comercialmente disponibles de copro III y protoporfirina IX fueron usados para identificar cada compuesto (Fig 3b). Con esta finalidad, las cepas BW251 13, AhemN y EM2 fueron crecidas hasta fase exponencial tardía y en ese momento fueron expuestas a Te03 2" (25 μg mL). Debido a que el protoporfirinógeno IX se oxida espontáneamente a protoporfirina IX luego de la extracción (Mancini, S. & Imlay, J.A. The induction of two biosynthetic enzymes helps Escherichia coli sustain heme synthesis and actívate catalase during hydrogen peroxide stress. Mol. Microbiol. 96, 744-763 (2015)), los valores mostrados representan la suma de ambos intermediarios. En la cepa BW251 13, los niveles de proto IX aumentaron 60 veces luego de la exposición a Te03 2" (Fig 3A y 3B), y la viabilidad celular disminuyó 2000 veces (Fig 3C). Por el contrario, proto IX fue indetectable en cepas AhemN y EM2, y sólo copro II I fue detectable en la cepa AhemN, aunque los niveles no sufrieron modificaciones luego de la exposición a Te03 2" (Fig 3A y 3B). Como se esperaba, dicho metal no afectó el crecimiento de la cepa EM2, mientras la viabilidad de la cepa AhemN disminuyó 70 veces (Fig 3C), una disminución menor que la observada para la cepa BW251 13. Los niveles intracelulares de Te03 2" fueron similares entre las cepas testeadas, descartando que las diferencias en la acumulación de intermediarios de la síntesis de hemo y en la viabilidad celular fuesen causadas por una disminución a los compuestos tóxicos.
Ejemplo de realización 4. ALA potencia la toxicidad de Te03 2".
Una aproximación alternativa para analizar si la toxicidad de Te03 2" es causada por la acumulación de intermediarios en la biosíntesis de hemo es incrementar la disponibilidad de sustratos para la vía. En E. coli, el precursor de la ruta ALA, es incorporado por el sistema de transporte de dipéptidos codificado por el operón dpp y puede ser utilizado para este propósito. La idea es que si la cepa EM2 antes individualizada por su numero de deposito CChRGM, adquiere al menos parte de la resistencia a Te03 2" mediante la disminución de los niveles de ALA, entonces la adición de ALA al medio de cultivo podría dejar sin efecto las mutaciones en hemA y hemL, y disminuir la resistencia a Te03 2". Para comparar de manera directa el efecto de ALA en el crecimiento de las cepas BW251 13 y EM2, la concentración de Te03 2" fue incrementada para la cepa EM2 antes individualizada por su numero de deposito CChRGM, a niveles (400 μς/Γπί) que resultan en una disminución en la viabilidad celular similar a la observada para la cepa BW251 13 (Fig 3C). La adición de concentraciones sub- letales de ALA (25 μg mL) al medio de crecimiento sensibilizó la cepa EM2 antes individualizada por su numero de deposito CChRGM, a Te03 2" y su viabilidad celular decrece a niveles indetectables luego de 180 minutos de exposición (Fig 4A). Por el contrario, células de EM2 crecidas en la ausencia de ALA y expuestas a la misma cantidad de Te03 2" se mantienen viables aun luego de 24 h (Fig 4A). Un resultado similar fue observado para la cepa BW251 13 tratada con Te03 2". En ausencia de ALA, las CFU/mL fueron 1700 veces más altas que células crecidas en presencia de ALA. En ambas cepas ALA fue igualmente incorporado y alcanzó niveles 400% veces más altos que en la cepa BW251 13 crecida en medio M9 y no afectó la viabilidad celular. Un incremento similar en el contenido de hemo fue observado en ambas cepas (Fig 4A).
