CN109820132B - Application of bacterial laccase CotA protein in degradation of mycotoxin - Google Patents
Application of bacterial laccase CotA protein in degradation of mycotoxin Download PDFInfo
- Publication number
- CN109820132B CN109820132B CN201811492897.9A CN201811492897A CN109820132B CN 109820132 B CN109820132 B CN 109820132B CN 201811492897 A CN201811492897 A CN 201811492897A CN 109820132 B CN109820132 B CN 109820132B
- Authority
- CN
- China
- Prior art keywords
- bacillus
- cota protein
- bacterial laccase
- protein
- additive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
- A23L5/20—Removal of unwanted matter, e.g. deodorisation or detoxification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Health & Medical Sciences (AREA)
- Nutrition Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to application of bacterial laccase CotA protein in degradation of mycotoxin in the technical field of enzyme engineering, in particular to application in simultaneous degradation of aflatoxin and zearalenone. Experiments prove that the bacterial laccase CotA protein can degrade aflatoxin and zearalenone at the same time without depending on any mediator.
Description
Technical Field
The invention belongs to the technical field of enzyme engineering, and particularly relates to application of bacterial laccase CotA protein in degradation of mycotoxin, in particular to application in simultaneous degradation of aflatoxin and zearalenone.
Background
Mycotoxins are secondary metabolites of the mold, have carcinogenic action, genetic toxicity, reproductive toxicity, neurotoxicity and immunosuppressive action, and can cause mycotoxin poisoning symptoms such as growth inhibition, disease susceptibility increase, metabolic disorder, reproductive disturbance and the like after animals take mildewed daily rations. Grain grains are infected with toxin-producing moulds in the field, if the environmental temperature and humidity are proper, the moulds continue to grow and propagate in the processing, transportation and storage processes, and the toxin content continues to increase. According to the international Food and Agricultural Organization (FAO), 25% of grains are contaminated with mycotoxins every year worldwide, and on average 2% are inedible, and the socio-economic losses due to poisoning, disease and death of people and animals caused by toxin contamination are immeasurable. The aflatoxin is mainly generated by aspergillus flavus and aspergillus parasiticus, wherein the toxicity and harm of aflatoxin B1 are the greatest, the acute toxicity of aflatoxin B1 is 10 times that of potassium cyanide and 68 times that of arsenic, and the difuran ring and the oxaneinone ring in the molecular structure are closely related to the toxicity and carcinogenicity of the bifuran ring and the oxaneinone ring. Zearalenone, also known as F-2 toxin, is a non-steroidal estrogenic mycotoxin mainly produced by fusarium graminearum, and is chemically named 6- (10-hydroxy-6-oxy-undecenyl) beta-clavulanate lactone, wherein the lactone bond and the hydroxyl group at the C4 position of the benzene ring are the main toxic groups of zearalenone.
The mycotoxin biodegradation is to convert mycotoxin into nontoxic or low-toxic metabolites under the action of microorganisms and specific enzymes generated by the microorganisms, has the advantages of safety, high efficiency, environmental protection and the like, and is the development trend of mycotoxin detoxification in current feeds and foods. At present, enzymes capable of degrading aflatoxin and zearalenone reported at home and abroad are mainly peroxidases, such as horseradish peroxidase, manganese peroxidase and the like, and laccase derived from fungi is also reported to have the activity of degrading aflatoxin and zearalenone. Hydrogen peroxide is needed to be used as a substrate in the process of catalyzing and degrading aflatoxin and zearalenone by peroxidase, and mediators are needed to participate in the process of catalyzing and degrading aflatoxin and zearalenone by fungal laccase, so that further evaluation on the effectiveness and safety of the peroxidase and fungal laccase for mycotoxin detoxification in feed and food is needed. In addition, the proteins having aflatoxin-degrading activity also include aflatoxin oxidase ADTZ derived from Armillaria pseudomellea and F420H 2-dependent reductase FDR derived from mycobacteria; the proteins having zearalenone degrading activity further include lactonohydrolase ZHD101 derived from Gliocladium roseum and zearalenone degrading enzyme ZENdease-N2 derived from Rhizoctonia solani.
There is increasing evidence that other enzymes with unknown properties may also be involved in the degradation of both aflatoxins and zearalenone mycotoxins with benzene and lactone ring structures. Therefore, it is imperative to find and develop new enzymes for the biodegradation of mycotoxins.
