WO2020113962A1 - Application of bacterial laccase cota protein in degradation of mycotoxins - Google Patents

Abstract

Application of bacterial laccase CotA protein and additive formed thereby in the degradation of mycotoxins, which specifically relate to the application thereof in the detoxification of aflatoxin and zearalenone in food, feed and raw material, grain, grain oil, grain byproducts, DDGS, milk, tea, Chinese herbal medicines and byproducts thereof, aging grains, complete feed for various animals, concentrated feed, premixed feed and silage, feed for aquatic animals, feed for pets and feed for fur animals. Experiments verify that the bacterial laccase CotA protein may simultaneously degrade the aflatoxin and the zearalenone independent of any mediator.

Description

Application of bacterial laccase CotA protein in the degradation of mycotoxins

This application requires the priority of the Chinese patent application filed on December 07, 2018 in the Chinese Patent Office with the application number 201811492897.9 and the invention titled "Application of Bacterial Laccase CotA Protein in Degrading Mycotoxins", the entire content of which is cited by reference Incorporated in this application.

Technical field

The invention belongs to the technical field of enzyme engineering, and specifically relates to the application of the bacterial laccase CotA protein in the degradation of mycotoxins, in particular the simultaneous degradation of aflatoxin and zearalenone and the like.

Background technique

Mycotoxins are secondary metabolites of molds and have carcinogenic, genotoxic, reproductive toxicity, neurotoxicity, and immunosuppressive effects. When animals eat moldy diets, growth inhibition, increased disease susceptibility, metabolic disorders, and reproduction disorders Waiting for the symptoms of mycotoxin poisoning. In addition, mycotoxin metabolites can remain in animal-derived food and enter the human body through the food chain, threatening human health. Grains and grains will be infected with toxin-producing molds in the field. If the ambient temperature and humidity are suitable, the molds will continue to grow and reproduce during processing, transportation, and storage, and the toxin content will continue to increase. The International Food and Agriculture Organization (FAO) estimates that 25% of the world’s grains are contaminated with mycotoxins every year, and an average of 2% are inedible. In addition, poisoning, disease, and death of humans and animals caused by toxin contamination make social and economic losses difficult. Estimate. Aflatoxin is mainly produced by Aspergillus flavus and Aspergillus parasite. Among them, aflatoxin B1 is the most toxic and harmful. Aflatoxin B1 is 10 times more acutely toxic than potassium cyanide and 68 times more arsenic. Its molecular structure contains difuran ring and Xanthone ring is closely related to its toxicity and carcinogenicity. Zearalenone, also known as F-2 toxin, is a non-steroidal mycotoxin produced by Fusarium graminearum, which has an estrogen effect, and its chemical name is 6-(10-hydroxy-6-oxy- Undecenyl) β-raysulactone, in which the lactone bond and the hydroxyl group at the C4 position of the benzene ring are the major toxic groups of zearalenone.

Mycotoxin biodegradation refers to the conversion of mycotoxins into non-toxic or low-toxic metabolites under the action of microorganisms and the specific enzymes they produce. It has the advantages of safety, high efficiency and environmental protection. It is the detoxification of mycotoxins in current feed and food Development trend. The enzymes reported at home and abroad that can degrade aflatoxin and zearalenone are mainly peroxidases, such as horseradish peroxidase, manganese peroxidase, etc. In addition, laccase derived from fungi has also been reported It has the activity of degrading aflatoxin and zearalenone. Peroxidase needs hydrogen peroxide as a substrate in the process of catalytic degradation of aflatoxin and zearalenone, and fungal laccase degrades aflatoxin and zearalenone requires the participation of a mediator, so peroxidation The effectiveness and safety of mycotoxin and fungal laccase in the detoxification of mycotoxins in feed and food need further evaluation. In addition, proteins with aflatoxin degradation activity also include aflatoxin oxidase ADTZ derived from Armillaria mellea and F420H2-dependent reductase FDR derived from Mycobacterium; proteins with zearalenone degradation activity also include Lactone hydrolase ZHD101 derived from Gliocladium rosenbergii and zearalenone degrading enzyme ZENdease-N2 derived from B. grisea

There is increasing evidence that other unknown enzymes may also be involved in the degradation of aflatoxin and zearalenone, two mycotoxins with benzene ring and lactone ring structures. Therefore, it is imperative to find and develop new enzymes for the biodegradation of mycotoxins.

Summary of the invention

The purpose of the present invention is to provide the application of bacterial laccase CotA protein in the detoxification of mycotoxins. Used in grain, grain, feed, food, fruit, milk, etc. and its processing by-products, industrial ethanol processing by-product DDGS, tea, Chinese herbal medicine and its processing by-products, aged grain, various animal feeds, concentrated feed , Premix feed and silage, aquatic animal feed, pet feed and fur animal feed and other materials detoxification of mycotoxins.

To this end, the technical solution of the present invention is as follows:

The present invention provides a bacterial laccase CotA protein. The amino acid sequence of the bacterial laccase CotA protein is:

As shown in SEQ ID NO.1 sequence;

Or one or two amino acid residues in the sequence shown in SEQ ID NO. 1 are substituted and/or deleted and/or inserted;

Or a sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having the function of bacterial laccase CotA protein.

In some specific embodiments of the present invention, the amino acid sequence of the bacterial laccase CotA protein is: has at least 70% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, and has the bacterial laccase CotA protein Sequence of functions.

