WO2018113429A1

WO2018113429A1 - Probiotic recombinant saccharomyces cerevisiae for assisting protein degradation and antimicrobial peptide secretion

Info

Publication number: WO2018113429A1
Application number: PCT/CN2017/109650
Authority: WO
Inventors: 张宏刚; 李莉
Original assignee: 广州格拉姆生物科技有限公司
Priority date: 2016-12-20
Filing date: 2017-11-07
Publication date: 2018-06-28
Also published as: CN106854657B; CN106854657A

Abstract

Provided is a probiotic recombinant Saccharomyces cerevisiae for assisting protein degradation and antimicrobial peptide secretion. The recombinant Saccharomyces cerevisiae contains a Saccharomyces cerevisiae multi-gene co-expression vector for assisting protein degradation and antimicrobial peptide secretion, and the vector contains a specific protease gene and an antimicrobial peptide gene.

Description

A probiotic recombinant Saccharomyces cerevisiae capable of assisting in the degradation of proteins and secretion of antimicrobial peptides

Technical field

The present invention relates to the fields of genetic engineering and fermentation engineering, and more particularly to a recombinant Saccharomyces cerevisiae which can assist in the degradation of proteins and secretion of antimicrobial peptides.

Background technique

The protein components in the feed ingredients are generally rich, and generally need to be degraded into peptides and amino acids by proteases for reuse; many probiotics, such as Bacillus, Aspergillus niger or Aspergillus oryzae, secrete proteases to carry out protein components in the environment. Decomposition and utilization, thereby promoting the growth of probiotic bacteria itself, but S. cerevisiae or lactic acid bacteria secrete less proteases, have lower degradation ability to protein materials, generally need to add protein degradation metabolites such as peptone to grow well; Acidic or neutral proteases are also commonly employed. Proteases are classified into endonucleases and exonucleases according to their mode of action. General microbial proteases are usually classified into a mixture of endonucleases and exonucleases. Most of the forage animals need to be supplemented with proteases. For example, early weaned piglets often need to add proteases to compensate for the lack of secreted digestive enzymes in the body.

Antimicrobial peptide refers to a kind of basic polypeptide substance with antibacterial activity induced by insects. Its molecular weight is about 2000-7000, and it consists of 20-60 amino acid residues. Most of these active peptides are characterized by strong alkalinity, thermal stability and broad-spectrum antibacterial properties. Antibacterial peptides inhibit the growth of pathogenic bacteria. Different antimicrobial peptides have different killing ability against bacteria, fungi, protozoa and viruses; antibacterial peptides also have selective immune activation and regulation functions.

Saccharomyces cerevisiae is an important part of probiotics. The expression of protein degrading enzymes and antibacterial peptides can be achieved in the Saccharomyces cerevisiae expression system, and the advantages of the two can be organically matched: on the one hand, the protease can be secreted to degrade the protein in the medium, increase the nitrogen source, and promote the growth of the probiotics of interest; On the other hand, it can secrete antibacterial peptides and inhibit the bacteria. In addition, the expressed protease gene exerts a synergistic effect between proteases at different pH optimums or proteases with different enzyme cleavage sites, thereby enabling more efficient degradation of protein materials to produce functional small peptides or Amino acids, etc. In terms of application, the use of yeast culture to raise animals can supplement digestive enzymes, enhance immunity and promote growth; in the kitchen waste, degrade waste protein, increase nitrogen source, and inhibit bacteria.

Summary of the invention

The technical problem to be solved by the present invention is to provide a recombinant Saccharomyces cerevisiae capable of assisting degradation of proteins and secreting antimicrobial peptides in feed addition, industrial alcohol production, kitchen waste, and the like in order to overcome the above-mentioned deficiencies of the prior art. The invention combines and optimizes the combination of an acid protease (Acid protease) gene, a neutral protease gene, an Aspartic-type Endopeptidase gene and a Serine Protease gene, and an antibacterial agent. The peptide gene was transferred into S. cerevisiae by a Saccharomyces cerevisiae co-expression vector. Different proteins Different combinations of enzyme gene genes can achieve reasonable optimization between proteases, effectively play a synergistic role between proteases, and secrete antibacterial peptides with antibacterial activity, thereby obtaining multifunctional probiotic recombinant Saccharomyces cerevisiae.

The object of the present invention is to provide a Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degrading proteins and secreting antibacterial peptides, and a construction method thereof.

Another object of the present invention is to provide a probiotic recombinant Saccharomyces cerevisiae which can assist in the degradation of proteins and secrete antimicrobial peptides, and a method for constructing the same.

The technical solution adopted by the present invention is:

A Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degrading proteins and secreting antibacterial peptides, wherein the vector comprises a protease gene and an antibacterial peptide gene;

The base sequence of the antibacterial peptide gene is shown in SEQ ID NO: 5;

The protease gene is at least one selected from the group consisting of an acid protease gene, a neutral protease gene, an aspartic protease gene, and a serine protease gene.

Further, the base sequence of the acid protease gene is shown in SEQ ID NO: 1, and the base sequence of the neutral protease gene is shown in SEQ ID NO: 2, the base of the aspartic protease gene. The base sequence is set forth in SEQ ID NO: 3, and the base sequence of the serine protease gene is shown in SEQ ID NO: 4.

Further, the protease gene is an acid protease gene and a neutral protease gene.

Further, the α-signal peptide gene sequence is present upstream of the protease gene and the antimicrobial peptide gene, and the base sequence of the α-signal peptide gene is as shown in SEQ ID NO: 6.

Further, the promoter of the protease gene gene is selected from the group consisting of pgk1-1, pgk1-2, the terminator is selected from the group consisting of pgkt1-1, pgkt1-2; the promoter of the antimicrobial peptide gene is pgk1-3, and the terminator is pgkt1 -3;

The base sequence of the pgk1-1 is shown in SEQ ID NO: 7; the base sequence of the pgkt1-1 is shown in SEQ ID NO: 8; the base sequence of the pgk1-2 is as SEQ ID NO: And the base sequence of the pgk1-2 is as shown in SEQ ID NO: 10; the base sequence of the pgk1-3 is as shown in SEQ ID NO: 11; the base sequence of the pgkt1-3 As shown in SEQ ID NO: 12.

Further, the backbone of the vector is a pGAPZaA plasmid.

Further, the above vector contains a 25s rDNA gene fragment of Saccharomyces cerevisiae, and its base sequence is shown in SEQ ID NO: 14.

A probiotic recombinant Saccharomyces cerevisiae capable of assisting in the degradation of proteins and secreting antibacterial peptides, into which the multi-gene co-expression vector of any of the above is inserted.