Disclosure of Invention
The invention aims to provide application of bacterial laccase CotA protein in mycotoxin detoxification. The product can be used for detoxicating mycotoxin in materials such as grains, feeds, foods, fruits, milk and the like and processing byproducts thereof, industrial ethanol processing byproducts DDGS and the like.
Therefore, the technical scheme of the invention is as follows:
the application of bacterial laccase CotA protein in degrading mycotoxin, wherein the mycotoxin is aflatoxin B1, B2, G1, G2, M1 or M2, zearalenone, zearalenol and zearalanol.
In the application, the bacterial laccase CotA protein is derived from bacillus.
In the above application, the Bacillus may be Bacillus licheniformis (Bacillus licheniformis), Bacillus subtilis (Bacillus subtilis), Bacillus amyloliquefaciens (Bacillus amyloliquefaciens), Bacillus pumilus (Bacillus pumilus), Bacillus lentus (Bacillus lentus) or Bacillus clausii (Bacillus clausii), and preferably Bacillus licheniformis (Bacillus licheniformis).
In the above application, the amino acid sequence of the bacterial laccase CotA protein may be:
a sequence shown as SEQ ID NO. 1;
or one or two amino acid residues in the sequence shown in SEQ ID NO.1 are substituted and/or deleted and/or inserted;
or a sequence which has at least 90 percent of sequence consistency with the amino acid sequence shown in SEQ ID NO.1 and has the function of bacterial laccase CotA protein.
In the application, the nucleotide sequence for coding the bacterial laccase CotA protein is as follows:
SED ID NO. 2;
or one or two nucleotide residues in the sequence shown in SED ID NO.2 are substituted and/or deleted and/or inserted;
or has at least more than 90 percent of sequence identity with the nucleotide sequence shown in SEQ ID NO. 2.
A food or feed additive comprising a bacterial laccase CotA protein in an amount of 1-10% and a physiologically acceptable carrier.
The physiologically acceptable carrier is selected from maltodextrin, limestone, cyclodextrin, wheat bran, rice bran, sucrose, starch, Na2SO4One or more of talc and PVA.
In the additive, the amino acid sequence of the bacterial laccase CotA protein can be as follows:
a sequence shown as SEQ ID NO. 1;
or one or two amino acid residues in the sequence shown in SEQ ID NO.1 are substituted and/or deleted and/or inserted;
or a sequence which has at least 90 percent of sequence consistency with the amino acid sequence shown in SEQ ID NO.1 and has the function of bacterial laccase CotA protein.
The additive also comprises a microecological preparation, wherein the microecological preparation is one or more of bacillus licheniformis, bacillus subtilis, bifidobacterium bifidum, enterococcus faecalis, enterococcus faecium, enterococcus lactis, lactobacillus acidophilus, lactobacillus casei, lactobacillus delbrueckii subsp lactis, lactobacillus plantarum, pediococcus acidilactici, pediococcus pentosaceus, candida utilis, bifidobacterium infantis, bifidobacterium longum, bifidobacterium breve, bifidobacterium adolescentis, streptococcus thermophilus, lactobacillus reuteri, bifidobacterium animalis, aspergillus oryzae, bacillus lentus, bacillus pumilus, lactobacillus cellobiosus, lactobacillus fermentum and lactobacillus delbrueckii subsp bulgaricus, and preferably, when the additive is used for silage or cattle feed, the additive further comprises at least one of propionibacterium propionicum, lactobacillus buchneri and lactobacillus paracasei; or the additive also contains bacillus coagulans and/or brevibacillus laterosporus when the additive is used for the feed of poultry, pigs and aquaculture animals.
In the above additive, the additive further comprises an additional enzyme; the additional enzyme is selected from: aflatoxin detoxification enzyme, zearalenone lactonase, fumonisin carboxyl esterase, fumonisin aminotransferase, aminopolyol amine oxidase, deoxynivalenol epoxide hydrolase, carboxypeptidase, aspergillus niger aspartic protease PEPAa, PEPAb, PEPAc or PEPAd, elastase, aminopeptidase, pepsin-like protease, trypsin-like protease, bacterial protease, an enzyme involved in starch metabolism, fiber degradation, lipid metabolism, a protein or enzyme involved in glycogen metabolism, amylase, arabinase, arabinofuranosidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, galactosidase, glucanase, endoglucanase, glucoamylase, glucose oxidase, glucosidases including one or more of beta-glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, lipolytic enzyme, laccase, lyase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin lyase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, rhamnogalacturonase, ribonuclease, african sweet fruit element, transferase, transporter, transglutaminase, xylanase, hexose oxidase, and acid phosphatase.