In some specific embodiments of the present invention, the amino acid sequence of the bacterial laccase CotA protein is: having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having the bacterial laccase CotA protein Sequence of functions.

In some specific embodiments of the present invention, the amino acid sequence of the bacterial laccase CotA protein is: has at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, and has the bacterial laccase CotA protein Sequence of functions.

In some specific embodiments of the present invention, the amino acid sequence of the bacterial laccase CotA protein is: has at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, and has the bacterial laccase CotA protein Sequence of functions.

In some specific embodiments of the invention, the nucleotide sequence encoding the bacterial laccase CotA protein is:

As shown in the sequence of SEDID NO.2;

Or one or two nucleotide residues in the sequence as shown in SED ID NO. 2 are substituted and/or deleted and/or inserted;

Or it has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.

In some specific embodiments of the present invention, the nucleotide sequence encoding the bacterial laccase CotA protein is: having at least 70% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.

In some specific embodiments of the present invention, the nucleotide sequence encoding the bacterial laccase CotA protein is: having at least 75% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.

In some specific embodiments of the present invention, the nucleotide sequence encoding the bacterial laccase CotA protein is: having at least 80% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.

In some specific embodiments of the present invention, the nucleotide sequence encoding the bacterial laccase CotA protein is: having a sequence identity of at least 85% with the nucleotide sequence shown in SEQ ID NO:2.

Based on the above research, the present invention also provides the application of the bacterial laccase CotA protein in the degradation of mycotoxins, the mycotoxins are aflatoxins B1, B2, G1, G2, M1, M2, corn red One or more of mycoenol, zearalenol, or zearalenol.

In the above application, the bacterial laccase CotA protein is derived from Bacillus.

In the above application, the Bacillus can be Bacillus licheniformis, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, Bacillus lentus Or Bacillus clausii, preferably Bacillus licheniformis.

In the above application, the amino acid sequence of the bacterial laccase CotA protein may be:

As shown in SEQ ID NO.1 sequence;

Or one or two amino acid residues in the sequence shown in SEQ ID NO. 1 are substituted and/or deleted and/or inserted;

Or a sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having the function of bacterial laccase CotA protein.

In the above application, the nucleotide sequence encoding the bacterial laccase CotA protein is:

As shown in the sequence of SEDID NO.2;

Or one or two nucleotide residues in the sequence as shown in SED ID NO. 2 are substituted and/or deleted and/or inserted;

Or it has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.

A food or feed additive comprising bacterial laccase CotA protein and a physiologically acceptable carrier, the content of the laccase CotA protein is 1-10%.

The physiologically acceptable carrier is selected from one or more of maltodextrin, milk powder, limestone, cyclodextrin, wheat, wheat bran, rice, rice bran, sucrose, starch, Na ₂ SO ₄ , talc or PVA Species.

Among the above additives, the amino acid sequence of the bacterial laccase CotA protein may be:

As shown in SEQ ID NO.1 sequence;

Or one or two amino acid residues in the sequence shown in SEQ ID NO. 1 are substituted and/or deleted and/or inserted;

Or a sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having the function of bacterial laccase CotA protein.

The above additives also include microecological preparations, which are Bacillus licheniformis, Bacillus subtilis, Bifidobacterium bifidum, Enterococcus faecalis, Enterococcus faecium, Enterococcus lactis, Lactobacillus acidophilus, Lactobacillus casei , Lactobacillus germani subsp. lactis, Lactobacillus plantarum, Pediococcus lactis, Pediococcus pentosus, Candida utilis, Bifidobacterium infantis, Bifidobacterium longum, Bifidobacterium breve, Bifidobacterium adolescentis, Thermophile One or more of Streptococcus, Lactobacillus reuteri, Bifidobacterium animalis, Aspergillus oryzae, Bacillus lentus, Bacillus pumilus, Lactobacillus cellobiose, Lactobacillus fermentum and Lactobacillus delbrueckii subsp. bulgaricus, Preferably, when the additive is used in silage or cattle feed, it further contains at least one of Propionibacterium, Lactobacillus brucelli and Lactobacillus paracasei; or the additive is used in poultry, pigs and aquatic products When feeding animal feed, it also contains Bacillus coagulans and/or Brevibacillus lateralis.

Among the above additives, the additives further include additional enzymes; the additional enzymes are selected from: aflatoxin detoxification enzymes, zearalenone lactone enzymes, fumonisin carboxylesterase, fumonisin aminotransferase , Aminopolyol amine oxidase, deoxyfusarium oxytetracycline epoxide hydrolase, carboxypeptidase, Aspergillus niger aspartic protease PEPAa, PEPAb, PEPAc or PEPAd, elastase, aminopeptidase, pepsin, stomach Protease-like proteases, trypsin, trypsin-like proteases, bacterial proteases, enzymes involved in starch metabolism, fiber degradation, lipid metabolism, proteins or enzymes involved in glycogen metabolism, amylase, arabinase, arabinofuranase, Catalase, cellulase, chitinase, rennet, cutinase, deoxyribonuclease, epimerase, esterase, galactosidase, glucanase, glucan lyase, internal Glucanase, glucoamylase, glucose oxidase, glucosidase, including β-glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase Enzymes, lipolytic enzymes, laccases, lyases, mannosidases, oxidases, oxidoreductases, pectate cleavage, pectin acetylesterase, pectin depolymerase, pectin methylase, pectin degrading enzymes , Peroxidase, polycopper oxidase, phenol oxidase, phytase, polygalacturonase, protease, rhamno-galacturonase, ribonuclease, african sweetener, transferase, One or more of transporter, transglutaminase, xylanase, hexose oxidase, and acid phosphatase.

