CN106854657B

CN106854657B - A kind of energy assistant degradation protein simultaneously secretes the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide

Info

Publication number: CN106854657B
Application number: CN201611186552.1A
Authority: CN
Inventors: 张宏刚; 李莉
Original assignee: GUANGZHOU GLAM BIOTECHNOLOGY CO Ltd
Current assignee: GUANGZHOU GLAM BIOTECHNOLOGY CO Ltd
Priority date: 2016-12-20
Filing date: 2016-12-20
Publication date: 2018-05-15
Anticipated expiration: 2036-12-20
Also published as: WO2018113429A1; CN106854657A

Abstract

The invention discloses a kind of energy assistant degradation protein and secrete the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide, containing assistant degradation protein and the saccharomyces cerevisiae polygenes coexpression vector of antibacterial peptide is secreted in the recombinant Saccharomyces cerevisiae, contain specific protease gene and antibacterial peptide gene in the carrier.Genetic recombination saccharomyces cerevisiae of the present invention can realize proteasome degradation, increase nitrogen source or production feature small peptide, while the antibacterial peptide of secretion has suppression miscellaneous bacteria, promote body growth and strengthen a variety of effects such as immune.In addition, by the combination collocation between the protease gene of different qualities, play synergistic effect of the different protease to protein degradation, wherein recombinant Saccharomyces cerevisiae can realize the protease for secreting different pH scopes, and non-confrontational bacterium peptide gene is degraded, so as to synchronously realize degraded and antibacterial peptide secretion of albumen etc..

Description

A kind of energy assistant degradation protein simultaneously secretes the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide

Technical field

The present invention relates to fields such as genetic engineering and Fermentation Engineerings, more particularly, to a kind of energy assistant degradation protein And secrete the recombinant Saccharomyces cerevisiae of antibacterial peptide.

Background technology

Protein component is generally relatively abundanter in feedstuff, generally requires and is degraded into peptides, amino by protease Acid, is recycled；Many prebiotic mushrooms, for example, bacillus and aspergillus niger or aspergillus oryzae etc. all can extracellular proteinase, it is right Protein component carries out decomposition utilization in environment, so that promote the thalli growth of probiotics itself, but saccharomyces cerevisiae or lactic acid The protease of bacterium secretion is less, relatively low to protein material degradation capability, generally requires the protein degradations such as supplement peptone Metabolin could preferably be grown；It is also general using acid or neutral proteinase in feed.Protease divides according to its mode of action For restriction endonuclease and excision enzyme, general microprotein enzyme is generally divided into the mixture of restriction endonuclease and excision enzyme.Feeding animal Protease is required supplementation with mostly, such as early-weaned piglets often need to add protease, make up and secrete digestive ferment in vivo Deficiency.

Antibacterial peptide (antimicrobial peptide) original refers to the one kind produced in insect bodies through induction and lives with antibacterial The basic polypeptide material of property, molecular weight are made of 20~60 amino acid residues 2000~7000 or so.This kind of active peptides Majority has the characteristics that strong basicity, heat endurance and broad-spectrum antiseptic.Antibacterial peptide suppresses pathogenic bacteria growth, and different antibacterial peptides are to thin Bacterium, fungi, protozoon and virus etc. have different killing abilities；Antibacterial peptide also has selective immune activation and regulatory function.

Important component of the saccharomyces cerevisiae as probiotics.Protein degradation enzyme is realized in Saccharomyces Serevisiae Expression System With the secreting, expressing of antibacterial peptide, organic collocation can will be carried out the advantages of both：On the one hand being secreted protease can degrade Protein in culture medium, increase nitrogen source, promote purpose growth of probiotics；On the other hand antibacterial peptide can be secreted, suppresses miscellaneous bacteria. In addition, in the protease gene of expression, between the protease for having played the protease or different restriction enzyme sites under different optimal pHs Synergistic effect, it is thus possible to more effectively degrade to protein raw material, production there is functional small peptide or amino acid Deng.In application aspect, using yeast culture letting animals feed, energy supplementing digestive enzyme, enhancing is immune and promotes to grow；Give up in kitchen In gurry, degraded waste eggshell white matter, increase nitrogen source, suppress miscellaneous bacteria.

The content of the invention

The technical problems to be solved by the invention are, in order to overcome the above-mentioned deficiency of the prior art, there is provided one kind can be The energy assistant degradation protein such as feed addition, industrial alcohol production, kitchen castoff simultaneously secretes antibacterial peptide recombinant Saccharomyces cerevisiae.This Invention is by by acid protease (Acid protease) gene, neutral proteinase (Neutral protease) gene, day Winter serine protease (Aspartic-type Endopeptidase) gene, serine protease (Serine Protease) base Because of different collocation and optimization, it is transferred to reference to antibacterial peptide gene by saccharomyces cerevisiae coexpression vector in saccharomyces cerevisiae.It is different The intergenic different collocation of protease gene, it can be achieved that reasonably optimizing between protease, effectively plays the collaboration between protease Effect, while secretion has the antibacterial peptides of antibacterial activity, so as to obtain that there is multi-functional prebiotic recombinant Saccharomyces cerevisiae.

It is an object of the invention to provide a kind of energy assistant degradation protein and secrete the saccharomyces cerevisiae polygenes of antibacterial peptide Coexpression vector and its construction method.

Another object of the present invention is to provide a kind of energy assistant degradation protein and secrete the prebiotic restructuring wine of antibacterial peptide Brewer yeast and its construction method.

The technical solution used in the present invention is：

A kind of energy assistant degradation protein simultaneously secretes the saccharomyces cerevisiae polygenes coexpression vector of antibacterial peptide, contains in the carrier There are protease gene, antibacterial peptide gene；

The base sequence of the antibacterial peptide gene such as SEQ ID NO：Shown in 5；

The protease gene is selected from acid protease gene, neutral protease gene, aspartic proteinase gene, silk At least one of serine protease gene.

Further, the base sequence of the acid protease gene such as SEQ ID NO：Shown in 1, the neutral proteinase The base sequence of gene such as SEQ ID NO：Shown in 2, the base sequence such as SEQ ID NO of the aspartic proteinase gene：3 It is shown, the base sequence such as SEQ ID NO of the serine protease gene：Shown in 4.

Further, the protease-based is because acid protease gene and neutral protease gene.

Further, there are α-signal peptide gene sequence, α-signal peptide for the protease gene, antibacterial peptide gene upstream The base sequence of gene such as SEQ ID NO：Shown in 6.

Further, the promoter of the protease gene gene is selected from pgk1-1, pgk1-2, and terminator is selected from pgkt1- 1、pgkt1-2；The promoter of the antibacterial peptide gene is pgk1-3, terminator pgkt1-3；

The base sequence of the pgk1-1 such as SEQ ID NO：Shown in 7；The base sequence of the pgkt1-1 such as SEQ ID NO：Shown in 8；The base sequence of the pgk1-2 such as SEQ ID NO：Shown in 9；The base sequence of the pgkt1-2 such as SEQ ID NO：Shown in 10；The pgk1-3, base sequence such as SEQ ID NO：Shown in 11；The base sequence of the pgkt1-3 such as SEQ ID NO：Shown in 12.

Further, the skeleton of the carrier is pGAPZaA plasmids.

Further, the 25s rDNA genetic fragments containing S. cervisiae, its base sequence such as SEQ in above-mentioned carrier ID NO：Shown in 14.

A kind of energy assistant degradation protein simultaneously secretes the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide, the recombinant Saccharomyces cerevisiae gene Inserted with any of the above-described polygenes coexpression vector in group.

A kind of any of the above-described energy assistant degradation protein and the saccharomyces cerevisiae polygenes coexpression load for secreting antibacterial peptide The construction method of body, comprises the following steps：

S1 integrating expression vectors pTEGC-BsmBI is built：

Between G418 resistant genes are connected into multiple cloning sites Msc I and the EcoR V of pGAPZaA plasmid vectors by S1.1, obtain Obtain carrier pGAPZaA-G418；

S1.2 is by base sequence such as SEQ ID NO：RDNA gene orders shown in 14 are connected into carrier pGAPZaA-G418 Between multiple cloning sites BamHI and EcoRI, carrier pGAPZaA-G418-rDNA is obtained；

Carrier pGAPZaA-G418-rDNA after Bgl II and EcoRI double digestions, is recycled large fragment product, obtained by S1.3 To linearized vector pTEGC, by base sequence such as SEQ ID NO：BsmBI-2 fragments and linearized vector pTEGC shown in 15 Connection, obtains integrating expression vector pTEGC-BsmBI；

The amplification of S2 promoters, terminator

The amplification of S2.1 promoters：Using saccharomyces cerevisiae genome DNA as template, respectively with primer pair PGK1F1-BsmBI and PGK1R1-BsmBI, PGK1F2-BsmBI and PGK1R2-BsmBI, PGK1F3-BsmBI and PGK1R3-BsmBI are amplified respectively Pgk1-1, pgk1-2, pgk1-3 promoter fragment；

The amplification of S2.2 terminators：Using saccharomyces cerevisiae genome DNA as template, respectively with primer pair PGKT1F1-BsmBI Distinguish with PGKT1R1-BsmBI, PGKT1F2-BsmBI and PGKT1R2-BsmBI, PGKT1F3-BsmBI and PGKT1R3-BsmBI Amplify pgkt1-1, pgkt1-2, pgkt1-3 and terminate sub-piece；

The acquisition of S3 α-signal peptide gene, acid protease gene, neutral protease gene, antibacterial peptide gene

The acquisition of S3.1 α-signal peptide-acid protease gene：Respectively with the carrier T containing α-signal peptide gene sequence, contain The carrier T of acid protease gene gene order is template, by primer MfaF1-BsmBI, Mfa-apR, Mfa-apF and ApR-BsmBI carries out the 5 ' ends that α-signal peptide gene sequence orientation is connected into acid protease gene gene by Overlap extension PCR, expands Increase and mfa-ap genetic fragments, i.e., the fragment containing α-signal peptide gene sequence and acid protease gene sequence；

The acquisition of S3.2 neutral protease genes：Using the carrier T containing neutral protease gene as template, with primer npF- BsmBI and npR-BsmBI are expanded, and obtain the np of the identification containing IIs type restriction enzymes BsmBI and cleavage site Genetic fragment；