Una explicación para la toxicidad incrementada de Te03 2" en la presencia de ALA podría ser la acumulación de proto IX en células crecidas en esas condiciones. De hecho, niveles incrementados de proto IX, copro II I y otros intermediarios no identificados de la biosíntesis de hemo fueron observados en las cepas BW251 13 y EM2 crecidas con ALA y expuestas a Te03 2" (Fig 4B y 4C). En la cepa EM2, proto IX y copro III se van acumulando progresivamente, incrementando sus niveles en 90 y 2 veces luego de 180 min de exposición a Te03 2", respectivamente. En la cepa BW251 13, los niveles de ambos metabolitos incrementan aproximadamente 3,5 veces (Fig 4B). Dado que las cepas BW251 13 y EM2 fueron tratadas con diferentes concentraciones de Te03 2", creemos que la menor acumulación de proto IX y muerte celular más lenta observada en la cepa BW251 13 respecto a la cepa EM2 antes individualizada por su numero de deposito CChRGM, se debe a la diferencia en la tasa de incorporación de Te03 2". En este sentido, se observó que los niveles intracelulares de Te03 2" fueron 20 veces más altos en la cepa EM2 antes individualizada por su numero de deposito CChRGM, tratada con 400 μg mL, respecto a la cepa BW251 13 tratada con 25 μg/mL por 180 min. Adicionalmente, los niveles de proto IX en células crecidas con ALA fueron 2 y 8 veces más altas en las cepas BW251 13 y EM2 incluso antes de la exposición a Te03 2" (Fig 4B), respecto a la cepa BW251 13 tratada solo con Te03 2" (Fig 3A). Esto indica que bajo las condiciones ensayadas, proto IX per se no es letal para E. coli y podría no ser el único responsable de la muerte celular observada, sino que la combinación de proto IX y Te03 2" es causante de la muerte celular observada.
De acuerdo a los resultados obtenidos, ALA potencia el efecto tóxico de Te03 2", y que lo anterior ocurre en cepas sensibles (BW251 13) o resistentes al metal (EM2) (Fig 4A). Se determinó la cantidad mínima de Te03 2" requerida para inhibir el crecimiento en presencia de ALA. Para ello, se expusieron las cepas BW251 13, AhemN, AhemF y EM2 a cantidades decrecientes de Te03 2" en presencia de una cantidad fija de ALA (25 μg mL). En todos los casos, la cantidad de Te03 2" necesaria para inhibir el crecimiento fue menor cuando ALA estuvo presente (Fig 1 C, 2B y 4D). Este efecto de potenciación de ALA en la toxicidad del Te03 2" se observó tanto cuando las células fueron pre-crecidas en la presencia de ALA (Fig 4D) o cuando ALA y Te03 2" fueron adicionados al mismo tiempo (Fig 4E).
Adicionalmente, para establecer la potenciación entre estos dos compuestos, se determinó la concentración mínima de ALA que inhibe el crecimiento celular cuando se combina con Te03 2". Como prueba de este principio, estos experimentos fueron limitados a las cepas BW251 13 y EM2. Se usaron cantidades fijas de Te03 2" (0,5 y 50 μg/mL para las cepas BW251 13 y EM2, respectivamente) y se variaron las concentraciones de ALA. Estas concentraciones de Te03 2" fueron escogidos dado que a estas concentraciones las cepas crecen robustamente en la ausencia (Fig 1 B), pero no en la presencia de ALA (Fig 4D). Como se observa en la figura 4F, concentraciones tan bajas como 0,098 μg/mL ALA fueron suficientes para inhibir el crecimiento de las cepas BW251 13 y EM2. En resumen, estos experimentos muestran que el Te03 2" mata células de E. coli debido a la acumulación de intermediarios de la biosíntesis de hemo, principalmente proto IX, y que la adición de ALA potencia dicho efecto.
Los experimentos antes expuestos indican que la resistencia a Te03 2" en la cepa EM2 antes individualizada por su numero de deposito CChRGM, se debe a la acumulación limitada de intermediarios en la síntesis de grupos hemo y que el incremento de la destoxificación de ROS no es requerido. Debido a lo anterior, se espera que bajo condiciones anaeróbicas, donde no se genera ROS, la cepa EM2 antes individualizada por su numero de deposito CChRGM, se mantenga resistente a Te03 2" y que ALA potencie dicha toxicidad. En efecto, como se describió anteriormente, la viabilidad celular de la cepa EM2 antes individualizada por su numero de deposito CChRGM, crecida en aerobiosis con ALA disminuye rápidamente, no pudiendo encontrarse células viables luego de 90 minutos, mientras que en ausencia de ALA el conteo celular disminuye, pero se mantiene la viabilidad (Fig 4G). En contraste, bajo condiciones anaeróbicas la cepa EM2 antes