In the above additives, the content of the micro-ecological preparation is 0-20%;

In the above additives, the content of the additional enzyme is 0-9%.

The preparation method of the above additives includes the following steps: the bacterial laccase CotA protein is mixed with a physiologically acceptable carrier to prepare an additive containing the laccase CotA protein, further, or in accordance with the microecological preparation and other enzymes according to certain Proportional mixing to obtain an additive; the CotA protein content of the additive is 1-10%.

Among the above additives, the bacterial laccase CotA protein: physiologically acceptable carrier: microecological preparation: the mass ratio of the additional enzyme can be: 1:70:20:9 or 2:70:20:8 or 3:70: 20:7 or 4:70:20:6 or 5:70:20:5 or 6:70:20:4 or 7:70:20:3 or 8:70:20:2 or 9:70:20: 1 or 10:70:20:0.

The invention also provides a method for degrading mycotoxins, including the following steps: treating the material containing mycotoxins with the bacterial laccase CotA protein or the additive according to the invention, the material includes but not limited to food, feed, feed materials, Grain, grain oil, grain processing by-products or milk.

In some specific embodiments of the present invention, the material further includes tea, Chinese herbal medicine and its processing by-products, industrial ethanol processing by-product DDGS, aged grain, full-price feed for pigs, chickens, cattle, sheep, aquatic animals, Concentrated feed, pre-mixed feed, silage, aquatic animal feed, pet feed and/or fur animal feed.

On the basis of the above research, the present invention also provides the application of the bacterial laccase CotA protein or the food or feed additive in the degradation of mycotoxins in food and/or feed, characterized in that the food and And/or feed includes but is not limited to food, feed, feed raw materials, grain, grain oil, grain processing by-products or milk.

The invention also provides the bacterial laccase CotA protein or the additive used in tea, Chinese herbal medicine and its processing by-products, industrial ethanol processing by-product DDGS, aged grain, pig, chicken, cattle, sheep and aquatic animals Application of mycotoxin in detoxification of full price feed, concentrated feed, pre-mixed feed, silage, aquatic animal feed, pet feed and/or fur animal feed.

The advantages and beneficial effects of the present invention:

The invention provides the application of the bacterial laccase CotA protein in the degradation of mycotoxins. The enzyme is derived from beneficial microorganisms and is suitable for application in food and feed; the experiment confirmed that the bacterial laccase CotA protein can simultaneously degrade aflatoxin and Zearalenone and other toxins.

BRIEF DESCRIPTION

Figure 1 shows the SDS-PAGE diagram of the recombinant plasmid PET31b-CotA expression product after purification; lane 1 is the purified recombinant CotA protein, and lane M is the protein molecular weight standard (116, 66.2, 45, 35, 25, 18.4, 14.4kDa) );

Figure 2 shows the results of HPLC analysis of recombinant CotA protein degrading AFB1 (A is AFB1 blank control group, B is AFB1 plus CotA protein treatment group);

Figure 3 shows the results of HPLC analysis of recombinant CotA protein degrading ZEN (A is ZEN blank control group, B is ZEN plus CotA protein treatment group);

Figure 4 shows the degradation of AFB1 and ZEN by CotA protein under different pH conditions;

Figure 5 shows the degradation of AFB1 and ZEN by CotA protein under different temperature conditions.

detailed description

The present invention will be further described below with reference to the drawings and specific embodiments. Unless otherwise specified, the biochemical reagents used in the examples are all commercially available reagents, and the technical means used in the examples are conventional means used by those skilled in the art.

The main experimental materials and reagents used in the embodiments of the present invention are:

The E. coli expression vector PET-31b, the cloned strain E. coli DH5α, and the expression strain E. coli Rosseta (DE3) were all purchased from Invitrogen. Restriction endonucleases and DNA ligases were purchased from NEB Company, aflatoxin and zearalenone standard products were purchased from sigma company, and other reagents were domestic analytical pure.

Example 1 Obtaining and expressing CotA protein

The genomic DNA of Bacillus licheniformis was used as the amplification template to amplify the CotA protein coding gene, and then construct a recombinant expression vector containing CotA protein coding gene sequence and its engineered bacteria, and express the CotA protein. Specific steps are as follows:

1. Cloning of the gene encoding CotA protein

1.1 Follow the steps below to extract genomic DNA from Bacillus licheniformis

(1) Inoculate the LB solid plate from the glycerol tube and incubate at 37°C for 12h.

(2) Pick a single colony from the plate of cultured cells to inoculate in 5mL liquid LB medium, 180r/min, and culture at 37℃ for 12h.

(3) Separate the bacterial solution into a sterilized 1.5mL microcentrifuge tube, centrifuge at 12000r/min for 1min to collect the bacterial cells, and discard the supernatant.

(4) Add 500 μL of the cell suspension to the centrifuge tube with the bacterial cell precipitate, whip the pipette tip to suspend the bacterial cell, warm bath at 37°C for 60 min; centrifuge at 12000 r/min for 1 min to collect the bacterial cell, and discard the supernatant.