The acquisition of S3.3 α-signal peptide-antibacterial peptide gene：Respectively with the carrier T containing α-signal peptide gene sequence, containing antibacterial The carrier T of peptide is template, and weight is carried out by primer MfaF3-BsmBI, Mfa-ampF, Mfa-ampR and Mfa-ampR-BsmBI α-signal peptide sequence orientation is connected into 5 ' ends of the antibacterial peptide gene of no signal peptide by folded extension PCR, amplifies mfa-amp gene pieces Section, i.e., the fragment containing α-signal peptide gene sequence and antibacterial peptide gene sequence；

The structure of S4 saccharomyces cerevisiae polygenes coexpression vectors

By acid protease gene expression box element pgk1-1, mfa-ap, pgkt1-1 of above-mentioned acquisition；Neutral proteinase Gene expression box element pgk1-2, np, pgkt1-2；Antibacterial peptide gene expression box element pgk1-3, mfa-amp, pgkt1-3 profit Digestion, purifying recycling are carried out with IIs type restriction enzymes BsmBI；Meanwhile cut using IIs type restriction enzymes BsmBI Above-mentioned integrating expression vector pTEGC-BsmBI, is linearized；These fragments used are connected into linearisation by one-step method orientation Integrating expression vector pTEGC-BsmBI in, up to saccharomyces cerevisiae polygenes coexpression vector；

The base sequence of primer described above is as follows：

PGK1F1-BsmBI：CGTCTCAgatc GAAGTACCTTCAAAG

PGK1R1-BsmBI：CGTCTCGgctaTATATTTGTTGTAAA

PGK1F2-BsmBI：CGTCTCAgtcaGAAGTACCTTCAAAG

PGK1R2-BsmBI：CGTCTCGgcatTATATTTGTTGTAAA

PGK1F3-BsmBI：CGTCTCAtgcaGAAGTACCTTCAAAG

PGK1R3-BsmBI：CGTCTCGtcgaTATATTTGTTGTAAA

PGKT1F1-BsmBI：CGTCTCAtgtacGATCTCCCATCGTCTCTACT

PGKT1R1-BsmBI：CGTCTCGgtcaAAGCTTTTTCGAAACGCAG

PGKT1F2-BsmBI：CGTCTCAtacgGATCTCCCATCGTCTCTACT

PGKT1R2-BsmBI：CGTCTCGtgcaAAGCTTTTTCGAAACGCAG

PGKT1F3-BsmBI：CGTCTCAatcgGATCTCCCATCGTCTCTACT

PGKT1R3-BsmBI：CGTCTCGagtcAAGCTTTTTCGAAACGCAG

MfaF1-BsmBI：CGTCTCAgctaATGAGATTTCCTTCAATTTTTAC

Mfa-apR：AGAGCAGCGGGCCCATGTCTTTTCTCGAGA

Mfa-apF：TCTCGAGAAAAGACATGGGCCCGCTGCTCT

apR-BsmBI：CGTCTCAatagCTAGTTCTTGGGAGAGGCA

npF-BsmBI：CGTCTCAgtcaATGAGAGTTACTACTTTGTCTACTG

npR-BsmBI CGTCTCAagctT TTAACACTTCAATTCGATAGCGT

MfaF3-BsmBI：CGTCTCAtcga ATGAGATTTCCTTCAATTTTTAC

Mfa-ampR：ACTTAGAGAAGATACCTCTTTTCTCGAGAGA

Mfa-ampF：TCTCTCGAGAAAAGAGGTATCTTCTCTAAGT

Mfa-ampR-BsmBI：CGTCTCAtagcTCTGTTGTTTTGCCAAGAGGT.

The construction method of a kind of energy assistant degradation protein and the prebiotic recombinant Saccharomyces cerevisiae for secreting antibacterial peptide, by above-mentioned structure The saccharomyces cerevisiae polygenes coexpression vector transformed saccharomyces cerevisiae host built, filters out positive monoclonal bacterium colony, and sequence verification Correctly, up to assistant degradation protein and the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide can be secreted.

The beneficial effects of the invention are as follows：

Genetic recombination saccharomyces cerevisiae of the present invention can realize proteasome degradation, increase nitrogen source or production feature small peptide, together When the antibacterial peptide secreted have and suppress miscellaneous bacteria, promote body growth and a variety of effects such as enhancing is immune.In addition, by different qualities Combination collocation between protease gene, plays synergistic effect of the different protease to protein degradation, wherein recombinant Saccharomyces cerevisiae It can realize the protease for secreting different pH scopes, and non-confrontational bacterium peptide gene is degraded, so as to synchronously realize albumen Degraded and antibacterial peptide secretion etc..

Brief description of the drawings

Fig. 1 is the recombinant Saccharomyces cerevisiae protease hydrolytic circle that embodiment 2 is built；1~9 is respectively the difference weight selected in figure Group monoclonal, No. 11 are host S. cervisiae.

Fig. 2 is bacteriostatic activity testing result of 2 recombinant Saccharomyces cerevisiae of embodiment to staphylococcus aureus ATCC22023； A, B are the zymotic fluid of recombinant Saccharomyces cerevisiae bacterium of the present invention in figure, and "+" is ampicillin, as positive control；"-" is H₂O, as negative control；

Fig. 3 is bacteriostatic activity testing result of 2 recombinant Saccharomyces cerevisiae of embodiment to bacillus subtilis；In figure " 81 " and " 65 " are the zymotic fluid of recombinant Saccharomyces cerevisiae bacterium of the present invention, and "+" is ampicillin, as positive control；"-" is H₂O, makees For negative control.

Embodiment

With reference to specific embodiment, the present invention is further illustrated, but is not limited thereto.

Saccharomyces cerevisiae polygenes of the embodiment 1 containing acid protease gene, neutral protease gene and antibacterial peptide gene The structure of coexpression vector

First, integrating expression vector pTEGC-BsmBI is built

1) acquisition of G418 resistant genes

PCR amplification target gene, using carrier pPIC9k as template, utilizes G418F-MscI and G418R-EcoRV primer (tables 1) G418 resistant genes are expanded.PCR reaction conditions：98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 50s, 30 circulations, 72 DEG C of 10min.Through 2% agarose gel electrophoresis is verified.

Target gene recycling, purifying, conversion Escherichia coli, verification, sample presentation sequencing.Recovery purifying purpose fragment, be stored in- 20 DEG C spare.Obtained G418 resistant genes are connected with carrier T, convert e.colistraindh5α, 37 DEG C of cultures, extract it Plasmid DNA, bacterium colony PCR screening positive strain is carried out using G418F-MscI and G418R-EcoRV primers, by positive colony send to The correctness of Invitrogen sequence verification gene.Sequencing result shows：G418 resistant genes and its restriction enzyme site are correctly connected into T Carry, do not undergo mutation, the base sequence such as SEQ ID NO of G418 resistant genes：Shown in 13.

Table 1 expands G418 resistant gene primers

Note：Letter is identification/cutting sequence of restriction enzyme at underscore.

2) structure of carrier pGAPZaA-G418

At 37 DEG C, pGAPZaA plasmids are cut using restriction enzyme MscI and EcoRV, and in 1.5% agarose Gel electrophoresis is verified；PMD-G418 carriers are cut using restriction enzyme cleavage MscI and EcoRV, obtain G418 resistance bases Cause, the agarose gel electrophoresis 1.5% are verified；PGAPZaA carriers, G418 resistance bases in the above-mentioned digestion products of recovery purifying Cause, is connected into carrier pGAPZaA by G418 resistant genes using T4 ligases, obtains carrier pGAPZaA-G418.

3) rDNA gene magnifications

Using saccharomyces cerevisiae genome DNA as template, using primer rDNAF and rDNAR primer (being shown in Table 2) PCR amplification rDNA Gene；PCR amplification condition is：98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 60s, 30 circulations, 72 DEG C of 10min；In 1% Ago-Gel Electrophoresis is verified, and introduces EcoRI and BamHI restriction enzyme sites respectively in upstream and downstream.

Obtained rDNA genes are connected with carrier T, convert e.colistraindh5α, 37 DEG C of cultures, extract its plasmid DNA, bacterium colony PCR screening positive strains are carried out using rDNAF and rDNAR primers.Sequencing result shows：RDNA genes and its digestion Site is correctly connected into T loads, does not undergo mutation, the base sequence such as SEQ ID NO of rDNA genes：Shown in 14.

Table 2 expands rDNA gene primers

4) carrier pGAPZaA-G418-rDNA is built

RDNA fragments, cutting plasmid under being cut using restriction enzyme BamHI and EcoRI in above-mentioned carrier T PGAPZaA-G418, rDNA, the load after linearisation is connected into using T4 ligases by recovery purifying pGAPZaA-G418 carrier frameworks Body pGAPZaA-G418, obtains recombinant vector pGAPZaA-G418-rDNA.

5) integrating expression vector pTEGC-BsmBI is built

Restriction enzyme cleavage Bgl II and EcoRI cut plasmid pGAPZaA-G418-rDNA, cut off on the carrier The sequences such as GAP promoters, a- signal peptides between BglII to EcoRI restriction enzyme sites, recycle large fragment product, obtain linearisation and carry Body pTEGC.

Using pMD19-T simple carriers as template, expanded by primer PMDF-BsmBI and PMDR-BsmBI (being shown in Table 3) Go out and identify sequence containing 2 BsmBI restriction enzyme sites, the fragment BsmBI-2 of about 233bp, is connected into carrier T, send to Invitrogen and surveys Sequence, sequencing is correct, does not undergo mutation, the base sequence such as SEQ ID NO of BsmBI-2：Shown in 15.

The carrier T after restructuring is cut using restriction enzyme cleavage Bgl II and EcoR I, recycles the DNA of about 233bp It, is then correctly connected into linearized vector pTEGC by fragment BsmBI-2 using T4 ligases, obtains integrating expression vector pTEGC-BsmBI。

Table 3 expands the DNA primer of skeleton containing BsmBI

Note：Capitalization at underscore is BglII or EcoRI restriction enzyme sites；Lowercase is IIs type restriction enzymes The identification sequence of enzyme BsmBI enzymes.