individualizada por su numero de deposito CChRGM, permanece viable en presencia o ausencia de ALA (Fig 4G). Sin embargo, como se propuso, la presencia de ALA sensibiliza fuertemente la cepa EM2 antes individualizada por su numero de deposito CChRGM, a Te03 2", y el número de CFU decrece 99,9% respecto al cultivo inicial, indicando que el Te03 2" tiene un mecanismo agudo de toxicidad que es independiente de ROS y que es potenciado por ALA. Finalmente, se analizó si el efecto citotóxico de la combinación de Te03 2" y ALA era extensivo a microorganismos en general. Para ello se crecieron cepas de Salmonella typhimurium, S. typhi, Klebsiella pneumoniae y Pseudomonas aeruginosa en medio mínimo (M9) con distintas concentraciones de Te03 2", y en presencia o ausencia de ALA. Como se observa en la figura 5, la combinatoria de Te03 2" y ALA fue mucho más tóxica para todos los patógenos ensayados respecto al uso solo de Te03 2", lo que demuestra que el uso de ambas moléculas combinadas permite el control de una gran batería de patógenos, sean estos resistentes o no al metal.
Un importante punto a destacar es que no sólo ALA es utilizado en PDT, y diversos derivados del mismo, incluyendo etil-ALA, alquil ásteres de ALA, y metil éster de ALA, entre otros, han sido utilizados exitosamente en el biocontrol de hongos, parásitos y bacterias (Almeida, A., Cunha, A., Faustino, M.A.F, Tomé, A. C, & Neves, M. G. P. M. S. Porphyrins as antimicrobial photosensitizing agents, Compr. Ser. Photoch. 1 1 , 83-160 (201 1 )). El objetivo del diseño de estos derivados de ALA es aumentar la lipofilicidad de estos compuestos, incrementando su permeabilidad a través de membranas y barreras físicas como la piel, y por ende, su biodisponibilidad intracelular. A la fecha, se han descrito más de 77 derivados de ALA, siendo los más eficaces en PDT los ésteres del mismo, como metil ALA y hexil ALA (Wachowska, M., Muchowicz, A., Firczuk, M., Gabrysiak, M., Winiarska, M., Wañczyk, M., Bojarczuk, K. & Golab, J. Aminolevulinic acid (ALA) as a prodrug in photodynamic therapy of cáncer. Molecules 16, 4140-4164 (201 1 )). En los ejemplos anteriores, los siguientes datos detallados se deben considerar:
Cepas bacterianas, medio y condiciones de crecimiento. Todas las cepas son derivadas de E. coli K-12 BW251 13. La cepa EM2 antes individualizada por su numero de deposito CChRGM, fue aislada luego de 26 pasajes seriales en condiciones aerobias (cada pasaje equivale a 24 h) de la cepa BW251 13 en medio LB con concentraciones incrementadas de Te03 2" hasta 400 μg/mL (Fig. 1 A). Las cepas fueron aisladas por purificación de colonias individuales. Los genomas de las cepas BW251 13, y EM2, así como la identificación de mutaciones en cada cepa fue determinada por Macrogen Inc (South Korea) usando Ilumina HiSeq 2000. Las cepas AhemN and AhemF fueron obtenidas de la colección Keio (Baba, T. Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K.A., Tomita, M., Wanner, B.L. & Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst Biol.2, 2006.0008 (2006)).
Las cepas EM42 y EM43 fueron generadas por el reemplazo de hemA con una versión silvestre del gen hemA o con hemA[3~\ E] en las cepas EM2 o BW251 13, respectivamente . Para lograr esto, hemA fue amplificado desde las cepas EM2 o BW251 13 usando partidores de diseño propio, estos son, un primer partidor forward 5'
CACGTCTTGAGCGATTATGACCCTTTTAGCACTCGG 3' (SEQ ID No.:1 ) y un primer partidor reverso 5' AGCTCCAGCCTACACTACTCCAGCCCGAGGCTG 3' (SEQ ID NO.:2), los que fueron clonados en el plasmidio pKD3 (Datsenko, K.A. & Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR producís. Proc. Nati. Acad. Sci. 97, 6640-6645 (2000)) usando la estrategia descrita por Gibson y cois (Gibson, D.G. Young, L, Chuang, R.Y., Venter, J.C., Hutchison, C.A. 3rd & Smith, H.O. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Met ods 6, 343-345 (2009)). El plasmidio pKD3 fue amplificado usando un segundo partidor forward 5' GTGTAGGCTGGAGCTGCT 3' (SEQ ID No.:3) y un segundo partidor reverso 5' AATCGCTCAAGACGTGTAATG 3' (SEQ ID No.: 4), también de diseño propio.