In the additive, the content of the microecological preparation is 0-20%;
in the above additive, the content of the additional enzyme is 0-9%.
The preparation method of the additive comprises the following steps: mixing the bacterial laccase CotA protein with a physiologically acceptable carrier thereof to prepare an additive containing the laccase CotA protein, and further mixing the additive with a microecological preparation and another enzyme according to a certain proportion to obtain the additive; the content of the CotA protein in the additive is 1-10%.
Among the above additives, bacterial laccase CotA protein: physiologically acceptable carrier: a microecological preparation: the mass ratio of the additional enzymes may be: 1: 70: 20: 9 or 2: 70: 20: 8 or 3: 70: 20: 7 or 4: 70: 20: 6 or 5: 70: 20: 5 or 6: 70: 20: 4 or 7: 70: 20: 3 or 8: 70: 20: 2 or 9: 70: 20: 1 or 10: 70: 20: 0.
a method of degrading mycotoxins comprising treating a mycotoxin-containing material with the bacterial laccase CotA protein or the additive.
In the above method, the treatment is mixing the above bacterial laccase CotA protein or the above additive with a mycotoxin-containing material.
In the method, the mycotoxins are aflatoxins B1, B2, G1, G2, M1 or M2, zearalenone, zearalenol and zearalanol.
In the method, the material containing mycotoxin is grains, feed, food, fruits, milk and the like and processing byproducts thereof or industrial ethanol processing byproducts DDGS and the like.
The invention has the advantages and beneficial effects that:
the invention provides application of bacterial laccase CotA protein in degradation of mycotoxin, and experiments prove that the bacterial laccase CotA protein can degrade aflatoxin and zearalenone simultaneously without depending on any mediator.
Drawings
FIG. 1 is a SDS-PAGE picture after purification of an expression product of the recombinant plasmid PET31 b-CotA; wherein lane 1 is the purified recombinant CotA protein and lane M is the protein molecular weight standard (116, 66.2, 45, 35, 25, 18.4, 14.4 kDa).
FIG. 2 shows the HPLC analysis results of recombinant CotA protein degradation AFB1 (A is AFB1 blank group, B plus CotA protein treatment group).
FIG. 3 shows the HPLC analysis results of recombinant CotA protein degradation ZEN (A is ZEN blank control group, B plus CotA protein treatment group).
FIG. 4 shows the degradation of AFB1 and ZEN by CotA protein under different pH conditions.
FIG. 5 shows the degradation of AFB1 and ZEN by CotA protein under different temperature conditions.
Detailed Description
The invention is further described with reference to the following figures and specific examples. The biochemical reagents used in the examples are all commercially available reagents, and the technical means used in the examples are conventional means used by those skilled in the art, unless otherwise specified.
The main experimental materials and reagents used in the examples of the invention were:
coli expression vector PET-31b, the cloned strain E.coli DH5 a, and the expression strain E.coli Rosseta (DE3) were purchased from Invitrogen. Restriction endonucleases and DAN ligase were purchased from NEB, aflatoxin and zearalenone standards from sigma, and other reagents were home-made analytical purifiers.
Example 1 obtaining and expression of CotA protein
And (2) amplifying the coding gene of the CotA protein by using the genome DNA of the bacillus licheniformis as an amplification template, then constructing a recombinant expression vector containing the coding gene sequence of the CotA protein and engineering bacteria thereof, and expressing the CotA protein. The method comprises the following specific steps:
1. cloning of the CotA protein-encoding Gene
1.1 extraction of Bacillus licheniformis genomic DNA by the following procedure
(1) The resulting mixture was inoculated from a glycerol tube and streaked onto an LB solid plate, and then subjected to static culture at 37 ℃ for 12 hours.
(2) A single colony was picked from the plate on which the cells were cultured and inoculated into 5mL of liquid LB medium and cultured at 37 ℃ at 180r/min for 12 hours.
(3) The bacterial liquid is subpackaged into a sterilized 1.5mL microcentrifuge tube, centrifuged at 12000r/min for 1min to collect the thallus, and the supernatant is discarded.