Any of the above-described structures of a Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degradation of proteins and secretion of antimicrobial peptides The method of building includes the following steps:

The S1 integrated expression vector pTEGC-BsmBI was constructed:

S1.1 ligated the G418 resistance gene between the multiple cloning sites Msc I and EcoR V of the pGAPZaA plasmid vector to obtain the vector pGAPZaA-G418;

S1.2, the base sequence is ligated into the vector pGAPZaA-G418 multiple cloning site BamHI and EcoRI, and the vector pGAPZaA-G418-rDNA is obtained;

S1.3 The vector pGAPZaA-G418-rDNA was double digested with Bgl II and EcoRI, and the large fragment product was recovered to obtain a linearized vector pTEGC, and the BsmBI-2 fragment represented by SEQ ID NO: 15 was linear. The vector pTEGC was ligated to obtain the integrated expression vector pTEGC-BsmBI;

S2 promoter, terminator amplification

Amplification of S2.1 promoter: using S. cerevisiae genomic DNA as a template, primers were used to amplify pgk1- by PGK1F1-BsmBI and PGK1R1-BsmBI, PGK1F2-BsmBI and PGK1R2-BsmBI, PGK1F3-BsmBI and PGK1R3-BsmBI, respectively. 1. pgk1-2, pgk1-3 promoter fragment;

Amplification of S2.2 terminator: using S. cerevisiae genomic DNA as a template, primers were used to amplify pgkt1-, PGKT1F1-BsmBI and PGKT1R1-BsmBI, PGKT1F2-BsmBI and PGKT1R2-BsmBI, PGKT1F3-BsmBI and PGKT1R3-BsmBI, respectively. 1. pgkt1-2, pgkt1-3 terminator fragment;

Acquisition of S3α-signal peptide gene, acid protease gene, neutral protease gene and antimicrobial peptide gene

Obtainment of S3.1α-signal peptide-acidase gene: T-vector containing α-signal peptide gene sequence, T-vector containing acid protease gene gene sequence as template, respectively, through primers MfaF1-BsmBI, Mfa-apR, Mfa- apF and apR-BsmBI were subjected to overlap extension PCR. The α-signal peptide gene sequence was ligated into the 5' end of the acid protease gene, and the mfa-ap gene fragment was amplified, which contained the α-signal peptide gene sequence and the acid protease gene sequence. Fragment

S3.2 Neutral protease gene was obtained: the T-vector containing the neutral protease gene was used as a template, and the primers npF-BsmBI and npR-BsmBI were used for amplification to obtain the recognition and cleavage site of the IIs-type restriction enzyme BsmBI. Point np gene fragment;

Acquisition of S3.3α-signal peptide-antibacterial peptide gene: T-vector containing α-signal peptide gene sequence, T-vector containing antibacterial peptide as template, respectively, through primers MfaF3-BsmBI, Mfa-ampF, Mfa-ampR and Mfa -ampR-BsmBI for overlap extension PCR, the α-signal peptide sequence was ligated into the 5' end of the antibacterial peptide gene without signal peptide, and the mfa-amp gene fragment was amplified, ie, the α-signal peptide gene sequence and the antimicrobial peptide gene were contained. a fragment of a sequence;

Construction of S4 Saccharomyces Cerevisiae Multi-gene Co-expression Vector

The acid protease gene expression cassette elements pgk1-1, mfa-ap, pgkt1-1 obtained above; neutral protease gene Expression cassette elements pgk1-2, np, pgkt1-2; antibacterial peptide gene expression cassette elements pgk1-3, mfa-amp, pgkt1-3 were digested with the type IIs restriction endonuclease BsmBI, purified and recovered; meanwhile, using IIs The restriction endonuclease BsmBI cleaves the above integrated expression vector pTEGC-BsmBI and linearizes it; the fragments used are ligated into the linearized integrated expression vector pTEGC-BsmBI by one-step method, and the S. cerevisiae multi-gene co-expression is obtained. Carrier

The base sequences of the above primers are as follows:

PGK1F1-BsmBI: CGTTCCAPidc GAAGTACCTTCAAAG

PGK1R1-BsmBI: CGTCTCGGctaTATATTTGTTGTAAA

PGK1F2-BsmBI: CGTCTCAgtcaGAAGTACCTTCAAAG

PGK1R2-BsmBI: CGTCTCGGcatTATATTTGTTGTAAA

PGK1F3-BsmBI: CGTCTCAtgcaGAAGTACCTTCAAAG

PGK1R3-BsmBI: CGTCTCGtcgaTATATTTGTTGTAAA

PGKT1F1-BsmBI: CGTCTCAtgtacGATCTCCCATCGTCTCTACT

PGKT1R1-BsmBI: CGTCTCGGgtcaAAGCTTTTTCGAAACGCAG

PGKT1F2-BsmBI: CGTCTCAtacgGATCTCCCATCGTCTCTACT

PGKT1R2-BsmBI: CGTCTCGtgcaAAGCTTTTTCGAAACGCAG

PGKT1F3-BsmBI: CGTCTCAatcgGATCTCCCATCGTCTCTACT

PGKT1R3-BsmBI: CGTCTCGagtcAAGCTTTTTCGAAACGCAG

MfaF1-BsmBI: CGTTCCGctaATGAGATTTCCTTCAATTTTTAC

Mfa-apR: AGAGCAGCGGGCCCATGTCTTTTCTCGAGA

Mfa-apF: TCTCGAGAAAAGACATGGGCCCGCTGCTCT

apR-BsmBI: CGTCTCAatagCTAGTTCTTGGGAGAGGCA

npF-BsmBI: CGTCTCAgtcaATGAGAGTTACTACTTTGTCTACTG

npR-BsmBI CGTCTCAagctT TTAACACTTCAATTCGATAGCGT

MfaF3-BsmBI: CCTTCTCAtcga ATGAGATTTCCTTCAATTTTTAC

Mfa-ampR: ACTTAGAGAAGATACCTCTTTTCTCGAGAGA

Mfa-ampF: TCTCTCGAGAAAAGAGGTATCTTCTCTAAGT

Mfa-ampR-BsmBI: CGTCTCAtagcTCTGTTGTTTTGCCAAGAGGT.

A method for constructing a probiotic recombinant Saccharomyces cerevisiae which can assist in degrading proteins and secreting antibacterial peptides, and transforming the Saccharomyces cerevisiae multi-gene co-expression vector constructed above into a Saccharomyces cerevisiae host, screening positive monoclonal colonies, and verifying the correct sequencing, that is, obtaining A probiotic recombinant Saccharomyces cerevisiae that assists in the degradation of proteins and secretes antimicrobial peptides.

The beneficial effects of the invention are:

The recombinant Saccharomyces cerevisiae of the invention can realize protease degradation, increase nitrogen source or produce functional small peptide, and secrete the antimicrobial peptide to inhibit various bacteria, promote body growth and enhance immunity. In addition, the combination of protease genes with different characteristics can play a synergistic effect on protein degradation by different proteases. The recombinant Saccharomyces cerevisiae can secrete proteases with different pH ranges, and does not degrade the antimicrobial peptide gene, thereby simultaneously realizing protein. Degradation and secretion of antimicrobial peptides.