Los 2 plasmidios resultantes (ver Figuras 9A y 9B) fueron usados como templado para una reacción de PCR utilizando un tercer partidor forward 5' GATGCAAGCAGACTAACCCT 3' (SEQ ID NO.:5) y un tercer partidor reverso 5' AAATGCACCCTGTAAAAAAAGAAAATGATGTACTGCATATGAATATCCT CCTTAG 3' (SEQ ID No.:6).
Las cepas EM42 y EM43 fueron construidas usando la recombinación λ red (Datsenko, K.A. & Wanner, B.L. One-step inactivation of c romosomal genes in Escheríchia coli K-12 using PCR producís. Proc. Nati. Acad. Sci. USA 97, 6640- 6645 (2000)) de los correspondientes productos de PCR en las cepas EM2 o BW251 13. La incorporación de la mutación deseada en el cromosoma fue confirmada por PCR y secuenciación.
Las curvas de crecimiento fueron desarrolladas en medio M9 (Miller, J.H. Experimente in Molecular Genetics (Cold Spring Harbor Laboratory Press, New York, 1972)) más 0,2% glucosa conteniendo o no telurito de potasio, H2O2 (Merck) suplementada o no con 25 μg/mL ALA (Sigma Aldrich), como se indica en la leyenda de cada figura (1 , 2, 4, 5, 6), en placas de 48 pocilios (NUNC). El crecimiento se inició con la adición de 10 μΐ de un cultivo saturado de cada cepa crecida en medio M9 en un pocilio contenido 990 μΐ (dilución 1 :100) del medio indicado en cada figura. El crecimiento fue desarrollado a 37°C en un incubador Tecan INFINITE M200 Pro con agitación constante a 141 ,9 rpm y la densidad óptica a 600 nm fue monitoreado cada 15 min por 24 h. Dado que el Te03 2" es reducido a teluro en el citoplasma celular (Fig 9), la OD6oo nm podría ser sobre-estimada en algunos casos, impidiendo el cálculo preciso de tasas de crecimiento y valores de IC50.
Para ios experimentos de viabilidad celular, cultivos de toda la noche fueron crecidos en medio M9, siendo diluidos (1 :1000) en matraces de 250 mL que contienen 25 mL de medio M9 con o sin TeÜ3 2", H2O2, suplementado o no con 25 μg/mL ALA (como se indica en cada figura) y las unidades formadoras de colonias (CFU/mL) fueron determinadas a los tiempos indicados. Los cultivos fueron crecidos a 37 °C con agitación de 250 rpm. Para los experimentos en condiciones anaerobias (Fig 4G), las células fueron crecidas en una cámara de anaerobiosis (Coy Laboratory Products) a 37 °C con una agitación de 125 rpm. El crecimiento fue iniciado como se describió anteriormente, pero en condiciones anaerobias. Al tiempo 0, los cultivos fueron divididos a la mitad y un matraz fue removido de la cámara de anaerobiosis y fue crecido en condiciones aerobias. Todas las soluciones fueron equilibradas dentro de la cámara de anaerobiosis por al menos una semana previo al desarrollo de los experimentos.
Perfil de química genómica del telurito en E. coli.
Experimentos de competición de la colección de E. coli tipificada (Otsuka, Y. et al. GenoBase: comprehensive resource datábase of Escherichia coli K-12. Nucleic Acids Res. 43 (Datábase issue): D606-17 (2015); Tabla 3) fue crecida en medio LB con telurito de potasio (0,63 μg/ml) o DMSO (solvente). Cada ensayo fue crecido en cultivos de 200 μΙ_ (n=3) a 37Ό por 24 h en un TECAN M1000. Luego de 24 h, el DNA genómico fue extraído usando el kit Pureünk 96-well genomic DNA extraction (Cat # K1821 -04A).
Los códigos de barra específicos de cada cepa fueron amplificados usando partidores indexados diseñados para secuenciación lllumina. Los partidores forward contiene la secuencia específica P5 de ¡Ilumina, y corresponden a: 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT CTTCCGATCTCGGTATGATCAATCTTCGGTAGTCCAGCG 3' (SEQ ID No:7); 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTCGGATTGTCAAATCTTCGGTAGTCCAGCG 3' (SEQ ID No:8); 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTAACCAGGTGTAATCTTCGGTAGTCCAGCG 3' (SEQ ID No:9); 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGGATGACTTCAATCTTCGGTAGTCCAGCG 