2nd, the amplification of promoter, terminator

1) amplification of promoter：

Using saccharomyces cerevisiae genome DNA as template, expanded using PGK1F1-BsmBI and PGK1R1-BsmBI primers (being shown in Table 4) Increase and pgk1-1 promoter fragments (its base sequence such as SEQ ID NO：Shown in 7), as opening for expression acid protease gene Mover.

Similarly, using genes of brewing yeast DNA as template, (it is shown in Table using PGK1F2-BsmBI and PGK1R2-BsmBI primers 4) pgk1-2 promoter fragments (its base sequence such as SEQ ID NO are amplified：Shown in 9), as expression neutral protease gene Promoter.

Similarly, using genes of brewing yeast DNA as template, (it is shown in Table using PGK1F3-BsmBI and PGK1R3-BsmBI primers 4) pgk1-3 promoter fragments (its base sequence such as SEQ ID NO are amplified：Shown in 11), as opening for expression antibacterial peptide gene Mover.

Promoter gene fragment obtained by above-mentioned amplification is respectively connected into pMD19-T Simple carriers, sequence verification, Retain correct positive colony.

2) amplification of terminator：

Using saccharomyces cerevisiae genome DNA as template, primer PGKT1F1-BsmBI and PGKT1R1-BsmBI (being shown in Table 4) are utilized Expand pgkt1-1 terminators (its base sequence such as SEQ ID NO：Shown in 8), for expressing the terminator of acidic protein gene.

Using saccharomyces cerevisiae genome DNA as template, primer PGKT1F2-BsmBI and PGKT1R2-BsmBI (being shown in Table 4) are utilized Expand pgkt1-2 terminators (its base sequence such as SEQ ID NO：Shown in 10), for expressing the termination of neutral protease gene Son.

Using saccharomyces cerevisiae genome DNA as template, primer PGKT1F3-BsmBI and PGKT1R3-BsmBI (being shown in Table 4) are utilized Expand pgkt1-3 terminators (its base sequence such as SEQ ID NO：Shown in 12), for expressing the terminator of antibacterial peptide gene.

Above-mentioned amplification obtains termination mrna exon fragment and is connected into pMD19-T Simple carriers, and sequence verification, retains Correct positive colony.

Table 4 expands saccharomyces cerevisiae promoter, the primer of terminator

Note：At underscore capitalization be IIs type restriction enzymes BsmBI identification sequence, underscore lowercase bold Letter is the cutting sequence of IIs type restriction enzymes BsmBI.

3rd, the acquisition of α-signal peptide gene, acid protease gene, neutral protease gene, antibacterial peptide gene

1) acquisition of α-signal peptide gene：Using saccharomyces cerevisiae genome DNA as template, using MfaF and MfaR primers (see Table 5) amplification obtain Mfa-BsmBI (fragment of α-signal peptide gene sequence i.e. containing BsmBI) fragment, amplification program is as follows： 98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 30s, 30 circulations, 72 DEG C of 10min；Carrier T is connected into, sample presentation sequencing, selects the correct positive Clone, so that by α-signal peptide gene (its base sequence such as SEQ ID NO：Shown in 6) preserve into carrier T.

Table 5 expands α-signal peptide gene, acid protease gene, neutral protease gene, antibacterial peptide gene primer

Note：Capitalization is the identification sequence of IIs type restriction enzymes BsmBI at underscore, and small letter is thick at underscore The cutting sequence that body letter is IIs type restriction enzymes BsmBI.

2) acquisition of acid protease gene：With reference to the black mold (Aspergillus niger) announced on Genbank Acid endopeptidase (acid protease) ap (XM_001397119.2) is (acid by the acid endopeptidase after artificial synthesized optimization Protease) gene ap base sequence such as SEQ ID NO：(bases longs 1140bp, amino acid sequence no signal peptide) shown in 1.

3) acquisition of neutral protease gene：With reference to the aspergillus oryzae (Aspergillus oryzae) announced on Genbank The base sequence such as SEQ that neutral protease gene np (S53810.1) passes through the neutral protease gene np after artificial synthesized optimization ID NO：(bases longs 1059bp, amino acid sequence have signal peptide) shown in 2.

4) acquisition of antibacterial peptide gene：Pass through the antibacterial of the clavula frog Rana exilispinosa after artificial synthesized optimization The base sequence such as SEQ ID NO of peptide Esculentin-1RE1 mutant Es-1RE1-T：Shown in 5, its amino acid sequence is GIFSKFLGKGLKNLFMKGAKTIGKEVGMDVVRTGIDIAGCKIKGEC(SEQ ID NO:46)。

By above-mentioned gained acid protease gene ap, neutral protease gene np, antibacterial peptide Esculentin-1RE1 mutation Body Es-1RE1-T gene orders are stored in pMD19-T Simple plasmids respectively, spare.

5) acquisition of α-signal peptide-acid protease gene：Respectively with the carrier T containing α-signal peptide gene sequence, containing acid The carrier T of property protease gene ap sequences is template, with special primer MfaF1-BsmBI, Mfa-apR, Mfa-apF and apR- α-signal peptide gene sequence orientation is connected into acid protease gene by BsmBI (being shown in Table 5) by Overlap extension PCR (SOE-PCR) 5 ' the ends of ap, amplify mfa-ap genetic fragments (containing α-signal peptide gene sequence and acid protease gene ap).

6) acquisition of neutral protease gene：Using the carrier T of the np containing neutral protease gene as template, with primer npF- BsmBI and npR-BsmBI (being shown in Table 5) are expanded, and obtain identification and cutting containing IIs type restriction enzymes BsmBI The np genetic fragments in site.

7) acquisition of α-signal peptide-antibacterial peptide gene：Respectively with the carrier T containing α-signal peptide gene sequence, containing antibacterial peptide The carrier T of Esculentin-1RE1 mutant Es-1RE1-T genes is template, with primer MfaF3-BsmBI, Mfa-ampF, Mfa-ampR and Mfa-ampR-BsmBI (being shown in Table 5) is connected α-signal peptide sequence orientation by Overlap extension PCR (SOE-PCR) Enter 5 ' ends of the antibacterial peptide gene of no signal peptide, amplify mfa-amp genetic fragments (containing α-signal peptide gene sequence and antibacterial Peptide Esculentin-1RE1 mutant Es-1RE1-T genes).

Above-mentioned amplification obtains genetic fragment and is connected into pMD19-Simple carriers, sequence verification, retains correctly sun Property clone.

4th, the polygenes coexpression vector containing acid protease gene, neutral protease gene and antibacterial peptide gene The structure of pTEGC-ap-np-amp

Acid protease gene expression box element pgk1-1 (promoter), the mfa-ap that will be obtained in above-mentioned " two " and " three " (containing α-signal peptide gene sequence and acid protease gene ap), pgkt1-1 (terminator)；Neutral protease gene expression cassette Element pgk1-2 (promoter), np (containing neutral protease gene np), pgkt1-2 (terminator)；Antibacterial peptide gene expression cassette Element pgk1-3 (promoter), mfa-amp (contain α-signal peptide gene sequence and antibacterial peptide Esculentin-1RE1 mutant Es-1RE1-T genes), pgkt1-3 (terminator) cut respectively from carrier T using IIs type restriction enzymes BsmBI, purify Recycling；Meanwhile the integrating expression vector pTEGC- of structure in above-mentioned " one " is cut using IIs type restriction enzymes BsmBI BsmBI, is linearized.An above-mentioned coupled reaction of fragment orientation is connected into integrating expression vector pTEGC- using T4 ligases BsmBI, obtains saccharomyces cerevisiae polygenes coexpression vector pTEGC-ap-np-amp, converts escherichia coli DH5a, selects conversion Son, sequence verification, obtains the positive transformant correctly connected, extracts plasmid, up to containing acid protease gene, neutral proteinase The polygenes coexpression vector pTEGC-ap-np-amp of gene and antibacterial peptide gene.

The structure of a kind of energy assistant degradation protein of embodiment 2 and the prebiotic recombinant Saccharomyces cerevisiae for secreting antibacterial peptide

First, the pretreatment of polygenes coexpression vector pTEGC-ap-np-amp

The polygenes coexpression vector pTEGC-ap-np-amp conversion escherichia coli DH5as that embodiment 1 is built carry out Activation and the overnight incubation in LB liquid medium, extract its plasmid, and carry out purifying recycling.Utilize restriction enzyme HpaI Linearized enzyme digestion is carried out, recovery purifying is spare.

2nd, the screening and verification of recombination yeast transformant

After polygenes coexpression vector pTEGC-ap-np-amp linearisations, saccharomyces cerevisiae is transferred to using Electroporation Transformation method In (the highest tolerable concentration to G418 is 200 μ g/ml), G418 concentration be 300 μ g/ml YPD tablets on cultivate 48h with On, the single bacterium colony that picking is grown is transformant.Transformant after verification is progressively containing 300ug/ml, 500ug/ml, 600ug/ml G418 YPD fluid nutrient mediums in carry out highly resistance screening, obtain positive monoclonal bacterium colony, sequence verification, obtains correct connection Positive restructuring yeast transformant, up to assistant degradation protein and the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide can be secreted.

3rd, the protease of recombinant Saccharomyces cerevisiae secretion and bacteriostatic activity are examined

1) proteinase activity detects

Experimental method：

Assistant degradation protein and it will can secrete the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide and be transferred to containing 1% obtained by upper step On the YPD tablets of casein, formula is following (each component contents of YPD halve, and add casein as protease hydrolyzed substrate)： Yeast extract 2.5g/l, tryptone 2.5g/l, glucose 10.0g/l, casein 10.0g/l, agar powder 15g/l, 30 More than 48h is cultivated under the conditions of DEG C, 1h is placed at 4 degree, observation whether there is obvious transparent hydrolysis circle.Utilize national standard " protease system Forint phenol method in agent " (GB/T23527-2009) carries out recombinant Saccharomyces cerevisiae the measure of proteinase activity.

Experimental result：

The results are shown in Figure 1 for observation, there it can be seen that having obvious water around the recombinant Saccharomyces cerevisiae of the present embodiment structure Solve transparent circle and (the hydrolysis circle size of recombinant bacterium is all higher than host's saccharomyces cerevisiae) occur, illustrate that recombinant Saccharomyces cerevisiae can degrade profit Use albumen.