(5) Add 225 μL of buffer A to the bacterial pellet and shake until the bacterial pellet is completely suspended.

(6) Add 10 μL of proteinase K solution to the tube and mix upside down.

(7) Add 25 μL of lysis solution S, mix upside down; place in a 57°C water bath for 20 min, and mix upside down 1-2 times.

(8) Add 250 μL of buffer B, shake for 5 s and mix thoroughly.

(9) Add 250 μL of absolute ethanol, shake well to mix for 15 s.

(10) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column, centrifuge at 12000r/min for 30s, pour off the waste liquid, and put the adsorption column into the collection tube.

(11) Add 500 μL of buffer C to the adsorption column, centrifuge at 12000 r/min for 30 s, discard the waste solution, and place the adsorption column in the collection tube.

(12) Add 700 μL of buffer W2 to the adsorption column, centrifuge for 30 s, discard the waste solution, and place the adsorption column in the collection tube.

(13) Add 500 μL of buffer W2 to the adsorption column, centrifuge at 12000 r/min for 3 min, and discard the waste solution.

(14) Place the adsorption column in a clean centrifuge tube and place it at room temperature for several minutes. Add 150 μL of eluent TE to the middle part of the adsorption membrane, place it at room temperature for 5 min, centrifuge at 12000 r/min for 2 min, and collect the solution into the centrifuge. In the tube.

1.2 Amplification of CotA protein encoding gene of Bacillus licheniformis, the steps are as follows:

According to the multi-cloning site of the PET-31b vector, NdeI and XhoI were selected as the restriction sites, and the upstream primer P1 and downstream primer P2 were designed and synthesized by Shanghai Shengong Bioengineering Technology Co., Ltd. Design the sequence of upstream primer P1 and downstream primer P2 as follows:

Upstream primer P1: 5′ATGAAACTTGAAAAATTCGTTG3′

Downstream primer P2: 5′TTATTGATGACGAACATCTG3′

The genomic DNA of Bacillus licheniformis was used as the template for amplification. The reaction conditions were:

DNA template	1μL
Upstream primer P1	2μL
Downstream primer P2		2μL
2×Pfu PCR Mix	25μL
ddH 2 O 2	20μL
total capacity	50μL

The amplification conditions were: pre-denaturation at 95℃ for 5min; denaturation at 95℃ for 30s; annealing at 50℃ for 30s, extension at 72℃ for 1min and 30s reaction for 30 cycles; 72℃ for complete extension for 10min. The PCR amplified products were subjected to 1% agarose gel electrophoresis, and the PCR products were recovered using agarose gel DNA recovery kit.

2. Construction of recombinant expression vector containing CotA protein coding gene sequence

The PCR product recovered in the previous step and the PET-31b plasmid were digested with NdeI and XhoI, and the digestion system was as follows:

Digestion conditions: 37°C water bath for 30min. The digested product was subjected to 1% agarose gel electrophoresis, and the PCR product and plasmid digested fragments were recovered using an agarose gel DNA recovery kit.

The PCR product and plasmid recovered by the above digestion were ligated overnight at 16°C with T4 DNA ligase; the ligation product was transformed into E. coli competent cell DH5α, screened by Amp resistant plate, positive transformants were picked, the transformed plasmid was extracted, and single and double Digestion verification and sequencing confirmed that the correct recombinant strain DH5α/PET-31b-CotA was obtained.

3. Induced expression and purification of CotA protein in E. coli

3.1 CotA protein induced expression

The recombinant E. coli Rosseta (DE3) transformed with PET-31b-CotA plasmid was inoculated in 5mL liquid LB medium for activation overnight, and transferred to a 500mL Erlenmeyer flask with a volume of 300mL at a ratio of 1:100, 180r/min Incubate at 37°C until the OD600 is 0.6, add a final concentration of 0.1mM IPTG to induce the expression of the target protein.

3.2 CotA protein purification

The fermentation broth was collected, centrifuged at 12000rpm for 30min at 4°C, and the supernatant was discarded; the cells were resuspended with phosphate buffer at pH 7.0, centrifuged at 12000rpm for 30min at 4°C, the supernatant was discarded, and the cells were washed three times. The bacterial cells were then resuspended in a binding buffer of 1 mg/mL, sonicated, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected and filtered. Because the C-terminus of the expressed CotA protein carries a histidine tag (6×His), a nickel ion affinity chromatography column (Ni2 ⁺ -NTA) was used to purify the recombinant protein. For equilibration, loading, and elution steps, see Qiagen. manual. The purified protein was ultrafiltered with a retention tube (10kDa) to remove the imidazole contained therein. The purification result of the target protein was detected by SDS-PAGE electrophoresis. The result is shown in Figure 1. Lane 1 is the expression product, and the arrow indicates the target band. It shows that the molecular weight of the protein expressed by the recombinant strain is about 60 kDa, which is consistent with the theoretical molecular weight.

Example 2 Detection of degradation activity of CotA protein on aflatoxin B1 and zearalenone

Dissolve aflatoxin B1 in dimethyl sulfoxide to make a 20 μg/mL mother liquor, and test according to the following 500 μL reaction system: 430 μL sodium phosphate buffer (0.1 M, pH 8.0), 20 μL CotA protein (10 μg), 50 μL of aflatoxin B1 solution. The system without CotA protein was used as a control. After the reaction was carried out at 37°C for 12h, 500 μL of methanol was added to terminate the reaction. AFB1 was detected by high-performance liquid chromatography. According to the change of AFB1 concentration, whether the CotA protein had degradation activity on AFB1 was analyzed.