3' (SEQ ID No:10); 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGTATGCGTCAAATCTTCGGTAGTCCAGCG 3' (SEQ ID No:1 1 ); 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTCCTAGTTCGAAATCTTCGGTAGTCCAGCG 3' (SEQ ID No:12); (SEQ ID No.:13). El cuarto partidor reverso contiene la secuencia específica P7 de lllumina y 20 bp de un sitio común de E. coli, y corresponde a: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTTGTAGGCTGGAGCTGC TTCG 3' (SEQ ID No.:13). Los códigos de barras fueron amplificados por PCR, purificados y cuantificados por qPCR como se ha descrito (Piotrowski, J.S. Simpkins, S.W., Li, S.C., Deshpande, R., Mcllwain, S.J., Ong, I.M., Myers, C.L., Boone, C. & Andersen, R.J. Chemical genomic profiling via barcode sequencing to predict compound mode of action. Methods Mol. Biol. 1263, 299-318 (2015)). Para la secuenciación de los códigos de barra, las muestras fueron corridas en un lllumina HiSeq2500 en modo de corrida rápida por 50 ciclos a una concentración de carga de 15 pM. El archivo Fastq resultante fue usado para el análisis de las mutantes sensibles y resistentes (Robinson, M.D., McCarthy, D.J. & Smyth, G.K. edge R: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140 (2010)). Se comparó las cuentas normalizadas de un solvente control (DMSO) para identificar respuestas específicas para los compuestos ensayados.
Extracción y medida de los niveles intracelulares de ALA y hemo. Cultivos saturados de las cepas ensayadas fueron crecidas en medio M9, diluidas (1 :100) en matraces de 500 mL que contienen 150 mL de medio suplementado o no con 25 μg/mL ALA. Los cultivos fueron crecidos a 37°C a una OD6oo nm -0,4 y el ALA intracelular fue extraído de 100 mL del cultivo como se describió previamente (Kanjo, N., Nakahigashi, K., Oeda, K. & Inokuchi, H. Isolation and characterization of a cDNA from soybean and its homolog from Escheríchia coli, which both complement the light sensitivity of Escheríchia coli hemH mutant strain VS101 . Genes. Genet. Syst. 76, 327-34 (2001 )) y cuantificado usando el reactivo de Ehrlich's (Sigma Aldrich) midiendo la absorbancia a 553 nm. El contenido de hemo intracelular fue extraído desde 1 mL de los mismos cultivos como se ha descrito previamente (Morrison, G.R. Fluorimetric microdeterrnination of heme protein. Anal. Chem. 37, 124-1 126 (1965)) y la fluorescencia fue determinada en el equipo Tecan INFINITE M200 Pro con una longitud de onda de excitación de 400nm y una longitud de onda de emisión de 610nm y 660 nm. Para ALA y hemo, los valores fueron normalizados con la OD6oo nm del cultivo.
Extracción y cuantsficación de porfirinas. Cultivos saturados de las cepas ensayadas fueron diluidos (1 :100) en 2000 mL de medio M9 suplementado o no con 25 μςΛηί ALA y crecidos a 37 °C a una OD6oo nm -0,4. En este punto, se agregó Te03 2" (25 μg/mL para las cepas BW251 13 y AhemN o 400 μg/mL para la cepa EM2) y las porfirinas fueron extraídas de 1000 mL (células crecidas en medio M9) o 400 mL (células crecidas en medio M9 con ALA) a los tiempos indicados como se describió previamente Nakayashiki, T. & Inokuchi, H. Effects of starvation for heme on the synthesis of porphyrins in Escherichia coli. Mol. Gen. Genet. 255, 376-381 (1997). ).
Las porfirinas fueron analizadas y cuantificadas usando un sistema "1200 series HPLC system" (Agilent Technologies) incluyendo un degasificador (G1322A), una bomba cuaternaria (G131 1 A), un detector de longitud de onda variable (G1314B) y un muestreador manual. El volumen de inyección fue 20xL. La separación se desarrolló en una columna Agilent Zorbax Eclipse XDB- C18 (4,6 x 150 mm, 5 μηι) eluida por 45 min a un flujo de 1 mL/min con un gradiente lineal desde 50% solvente A (10% acetonitrilo en 1 M acetato de amonio; pH 5, 1 ), 50% solvente B (metanol-ácido acético 10:1 , v/v) a 100% solvente B, seguido por elución con 100% solvente B por 5 min. La composición de porfirina de cada muestra fue analizada siguiendo la absorbancia a 300nm. Se utilizó estándares comercialmente disponibles de coproporfirinógeno III y protoporfirina IX (Frontier Scientific) para identificar y cuantificar cada compuesto en las diferentes muestras. Los valores fueron normalizados por mg de proteína utilizando el método de Bradford (Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principie of protein-dye binding. Anal. Biochem. 72, 248- 254 (1976)).