(4) Adding 500 μ L of cell suspension into the centrifuge tube with thallus precipitate, blowing with a gun head to suspend thallus, and bathing at 37 deg.C for 60 min; the cells were collected by centrifugation at 12000r/min for 1min and the supernatant was discarded.
(5) 225. mu.L of buffer A was added to the pellet, and the pellet was shaken until the pellet was completely suspended.
(6) Add 10. mu.L proteinase K solution to the tube and mix by inversion.
(7) Adding 25 mu L of lysis solution S, reversing and uniformly mixing; standing in water bath at 57 deg.C for 20min, and mixing by reversing for 1-2 times.
(8) Add 250. mu.L of buffer B and mix well with shaking for 5 s.
(9) Add 250. mu.L of absolute ethanol, shake well and mix for 15 s.
(10) Adding the solution and flocculent precipitate obtained in the previous step into an adsorption column, centrifuging at 12000r/min for 30s, pouring off waste liquid, and placing the adsorption column into a collecting pipe.
(11) Adding 500 mu L of buffer solution C into the adsorption column, centrifuging at 12000r/min for 30s, pouring waste liquid, and placing the adsorption column into a collection tube.
(12) Add 700. mu.L of buffer W2 to the adsorption column, centrifuge for 30s, pour off the waste, place the adsorption column in the collection tube.
(13) The adsorption column was added with 500. mu.L of buffer W2, centrifuged at 12000r/min for 3min, and the waste solution was discarded.
(14) Placing the adsorption column in a clean centrifuge tube, standing at room temperature for several minutes, suspending and dropwise adding 150 μ L of eluent TE to the middle part of the adsorption membrane, standing at room temperature for 5min, centrifuging at 12000r/min for 2min, and collecting the solution in the centrifuge tube.
1.2 the amplification of the coding gene of the CotA protein of the bacillus licheniformis comprises the following steps:
an upstream primer P1 and a downstream primer P2 were designed according to the multi-cloning site of the vector PET-31b by selecting NdeI and XhoI as the cleavage sites, and were synthesized by Shanghai Biotechnology engineering Co., Ltd. The sequences of the upstream primer P1 and the downstream primer P2 are designed as follows:
upstream primer P1: 5'ATGAAACTTGAAAAATTCGTTG3'
The downstream primer P2: 5'TTATTGATGACGAACATCTG3'
The Bacillus licheniformis genome DNA is used as a template for amplification, and the reaction conditions are as follows:
the amplification conditions were: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 50 ℃ for 30s, and extending at 72 ℃ for 1min for 30s reaction for 30 cycles; extension was complete for 10min at 72 ℃. The PCR amplification product was subjected to electrophoresis on a 1% agarose gel, and the PCR product was recovered using an agarose gel DNA recovery kit.
2. Construction of recombinant expression vector containing CotA protein coding gene sequence
The PCR product recovered in the previous step and the PET-31b plasmid were digested with NdeI and XhoI in a double-restriction system as follows:
| PCR product/PET-31 b plasmid | 30μL |
| NdeI | |
| XhoI | 1μL |
| 10×CutSmart Buffer | 5μL |
| ddH2O2 | 13μL |
| Total volume | 50μL |
The enzyme digestion conditions are as follows: water bath at 37 deg.c for 30 min. The digested product was electrophoresed through 1% agarose gel, and the PCR product and the plasmid digested fragment were recovered by agarose gel DNA recovery kit.
Connecting the PCR product and the plasmid recovered by enzyme digestion with T4DNA ligase at 16 ℃ overnight; and transforming the connecting product into an escherichia coli competent cell DH5 alpha, screening by an Amp resistance plate, selecting a positive transformant, extracting a transformation plasmid, performing single and double enzyme digestion verification and sequencing, and determining to construct and obtain a correct recombinant strain DH5 alpha/PET-31 b-CotA.
3. Inducible expression and purification of CotA protein in E.coli
3.1 inducible expression of the CotA protein
Recombinant E.coli Rosseta (DE3) transformed with PET-31b-CotA plasmid was inoculated in 5mL of liquid LB medium and activated overnight at a rate of 1: transferring 100 proportion into 500mL triangular flask with liquid loading capacity of 300mL, culturing at 37 ℃ at 180r/min until OD600 is 0.6, and adding IPTG with final concentration of 0.1mM to induce target protein expression.