DRAWINGS

1 is a recombinant Saccharomyces cerevisiae protease hydrolysis loop constructed in Example 2; in the figure, 1 to 9 are selected different recombinant monoclonals, and No. 11 is a host Saccharomyces cerevisiae.

2 is a test result of the antibacterial activity of the recombinant Saccharomyces cerevisiae of the present invention against Staphylococcus aureus ATCC22023; in the figure, A and B are fermentation broths of the recombinant Saccharomyces cerevisiae of the present invention, and "+" is ampicillin as a positive control; "-" is H ₂ O as a negative control;

Figure 3 is a test result of the antibacterial activity of the recombinant Saccharomyces cerevisiae of Example 2 against Bacillus subtilis; in the figure, "81" and "65" are the fermentation broth of the recombinant Saccharomyces cerevisiae of the present invention, and "+" is ampicillin, which is positive. Control; "-" is H ₂ O as a negative control.

detailed description

The present invention will be further described below in conjunction with specific embodiments, but is not limited thereto.

Example 1 Construction of Saccharomyces cerevisiae multi-gene co-expression vector containing acid protease gene, neutral protease gene and antimicrobial peptide gene

First, the integrated expression vector pTEGC-BsmBI construction

1) Acquisition of G418 resistance gene

The gene of interest was amplified by PCR, and the G418 resistance gene was amplified using the G418F-MscI and G418R-EcoRV primers (Table 1) using the vector pPIC9k as a template. PCR reaction conditions: 98 ° C for 10 s, 55 ° C for 15 s, 72 ° C for 50 s, 30 cycles, 72 ° C for 10 min. It was verified by 2% agarose gel electrophoresis.

The target gene is recovered, purified, transformed into E. coli, verified, and sent for sequencing. The purified fragment was recovered and stored at -20 ° C until use. The obtained G418 resistance gene was ligated with the T vector, transformed into Escherichia coli DH5α strain, cultured at 37 ° C, and the plasmid DNA was extracted, and the positive strain was screened by colony PCR using G418F-MscI and G418R-EcoRV primers, and the positive clone was sent to English. Jieji sequencing verified the correctness of the gene. The sequencing results showed that the G418 resistance gene and its restriction site were correctly ligated into T-load without mutation, and the base sequence of the G418 resistance gene is shown in SEQ ID NO: 13.

Table 1 Amplification of G418 resistance gene primers

Note: The letter underlined is the recognition/cleavage sequence of the restriction enzyme.

2) Construction of vector pGAPZaA-G418

The pGAPZaA plasmid was cleaved with restriction endonucleases MscI and EcoRV at 37 ° C and verified by 1.5% agarose gel electrophoresis; cleavage of MscI and EcoRV by restriction endonuclease to cleave pMD-G418 vector to obtain G418 resistance The gene was verified by 1.5% agarose gel electrophoresis; the pGAPZaA vector and the G418 resistance gene in the above-mentioned digested product were recovered and purified, and the G418 resistance gene was ligated into the vector pGAPZaA by T4 ligase to obtain the vector pGAPZaA-G418.

3) rDNA gene amplification

The S. cerevisiae genomic DNA was used as a template, and the rDNA gene was amplified by primer rDNAF and rDNAR primers (see Table 2). The PCR amplification conditions were: 98 ° C for 10 s, 55 ° C for 15 s, 72 ° C for 60 s, 30 cycles, 72 ° C for 10 min. ; Validated on 1% agarose gel electrophoresis, and introduced EcoRI and BamHI restriction sites in the upstream and downstream.

The obtained rDNA gene was ligated with the T vector, transformed into Escherichia coli DH5α strain, cultured at 37 ° C, and the plasmid DNA was extracted, and the positive strain was screened by colony PCR using rDNAF and rDNAR primers. The sequencing results showed that the rDNA gene and its restriction site were correctly ligated into T-load without mutation, and the base sequence of the rDNA gene is shown in SEQ ID NO: 14.

Table 2 amplification of rDNA gene primers

4) Construction of vector pGAPZaA-G418-rDNA

The rDNA fragment on the above T vector was digested with restriction endonucleases BamHI and EcoRI, and the plasmid pGAPZaA-G418 was cleaved, and the pGAPZaA-G418 vector backbone was recovered and purified. The rDNA was ligated into the linearized vector pGAPZaA-G418 by T4 ligase. The recombinant vector pGAPZaA-G418-rDNA was obtained.

5) Construction of the integrated expression vector pTEGC-BsmBI

Restriction enzyme cleavage of Bgl II and EcoRI cleavage plasmid pGAPZaA-G418-rDNA, excision of BglII on this vector The GAP promoter, a-signal peptide and the like sequence between the EcoRI restriction sites were recovered, and the large fragment product was recovered to obtain a linearized vector pTEGC.

Using the pMD19-T simple vector as a template, the primers PMDF-BsmBI and PMDR-BsmBI (see Table 3) were used to amplify a BsmBI-cleaving site recognition sequence, a fragment of about 233 bp, BsmBI-2, and ligated into the T vector. The sequence was sent to Infinease sequencing, and the sequencing was correct without mutation. The base sequence of BsmBI-2 is shown in SEQ ID NO: 15.

The recombinant T vector was excised by restriction endonuclease cleavage of Bgl II and EcoR I, and the 233 bp DNA fragment BsmBI-2 was recovered, and then correctly ligated into the linearized vector pTEGC by T4 ligase to obtain the integrated expression vector pTEGC. -BsmBI.

Table 3 Amplification of primers containing BsmBI backbone DNA

Note: The uppercase letter at the underline is the BglII or EcoRI restriction site; the lowercase letter is the recognition sequence of the IIs restriction endonuclease BsmBI enzyme.

Second, the amplification of the promoter and terminator

1) Amplification of the promoter:

Using the S. cerevisiae genomic DNA as a template, the pgk1-1 promoter fragment (the base sequence is shown in SEQ ID NO: 7) was amplified using PGK1F1-BsmBI and PGK1R1-BsmBI primers (see Table 4) for expression of acidity. The promoter of the protease gene.

Similarly, using the S. cerevisiae gene DNA as a template, the PGK1F2-BsmBI and PGK1R2-BsmBI primers (see Table 4) were used to amplify the pgk1-2 promoter fragment (the base sequence is shown in SEQ ID NO: 9). A promoter that expresses a neutral protease gene.

Similarly, using the S. cerevisiae gene DNA as a template, the PGK1F3-BsmBI and PGK1R3-BsmBI primers (see Table 4) were used to amplify the pgk1-3 promoter fragment (the base sequence is shown in SEQ ID NO: 11). A promoter that expresses the antimicrobial peptide gene.