The chromatographic conditions for high performance liquid chromatography detection of AFB1 are: chromatographic column: Agilent C18 column, 4.6mm×150mm×5μm; mobile phase: methanol-water (45:55); flow rate: 1mL/min; pump pressure: 75bar; Sample volume: 20 μL; detection wavelength of fluorescence detector: λex=360 nm, λem=440 nm; collection time: 20 minutes.

Under the above chromatographic conditions, as shown in Figure 2, the control sample has a strong absorption peak at the retention time RT = 12.4min, but the addition of the CotA protein group basically has no AFB1 target peak detected. According to the absorption peak area calculation, there are already 95 % AFB1 molecules are degraded, indicating that the recombinant CotA protein has the activity of degrading aflatoxin B1.

Dissolve zearalenone in acetonitrile to make a 100 μg/mL mother liquor, and test according to the following 500 μL reaction system: 430 μL sodium phosphate buffer (0.1 M, pH 8.0), 20 μL CotA protein (10 μg), 50 μL corn red Mycophenone solution. The system without CotA protein was used as a control. After the reaction was carried out at 37°C for 12h, 500 μL of methanol was added to terminate the reaction. High performance liquid chromatography was used to detect whether the CotA protein had degrading activity on ZEN according to the change of ZEN concentration.

The chromatographic conditions for high performance liquid chromatography detection of ZEN are: Column: Agilent C18 column, 4.6mm×150mm×5μm; Mobile phase: acetonitrile-water-methanol (46:46:8); flow rate: 1mL/min; pump pressure : 45 bar; injection volume: 20 μL; detection wavelength of fluorescence detector: λex=274 nm, λem=440 nm; collection time: 18 minutes.

Under the above chromatographic conditions, as shown in Fig. 3, the control sample had a strong absorption peak at the retention time RT = 12.2min, but the addition of CotA protein group basically did not detect the ZEN target peak. According to the calculation of the absorption peak area, there are already 95 % Of the ZEN molecules are degraded, indicating that the recombinant CotA protein has the activity of degrading zearalenone.

Example 3 The effect of pH on the degradation of aflatoxin B1 and zearalenone by CotA protein

To test the activity of CotA protein degrading AFB1 under different pH conditions, the reaction system used in Case Example 2: 430 μL buffer (0.1M sodium citrate buffer, pH 5-6; 0.1M sodium phosphate buffer, pH 7-8; 0.1 M glycine-NaOH buffer, pH 9), 20 μL CotA protein (10 μg), 50 μL aflatoxin B1 solution. After the reaction was carried out at 37°C for different time (1, 3, 6, 9, 12h), 500 μL of methanol was added to terminate the reaction, and the method described in Case 2 was used to detect the residual AFB1 content in the system. The results are shown in Figure 4. Under neutral and alkaline conditions, CotA protein degrades AFB1 with relatively high activity, and the optimal pH is 8.0.

To test the activity of CotA protein degrading ZEN under different pH conditions, the reaction system used in Case Example 2: 430 μL buffer (0.1M sodium citrate buffer, pH6; 0.1M sodium phosphate buffer, pH7-8; 0.1M glycine -NaOH buffer, pH 9-10), 20 μL CotA protein (10 μg), 50 μL zearalenone solution. After the reaction was carried out at 37°C for different time (1, 3, 6, 9, 12h), 500 μL of methanol was added to terminate the reaction. The method described in Case Example 2 was used to detect the residual ZEN content in the system. The results are shown in Figure 4. Under neutral and alkaline conditions, CotA protein degrades ZEN with relatively high activity, and the optimal pH is 8.0.

Example 4 The effect of temperature on the degradation of aflatoxin B1 and zearalenone by CotA protein

To test the activity of CotA protein to degrade AFB1 and ZEN under different temperature conditions, the reaction system used in Case Example 2 was used: 430 μL buffer (0.1M sodium phosphate buffer, pH8), 20 μL CotA protein (10 μg), 50 μL aflatoxin B1 Solution or zearalenone solution. The reaction was carried out at different temperatures (30, 40, 50, 60, 65, 70, 75, 80°C) for 30 minutes, and then 500 μL of methanol was added to terminate the reaction. The method described in Case 2 was used to detect the residual toxin content in the system. The results are shown in Figure 5. The optimal temperature for CotA protein degradation AFB1 is 70℃, and the optimal temperature for ZEN degradation is 75℃.

Example 5 CotA protein degradation of aflatoxin B1 and zearalenone enzymatic reaction kinetic parameter determination

CotA protein degradation of aflatoxin B1 and zearalenone enzyme activity is defined as the amount of enzyme required to degrade 1 μg of toxin per minute.