It is as shown in table 6 to the proteinase activity testing result of recombinant Saccharomyces cerevisiae, it can be seen that what embodiment 2 was built The proteinase activity of recombinant Saccharomyces cerevisiae is significantly higher than not engineered host's saccharomyces cerevisiae, up to 26U/ml.

The above results illustrate corresponding acid protease gene, neutral protease gene and antibacterial peptide in embodiment 2 Gene co-expresses in saccharomyces cerevisiae body, screens the acid protease gene of the recombinant bacterium of acquisition, neutral protease gene obtains Good expression effect, and secreted acid protease, neutral proteinase have good enzymatic activity.

6 recombinant bacterium proteinase activity of table measures

Strain	Proteinase activity (U/ml)
		Host's saccharomyces cerevisiae	3.3
2 recombinant Saccharomyces cerevisiae of embodiment	26

2) bacteriostatic activity detects

Experimental method：

Using gram-positive bacteria staphylococcus aureus ATCC22023, bacillus subtilis as tested bacterium, trained through liquid Support in base and cultivate in OD₆₀₀Nm=0.4-1, appropriate dilution, mix, even spread (culture medium prescription into MH culture medium flat plates For：5g/l beef extracts leaching powder, 17.5g/l caseins hydrolysate, 1.5g/l starch, agar powder 20g/l).By weight obtained by the present embodiment The zymotic fluid of group S. cervisiae is added in Oxford cup, is the positive with ampicillin (1.5 μ g) using aqua sterilisa as negative control Control, cultivates 16-18h at 37 DEG C, observes inhibition zone situation.

Experimental result：

Experimental result as shown in Figures 2 and 3, there it can be seen that the present embodiment structure recombinant Saccharomyces cerevisiae bacterium hair Zymotic fluid has obvious inhibition zone to staphylococcus aureus ATCC22023 and bacillus subtilis, illustrates gained restructuring wine brewing Saccharomycete successful secretion goes out antibacterial peptide.

Polygenes of the embodiment 3 containing acid protease gene, aspartic proteinase gene and antibacterial peptide gene is total to table Up to the structure of carrier

The method of the present embodiment structure saccharomyces cerevisiae polygenes coexpression vector is with embodiment 1, except that will be connected into carrier Neutral protease gene replace with the aspartic proteinase gene (base sequence of yellow inulinase (Aspergillus flavus) Such as SEQ ID NO：Shown in 3, with reference to announcement gene order NCBI on Genbank:XM_002375471. through codon optimization, change Synthesis is learned to obtain) outside, other are same as Example 1, the saccharomyces cerevisiae polygenes coexpression vector name of the present embodiment structure For pTEGC-ap-atp-amp.

Polygenes coexpression of the embodiment 4 containing acid protease gene, serine protease gene and antibacterial peptide gene The structure of carrier

The method of the present embodiment structure saccharomyces cerevisiae polygenes coexpression vector is with embodiment 1, except that will be connected into carrier Neutral protease gene replace with the serine protease gene of aspergillus oryzae (Aspergillus oryzae) (base sequence be such as SEQ ID NO：Shown in 4, with reference to announcement gene order NCBI on Genbank:XM_001821085.2. through codon optimization, change Synthesis is learned to obtain) outside, other are same as Example 1, the saccharomyces cerevisiae polygenes coexpression vector name of the present embodiment structure For pTEGC-ap-sp-amp.

Polygenes of the embodiment 5 containing aspartic proteinase gene, serine protease gene and antibacterial peptide gene is total to The structure of expression vector

The method of the present embodiment structure saccharomyces cerevisiae polygenes coexpression vector is with embodiment 1, except that will be connected into carrier Acid protease gene, neutral protease gene replace with the aspartic acid albumen of yellow inulinase (Aspergillus flavus) Enzyme gene (base sequence such as SEQ ID NO：Shown in 3, with reference to announcement gene order NCBI on Genbank:XM_002375471. Through codon optimization, chemical synthesis obtain) and aspergillus oryzae (Aspergillus oryzae) serine protease gene (base Sequence such as SEQ ID NO：Shown in 4, with reference to announcement gene order NCBI on Genbank:XM_001821085.2. it is excellent through codon Change, chemical synthesis obtains) outside, other are same as Example 1, the saccharomyces cerevisiae polygenes coexpression vector of the present embodiment structure It is named as pTEGC-atp-sp-amp.

A kind of structure of 6 recombinant Saccharomyces cerevisiae of embodiment

The saccharomyces cerevisiae polygenes coexpression vector pTEGC-ap-atp-amp restriction enzymes that embodiment 3 is built Linearisation, the Electroporation Transformation method mediated using lithium acetate are transferred in saccharomyces cerevisiae, are put down in the YPD that G418 concentration is 300 μ g/ml More than 48h is cultivated on plate, the single bacterium colony that picking is grown is transformant.Transformant after PCR is verified progressively containing 300 μ g/ml, 500 μ g/ml, 600 μ g/ml G418 YPD fluid nutrient mediums in screen, obtain positive monoclonal bacterium colony, sequence verification, obtain The positive restructuring yeast transformant correctly connected, you can.

A kind of structure of 7 recombinant Saccharomyces cerevisiae of embodiment

The saccharomyces cerevisiae polygenes coexpression vector pTEGC-ap-sp-amp restriction enzymes that embodiment 4 is built Linearisation, the Electroporation Transformation method mediated using lithium acetate are transferred in saccharomyces cerevisiae, are put down in the YPD that G418 concentration is 300 μ g/ml More than 48h is cultivated on plate, the single bacterium colony that picking is grown is transformant.Transformant after PCR is verified progressively containing 300 μ g/ml, 500 μ g/ml, 600 μ g/ml G418 YPD fluid nutrient mediums in screen, obtain positive monoclonal bacterium colony, sequence verification, obtain The positive restructuring yeast transformant correctly connected, you can.

A kind of structure of 8 recombinant Saccharomyces cerevisiae of embodiment

The saccharomyces cerevisiae polygenes coexpression vector body pTEGC-atp-sp-amp restriction enzymes that embodiment 5 is built Enzyme linearizes, and the Electroporation Transformation method mediated using lithium acetate is transferred in saccharomyces cerevisiae, in the YPD that G418 concentration is 300 μ g/ml More than 48h is cultivated on tablet, the single bacterium colony that picking is grown is transformant.Transformant after PCR is verified is progressively containing 300 μ g/ Ml, 500 μ g/ml, 600 μ g/ml G418 YPD fluid nutrient mediums in screen, obtain positive monoclonal bacterium colony, sequence verification, Obtain the positive restructuring yeast transformant correctly connected, you can.

9 antibacterial peptide mutant of embodiment and the anti-microbial property of former antibacterial peptide contrast

By biotech firm synthesize the antibacterial peptide Esculentin-1RE1 of clavula frog Rana exilispinosa with and its Mutant Es-1RE1-T (its base sequence such as SEQ ID NO：Shown in 5).With salmonella CMCC50071, Escherichia coli CICC10899 and staphylococcus aureus ATCC22023 is as indicator bacteria, before the Esculentin-1RE1 mutation of detection antibacterial peptide Afterwards to the minimal inhibitory concentration (MIC) of above-mentioned indicator bacteria.

Testing result is as shown in table 7, the anti-microbial property for the clavula frog antibacterial peptide mutant Es-1RE1-T that the present invention uses (MIC indexs) is superior to unmutated antibacterial peptide.

7 antibacterial peptide anti-microbial property contrast table of table

The recombinant Saccharomyces cerevisiae prepared below to above-mentioned different embodiments makees further performance detection

First, the detection of recombinant Saccharomyces cerevisiae bacteriostatic activity

By taking bacteriostatic activity detects as an example

Experimental method：

Gram-positive bacteria staphylococcus aureus ATCC22023, Gram-negative bacteria Escherichia coli CICC10899 are made For tested bacterium, through being cultivated in fluid nutrient medium in OD₆₀₀Nm=0.4-1, appropriate dilution, mix, even spread to MH culture mediums (culture medium prescription is in tablet：5g/l beef extracts leaching powder, 17.5g/l caseins hydrolysate, 1.5g/l starch, agar powder 20g/l). The recombinant Saccharomyces cerevisiae bacterium and not engineered original host wine brewing that the embodiment after the activation of equivalent 2,6,7,8 is built are taken respectively The fermented liquid supernatant of saccharomycete, in Oxford cup, using aqua sterilisa as negative control, with ampicillin (1.5 μ g) for positive control, 16-18h is cultivated at 37 DEG C, observes inhibition zone situation.

Experimental result：

Testing result is as shown in table 8, there it can be seen that the zymotic fluid pair for the recombinant Saccharomyces cerevisiae bacterium that embodiment 2 is built The inhibition zone of staphylococcus aureus ATCC22023 and Escherichia coli CICC10899 are the most obvious, and bacteriostatic activity is most strong, implement The recombinant Saccharomyces cerevisiae of example 6-8 structures has antibacterial effect to staphylococcus aureus ATCC22023 and Escherichia coli CICC10899 Fruit (inhibition zone size), but slightly below embodiment 2.

The antibacterial statistical form of recombinant Saccharomyces cerevisiae bacterium of the different embodiments of table 8

Note：The outer 8mm of Oxford cup outside diameter, actual inhibition zone size is d-8, mm.

2nd, the detection of recombinant Saccharomyces cerevisiae proteinase activity

Experimental method：

The monoclonal of the hydrolysis circle maximum in each embodiment using casein screening is selected, after taking the activation of equivalent respectively The recombinant Saccharomyces cerevisiae bacterium and not engineered original host S. cervisiae that embodiment 2,6,7,8 is built, are respectively connected to induce In YPD fluid nutrient mediums of the substrate containing 2% casein, each group culture medium dosage is equal, and training is vibrated under the conditions of 30 DEG C, 220rpm Support to 72h, supplement the carbon sources such as appropriate glucose every 24h, Aspirate supernatant carries out proteinase activity measure.With reference to national standard " egg Forint phenol method in white enzyme preparation " (GB/T23527-2009) in pH6.5, temperature for 40 DEG C of progress total protease enzyme activity surveys It is fixed.Extracted with reference to national standard GB/T 22492-2008 " soy peptide powder " and measure molten albumen (the small peptide and amino acid) content of acid, instruction Degradation effect of the recombinant bacterium to protein.