The promoter gene fragments obtained by the above amplification were respectively ligated into the pMD19-T Simple vector, and verified by sequencing to retain the correct positive clone.

2) Amplification of the terminator:

Using the Saccharomyces cerevisiae genomic DNA as a template, the pgkt1-1 terminator (the base sequence is shown in SEQ ID NO: 8) was amplified using the primers PGKT1F1-BsmBI and PGKT1R1-BsmBI (see Table 4) for expression of the acidic protein gene. Terminator.

The S. cerevisiae genomic DNA was used as a template, and the pgkt1-2 terminator (the base sequence is shown in SEQ ID NO: 10) was amplified using the primers PGKT1F2-BsmBI and PGKT1R2-BsmBI (see Table 4) for expression of neutral protease. The terminator of the gene.

The S. cerevisiae genomic DNA was used as a template, and the pgkt1-3 terminator (the base sequence is shown in SEQ ID NO: 12) was amplified using the primers PGKT1F3-BsmBI and PGKT1R3-BsmBI (see Table 4) for expression of the antimicrobial peptide gene. Terminator.

The above-mentioned amplification-derived terminator gene fragments were ligated into the pMD19-T Simple vector, and verified by sequencing, and the correct positive clones were retained.

Table 4 primers for amplifying the Saccharomyces cerevisiae promoter and terminator

Note: The capital letter under the underline is the recognition sequence of the type IIs restriction endonuclease BsmBI, and the underlined lower case letter is the cleavage sequence of the type IIs restriction endonuclease BsmBI.

3. Acquisition of α-signal peptide gene, acid protease gene, neutral protease gene and antimicrobial peptide gene

1) Acquisition of α-signal peptide gene: using Saccharomyces cerevisiae genomic DNA as a template, using MfaF and MfaR primers (see Table 5) Amplification of Mfa-BsmBI (ie, a fragment containing the α-signal peptide gene sequence of BsmBI), the amplification procedure is as follows: 98 ° C for 10 s, 55 ° C for 15 s, 72 ° C for 30 s, 30 cycles, 72 ° C for 10 min; The T vector was ligated, sampled for sequencing, and the correct positive clone was selected, thereby storing the α-signal peptide gene (the base sequence thereof is shown in SEQ ID NO: 6) in the T vector.

Table 5 amplification of α-signal peptide gene, acid protease gene, neutral protease gene, antimicrobial peptide gene primer

Note: The capital letter under the underline is the recognition sequence of the type IIs restriction endonuclease BsmBI, and the lowercase bold letter under the underline is the cleavage sequence of the type IIs restriction endonuclease BsmBI.

2) Obtainment of acid protease gene: The acid endopeptidase (acid protease) optimized by artificial synthesis is described by reference to the acid endopeptidase (acid protease) ap (XM_001397119.2) of Aspergillus niger published on Genbank. The base sequence of the gene ap is shown in SEQ ID NO: 1 (base length 1140 bp, amino acid sequence without signal peptide).

3) Obtaining the neutral protease gene: The base sequence of the neutral protease gene np optimized by artificial synthesis according to the Aspergillus oryzae neutral protease gene np (S53810.1) published on Genbank is SEQ ID NO: 2 (base length 1059 bp, amino acid sequence signal peptide).

4) Obtainment of antibacterial peptide gene: The base sequence of the antibacterial peptide Esculentin-1RE1 mutant Es-1RE1-T of Rana exilispinosa optimized by artificial synthesis is shown in SEQ ID NO: 5, and the amino acid sequence thereof is GIFSKFLGKGLKNLFMKGAKTIGKEVGMDVVRTGIDIAGCKIKGEC (SEQ ID NO: 46).

The acid protease gene ap, the neutral protease gene np, and the antibacterial peptide Esculentin-1 RE1 mutant Es-1RE1-T gene sequence obtained above were separately stored in the pMD19-T Simple plasmid, and used.

5) Obtainment of α-signal peptide-acid protease gene: T-vector containing α-signal peptide gene sequence, T vector containing acid protease gene ap sequence as template, and specific primers MfaF1-BsmBI, Mfa-apR, Mfa -apF and apR-BsmBI (see Table 5). The α-signal peptide gene sequence was ligated into the 5' end of the acid protease gene ap by overlap extension PCR (SOE-PCR) to amplify the mfa-ap gene fragment (containing α - signal peptide gene sequence and acid protease gene ap).

6) Obtaining the neutral protease gene: using the T vector containing the neutral protease gene np as a template, and amplifying the primers npF-BsmBI and npR-BsmBI (see Table 5) to obtain the restriction endonuclease BsmBI containing IIs. Identification and cleavage of the np gene fragment.

7) Obtainment of α-signal peptide-antibacterial peptide gene: T-vector containing α-signal peptide gene sequence, T vector containing antibacterial peptide Esculentin-1 RE1 mutant Es-1RE1-T gene as template, and primer MfaF3- BsmBI, Mfa-ampF, Mfa-ampR, and Mfa-ampR-BsmBI (see Table 5) were ligated to the 5' end of the anti-peptide gene of the signal-free peptide by overlap extension PCR (SOE-PCR). The mfa-amp gene fragment (containing the α-signal peptide gene sequence and the antimicrobial peptide Esculentin-1 RE1 mutant Es-1RE1-T gene) was amplified.

The above amplified gene fragments were ligated into the pMD19-Simple vector, and verified by sequencing, and the correct positive clones were retained.

Construction of a multi-gene co-expression vector pTEGC-ap-np-amp containing acid protease gene, neutral protease gene and antimicrobial peptide gene

The acid protease gene expression cassette element pgk1-1 (promoter), mfa-ap (containing α-signal peptide gene sequence and acid protease gene ap), pgkt1-1 (terminator) obtained in the above "two" and "three" Neutral protease gene expression cassette element pgk1-2 (promoter), np (containing neutral protease gene np), pgkt1-2 (terminator); antibacterial peptide gene expression cassette element pgk1-3 (promoter), mfa -amp (containing α-signal peptide gene sequence and antibacterial peptide Esculentin-1RE1 mutant Es-1RE1-T gene), pgkt1-3 (terminator) was digested from T vector by using type IIs restriction endonuclease BsmBI At the same time, the integrated expression vector pTEGC-BsmBI constructed in the above "1" was cleaved by the IIs restriction endonuclease BsmBI and linearized. The above-mentioned fragment was ligated into the integrated expression vector pTEGC-BsmBI by T4 ligase, and the S. cerevisiae multi-gene co-expression vector pTEGC-ap-np-amp was obtained, transformed into E. coli DH5a, and the transformants were selected and verified by sequencing. The positive transformant was ligated, and the plasmid was extracted to obtain a multi-gene co-expression vector pTEGC-ap-np-amp containing an acid protease gene, a neutral protease gene and an antimicrobial peptide gene.