3.2 CotA protein purification
Collecting fermentation liquor, centrifuging at 4 deg.C and 12000rpm for 30min, and removing supernatant; the cells were resuspended in phosphate buffer pH7.0, centrifuged at 12000rpm for 30min at 4 ℃ and the supernatant discarded, and the cells were washed repeatedly three times. Then, the bacterial cells were resuspended in a binding buffer of 1mg/mL, disrupted by sonication, centrifuged at 12000rpm for 10min at 4 ℃ and the supernatant was collected and filtered. Since the C-terminus of the expressed CotA protein carries a histidine tag (6 XHis), a nickel ion affinity chromatography column (Ni 2) was used+NTA) purification of recombinant proteins, equilibration, loading, elution, etc. see Qiagen instructions. The purified protein is ultrafiltered by a retention tube (10kDa) to remove contained imidazole, and the purification result of the target protein is detected by SDS-PAGE electrophoresis, and the result is shown in figure 1, wherein a lane 1 is an expression product, and an arrow indicates a target band, which shows that the molecular weight of the protein expressed by the recombinant strain is about 60kDa and is consistent with the theoretical molecular weight.
Example 2 detection of Activity of CotA protein on degradation of aflatoxin B1 and zearalenone
Aflatoxin B1 was dissolved in dimethyl sulfoxide to make a 20. mu.g/mL stock solution, and the experiment was performed in a 500. mu.L reaction system as follows: mu.L of sodium phosphate buffer (0.1M, pH8.0), 20. mu.L of the CotA protein (10. mu.g), 50. mu.L of aflatoxin B1 solution. A system without the addition of the CotA protein was used as a control. The reaction was terminated by adding 500. mu.L of methanol after 12 hours at 37 ℃ and analyzed by HPLC for whether the CotA protein has a degrading activity to AFB1 based on the change in the concentration of AFB 1.
The chromatographic conditions for detecting AFB1 by high performance liquid chromatography are as follows: a chromatographic column: agilent C18 chromatography column, 4.6mm × 150mm × 5 μm; mobile phase: methanol-water (45: 55); flow rate: 1 mL/min; pumping pressure: 75 bar; sample introduction amount: 20 mu L of the solution; fluorescence detector detection wavelength: λ ex-360 nm, λ em-440 nm; collecting time: for 20 minutes.
Under the chromatographic conditions, as shown in fig. 2, the sample of the control group has a strong absorption peak at the retention time RT of 12.4min, while the target peak of AFB1 is not detected basically when the CotA protein group is added, and 95% of AFB1 molecules are degraded by calculating the absorption peak area, indicating that the recombinant CotA protein has aflatoxin B1 degradation activity.
Zearalenone was dissolved in acetonitrile to prepare a mother liquor of 100. mu.g/mL, and the experiment was carried out in a 500. mu.L reaction system as follows: mu.L of sodium phosphate buffer (0.1M, pH8.0), 20. mu.L of CotA protein (10. mu.g), 50. mu.L of zearalenone solution. A system without the addition of the CotA protein was used as a control. The reaction was terminated by adding 500. mu.L of methanol after 12 hours at 37 ℃ and examined by high performance liquid chromatography based on the change in the ZEN concentration to analyze whether the CotA protein has a degrading activity to ZEN.
The chromatographic conditions for detecting ZEN by high performance liquid chromatography are as follows: a chromatographic column: agilent C18 column, 4.6mm X150 mm X5 μm; mobile phase: acetonitrile-water-methanol (46: 46: 8); flow rate: 1 mL/min; pumping pressure: 45 bar; sample introduction amount: 20 mu L of the solution; fluorescence detector detection wavelength: λ ex-274 nm, λ em-440 nm; collecting time: for 18 minutes.
Under the chromatographic conditions, as shown in fig. 3, the sample of the control group has a strong absorption peak at the retention time RT of 12.2min, while the group added with the CotA protein has no ZEN target peak basically detected, and 95% of ZEN molecules are degraded by calculating the absorption peak area, indicating that the recombinant CotA protein has zearalenone degradation activity.
Example 3 Effect of pH on the Activity of the CotA protein to degrade Aflatoxin B1 and zearalenone
To test the activity of CotA protein degrading AFB1 at different pH conditions, the reaction system used in case example 2 was used: mu.L of buffer (0.1M sodium citrate buffer, pH 5-6; 0.1M sodium phosphate buffer, pH 7-8; 0.1M glycine-NaOH buffer, pH9), 20. mu.L of CotA protein (10. mu.g), 50. mu.L of aflatoxin B1 solution. The reaction was stopped by adding 500. mu.L of methanol after various times (1, 3, 6, 9, 12h) at 37 ℃ and the residual AFB1 content in the system was determined by the method described in example 2. As a result, as shown in FIG. 4, under neutral and slightly alkaline conditions, the activity of CotA protein degrading AFB1 was relatively high, and the optimum pH was 8.0.