Determinaciones bioquímicas. Para todas las determinaciones bioquímicas, cultivos saturados de las cepas crecidas en medio M9 fueron inoculadas en matraces de 250 mL conteniendo 125 mL de medio M9 suplementado o no con 25 μg/mL ALA (indicado en cada figura). Los cultivos fueron crecidos aeróbicamente a 37°C con agitación de 250 rpm hasta OD600 nm de 0,4. En este punto, las células fueron tratadas con Te03 2" o H202, como se indica en cada figura. A los tiempos indicados, una alícuota de 25 mL fue centrifugada a 8000 g a 4Ό por 5 min y el pellet celular fue lavado dos veces con 5 mL de 50 mM Tris-HCI pH 7,4. El pellet fue suspendido en 500 μΐ de 50 mM Tris-HCI pH 7,4 y las células fueron lisadas por sonicacion. Para la medición de actividad catalasa, el pellet fue suspendido en amortiguador salino fosfato 50 mM pH 7,4. Los extractos libres de células fueron centrifugados a 14000 g a 4Ό por 20 min y fueron usados para determinar distintas actividades. Para todos los casos, la OD fue seguida usando el equipo Tecan INFINITE M200 Pro, y los valores fueron normalizados por mg de proteína de acuerdo al método de Bradford (Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principie of protein-dye binding. Anal. Biochem. 72, 248-254 (1976)).
Actividad catalasa. La actividad catalasa fue determinada en reacciones de 200 μΐ usando 10 μΐ de extracto libre de células como se describió previamente (Jakubowski, W., Biliñski, T. & Bartosz, G. Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radie. Biol. Med. 28, 659-664 (2000)) siguiendo el consumo de H202 a 240nm. La actividad catalasa fue definida como nmoles de H202 consumidos min"1 mg proteina"1.
Actividad superóxido dismutasa (SOD). La actividad fue determinada en reacciones de 200 μΐ usando 10 μΐ de extracto libre de células en amortiguador 50 mM Tris-HCI pH 7,4, 1 mM EDTA con 25 μΜ nitro tetrazolio azul (NTB, Sigma Aldrich), 50 μΜ xantina y 0,25 μg μL xantina oxidasa (Sigma Aldrich). La actividad SOD fue monitoreada siguiendo la oxidación de NTB a 412 nm como se ha descrito previamente (Jakubowski, W., Biliñski, T. & Bartosz, G. Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radie. Biol. Med. 28, 659-664 (2000)). Una unidad de actividad SOD fue definida como la cantidad de enzima requerida para inhibir en un 50% la oxidación de NBT min"1 mg proteina"1.
Actividad telurito reductasa (TR). Esta actividad fue determinada en reacciones de 200 μΐ usando 10 μΐ de extracto libre de células en buffer 50mM Tris-HCI pH 7,4, 1 mM Te03 2", 1 mM NAD(P)H (Sigma Aldrich) y 1 mM β- mercaptoetanol (Sigma Aldrich). La actividad TR fue monitoreada siguiendo la aparición de teluro 500nm como se ha descrito previamente (Calderón, I.L. Arenas, F.A., Pérez, J.M., Fuentes, D.E., Araya, M.A., Saavedra, CP., Tantaleán, J.C., Pichuantes, S.E., Youderian, P.A. & Vásquez CC. Catalases are NAD(P)H-dependent tellurite reductases. PLoS ONE. 20, 1 :e70 (2006)). Una unidad de actividad TR fue definida como la cantidad de enzima requerida para incrementar la OD a 500 nm en 0,001 min"1 mg proteina"1. Contenido total de tioles. El contenido total de tioles fue cuantificado usando el agente de Ellman ácido 5,5'-ditiobis-(2-nitrobenzoico) (DTNB, Sigma-Aldrich) como se describió previamente (Turner, R.J. , Weiner, J.H. & Taylor, D.E. Tellurite-mediated thiol oxidation in Escherichia coli. Microbiology. 145, 2549- 2557 (1999)) siguiendo la generación de TNB"2 a 412nm. Los valores fueron normalizados por mg de proteína.