Example 2 Construction of a probiotic recombinant Saccharomyces cerevisiae capable of assisting in the degradation of proteins and secretion of antimicrobial peptides

1. Pretreatment of multi-gene co-expression vector pTEGC-ap-np-amp

The multi-gene co-expression vector pTEGC-ap-np-amp constructed in Example 1 was transformed into E. coli DH5a for activation and cultured in liquid LB medium overnight, and the plasmid was extracted and purified. The restriction endonuclease HpaI was used for linearization digestion, recovered and purified, and used.

2. Screening and verification of recombinant yeast transformants

The multi-gene co-expression vector pTEGC-ap-np-amp was linearized and transformed into S. cerevisiae (the highest tolerance concentration to G418 of 200 μg/ml) by electroporation transformation, and YPD plate with G418 concentration of 300 μg/ml. The above culture was cultured for more than 48 hours, and the single colony that grew out was picked as a transformant. The verified transformants were subjected to high-resistance screening in YPD liquid medium containing 300 ug/ml, 500 ug/ml, and 600 ug/ml of G418 to obtain positive monoclonal colonies, which were verified by sequencing to obtain correctly linked positive recombinant yeast transformants. It is a probiotic recombinant Saccharomyces cerevisiae that can assist in the degradation of proteins and the secretion of antimicrobial peptides.

3. Protease and antibacterial activity test of recombinant Saccharomyces cerevisiae

1) Detection of protease activity

experimental method:

The probiotic recombinant Saccharomyces cerevisiae, which can be used in the previous step to assist in the degradation of proteins and secrete antibacterial peptides, was transferred to a YPD plate containing 1% casein. The formula was as follows (the content of each component of YPD was halved, and casein was added as a substrate for protease digestion) : yeast extract 2.5g / l, tryptone 2.5g / l, glucose 10.0g / l, casein 10.0g / l, agar powder 15g / l, cultured at 30 ° C for more than 48h, placed at 4 degrees for 1h, Observe whether there is a clear transparent hydrolyzed circle. The recombinant Saccharomyces cerevisiae was assayed for protease activity using the forinol method in the national standard "Protease Formulation" (GB/T23527-2009).

Experimental results:

The observation results are shown in Fig. 1. It can be seen that there is a clear hydrolyzed transparent circle around the recombinant Saccharomyces cerevisiae constructed in this example (the size of the hydrolysis circle of the recombinant bacteria is larger than that of the host Saccharomyces cerevisiae), indicating that the recombinant Saccharomyces cerevisiae can degrade the protein. .

The results of the protease enzyme activity assay for recombinant S. cerevisiae are shown in Table 6, from which it can be seen that the protease activity of the recombinant Saccharomyces cerevisiae constructed in Example 2 is significantly higher than that of the unmodified host Saccharomyces cerevisiae, up to 26 U/ml.

The above results indicate that the corresponding acid protease gene, neutral protease gene and antimicrobial peptide gene are co-expressed in Saccharomyces cerevisiae in Example 2, and the acid protease gene and neutral protease gene of the obtained recombinant strain are well expressed. The secreted acid protease and neutral protease have good enzymatic activity.

Table 6 Recombinant protease protease activity assay

Strain

Protease activity (U/ml)

宿主酿酒酵母Host Saccharomyces	3.33.3
实施例2重组酿酒酵母Example 2 recombinant Saccharomyces cerevisiae	2626

2) Antibacterial activity test

experimental method:

The Gram-positive bacteria Staphylococcus aureus ATCC22023 and Bacillus subtilis were used as test bacteria, cultured in liquid medium to OD ₆₀₀ nm=0.4-1, appropriately diluted, mixed and uniformly coated onto MH medium plate. Medium (medium formula: 5 g/l beef extract, 17.5 g/l casein hydrolysate, 1.5 g/l starch, agar powder 20 g/l). The fermentation broth of the recombinant Saccharomyces cerevisiae obtained in the present example was added to an Oxford cup, the sterilized water was used as a negative control, and ampicillin (1.5 μg) was used as a positive control, and cultured at 37 ° C for 16-18 hours to observe the inhibition zone.

Experimental results:

The experimental results are shown in FIG. 2 and FIG. 3 , and it can be seen that the fermentation broth of the recombinant Saccharomyces cerevisiae constructed in the present embodiment has obvious inhibition zones against Staphylococcus aureus ATCC22023 and Bacillus subtilis, indicating that the recombinant wine is obtained. Yeast successfully secretes antibacterial peptides.

Example 3 Construction of a multi-gene co-expression vector containing an acid protease gene, an aspartic protease gene and an antimicrobial peptide gene

The method for constructing the Saccharomyces cerevisiae multi-gene co-expression vector in this example is the same as in Example 1, except that the neutral protease gene ligated into the vector is replaced with the aspartic protease gene of Aspergillus flavus (base sequence such as The serotypes of the Saccharomyces cerevisiae multi-gene co-expression vector constructed in this example are the same as in Example 1, as shown in SEQ ID NO: 3, with reference to the gene sequence NCBI: XM_002375471. obtained by codon optimization, chemical synthesis. For pTEGC-ap-atp-amp.

Example 4 Construction of a multi-gene co-expression vector containing an acid protease gene, a serine protease gene and an antimicrobial peptide gene

The method for constructing the S. cerevisiae multi-gene co-expression vector in this example is the same as in Example 1, except that the neutral protease gene ligated into the vector is replaced with the serine protease gene of Aspergillus oryzae (base sequence is SEQ ID NO: As shown in Fig. 4, with reference to the gene sequence NCBI published on Genbank: XM_001821085.2. obtained by codon optimization, chemical synthesis, the others are the same as in Example 1. The Saccharomyces cerevisiae multi-gene co-expression vector constructed in this example was named pTEGC. -ap-sp-amp.

Example 5 Construction of a multi-gene co-expression vector containing an aspartic protease gene, a serine protease gene and an antimicrobial peptide gene

The method for constructing the Saccharomyces cerevisiae multi-gene co-expression vector in this example is the same as in Example 1, except that the acidity to be ligated into the vector is The protease gene and the neutral protease gene are replaced with the aspartic protease gene of Aspergillus flavus (the base sequence is shown in SEQ ID NO: 3, and the gene sequence published on Genbank is NCBI: XM_002375471. Codon-optimized) , obtained by chemical synthesis) and the serine protease gene of Aspergillus oryzae (base sequence is shown in SEQ ID NO: 4, refer to the gene sequence published on Genbank NCBI: XM_001821085.2. Codon-optimized, chemical synthesis) The other Saccharomyces cerevisiae multi-gene co-expression vector constructed in this example was named pTEGC-atp-sp-amp.