Experimental result：

Testing result such as table 9, there it can be seen that embodiment 2 builds recombinant Saccharomyces cerevisiae protease activity highest, reaches 35U/ml；The ability of protein degradation matter is optimal, and the sour molten protein content highest in its culture medium, reaches 15.6g/100ml.

And the recombinant Saccharomyces cerevisiae bacterium total protease enzyme activity that embodiment 6~8 is built is about the half of embodiment 2.It is cultivated The molten protein content of acid is in 7-8g/100ml in base, hence it is evident that less than the recombinant Saccharomyces cerevisiae of embodiment 2..

And host's saccharomyces cerevisiae only has endogenous protease enzyme activity, about 4.3U/ml, its sour molten protein content and culture medium It is close, protein degradation is unable to substantially.

The above results illustrate that embodiment 2 builds recombinant Saccharomyces cerevisiae bacterium and has good acid protease, neutral proteinase Activity, i.e., when acid protease, neutral proteinase and antibacterial peptide being carried out co expression in recombinant Saccharomyces cerevisiae bacterium, restructuring is made Brewer yeast bacterium has best proteinase activity.

9 recombinant Saccharomyces cerevisiae liquid fermentation protein degradation (casein) of table

Group	Proteinase activity (U/ml)	The molten protein content (g/100ml) of acid
			Culture medium	‐	5.4
Host's saccharomyces cerevisiae	4.3	5.8
			2 recombinant Saccharomyces cerevisiae of embodiment	35	15.6
6 recombinant Saccharomyces cerevisiae of embodiment	13	8.8
			7 recombinant Saccharomyces cerevisiae of embodiment	18	7.2
8 recombinant Saccharomyces cerevisiae of embodiment	16	7.3

3rd, different recombinant Saccharomyces cerevisiaes carry out the effect detection of high protein solid state fermentation

Experimental method：

Recombinant Saccharomyces cerevisiae bacterium that the embodiment after the activation of equivalent 2,6,7,8 is built and not engineered original is taken respectively Host S. cervisiae carries out the solid state fermentation of raw material, produces yeast culture, and formula is as follows：Dregs of beans (soybean protein isolate) 40g, wheat bran 10g, brown sugar 10g, husk 5g, material-water ratio 1:1.The kelvin of GB/T 6432-1994 " crude protein measures in feed " Nitriding measures crude protein content；Extracted with reference to national standard GB/T 22492-2008 " soy peptide powder " and measure the molten protein content of acid； With reference to GB/T 13093-2006 " measure of total number of bacteria in feed " detection bacterium numbers and yeast viable count.

Experimental result：

Testing result is as shown in table 10, there it can be seen that 2 recombinant Saccharomyces cerevisiae of embodiment fermentation material containing high protein After culture medium, yeast viable count highest, crude protein incrementss are more, the molten protein content higher of acid, and express antibacterial peptide gene Recombinant bacterium yeast culture in miscellaneous bacteria (gemma class) it is few；And product after the recombinant Saccharomyces cerevisiae solid state fermentation of embodiment 6-7 Yeast viable count, crude protein and the molten albumen equal size of acid are higher than host yeast, but are below embodiment 2, and miscellaneous bacteria Number is also slightly above embodiment 2.It follows that the solid state fermentation effect for the recombinant Saccharomyces cerevisiae that embodiment 2 is built is best.

The different recombinant Saccharomyces cerevisiae solid state fermentation 48h results of table 10

4th, the effect detection that different recombinant Saccharomyces cerevisiaes ferment kitchen castoff

Experimental method：

Recombinant Saccharomyces cerevisiae bacterium that the embodiment after the activation of equivalent 2,6,7,8 is built and not engineered original is taken respectively Host S. cervisiae carries out liquid fermentation the kitchen castoff in unpasteurized 1 day, and decomposition utilizes its organic matter, and converts It is as follows for the benefit materials such as Yeast protein and ethanol, fermentation medium：Kitchen castoff 75g, glucose 10g, tryptone 5g, material-water ratio 1:1, adjust pH to 6.0.Ferment 72h, measures each parameter under its product weight in wet base.

Experimental result：

Testing result is as shown in table 11, there it can be seen that 2 recombinant Saccharomyces cerevisiae of embodiment is to Kitchen waste fermentation In, bacterium yeast viable count higher, crude protein incrementss are more, the molten protein content higher of acid, and express the weight of antibacterial peptide gene Miscellaneous bacteria (gemma class) does not express few an order of magnitude of the recombinant bacterium of antibacterial peptide, recombinant bacterium than other in the yeast culture of group bacterium Experimental group yeast count it is more, miscellaneous bacteria is less, thus the corresponding higher of concentration of alcohol；The restructuring wine brewing ferment of embodiment 6-7 Its yeast viable count, crude protein increment, the molten albumen increment of acid are superior to host's saccharomyces cerevisiae after female fermenting kitchen discarded object, than reality The low of example 2 is applied, miscellaneous bacteria number is also higher.

Testing result after the different recombinant Saccharomyces cerevisiae fermenting kitchen discarded object 60h of table 11

Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention and from above-described embodiment Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.

SEQUENCE LISTING

<110>Guangzhou Glam Biotechnology Co., Ltd.

<120>A kind of energy assistant degradation protein simultaneously secretes the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide

<130>

<160> 46

<170> PatentIn version 3.5

<210> 1

<211> 1140

<212> DNA

<213>Artificial sequence

<400> 1

catgggcccg ctgctctccg caaagcatac cggaagtacg gaatagctcc cagcagtttc 60

aacatcgatc tggcagactt taaacccatt acgacaaccc atgctgctgc tgggagcgag 120

attgcagagc ctgatcagac tggcgctgtc agtgctactt ccgtcgagaa cgatgccgag 180

ttcgtttcgc ctgttcttat tggcggccag aagatcgtca tgacatttga cactggttct 240

tctgactttt gggtgttcga tacgaatctc aatgaaacct tgacgggaca cacggagtac 300

aacccttcga actcctcgac cttcaagaag atggacggat acaccttcga tgtctcgtat 360

ggtgacgact cgtacgcctc tggccccgtc ggaacggata ccgtcaacat tggcggcgcc 420

attgtcaagg agcaagcctt cggtgtcccc gaccaggtat cccagtcgtt catcgaggac 480

acgaactcca acggcctggt cgggttgggc ttttcctcca tcaacaccat caaaccggag 540

gcgcaagaca cgttcttcgc caatgtcgca ccaagtctgg acgagcccgt catgaccgcc 600

tcgctcaagg ctgacggagt gggcgagtac gagttcggca cgatcgacaa agacaagtac 660

cagggcaaca ttgccaacat cagcgtggac tcatcgaacg gatactggca gttctccact 720

cccaagtact ccgtggcaga cggagagctg aaggacattg gaagcttgaa cacctcgatc 780

gcggacaccg gtacctccct tatgctgctg gatgaagacg tggttactgc ctactatgcg 840

caagttccca actcggtcta cgtgagcagt gccggtggtt acatctaccc ctgcaacacc 900

actcttccca gcttctcgct tgtcctcggc gagtcgagcc tggccacgat ccccggtaac 960

ctgatcaatt tctccaaggt tggcaccaac accaccaccg gacaggcctt gtgctttggc 1020

ggcattcaat ccaacggaaa cacctcgctg cagattctgg gcgatatttt cctgaaggcc 1080

tttttcgttg tcttcgacat gcgcggcccc tcgcttggtg ttgcctctcc caagaactag 1140

<210> 2

<211> 1059

<212> DNA

<213>Artificial sequence

<400> 2

atgagagtta ctactttgtc tactgctttg ttcgctttga cttctactgc tgtttctgct 60

ccaactgctg gttcttcttc tccaggtttg gaagttaagt tgactcaaat cgacaacact 120

agagttaagg ctgttgttaa gaacactggt tctgaagaag tttctttcgt tcacttgaac 180

ttcttcaagg acgctggtcc agttaagaag gtttctgttt acagaggtca agacgaagtt 240

caattcgaag gtatcaagag aagattgaga tcttctggta tcactaagga agctgttact 300

tctttgggtg ctggtgaaac tttggaagac gaattcgaca tcgcttctac ttctgacttg 360

gcttctggtg gtccagtttc tatcagatct cacggtttcg ttccaatcgt tgttgacggt 420

aagatcactg gttacatccc atacaagtct aacgacttga ctgttaatgt tgacggtggt 480

aaggctgcta aggttactaa ggctttgtct caattgacta gaagaactga agttactgac 540

tgtaagggtg acgctgaatc ttctttgact actgctttgt ctaacgctgc taagttggct 600

aaccaagctg ctgaagctgc tgaatctggt gacgaatcta agttcgaaga atacttcaag 660

actactgacc aacaaactag aactactgtt gctgaaagat tgagagctgt tgctaaggaa 720

gctggttcta cttctggtgg ttctactact taccactgta acgacccata cggttactgt 780

gaaccaaacg ttttggctta cactttgcca tctaagaacg aaatcgctaa ctgtgacatc 840

tactactctg aattgccacc attggctcaa aagtgtcacg ctcaagacca agctactact 900

actttgcacg aattcactca cgctccaggt gtttaccaac caggtactga agacttgggt 960

tacggttacg acgctgctac tcaattgtct gctcaagacg ctttgaacaa cgctgactct 1020

tacgctttgt acgctaacgc tatcgaattg aagtgttaa 1059

<210> 3

<211> 1059

<212> DNA

<213>Artificial sequence

<400> 3

atgagagtta ctactttgtc tactgctttg ttcgctttga cttctactgc tgtttctgct 60

ccaactgctg gttcttcttc tccaggtttg gaagttaagt tgactcaaat cgacaacact 120

agagttaagg ctgttgttaa gaacactggt tctgaagaag tttctttcgt tcacttgaac 180

ttcttcaagg acgctggtcc agttaagaag gtttctgttt acagaggtca agacgaagtt 240

caattcgaag gtatcaagag aagattgaga tcttctggta tcactaagga agctgttact 300

tctttgggtg ctggtgaaac tttggaagac gaattcgaca tcgcttctac ttctgacttg 360

gcttctggtg gtccagtttc tatcagatct cacggtttcg ttccaatcgt tgttgacggt 420

aagatcactg gttacatccc atacaagtct aacgacttga ctgttaatgt tgacggtggt 480

aaggctgcta aggttactaa ggctttgtct caattgacta gaagaactga agttactgac 540

tgtaagggtg acgctgaatc ttctttgact actgctttgt ctaacgctgc taagttggct 600

aaccaagctg ctgaagctgc tgaatctggt gacgaatcta agttcgaaga atacttcaag 660

actactgacc aacaaactag aactactgtt gctgaaagat tgagagctgt tgctaaggaa 720

gctggttcta cttctggtgg ttctactact taccactgta acgacccata cggttactgt 780

gaaccaaacg ttttggctta cactttgcca tctaagaacg aaatcgctaa ctgtgacatc 840

tactactctg aattgccacc attggctcaa aagtgtcacg ctcaagacca agctactact 900

actttgcacg aattcactca cgctccaggt gtttaccaac caggtactga agacttgggt 960

tacggttacg acgctgctac tcaattgtct gctcaagacg ctttgaacaa cgctgactct 1020

tacgctttgt acgctaacgc tatcgaattg aagtgttaa 1059

<210> 4

<211> 741

<212> DNA

<213>Artificial sequence

<400> 4

atgatgaagg acactttgtc tttcgctaga ttggctttgt tgttgttcgg tttcgttgtt 60

atcccaactc aagctatcgt tggtggtatc gctactacta actctatctc tatcggtgct 120

gtttacactc aaggtttgtt cggttctcaa tacgcttgtg ctggtacttt cgtttcttct 180

aacaagttct tgactgctgc tgactgtgtt ttgggtcact ctccaagaga catctctatc 240

aagtggggtg cttctaacag attgaacgaa ccatcttctt ctccaccaac tttggttact 300

atccacccag actacaacga attgactggt gacgctaacg ttgctgtttt gactttgaag 360

acttctacta ctggtccatc tcacgctact ttggctaagg aatcttctat ccaaactggt 420

gacgctttga ctttgtacgg ttggggtttg actggtttgg aaggtttgtc tactagattc 480

ccagctgaat tgcacatggt tgaagttcca gctttgtcta cttctgaatg tagatctgaa 540

ggtatcgaca tcggtgctgg tcaattctgt gaccaatctg actctggtaa gggtttctgt 600

atcggtgacc acggtggtcc agttgttgac tcttctggta ctgttgttgg tatcatctct 660

ggtagagaaa actgtggttt gggtactcca gaagttatca ctaacgttgc ttactactac 720

cactggatca tctctcaata a 741

<210> 5

<211> 138

<212> DNA

<213>Artificial sequence

<400> 5

ggtatcttct ctaagttctt gggtaagggt ttgaagaact tgttcatgaa gggtgctaag 60

actatcggta aggaagttgg tatggacgtt gttagaactg gtatcgacat cgctggttgt 120

aagatcaagg gtgaatgt 138

<210> 6

<211> 255

<212> DNA

<213>Artificial sequence

<400> 6

atgagatttc cttcaatttt tactgctgtt ttattcgcag catcctccgc attagctgct 60

ccagtcaaca ctacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt 120

tactcagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat 180

aacgggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 240

tctctcgaga aaaga 255

<210> 7

<211> 999

<212> DNA

<213>Artificial sequence

<400> 7

cgtctcagat cgaagtacct tcaaagaatg gggtctcatc ttgttttgca tgtaccactg 60

agcaggataa taatagaaat gataatatac tatagtagag ataacgtcga tgacttccca 120

tactgtaatt gcttttagtt gtgtattttt agtgtgcaag tttctgtaaa tcgattaatt 180

tttttttctt tcctcttttt attaacctta atttttattt tagattcctg acttcaactc 240

aagacgcaca gatattataa catctgcaca ataggcattt gcaagaatta ctcgtgagta 300

aggaaagagt gaggaactat cgcatacctg catttaaaga tgccgatttg ggcgcgaatc 360

ctttattttg gcttcaccct catactatta tcagggccag aaaaaggaag tgtttccctc 420

cttcttgaat tgatgttacc ctcataaaac acgtggcctc ttatcaagaa agaaattacc 480

gtcgctcgtg atttgtttgc aaagagaaca aaactgaaaa aacccagaca cgctcgactt 540

cctgtcttcc tattgattgc agcttccaat ttcgtcacac aacaaggtcc tagcgacggc 600

tcacaggttt tgtaacaagc aatcgaaggt tctggaatgg cgggaaaggg tttagtacca 660

catgctatga tgcccactgt gatctccaga gcaaagttcg ttcgatcgta ctgttactct 720

ctctctttca aacagaaatg tccgaatcgt gtgacaacaa cagcctgttc tcacacactc 780

ttttcttcta accaaggggg tggtttagtt tagtagaacc tcgtgaaact tacatttaca 840

tatatataaa cttgcataaa ttggtcaatg caagaaatac atatttggtc ttttctaatt 900

cgtagttttt caagttctta gatgctttct ttttctcttt tttacagatc atcaaggaag 960

taattatcta ctttttacaa caaatatata gccgagacg 999

<210> 8

<211> 402

<212> DNA

<213>Artificial sequence

<400> 8

cgtctcagta cgatctccca tgtctctact ggtggtggtg cttctttgga attattggaa 60

ggcaaggaat tgccaggtgt tgctttctta tccgaaaaga aataaattga attgaattga 120

aatcgataga tcaatttttt tcttttctct ttccccatcc tttacgctaa aataatagtt 180

tattttattt tttgaatatt ttttatttat atacgtatat atagactatt atttactttt 240

aatagattat taagattttt attaaaaaaa aattcgtccc tctttttaat gccttttatg 300

cagttttttt ttcccattcg atatttctat gttcgggttt cagcgtattt taagtttaat 360

aactcgaaaa ttctgcgttt cgaaaaagct ttgaccgaga cg 402

<210> 9

<211> 999

<212> DNA

<213>Artificial sequence

<400> 9

cgtctcagtc agaagtacct tcaaagaatg gggtctcatc ttgttttgca tgtaccactg 60

agcaggataa taatagaaat gataatatac tatagtagag ataacgtcga tgacttccca 120

tactgtaatt gcttttagtt gtgtattttt agtgtgcaag tttctgtaaa tcgattaatt 180

tttttttctt tcctcttttt attaacctta atttttattt tagattcctg acttcaactc 240

aagacgcaca gatattataa catctgcaca ataggcattt gcaagaatta ctcgtgagta 300

aggaaagagt gaggaactat cgcatacctg catttaaaga tgccgatttg ggcgcgaatc 360

ctttattttg gcttcaccct catactatta tcagggccag aaaaaggaag tgtttccctc 420

cttcttgaat tgatgttacc ctcataaaac acgtggcctc ttatcaagaa agaaattacc 480

gtcgctcgtg atttgtttgc aaagagaaca aaactgaaaa aacccagaca cgctcgactt 540

cctgtcttcc tattgattgc agcttccaat ttcgtcacac aacaaggtcc tagcgacggc 600

tcacaggttt tgtaacaagc aatcgaaggt tctggaatgg cgggaaaggg tttagtacca 660

catgctatga tgcccactgt gatctccaga gcaaagttcg ttcgatcgta ctgttactct 720

ctctctttca aacagaaatg tccgaatcgt gtgacaacaa cagcctgttc tcacacactc 780

ttttcttcta accaaggggg tggtttagtt tagtagaacc tcgtgaaact tacatttaca 840

tatatataaa cttgcataaa ttggtcaatg caagaaatac atatttggtc ttttctaatt 900

cgtagttttt caagttctta gatgctttct ttttctcttt tttacagatc atcaaggaag 960

taattatcta ctttttacaa caaatataat gccgagacg 999

<210> 10

<211> 402

<212> DNA

<213>Artificial sequence

<400> 10

cgtctcatac ggatctccca tgtctctact ggtggtggtg cttctttgga attattggaa 60

ggcaaggaat tgccaggtgt tgctttctta tccgaaaaga aataaattga attgaattga 120

aatcgataga tcaatttttt tcttttctct ttccccatcc tttacgctaa aataatagtt 180

tattttattt tttgaatatt ttttatttat atacgtatat atagactatt atttactttt 240

aatagattat taagattttt attaaaaaaa aattcgtccc tctttttaat gccttttatg 300