Claims

REIVINDICACIONES
1 . Composición para el control de patógenos, caracterizada porque comprende ácido delta-aminolevulínico (ALA) o un derivado del mismo y oxianiones y teluro o un derivado délo mismo.
2. Composición de acuerdo a la reivindicación 1 , caracterizada porque dicho derivado corresponde a etil-ALA, alquilésteres de ALA o metiléster de ALA.
3. Uso de una composición que comprende ALA o un derivado del mismo y oxianiones y teluro o un derivado del mismos, caracterizado porque sirve para preparar un medicamento útil para el control de patógenos.
4. Uso de una composición que comprende ALA o un derivado del mismo y oxianiones y teluro o un derivado del mismo, caracterizado porque sirve para preparar una formulación veterinaria útil para el control de patógenos.
5. Uso de una composición que comprende ALA o un derivado del mismo y oxianiones y teluro o un derivado del mismo, caracterizado porque sirve para preparar una formulación plaguicida útil para el control de patógenos.
6. Uso de una composición que comprende ALA o un derivado del mismo y oxianiones y teluro un derivado del mismo, caracterizado porque sirve para el control de patógenos en aguas contaminadas.
PCT/CL2017/050089 2016-12-29 2017-12-27 Composicion de acido delta-aminolevulinico, oxianiones y teluro o sus derivados, util en el control de patogenos WO2018119540A1 (es)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CL2016003379A CL2016003379A1 (es) 2016-12-29 2016-12-29 “composición que comprende ácido delta-aminolevulínico (ala) o un derivado del mismo y oxianiones y teluro o sus derivados y su uso para el control de patógenos.”
CL3379-2016 2016-12-29

Publications (1)

Publication Number Publication Date
WO2018119540A1 true WO2018119540A1 (es) 2018-07-05

Family

ID=60331264

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CL2017/050089 WO2018119540A1 (es) 2016-12-29 2017-12-27 Composicion de acido delta-aminolevulinico, oxianiones y teluro o sus derivados, util en el control de patogenos

Country Status (2)

Country Link
CL (1) CL2016003379A1 (es)
WO (1) WO2018119540A1 (es)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023019838A1 (zh) * 2021-08-17 2023-02-23 湖南复瑞生物医药技术有限责任公司 一种5-氨基酮戊酸酯化物、用途和农药组合物

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2748266A1 (fr) * 1996-04-19 1997-11-07 Assche Charles Jacques Van Procedes de traitements biocides des eaux industrielles et de baignade
EP2572711A1 (en) * 2010-05-19 2013-03-27 SBI Pharmaceuticals Co., Ltd. Antimalarial drug which contains 5-aminolevulinic acid or derivative thereof as active ingredient
EP2805617A1 (en) * 2012-01-19 2014-11-26 Shoichi Shirotake Antibacterial agent against plant disease-causing bacteria

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2748266A1 (fr) * 1996-04-19 1997-11-07 Assche Charles Jacques Van Procedes de traitements biocides des eaux industrielles et de baignade
EP2572711A1 (en) * 2010-05-19 2013-03-27 SBI Pharmaceuticals Co., Ltd. Antimalarial drug which contains 5-aminolevulinic acid or derivative thereof as active ingredient
EP2805617A1 (en) * 2012-01-19 2014-11-26 Shoichi Shirotake Antibacterial agent against plant disease-causing bacteria