Using the 500 μL reaction system used in Case Example 2: 430 μL buffer (0.1 M sodium phosphate buffer, pH 8), 20 μL CotA protein (10 μg), 50 μL aflatoxin B1 solution, in which the final concentration of AFB1 was 1, 2, 5, 10, 25, 40, 50, 75 and 100 μg/mL, 37°C for 30 min; determine the initial reaction rate of CotA catalytic degradation of AFB1 in different concentrations of AFB1 system, according to the Mie equation, use Graphpad5.0 to perform Michaelis-Menten regression analysis, The K _m and the maximum reaction rate V _{m of} CotA catalytic degradation of AFB1 are solved. According to the amount of enzyme added in the system, the K _cat value is further solved. Similarly, in a system with ZEN concentrations of 5, 10, 25, 50, 100, 150, 200, 300, and 400 μg/mL, the initial reaction rate of CotA for catalytic degradation of ZEN is determined, and the corresponding kinetic parameters of the enzymatic reaction are solved. The results are shown in Table 1.

Table 1 shows the kinetic parameters of CotA catalytic degradation of aflatoxin B1 and zearalenone

Example 6 CotA catalytic degradation efficiency of AFM1, AFG1, zearalenol and zearalenol

The AFM1, AFG1, zearalenol and zearalenol were dissolved in dimethyl sulfoxide to make a 20μg/mL mother liquor, and the test was carried out according to the following 500μL reaction system: 430μL sodium phosphate buffer (0.1M, pH6. 0-8.0), 20 μL CotA protein (10 μg), 50 μL mother liquid of various toxins. The system without CotA protein was used as a control. After the reaction was carried out at 37°C for 12h, 500 μL of methanol was added to terminate the reaction. High-performance liquid chromatography was used to detect whether the CotA protein had degrading activity against several toxins according to the change in the concentration of each toxin. Specific embodiments are as in Example 2. The efficiency of CotA for catalytic degradation of AFM1, AFG1, zearalenol and zearalenol is shown in Table 2.

Table 2 CotA catalytic degradation efficiency of AFM1, AFG1, zearalenol and zearalenol

Example 7 An additive and preparation method thereof

Weigh the carrier of 90% of the total mass of the additive (maltodextrin and talc mixed at a mass ratio of 2:1), and then mix the bacterial laccase CotA protein at a ratio of 10% of the total mass of the additive to obtain the additive.

Example 8 An additive and preparation method thereof

Weigh the carrier of 9% of the total mass of the additive (maltodextrin and talc powder are mixed in a mass ratio of 1:1), then mix in the bacterial laccase CotA protein at a ratio of 1% of the total mass of the additive, and finally according to the total amount of the additive 90% of the mixture was mixed with Bacillus licheniformis and Bacillus amyloliquefaciens mixed preparation powder (the mass ratio of Bacillus licheniformis and Bacillus amyloliquefaciens was 1:1) to obtain additives.

Example 9 An additive and preparation method thereof

First, 70% of the total mass of the additive is mixed with 10% of the total mass of the additive, and then the bacterial laccase CotA protein is mixed in the proportion of 10% of the total mass of the additive, and finally 10% of the total amount of the additive % Is mixed with zearalenone lactone enzyme to obtain additives.

Example 10 An additive and its preparation method

First mix 70% of the total mass of the additive with maltodextrin and 20% of the total mass of the additive, then mix the solid bacterial laccase CotA protein at a ratio of 5% of the total mass of the additive, and finally add the total amount of the additive The amount of 5% is mixed with aflatoxin detoxification enzyme to obtain additives.

Example 11

AFB1 in naturally moldy corn was treated with the additives described in Example 8.

The additive is mixed with natural moldy corn (AFB1=50ppb) at a ratio of 0.1%, and digested for 24 hours in in vitro simulated animal gastrointestinal fluid, which is used to degrade AFB1 in natural moldy grain, grain or feed.

Simulated gastric juice: accurately weigh 2g of corn containing naturally moldy AFB1, then add 2mg of additive, put it in a 100mL Erlenmeyer flask, add 25mL of PBS (0.1M pH6.0), adjust the pH to 6.8, and mix well. Add 1mL of prepared amylase solution, and digest at 39℃, 150r/min for 2h. Add 10mL of 0.2M HCl, adjust the pH to 2.0 with 1M HCl or 1M NaOH solution, add 1mL of freshly prepared acid protease (50000U/g), mix well, seal with parafilm, and incubate at 39℃ for 6h (150r/min) ).

Simulated intestinal juice: After 6 hours of simulated gastric juice incubation, add 5mL of 0.6M NaOH solution, adjust the pH to 6.8 with 1M HCl or 1M NaOH, then add freshly prepared intestinal exogenous enzyme suspension (protease: amylase: lipase = 3:1:1), sealed with parafilm, and cultivated on a constant temperature shaker at 39℃ for 18h (150r/min) respectively.

After the reaction, the degradation rate of AFB1 in natural moldy corn was determined to be 91.24%.

Example 12

The ZEN in the industrial ethanol processing by-product DDGS was treated with the additives described in Example 8.

The additive is mixed with DDGS (ZEN=3ppm), a by-product of industrial ethanol processing, at a ratio of 0.1%, and digested in the in vitro simulated animal gastrointestinal fluid for 24h to degrade ZEN in DDGS.

Simulated gastric juice: accurately weigh 2g of ZEN mildewed DDGS, add 2mg of additive, put it in a 100mL Erlenmeyer flask, add 25mL of PBS (0.1M pH 6.0), adjust the pH to 6.8, and mix well. Add 1mL of prepared amylase solution, and digest at 39℃, 150r/min for 2h. Add 10mL 0.2M HCl, adjust the pH to 2.0 with 1M HCl or 1M NaOH solution, add 1mL of freshly prepared acidic protease (50000U/g), mix well, seal with parafilm, and incubate at 39℃ for 6h (150r/min) ).