cagttttttt ttcccattcg atatttctat gttcgggttt cagcgtattt taagtttaat 360

aactcgaaaa ttctgcgttt cgaaaaagct ttgcacgaga cg 402

<210> 11

<211> 999

<212> DNA

<213>Artificial sequence

<400> 11

cgtctcatgc agaagtacct tcaaagaatg gggtctcatc ttgttttgca tgtaccactg 60

agcaggataa taatagaaat gataatatac tatagtagag ataacgtcga tgacttccca 120

tactgtaatt gcttttagtt gtgtattttt agtgtgcaag tttctgtaaa tcgattaatt 180

tttttttctt tcctcttttt attaacctta atttttattt tagattcctg acttcaactc 240

aagacgcaca gatattataa catctgcaca ataggcattt gcaagaatta ctcgtgagta 300

aggaaagagt gaggaactat cgcatacctg catttaaaga tgccgatttg ggcgcgaatc 360

ctttattttg gcttcaccct catactatta tcagggccag aaaaaggaag tgtttccctc 420

cttcttgaat tgatgttacc ctcataaaac acgtggcctc ttatcaagaa agaaattacc 480

gtcgctcgtg atttgtttgc aaagagaaca aaactgaaaa aacccagaca cgctcgactt 540

cctgtcttcc tattgattgc agcttccaat ttcgtcacac aacaaggtcc tagcgacggc 600

tcacaggttt tgtaacaagc aatcgaaggt tctggaatgg cgggaaaggg tttagtacca 660

catgctatga tgcccactgt gatctccaga gcaaagttcg ttcgatcgta ctgttactct 720

ctctctttca aacagaaatg tccgaatcgt gtgacaacaa cagcctgttc tcacacactc 780

ttttcttcta accaaggggg tggtttagtt tagtagaacc tcgtgaaact tacatttaca 840

tatatataaa cttgcataaa ttggtcaatg caagaaatac atatttggtc ttttctaatt 900

cgtagttttt caagttctta gatgctttct ttttctcttt tttacagatc atcaaggaag 960

taattatcta ctttttacaa caaatatatc gacgagacg 999

<210> 12

<211> 402

<212> DNA

<213>Artificial sequence

<400> 12

cgtctcaatc ggatctccca tgtctctact ggtggtggtg cttctttgga attattggaa 60

ggcaaggaat tgccaggtgt tgctttctta tccgaaaaga aataaattga attgaattga 120

aatcgataga tcaatttttt tcttttctct ttccccatcc tttacgctaa aataatagtt 180

tattttattt tttgaatatt ttttatttat atacgtatat atagactatt atttactttt 240

aatagattat taagattttt attaaaaaaa aattcgtccc tctttttaat gccttttatg 300

cagttttttt ttcccattcg atatttctat gttcgggttt cagcgtattt taagtttaat 360

aactcgaaaa ttctgcgttt cgaaaaagct tgactcgaga cg 402

<210> 13

<211> 806

<212> DNA

<213>Artificial sequence

<400> 13

ttagaaaaac tcatcgagca tcaaatgaaa ctgcaattta ttcatatcag gattatcaat 60

accatatttt tgaaaaagcc gtttctgtaa tgaaggagaa aactcaccga ggcagttcca 120

taggatggca agatcctggt atcggtctgc gattccgact cgtccaacat caatacaacc 180

tattaatttc ccctcgtcaa aaataaggtt atcaagtgag aaatcaccat gagtgacgac 240

tgaatccggt gagaatggca aaagcttatg catttctttc cagacttgtt caacaggcca 300

gccattacgc tcgtcatcaa aatcactcgc atcaaccaaa ccgttattca ttcgtgattg 360

cgcctgagcg agactaaata cgcgatcgct gttaaaagga caattacaaa caggaatcga 420

atgcaaccgg cgcaggaaca ctgccagcgc atcaacaata ttttcacctg aatcaggata 480

ttcttctaat acctggaatg ctgttttccc ggggatcgca gtggtgagta accatgcatc 540

atcaggagta cggataaaat gcttgatggt cggaagaggc ataaattccg tcagccagtt 600

tagtctgacc atctcatctg taacatcatt ggcaacgcta cctttgccat gtttcagaaa 660

caactctggc gcatcgggct tcccatacaa tcgatagatt gtcgcacctg attgcccgac 720

attatcgcga gcccatttat acccatataa atcagcatcc atgttggaat ttaatcgcgg 780

cctcgagcaa gacgtttccc gttgaa 806

<210> 14

<211> 1812

<212> DNA

<213>Artificial sequence

<400> 14

ccagcatcct tgacttacgt cgcagtcctc agtcccagct ggcagtattc ccacaggcta 60

taatacttac cgaggcaagc tacattccta tggatttatc ctgccaccaa aactgatgct 120

ggcccagtga aatgcgagat tcccctaccc acaaggagca gagggcacaa aacaccatgt 180

ctgatcaaat gcccttccct ttcaacaatt tcacgtactt tttcactctc ttttcaaagt 240

tcttttcatc tttccatcac tgtacttgtt cgctatcgcg actctcgcca atatttagct 300

ttagatggaa tttaccaccc acttagagct gcattcccaa acaactcgac tcttcgaagg 360

cactttacaa agaaccgcac tcctcgccac acgggattct caccctctat gacgtcctgt 420

tccaaggaac atagacaagg aacggcccca aagttgccct ctccaaatta caactcgggc 480

accgaaggta ccagatttca aatttgagct tttgccgctt cactcgccgt tactaaggca 540

atcccggttg gtttcttttc ctccgcttat tgatatgctt aagttcagcg ggtactccta 600

cctgatttga ggtcaaactt taagaacatt gttcgcctag acgctctctt cttatcgata 660

acgttccaat acgctcagta taaaaaaaga ttagccgcag ttggtaaaac ctaaaacgac 720

cgtacttgca ttatacctca agcacgcaga gaaacctctc tttggaaaaa aaacatccaa 780

tgaaaaggcc agcaatttca agttaactcc aaagagtatc actcactacc aaacagaatg 840

tttgagaagg aaatgacgct caaacaggca tgccccctgg aataccaagg ggcgcaatgt 900

gcgttcaaag attcgatgat tcacggactt ctgcaattca cattacgtat cgcatttcgc 960

tgcgttcttc atcgatgcga gaaccaagag atccgttgtt gaaagttttt aatattttaa 1020

aatttccagt tacgaaaatt cttgtttttg acaaaaattt aatgaataga taaaattgtt 1080

tgtgtttgtt acctctgggc cccgattgct cgaatgccca aagaaaaagt tgcaaagata 1140

tgaaaactcc acagtgtgtt gtattgaaac ggttttaatt gtcctataac aaaagcacag 1200

aaatctctca ccgtttggaa tagcaagaaa gaaacttaca agcctagcaa gaccgcgcac 1260

ttaagcgcag gcccggctgg actctccatc tcttgtcttc ttgcccagta aaagctctca 1320

tgctcttgcc aaaacaaaaa aatccatttt caaaattatt aaatttcttt aatgatcctt 1380

ccgcaggttc acctacggaa accttgttac gacttttagt tcctctaaat gaccaagttt 1440

gtccaaattc tccgctctga gatggagttg cccccttctc taagcagatc ctgaggcctc 1500

actaagccat tcaatcggta ctagcgacgg gcggtgtgta caaagggcag ggacgtaatc 1560

aacgcaagct gatgacttgc gcttactagg acttcctcgt tgaagagcaa taattacaat 1620

gctctatccc cagcacgacg gagtttcaca agattaccaa gacctctcgg ccaaggttag 1680

actcgctggc tccgtcagtg tagcgcgcgt gcggcccaga acgtctaagg gcatcacaga 1740

cctgttattg cctcaaactt ccatcggctt gaaaccgata gtccctctaa gaagtggata 1800

accagcaaat gc 1812

<210> 15

<211> 220

<212> DNA

<213>Artificial sequence

<400> 15

gatcagagac gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 60

gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 120

ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 180

aaacccgaca ggactataac tctgctctat cgtctctcta 220

<210> 16

<211> 29

<212> DNA

<213>Artificial sequence

<400> 16

tggccattag aaaaactcat cgagcatca 29

<210> 17

<211> 31

<212> DNA

<213>Artificial sequence

<400> 17

gatatcttca acgggaaacg tcttgctcga g 31

<210> 18

<211> 27

<212> DNA

<213>Artificial sequence

<400> 18

cggaattcgc atgccatcct accgacc 27

<210> 19

<211> 29

<212> DNA

<213>Artificial sequence

<400> 19

cgggatccgg gtttagaccg tcgtgagac 29

<210> 20

<211> 36

<212> DNA

<213>Artificial sequence

<400> 20

agatctgatc agagacgcgg taatacggtt atccac 36

<210> 21

<211> 36

<212> DNA

<213>Artificial sequence

<400> 21

gaattcgact agagacgtta tagtcctgtc gggttt 36

<210> 22

<211> 26

<212> DNA

<213>Artificial sequence

<400> 22

cgtctcagat cgaagtacct tcaaag 26

<210> 23

<211> 26

<212> DNA

<213>Artificial sequence

<400> 23

cgtctcggct atatatttgt tgtaaa 26

<210> 24

<211> 32

<212> DNA

<213>Artificial sequence

<400> 24

cgtctcatgt acgatctccc atcgtctcta ct 32

<210> 25

<211> 30

<212> DNA

<213>Artificial sequence

<400> 25

cgtctcggtc aaagcttttt cgaaacgcag 30

<210> 26

<211> 26

<212> DNA

<213>Artificial sequence

<400> 26

cgtctcagtc agaagtacct tcaaag 26

<210> 27

<211> 26

<212> DNA

<213>Artificial sequence

<400> 27

cgtctcggca ttatatttgt tgtaaa 26

<210> 28

<211> 31

<212> DNA

<213>Artificial sequence

<400> 28

cgtctcatac ggatctccca tcgtctctac t 31

<210> 29

<211> 30

<212> DNA

<213>Artificial sequence

<400> 29

cgtctcgtgc aaagcttttt cgaaacgcag 30

<210> 30

<211> 26

<212> DNA

<213>Artificial sequence

<400> 30

cgtctcatgc agaagtacct tcaaag 26

<210> 31

<211> 26

<212> DNA

<213>Artificial sequence

<400> 31

cgtctcgtcg atatatttgt tgtaaa 26

<210> 32

<211> 31

<212> DNA

<213>Artificial sequence

<400> 32

cgtctcaatc ggatctccca tcgtctctac t 31

<210> 33

<211> 30

<212> DNA

<213>Artificial sequence

<400> 33

cgtctcgagt caagcttttt cgaaacgcag 30

<210> 34

<211> 23

<212> DNA

<213>Artificial sequence

<400> 34

atgagatttc cttcaatttt tac 23

<210> 35

<211> 28

<212> DNA

<213>Artificial sequence

<400> 35

tcttttctcg agagataccc cttcttct 28

<210> 36

<211> 34

<212> DNA

<213>Artificial sequence

<400> 36

cgtctcagct aatgagattt ccttcaattt ttac 34

<210> 37

<211> 30

<212> DNA

<213>Artificial sequence

<400> 37

agagcagcgg gcccatgtct tttctcgaga 30

<210> 38

<211> 30

<212> DNA

<213>Artificial sequence

<400> 38

tctcgagaaa agacatgggc ccgctgctct 30

<210> 39

<211> 30

<212> DNA

<213>Artificial sequence

<400> 39

cgtctcaata gctagttctt gggagaggca 30

<210> 40

<211> 36

<212> DNA

<213>Artificial sequence

<400> 40

cgtctcagtc aatgagagtt actactttgt ctactg 36

<210> 41

<211> 35

<212> DNA

<213>Artificial sequence

<400> 41

cgtctcaagc ttttaacact tcaattcgat agcgt 35

<210> 42

<211> 34

<212> DNA

<213>Artificial sequence

<400> 42

cgtctcatcg aatgagattt ccttcaattt ttac 34

<210> 43

<211> 31

<212> DNA

<213>Artificial sequence

<400> 43

acttagagaa gatacctctt ttctcgagag a 31

<210> 44

<211> 31

<212> DNA

<213>Artificial sequence

<400> 44

tctctcgaga aaagaggtat cttctctaag t 31

<210> 45

<211> 32

<212> DNA

<213>Artificial sequence

<400> 45

cgtctcatag ctctgttgtt ttgccaagag gt 32

<210> 46

<211> 46

<212> PRT

<213>Artificial sequence

<400> 46

Gly Ile Phe Ser Lys Phe Leu Gly Lys Gly Leu Lys Asn Leu Phe Met

1 5 10 15

Lys Gly Ala Lys Thr Ile Gly Lys Glu Val Gly Met Asp Val Val Arg

20 25 30

Thr Gly Ile Asp Ile Ala Gly Cys Lys Ile Lys Gly Glu Cys

35 40 45

Claims

1. a kind of energy assistant degradation protein simultaneously secretes the saccharomyces cerevisiae polygenes coexpression vector of antibacterial peptide, it is characterised in that： Contain protease gene, antibacterial peptide gene in the carrier；