Example 6 Construction of a recombinant Saccharomyces cerevisiae

The Saccharomyces cerevisiae multi-gene co-expression vector pTEGC-ap-atp-amp constructed in Example 3 was linearized with restriction endonuclease and transferred into S. cerevisiae using lithium acetate-mediated electroporation transformation at a G418 concentration of 300 μg. The cells were cultured on /ml YPD plates for more than 48 hours, and the single colonies grown were picked as transformants. The PCR-converted transformants were screened in YPD liquid medium containing 300 μg/ml, 500 μg/ml, and 600 μg/ml of G418 to obtain positive monoclonal colonies, which were verified by sequencing to obtain correctly linked positive recombinant yeast transformants. Just fine.

Example 7 Construction of a recombinant Saccharomyces cerevisiae

The Saccharomyces cerevisiae multi-gene co-expression vector pTEGC-ap-sp-amp constructed in Example 4 was linearized with restriction endonuclease and transferred into S. cerevisiae using lithium acetate-mediated electroporation transformation at a G418 concentration of 300 μg. The cells were cultured on /ml YPD plates for more than 48 hours, and the single colonies grown were picked as transformants. The PCR-converted transformants were screened in YPD liquid medium containing 300 μg/ml, 500 μg/ml, and 600 μg/ml of G418 to obtain positive monoclonal colonies, which were verified by sequencing to obtain correctly linked positive recombinant yeast transformants. Just fine.

Example 8 Construction of a recombinant Saccharomyces cerevisiae

The Saccharomyces cerevisiae multi-gene co-expression vector pTEGC-atp-sp-amp constructed in Example 5 was linearized with restriction endonuclease and transferred into S. cerevisiae using lithium acetate-mediated electroporation transformation at G418 concentration. The cells were cultured on a 300 μg/ml YPD plate for more than 48 hours, and the grown single colonies were picked as transformants. The PCR-converted transformants were screened in YPD liquid medium containing 300 μg/ml, 500 μg/ml, and 600 μg/ml of G418 to obtain positive monoclonal colonies, which were verified by sequencing to obtain correctly linked positive recombinant yeast transformants. Just fine.

Example 9 Comparison of Antibacterial Properties of Antibacterial Peptide Mutants and Original Antibacterial Peptides

The antibacterial peptide Esculentin-1RE1 of Rana exilispinosa and its mutant Es-1RE1-T (the base sequence of which is shown in SEQ ID NO: 5) were synthesized by the biotechnology company. Salmonella CMCC50071, Escherichia coli CICC10899 and Staphylococcus aureus ATCC22023 were used as indicator bacteria to detect the minimum inhibitory concentration (MIC) of the above-mentioned indicator bacteria before and after the mutation of the antibacterial peptide Esculentin-1RE1.

The test results are shown in Table 7, and the antibacterial properties (MIC) of the antibacterial peptide mutant Es-1RE1-T of the small spiny frog used in the present invention. The indicator) is superior to the unmutated antimicrobial peptide.

Table 7 antibacterial peptide antibacterial performance comparison table

Further testing of the recombinant Saccharomyces cerevisiae prepared in the different examples described above is carried out.

1. Detection of antibacterial activity of recombinant Saccharomyces cerevisiae

Taking antibacterial activity detection as an example

experimental method:

Gram-positive bacteria Staphylococcus aureus ATCC22023 and Gram-negative bacteria Escherichia coli CICC10899 were used as test bacteria, cultured in liquid medium to OD ₆₀₀ nm=0.4-1, appropriately diluted, mixed and uniformly coated. To the MH medium plate (medium formula: 5 g/l beef extract, 17.5 g/l casein hydrolysate, 1.5 g/l starch, agar powder 20 g/l). The same amount of activated recombinant Saccharomyces cerevisiae constructed in Examples 2, 6, 7, and 8 and the unmodified original host Saccharomyces cerevisiae fermentation broth supernatant, in the Oxford Cup, with sterile water as a negative control Ampicillin (1.5 μg) was used as a positive control, and cultured at 37 ° C for 16-18 h to observe the inhibition zone.

Experimental results:

The test results are shown in Table 8. It can be seen that the fermentation broth of the recombinant Saccharomyces cerevisiae constructed in Example 2 has the most obvious inhibition zone against Staphylococcus aureus ATCC22023 and Escherichia coli CICC10899, and the antibacterial activity is the strongest. The recombinant Saccharomyces cerevisiae constructed in 6-8 had antibacterial effects (inhibition zone size) against Staphylococcus aureus ATCC22023 and Escherichia coli CICC10899, but slightly lower than that of Example 2.

Table 8 bacteriostatic statistics of recombinant Saccharomyces cerevisiae in different examples

Note: The outside diameter of the Oxford Cup is 8mm, and the actual inhibition zone size is d-8,mm.

2. Detection of recombinant Saccharomyces cerevisiae protease activity

experimental method:

The largest monoclonal clones using the casein screen in each of the examples were selected, and the recombinant Saccharomyces cerevisiae constructed in the same manner as in Examples 2, 6, 7, and 8 and the unmodified original host Saccharomyces cerevisiae were respectively taken. , respectively, into the YPD liquid medium containing 2% casein inducing substrate, the amount of each group of medium is equal, shake culture at 72 ° C, 220 rpm for 72 h, supplement the appropriate amount of glucose and other carbon sources every 24 h, draw on The supernatant was assayed for protease activity. The total protease activity was determined by reference to the forintol method in the national standard "Protease Formulation" (GB/T23527-2009) at pH 6.5 and a temperature of 40 °C. Refer to the national standard GB/T 22492-2008 "soybean peptide powder" to extract and determine the content of acid-soluble protein (small peptide and amino acid), indicating the degradation effect of recombinant bacteria on protein.

Experimental results:

The test results are shown in Table 9. It can be seen that the recombinant S. cerevisiae activity of Example 2 was the highest, reaching 35 U/ml; the ability to degrade protein was the best, and the acid-soluble protein content in the medium was the highest, reaching 15.6 g/100 ml. .

The recombinant S. cerevisiae total protease activity as constructed in Examples 6-8 was about half that of Example 2. The acid-soluble protein content in the medium was 7-8 g/100 ml, which was significantly lower than that of the recombinant Saccharomyces cerevisiae of Example 2.

The host Saccharomyces cerevisiae has only endogenous protease activity, about 4.3 U/ml, and its acid-soluble protein content is close to that of the medium, and it can not degrade the protein.

The above results indicate that the recombinant S. cerevisiae constructed in Example 2 has good acid protease and neutral protease activity, that is, when the acid protease, the neutral protease and the antibacterial peptide are co-expressed in the recombinant Saccharomyces cerevisiae, the recombinant Saccharomyces cerevisiae has The best protease activity.