Simulated small intestinal juice: After 6 hours of simulated gastric juice incubation, add 5mL 0.6M NaOH solution, adjust the pH to 6.8 with 1M HCl or 1M NaOH, then add freshly prepared intestinal exogenous enzyme suspension (protease: amylase: lipase = 3:1:1), sealed with parafilm, and cultivated on a constant temperature shaker at 39℃ for 18h (150r/min) respectively.

After the reaction was completed, the degradation rate of ZEN in moldy DDGS was determined to be 93.23%.

The application of the bacterial laccase CotA protein provided by the present invention in the degradation of mycotoxins has been described in detail above. This document uses specific examples to explain the principles and implementations of the present invention. The descriptions of the above examples are only used to help understand the method and core ideas of the present invention. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, the present invention may also be subjected to several improvements and modifications, and these improvements and modifications also fall within the protection scope of the claims of the present invention.

Claims (31)

1. The bacterial laccase CotA protein is characterized in that the amino acid sequence of the bacterial laccase CotA protein is:

   As shown in SEQ ID NO.1 sequence;

   Or one or two amino acid residues in the sequence shown in SEQ ID NO. 1 are substituted and/or deleted and/or inserted;

   Or a sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having the function of bacterial laccase CotA protein.
2. The bacterial laccase CotA protein according to claim 1, wherein the amino acid sequence of the bacterial laccase CotA protein has at least 70% sequence identity with the amino acid sequence shown in SEQ ID NO:1, And it has the function sequence of bacterial laccase CotA protein.
3. The bacterial laccase CotA protein according to claim 1, wherein the bacterial laccase CotA protein has an amino acid sequence of at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO:1, And it has the function sequence of bacterial laccase CotA protein.
4. The bacterial laccase CotA protein according to claim 1, wherein the bacterial laccase CotA protein has an amino acid sequence of at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO:1, And it has the function sequence of bacterial laccase CotA protein.
5. The bacterial laccase CotA protein according to claim 1, wherein the amino acid sequence of the bacterial laccase CotA protein has at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO:1, And it has the function sequence of bacterial laccase CotA protein.
6. The bacterial laccase CotA protein according to claim 1, wherein the nucleotide sequence encoding the bacterial laccase CotA protein is:

   As shown in the sequence of SEDID NO.2;

   Or one or two nucleotide residues in the sequence as shown in SED ID NO. 2 are substituted and/or deleted and/or inserted;

   Or it has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.
7. The bacterial laccase CotA protein according to claim 1, wherein the nucleotide sequence encoding the bacterial laccase CotA protein is at least 70% of the nucleotide sequence shown in SEQ ID NO: 2 Sequence consistency.
8. The bacterial laccase CotA protein according to claim 1, wherein the nucleotide sequence encoding the bacterial laccase CotA protein is at least 75% of the nucleotide sequence shown in SEQ ID NO: 2 Sequence consistency.
9. The bacterial laccase CotA protein according to claim 1, wherein the nucleotide sequence encoding the bacterial laccase CotA protein is at least 80% of the nucleotide sequence shown in SEQ ID NO: 2 Sequence consistency.
10. The bacterial laccase CotA protein of claim 1, wherein the nucleotide sequence encoding the bacterial laccase CotA protein is at least 85% of the nucleotide sequence shown in SEQ ID NO: 2 Sequence consistency.
11. The use of the bacterial laccase CotA protein according to any one of claims 1 to 10 in the degradation of mycotoxins.
12. The use according to claim 11, characterized in that the mycotoxins are aflatoxins B1, B2, G1, G2, M1, M2, zearalenone, zearalenol or zearalenol One or more of them.
13. The application according to claim 11, characterized in that the bacterial laccase CotA protein is derived from Bacillus, the Bacillus is Bacillus licheniformis, Bacillus subtilis, Bacillus amyloliquefaciens (Bacillus amyloliquefaciens), Bacillus brevis (Bacillus pumilus), Bacillus lentus (Bacillus lentus) or Bacillus clausii (Bacillus clausii), preferably Bacillus licheniformis.
14. The use according to claim 11, characterized in that the amino acid sequence of the bacterial laccase CotA protein is:

    As shown in SEQ ID NO.1 sequence;

    Or one or two amino acid residues in the sequence shown in SEQ ID NO. 1 are substituted and/or deleted and/or inserted;

    Or a sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having the function of bacterial laccase CotA protein.
15. The use according to claim 11, characterized in that the amino acid sequence of the bacterial laccase CotA protein is: at least 70% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, and has a bacterial lacquer The functional sequence of the enzyme CotA protein.
16. The application according to claim 11, characterized in that the amino acid sequence of the bacterial laccase CotA protein is: at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, and has a bacterial lacquer The functional sequence of the enzyme CotA protein.
17. The application according to claim 11, characterized in that the amino acid sequence of the bacterial laccase CotA protein is: having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and having a bacterial lacquer The functional sequence of the enzyme CotA protein.
18. The application according to claim 11, characterized in that the amino acid sequence of the bacterial laccase CotA protein is at least 85% identical to the amino acid sequence shown in SEQ ID NO: 1, and has a bacterial lacquer The functional sequence of the enzyme CotA protein.
19. The use according to claim 11, characterized in that the nucleotide sequence encoding the bacterial laccase CotA protein is:

    As shown in the sequence of SEDID NO.2;

    Or one or two nucleotide residues in the sequence as shown in SED ID NO. 2 are substituted and/or deleted and/or inserted;

    Or it has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:2.
20. The use according to claim 11, characterized in that the nucleotide sequence encoding the bacterial laccase CotA protein is: at least 70% sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 .
21. The application according to claim 11, characterized in that the nucleotide sequence encoding the bacterial laccase CotA protein is: having at least 75% sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 .
22. The application according to claim 11, characterized in that the nucleotide sequence encoding the bacterial laccase CotA protein is: at least 80% sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 .
23. The application according to claim 11, characterized in that the nucleotide sequence encoding the bacterial laccase CotA protein is at least 85% identical to the nucleotide sequence shown in SEQ ID NO: 2 .
24. A food or feed additive, characterized in that it contains bacterial laccase CotA protein and its physiologically acceptable carrier, and the content of the bacterial laccase CotA protein is 1-10%.
25. The food or feed additive according to claim 24, wherein the physiologically acceptable carrier is selected from maltodextrin, milk powder, limestone, cyclodextrin, wheat, wheat bran, rice, rice bran, sucrose, starch , Na ₂ SO ₄ , talc or one or more of PVA.
26. The food or feed additive according to claim 24, further comprising a micro-ecological preparation, the micro-ecological preparation is Bacillus licheniformis, Bacillus subtilis, Bifidobacterium bifidus, Enterococcus faecalis, Enterococcus faecium, Enterococcus lactis, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus germani, Lactobacillus plantarum, Lactobacillus plantarum, Pediococcus lactis, Pediococcus pentosus, Candida utilis, Bifidobacterium infantis, Bifidobacterium longum, Bifidobacterium breve, Bifidobacterium adolescentis, Streptococcus thermophilus, Lactobacillus reuteri, Bifidobacterium animalis, Aspergillus oryzae, Bacillus lentus, Bacillus pumilus, Lactobacillus cellobiose, Lactobacillus fermentum or Lactobacillus delbrueckii One or more of Bacillus subsp. bulgaricus, preferably, when used in silage or cattle feed, the feed additive further contains at least one of Propionibacterium, Lactobacillus brucelli and Lactobacillus paracasei Or, the feed additive also contains Bacillus coagulans and/or Brevibacillus sp. when used in the feed of poultry, pigs and aquaculture animals.
27. The food or feed additive according to claim 24, characterized in that the additive further comprises additional enzymes; the additional enzymes are selected from the group consisting of: aflatoxin detoxification enzyme, zearalenone lactone enzyme, volt Equine toxin carboxylesterase, fumonisin aminotransferase, aminopolyolamine oxidase, deoxyfusarium oxysporum epoxide hydrolase, carboxypeptidase, Aspergillus niger aspartic protease PEPAa, PEPAb, PEPAc or PEPAd , Elastase, aminopeptidase, pepsin, pepsin-like protease, trypsin, trypsin-like protease, bacterial protease, enzymes involved in starch metabolism, fiber degradation, lipid metabolism, proteins or enzymes involved in glycogen metabolism, starch Enzyme, arabinase, arabinofuranase, catalase, cellulase, chitinase, rennet, cutinase, deoxyribonuclease, epimerase, esterase, -galactosidase , Glucanase, glucan lyase, endoglucanase, glucoamylase, glucose oxidase, glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolysis Enzyme, invertase, isomerase, lipolytic enzyme, laccase, lyase, mannosidase, oxidase, oxidoreductase, pectate cleavage, pectin acetylesterase, pectin depolymerase, pectin A Esterase, pectin-decomposing enzyme, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, rhamno-galacturonase, ribonuclease, African sweetener, transfer One or more of enzymes, transporters, transglutaminase, xylanase, hexose oxidase, or acid phosphatase.
28. A method for degrading mycotoxins, comprising the steps of treating bacterial laccase CotA protein or the additive according to any one of claims 24 to 27 with a material containing mycotoxins, the material including but not limited to food, Feed, feed materials, grain, grain and oil, grain processing by-products or milk.
29. The method according to claim 28, characterized in that the material further includes tea, Chinese herbal medicine and its processing by-products, industrial ethanol processing by-product DDGS, aged food, pig, chicken, cattle, sheep, aquatic animals Feed, concentrated feed, pre-mixed feed, silage, aquatic animal feed, pet feed and/or fur animal feed.
30. The use of the bacterial laccase CotA protein according to any one of claims 1 to 10 or the food or feed additive according to any one of claims 24 to 27 in the degradation of mycotoxins in food and/or feed, characterized in that: The food and/or feed includes but is not limited to food, feed, feed raw materials, grain, grain oil, grain processing by-products or milk.
31. The bacterial laccase CotA protein according to any one of claims 1 to 10 or the additive according to any one of claims 24 to 27 in tea, Chinese herbal medicine and its processing by-products, industrial ethanol processing by-product DDGS, aged food, Application of mycotoxin detoxification in full-price feed, concentrated feed, pre-mixed feed, silage, aquatic animal feed, pet feed and/or fur animal feed for pigs, chickens, cattle, sheep and aquatic animals.

Images