The protease gene is selected from acid protease gene, neutral protease gene, aspartic proteinase gene, serine At least one of protease gene；

The base sequence of the acid protease gene such as SEQ ID NO：Shown in 1, the base sequence of the neutral protease gene Row such as SEQ ID NO：Shown in 2, the base sequence such as SEQ ID NO of the aspartic proteinase gene：Shown in 3, the silk The base sequence of serine protease gene such as SEQ ID NO：Shown in 4.

A kind of assistant degradation protein and the saccharomyces cerevisiae polygenes of antibacterial peptide can be secreted it be total to table 2. according to claim 1 Up to carrier, it is characterised in that：The protease-based is because acid protease gene and neutral protease gene.

A kind of assistant degradation protein and the saccharomyces cerevisiae polygenes of antibacterial peptide can be secreted it be total to table 3. according to claim 1 Up to carrier, it is characterised in that：There are α-signal peptide gene sequence, α-signal for the protease gene, antibacterial peptide gene upstream The base sequence of peptide gene such as SEQ ID NO：Shown in 6.

4. according to a kind of energy assistant degradation protein of claims 1 to 3 any one of them and secrete the saccharomyces cerevisiae of antibacterial peptide Polygenes coexpression vector, it is characterised in that：The promoter of the protease gene gene is selected from pgk1-1, pgk1-2, terminates Son is selected from pgkt1-1, pgkt1-2；The promoter of the antibacterial peptide gene is pgk1-3, terminator pgkt1-3；

The base sequence of the pgk1-1 such as SEQ ID NO：Shown in 7；

The base sequence of the pgkt1-1 such as SEQ ID NO：Shown in 8；

The base sequence of the pgk1-2 such as SEQ ID NO：Shown in 9；

The base sequence of the pgkt1-2 such as SEQ ID NO：Shown in 10；

The pgk1-3, base sequence such as SEQ ID NO：Shown in 11；

The base sequence of the pgkt1-3 such as SEQ ID NO：Shown in 12.

5. according to a kind of energy assistant degradation protein of claims 1 to 3 any one of them and secrete the saccharomyces cerevisiae of antibacterial peptide Polygenes coexpression vector, it is characterised in that：The skeleton of the carrier is pGAPZaA plasmids.

6. according to a kind of energy assistant degradation protein of claims 1 to 3 any one of them and secrete the saccharomyces cerevisiae of antibacterial peptide Polygenes coexpression vector, it is characterised in that：25S rDNA genetic fragments containing S. cervisiae, its base sequence in the carrier Row such as SEQ ID NO：Shown in 14.

7. a kind of energy assistant degradation protein simultaneously secretes the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide, it is characterised in that the restructuring is made Inserted with any polygenes coexpression vector of claim 1~6 in brewer yeast genome.

8. claim 1~6 is any described a kind of assistant degradation protein and to be secreted the saccharomyces cerevisiae polygenes of antibacterial peptide and is total to The construction method of expression vector, it is characterised in that：Comprise the following steps：

S1 integrating expression vectors pTEGC-BsmBI is built：

Between G418 resistant genes are connected into multiple cloning sites Msc I and the EcoR V of pGAPZaA plasmid vectors by S1.1, carried Body pGAPZaA-G418；

S1.2 is by base sequence such as SEQ ID NO：RDNA gene orders shown in 14 are connected into more grams of carrier pGAPZaA-G418 Between grand site BamHI and EcoRI, carrier pGAPZaA-G418-rDNA is obtained；

Carrier pGAPZaA-G418-rDNA after Bgl II and EcoRI double digestions, is recycled large fragment product, obtains line by S1.3 Property carrier pTEGC, by base sequence such as SEQ ID NO：BsmBI-2 fragments shown in 15 are connected with linearized vector pTEGC, Obtain integrating expression vector pTEGC-BsmBI；

The amplification of S2 promoters, terminator

The amplification of S2.2 terminators：Using saccharomyces cerevisiae genome DNA as template, respectively with primer pair PGKT1F1-BsmBI and PGKT1R1-BsmBI, PGKT1F2-BsmBI and PGKT1R2-BsmBI, PGKT1F3-BsmBI and PGKT1R3-BsmBI expand respectively Increase and pgkt1-1, pgkt1-2, pgkt1-3 termination sub-piece；

The acquisition of S3.1 α-signal peptide-acid protease gene：Respectively with the carrier T containing α-signal peptide gene sequence, containing acidity The carrier T of protease gene gene order is template, passes through primer MfaF1-BsmBI, Mfa-apR, Mfa-apF and apR- BsmBI carries out the 5 ' ends that α-signal peptide gene sequence orientation is connected into acid protease gene by Overlap extension PCR, amplifies mfa- Ap genetic fragments, i.e., the fragment containing α-signal peptide gene sequence and acid protease gene sequence；

The acquisition of S3.2 neutral protease genes：Using the carrier T containing neutral protease gene as template, with primer npF-BsmBI And npR-BsmBI is expanded, the np genes of the identification containing IIs type restriction enzymes BsmBI and cleavage site are obtained Fragment；

The acquisition of S3.3 α-signal peptide-antibacterial peptide gene：Respectively with the carrier T containing α-signal peptide gene sequence, the T containing antibacterial peptide Carrier is template, and overlapping prolong is carried out by primer MfaF3-BsmBI, Mfa-ampF, Mfa-ampR and Mfa-ampR-BsmBI 5 ' the ends that α-signal peptide sequence orientation is connected into the antibacterial peptide gene of no signal peptide by PCR are stretched, amplify mfa-amp genetic fragments, Fragment i.e. containing α-signal peptide gene sequence and antibacterial peptide gene sequence；

The structure of S4 saccharomyces cerevisiae polygenes coexpression vectors

By acid protease gene expression box element pgk1-1, mfa-ap, pgkt1-1 of above-mentioned acquisition；Neutral protease gene Express box element pgk1-2, np, pgkt1-2；Antibacterial peptide gene expression box element pgk1-3, mfa-amp, pgkt1-3 utilize IIs Type restriction enzyme BsmBI carries out digestion, purifying recycling；Meanwhile cut using IIs type restriction enzymes BsmBI above-mentioned Integrating expression vector pTEGC-BsmBI, is linearized；These fragments used are connected into the whole of linearisation by one-step method orientation Close in expression vector pTEGC-BsmBI, up to saccharomyces cerevisiae polygenes coexpression vector；

The base sequence of primer described above is as follows：

PGK1F1-BsmBI：CGTCTCAgatc GAAGTACCTTCAAAG

PGK1R1-BsmBI：CGTCTCGgctaTATATTTGTTGTAAA

PGK1F2-BsmBI：CGTCTCAgtcaGAAGTACCTTCAAAG

PGK1R2-BsmBI：CGTCTCGgcatTATATTTGTTGTAAA

PGK1F3-BsmBI：CGTCTCAtgcaGAAGTACCTTCAAAG

PGK1R3-BsmBI：CGTCTCGtcgaTATATTTGTTGTAAA

PGKT1F1-BsmBI：CGTCTCAtgtacGATCTCCCATCGTCTCTACT

PGKT1R1-BsmBI：CGTCTCGgtcaAAGCTTTTTCGAAACGCAG

PGKT1F2-BsmBI：CGTCTCAtacgGATCTCCCATCGTCTCTACT

PGKT1R2-BsmBI：CGTCTCGtgcaAAGCTTTTTCGAAACGCAG

PGKT1F3-BsmBI：CGTCTCAatcgGATCTCCCATCGTCTCTACT

PGKT1R3-BsmBI：CGTCTCGagtcAAGCTTTTTCGAAACGCAG

MfaF1-BsmBI：CGTCTCAgctaATGAGATTTCCTTCAATTTTTAC

Mfa-apR：AGAGCAGCGGGCCCATGTCTTTTCTCGAGA

Mfa-apF：TCTCGAGAAAAGACATGGGCCCGCTGCTCT

apR-BsmBI：CGTCTCAatagCTAGTTCTTGGGAGAGGCA

npF-BsmBI：CGTCTCAgtcaATGAGAGTTACTACTTTGTCTACTG

npR-BsmBI CGTCTCAagctT TTAACACTTCAATTCGATAGCGT

MfaF3-BsmBI：CGTCTCAtcga ATGAGATTTCCTTCAATTTTTAC

Mfa-ampR：ACTTAGAGAAGATACCTCTTTTCTCGAGAGA

Mfa-ampF：TCTCTCGAGAAAAGAGGTATCTTCTCTAAGT

Mfa-ampR-BsmBI：CGTCTCAtagcTCTGTTGTTTTGCCAAGAGGT.

9. the construction method of a kind of energy assistant degradation protein and the prebiotic recombinant Saccharomyces cerevisiae for secreting antibacterial peptide, its feature exist In the saccharomyces cerevisiae polygenes coexpression vector transformed saccharomyces cerevisiae host for building claim 8, filters out positive monoclonal Bacterium colony, and sequence verification is correct, up to energy assistant degradation protein and secretes the prebiotic recombinant Saccharomyces cerevisiae of antibacterial peptide.