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FOTINOS, N. ET AL.: "Effects on Gram-Negative and Gram-Positive bacteria mediated by 5-aminolevulinic acid and 5-aminolevulinic acid derivatives", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 52, no. 4, 1 April 2008 (2008-04-01), pages 1366 - 1373, XP055515805 *
IVAN L. CALDERÓN LIZANA: "Toxicidad del Telurito de Potasio (K2TeO3) en Escherichia coli: Un Daño de Tipo Oxidativo", UNIVERSIDAD DE SANTIAGO DE CHILE FACULTAD DE QUÍMICA Y BIOLOGÍA, 2008, XP055515815, Retrieved from the Internet <URL:http://repositorio.conicyt.cl/handle/10533/175901> [retrieved on 20170409] *
MORALES, E. H. ET AL.: "Accumulation of heme biosynthetic intermediates contributes to the antibacterial action of the metalloid tellurite", NATURE COMMUNICATIONS, vol. 8, no. 15320, 11 May 2017 (2017-05-11), pages 1 - 12, XP055515802 *
TAYLOR, D. E.: "Bacterial tellurite resistance", TRENDS IN MICROBIOLOGY, vol. 7, no. 3, March 1999 (1999-03-01), pages 111 - 115, XP055515808 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023019838A1 (zh) * 2021-08-17 2023-02-23 湖南复瑞生物医药技术有限责任公司 一种5-氨基酮戊酸酯化物、用途和农药组合物

Also Published As

Publication number Publication date
CL2016003379A1 (es) 2017-08-04

Similar Documents

Publication Publication Date Title
US9085765B2 (en) Reduced genome E. coli
EP1829965A1 (en) Industrially useful microorganism
US20110111458A1 (en) Industrially useful microorganism
CN101115832A (zh) 工业上有用的微生物
Camilli et al. Use of recombinase gene fusions to identify Vibrio cholerae genes induced during infection
US8119365B2 (en) Insertion sequence-free bacteria
EP3113800B1 (en) Enhanced production of recombinant crm197 in e. coli
Berlyn et al. Linkage map of Escherichia coli K-9
CN101203529A (zh) 来自脑膜炎/脓毒症相关性大肠杆菌的蛋白质和核酸
CN112501098A (zh) 具有降解苯丙氨酸能力的工程益生菌
CN112662607A (zh) 具备表面展示苯丙氨酸解氨酶的工程益生菌
CN112662606A (zh) 用于治疗苯丙酮尿症的工程益生菌
Effendi et al. Prospective and challenges of live bacterial therapeutics from a superhero Escherichia coli Nissle 1917
WO2018119540A1 (es) Composicion de acido delta-aminolevulinico, oxianiones y teluro o sus derivados, util en el control de patogenos
CN112225785B (zh) GntR家族转录抑制因子突变体、突变基因及其在制备维生素B2中的应用
Sodoyer et al. Antibiotic-free selection for bio-production: Moving towards a new „gold standard “
Kosmidis et al. The E. coli transcriptional regulatory network and its spatial embedding
Paytubi et al. Bacterial Hha-like proteins facilitate incorporation of horizontally transferred DNA
CN114480455B (zh) 一种降低血液尿酸水平的功能基因片段、重组菌株及应用
US8039008B2 (en) Identification of residues critical for the function of the vibrio cholerae virulence regulator ToxT by scanning alanine mutagenesis
JP2021524230A (ja) アッカーマンシア種の遺伝子操作のためのシステムおよび方法
Hazlett Investigating the effects of genetic background on the fitness of quinolone resistance mutations in Escherichia coli
Schubiger et al. Growth Assays of Vibrio Cholerae Membrane Transporter Mutants in Different pH and Cation Conditions
US20230172997A1 (en) Recombinant bacteria for production of indole-3-acetic acid (iaa) and uses thereof
Bryant Functional genomics, analysis of adaptation in and applications of models to the metabolism of engineered Escherichia coli

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17888206

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17888206

Country of ref document: EP

Kind code of ref document: A1