Table 9 Recombinant Saccharomyces cerevisiae liquid fermentation degradation protein (casein)

组别Group	蛋白酶酶活(U/ml)Protease activity (U/ml)	酸溶蛋白含量(g/100ml)Acid soluble protein content (g/100ml)
培养基Medium	--	5.45.4
宿主酿酒酵母Host Saccharomyces	4.34.3	5.85.8
实施例2重组酿酒酵母Example 2 recombinant Saccharomyces cerevisiae	3535	15.615.6
实施例6重组酿酒酵母Example 6 recombinant Saccharomyces cerevisiae	1313	8.88.8
实施例7重组酿酒酵母Example 7 recombinant Saccharomyces cerevisiae	1818	7.27.2
实施例8重组酿酒酵母Example 8 recombinant Saccharomyces cerevisiae	1616	7.37.3

3. Detection of high-protein solid-state fermentation by different recombinant Saccharomyces cerevisiae

experimental method:

An equivalent amount of the activated recombinant Saccharomyces cerevisiae constructed in Examples 2, 6, 7, and 8 and the unmodified original host Saccharomyces cerevisiae were respectively subjected to solid-state fermentation of the raw material to produce a yeast culture, and the formulation was as follows: Soy protein isolate 40g, bran 10g, brown sugar 10g, chaff 5g, feed to water ratio of 1:1. GB/T 6432-1994 "Determination of crude protein in feed" by Kjeldahl method for determination of crude protein content; reference to national standard GB/T 22492-2008 "soy peptide powder" extraction and determination of acid-soluble protein content; reference GB/T 13093 -2006 "Determination of the total number of bacteria in the feed" The number of bacteria and the number of live yeasts were measured.

Experimental results:

The detection results are shown in Table 10. As can be seen from the above, after the recombinant Saccharomyces cerevisiae fermented the medium containing the high protein material, the yeast had the highest viable count, the crude protein increased, and the acid soluble protein content was higher. The yeast culture expressing the antibacterial peptide gene has less bacteria (spores) in the yeast culture; and the recombinant yeast Saccharomyces cerevisiae of Example 6-7 has a higher ratio of yeast viable cells, crude protein and acid-soluble protein than the host. The yeast was high, but both were lower than in Example 2, and the number of bacteria was also slightly higher than that of Example 2. It can be seen that the recombinant fermentation yeast constructed in Example 2 has the best solid-state fermentation effect.

Table 10 Results of solid-state fermentation of different recombinant Saccharomyces cerevisiae

Fourth, the effect of different recombinant Saccharomyces cerevisiae on the fermentation of kitchen waste

experimental method:

The same amount of activated recombinant Saccharomyces cerevisiae constructed in Examples 2, 6, 7, and 8 and the unmodified original host Saccharomyces cerevisiae were respectively subjected to liquid fermentation and decomposition of unsterilized kitchen waste within 1 day. Using its organic matter, and converting it into yeast protein and beneficial substances such as ethanol, the fermentation medium is as follows: kitchen waste 75g, glucose 10g, tryptone 5g, the ratio of material to water is 1:1, and the pH is adjusted to 6.0. After fermentation for 72 h, the parameters of the wet weight of the product were determined.

Experimental results:

The test results are shown in Table 11. As can be seen from the above, in the fermentation of the kitchen waste by the recombinant Saccharomyces cerevisiae of Example 2, the number of live bacteria of the yeast was higher, the amount of crude protein increased, and the content of acid-soluble protein was higher. Recombination of antibacterial peptide genes The bacteria in the yeast culture (spore) is one order of magnitude smaller than other recombinant bacteria that do not express the antimicrobial peptide. The experimental group of the recombinant bacteria has more yeasts and fewer bacteria, so the ethanol concentration is correspondingly higher. The recombinant Saccharomyces cerevisiae of Examples 6-7 fermented the kitchen waste, and the yeast viable cell count, crude protein increment, and acid-soluble protein increase were all superior to the host Saccharomyces cerevisiae, which was lower than that of Example 2, and the number of bacteria was also Higher.

Table 11 Test results of different recombinant Saccharomyces cerevisiae fermentation kitchen waste after 60h

The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and combinations thereof may be made without departing from the spirit and scope of the invention. Simplifications should all be equivalent replacements and are included in the scope of the present invention.

Claims

A Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degrading proteins and secreting antibacterial peptides, wherein the vector comprises a protease gene and an antibacterial peptide gene;

The base sequence of the antibacterial peptide gene is shown in SEQ ID NO: 5;

The protease gene is at least one selected from the group consisting of an acid protease gene, a neutral protease gene, an aspartic protease gene, and a serine protease gene.
The Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting degradation of a protein and secreting an antimicrobial peptide according to claim 1, wherein the base sequence of the acid protease gene is as shown in SEQ ID NO: The base sequence of the neutral protease gene is shown in SEQ ID NO: 2, the base sequence of the aspartic protease gene is shown in SEQ ID NO: 3, and the base sequence of the serine protease gene is SEQ ID: NO: 4 is shown.
The Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degrading proteins and secreting antibacterial peptides according to claim 1, wherein the protease gene is an acid protease gene and a neutral protease gene.
The Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degrading proteins and secreting antibacterial peptides according to claim 1, wherein the protease gene and the antibacterial peptide gene have an α-signal peptide gene sequence upstream, α- The base sequence of the signal peptide gene is shown in SEQ ID NO: 6.
A Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting degradation of a protein and secreting an antimicrobial peptide according to any one of claims 1 to 4, wherein the promoter of the protease gene is selected from the group consisting of pgk1-1 and pgk1-2 , the terminator is selected from the group consisting of pgkt1-1, pgkt1-2; the promoter of the antimicrobial peptide gene is pgk1-3, and the terminator is pgkt1-3;

The base sequence of the pgk1-1 is as shown in SEQ ID NO: 7.

The base sequence of the pgkt1-1 is shown in SEQ ID NO:8;

The base sequence of the pgk1-2 is as shown in SEQ ID NO:9;

The base sequence of the pgkt1-2 is as shown in SEQ ID NO:10;

The base sequence of the pgk1-3, as shown in SEQ ID NO: 11;

The base sequence of the pgkt1-3 is shown in SEQ ID NO: 12.
A Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degradation of a protein and secreting an antimicrobial peptide according to any one of claims 1 to 4, wherein the skeleton of the vector is a pGAPZaA plasmid.
A Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting degradation of a protein and secreting an antimicrobial peptide according to any one of claims 1 to 4, wherein the vector comprises a 25s rDNA gene fragment of Saccharomyces cerevisiae, and the base sequence thereof As shown in SEQ ID NO: 14.
A probiotic recombinant Saccharomyces cerevisiae capable of assisting in the degradation of proteins and secreting antibacterial peptides, wherein the recombinant Saccharomyces cerevisiae genome is inserted with the multi-gene co-expression vector of any one of claims 1 to 7.
The method for constructing a Saccharomyces cerevisiae multi-gene co-expression vector capable of assisting in degrading proteins and secreting antibacterial peptides according to any one of claims 1 to 7, comprising the steps of:

The S1 integrated expression vector pTEGC-BsmBI was constructed:

S1.1 ligated the G418 resistance gene between the multiple cloning sites Msc I and EcoR V of the pGAPZaA plasmid vector to obtain the vector pGAPZaA-G418;

S1.2, the base sequence is ligated into the vector pGAPZaA-G418 multiple cloning site BamHI and EcoRI, and the vector pGAPZaA-G418-rDNA is obtained;

S1.3 The vector pGAPZaA-G418-rDNA was double digested with Bgl II and EcoRI, and the large fragment product was recovered to obtain a linearized vector pTEGC, and the BsmBI-2 fragment represented by SEQ ID NO: 15 was linear. The vector pTEGC was ligated to obtain the integrated expression vector pTEGC-BsmBI;

S2 promoter, terminator amplification

Amplification of S2.1 promoter: using S. cerevisiae genomic DNA as a template, primers were used to amplify pgk1- by PGK1F1-BsmBI and PGK1R1-BsmBI, PGK1F2-BsmBI and PGK1R2-BsmBI, PGK1F3-BsmBI and PGK1R3-BsmBI, respectively. 1. pgk1-2, pgk1-3 promoter fragment;

Amplification of S2.2 terminator: using S. cerevisiae genomic DNA as a template, primers were used to amplify pgkt1-, PGKT1F1-BsmBI and PGKT1R1-BsmBI, PGKT1F2-BsmBI and PGKT1R2-BsmBI, PGKT1F3-BsmBI and PGKT1R3-BsmBI, respectively. 1. pgkt1-2, pgkt1-3 terminator fragment;

Acquisition of S3α-signal peptide gene, acid protease gene, neutral protease gene and antimicrobial peptide gene

Obtainment of S3.1α-signal peptide-acidase gene: T-vector containing α-signal peptide gene sequence, T-vector containing acid protease gene gene sequence as template, respectively, through primers MfaF1-BsmBI, Mfa-apR, Mfa- apF and apR-BsmBI were subjected to overlap extension PCR. The α-signal peptide gene sequence was ligated into the 5' end of the acid protease gene, and the mfa-ap gene fragment was amplified, which contained the α-signal peptide gene sequence and the acid protease gene sequence. Fragment

S3.2 Neutral protease gene was obtained: the T-vector containing the neutral protease gene was used as a template, and the primers npF-BsmBI and npR-BsmBI were used for amplification to obtain the recognition and cleavage site of the IIs-type restriction enzyme BsmBI. Point np gene fragment;

Acquisition of S3.3α-signal peptide-antibacterial peptide gene: T-vector containing α-signal peptide gene sequence, T-vector containing antibacterial peptide as template, respectively, through primers MfaF3-BsmBI, Mfa-ampF, Mfa-ampR and Mfa -ampR-BsmBI Performing overlap extension PCR to ligate the α-signal peptide sequence to the 5' end of the antibacterial peptide gene of the signal-free peptide, and amplifying the mfa-amp gene fragment, that is, a fragment containing the α-signal peptide gene sequence and the antimicrobial peptide gene sequence;

Construction of S4 Saccharomyces Cerevisiae Multi-gene Co-expression Vector

The acid protease gene expression cassette elements pgk1-1, mfa-ap, pgkt1-1 obtained above; neutral protease gene expression cassette elements pgk1-2, np, pgkt1-2; antibacterial peptide gene expression cassette elements pgk1-3, mfa -amp, pgkt1-3 was digested with the type IIs restriction endonuclease BsmBI, purified and recovered; at the same time, the above integrated expression vector pTEGC-BsmBI was cleaved by the type IIs restriction endonuclease BsmBI and linearized; The fragment is ligated into the linearized integrated expression vector pTEGC-BsmBI by a one-step method, and the Saccharomyces cerevisiae multi-gene co-expression vector is obtained;

The base sequences of the above primers are as follows:

PGK1F1-BsmBI: CGTTCCAPidc GAAGTACCTTCAAAG

PGK1R1-BsmBI: CGTCTCGGctaTATATTTGTTGTAAA

PGK1F2-BsmBI: CGTCTCAgtcaGAAGTACCTTCAAAG

PGK1R2-BsmBI: CGTCTCGGcatTATATTTGTTGTAAA

PGK1F3-BsmBI: CGTCTCAtgcaGAAGTACCTTCAAAG

PGK1R3-BsmBI: CGTCTCGtcgaTATATTTGTTGTAAA

PGKT1F1-BsmBI: CGTCTCAtgtacGATCTCCCATCGTCTCTACT

PGKT1R1-BsmBI: CGTCTCGGgtcaAAGCTTTTTCGAAACGCAG

PGKT1F2-BsmBI: CGTCTCAtacgGATCTCCCATCGTCTCTACT

PGKT1R2-BsmBI: CGTCTCGtgcaAAGCTTTTTCGAAACGCAG

PGKT1F3-BsmBI: CGTCTCAatcgGATCTCCCATCGTCTCTACT

PGKT1R3-BsmBI: CGTCTCGagtcAAGCTTTTTCGAAACGCAG

MfaF1-BsmBI: CGTTCCGctaATGAGATTTCCTTCAATTTTTAC

Mfa-apR: AGAGCAGCGGGCCCATGTCTTTTCTCGAGA

Mfa-apF: TCTCGAGAAAAGACATGGGCCCGCTGCTCT

apR-BsmBI: CGTCTCAatagCTAGTTCTTGGGAGAGGCA

npF-BsmBI: CGTCTCAgtcaATGAGAGTTACTACTTTGTCTACTG

npR-BsmBI CGTCTCAagctT TTAACACTTCAATTCGATAGCGT

MfaF3-BsmBI: CCTTCTCAtcga ATGAGATTTCCTTCAATTTTTAC

Mfa-ampR: ACTTAGAGAAGATACCTCTTTTCTCGAGAGA

Mfa-ampF: TCTCTCGAGAAAAGAGGTATCTTCTCTAAGT

Mfa-ampR-BsmBI: CGTCTCAtagcTCTGTTGTTTTGCCAAGAGGT.
A method for constructing a probiotic recombinant Saccharomyces cerevisiae capable of assisting in the degradation of proteins and secreting antibacterial peptides, wherein the Saccharomyces cerevisiae multi-gene co-expression vector constructed according to claim 9 is transformed into a Saccharomyces cerevisiae host, and positive monoclonal colonies are screened and sequenced. Properly verified, it is a probiotic recombinant Saccharomyces cerevisiae that can assist in the degradation of proteins and the secretion of antimicrobial peptides.