To test the activity of CotA protein degrading ZEN at different pH conditions, the reaction system used in example 2 was used: mu.L of buffer (0.1M sodium citrate buffer, pH 6; 0.1M sodium phosphate buffer, pH 7-8; 0.1M glycine-NaOH buffer, pH9-10), 20. mu.L of CotA protein (10. mu.g), 50. mu.L of zearalenone solution. The reaction was stopped by adding 500. mu.L of methanol after various times (1, 3, 6, 9, 12h) at 37 ℃ and the residual ZEN content in the system was determined by the method described in example 2. As a result, as shown in FIG. 4, under neutral and slightly alkaline conditions, the activity of CotA protein degrading ZEN was relatively high, and the optimum pH was 8.0.
Example 4 Effect of temperature on the Activity of the CotA protein to degrade Aflatoxin B1 and zearalenone
To test the activity of CotA protein degrading AFB1 and ZEN under different temperature conditions, the reaction system used in case implementation 2 was used: mu.L of buffer (0.1M sodium phosphate buffer, pH8), 20. mu.L of CotA protein (10. mu.g), 50. mu.L of aflatoxin B1 solution or zearalenone solution. The reaction was carried out at different temperatures (30, 40, 50, 60, 65, 70, 75, 80 ℃) for 30min, and then 500. mu.L of methanol was added to terminate the reaction, and the residual toxin content in the system was determined by the method described in example 2. The result is shown in FIG. 5, the optimal temperature for the CotA protein to degrade AFB1 is 70 ℃, and the optimal temperature for degrading ZEN is 75 ℃.
Example 5 determination of kinetic parameters of enzymatic reaction for degrading aflatoxin B1 and zearalenone by CotA protein
The enzyme activity of the CotA protein for degrading aflatoxin B1 and zearalenone is defined as the amount of enzyme required for degrading 1 μ g of toxin per minute.
The 500. mu.L reaction system used in example 2 was used: 430. mu.L of buffer (0.1M sodium phosphate buffer, pH8), 20. mu.L of CotA protein (10. mu.g), 50. mu.L of aflatoxin B1 solution with AFB1 at final concentrations of 1, 2, 5, 10, 25, 40, 50, 75 and 100. mu.g/mL, respectively, reacted at 37 ℃ for 30 min; measuring the initial reaction rate of CotA catalytic degradation AFB1 in AFB1 systems with different concentrations, performing Michaelis-Menten regression analysis by using Graphpad5.0 according to the Mie's equation, and solving the K of CotA catalytic degradation AFB1mAnd a maximum reaction rate VmFurther solving K according to the amount of enzyme added in the systemcatThe value is obtained. Similarly, the initial reaction rate for the CotA catalyzed degradation of ZEN was determined in a system with ZEN concentrations of 5, 10, 25, 50, 100, 150, 200, 300, 400 μ g/mL and the corresponding enzymatic reaction kinetics parameters were solved. The results are shown in Table 1.
Table 1 shows the reaction kinetic parameters of the catalytic degradation of aflatoxin B1 and zearalenone by CotA
Example 6 efficiency of CotA catalyzed degradation of AFM1, AFG1, zearalenol, and zearalanol
AFM1, AFG1, zearalenol and zearalanol are respectively dissolved in dimethyl sulfoxide to prepare 20 mu g/mL of mother liquor, and experiments are carried out according to the following 500 mu L of reaction system: mu.L of sodium phosphate buffer (0.1M, pH6.0-8.0), 20. mu.L of LCOTA protein (10. mu.g), 50. mu.L of each stock solution. A system without the addition of the CotA protein was used as a control. After the reaction was carried out at 37 ℃ for 12 hours, 500. mu.L of methanol was added to terminate the reaction, and whether the CotA protein had a degrading activity against several toxins was analyzed by high performance liquid chromatography detection based on the change in the concentration of each toxin. Specific embodiments as in example 2, the efficiency of CotA catalyzed degradation of AFM1, AFG1, zearalenol, and zearalanol is shown in table 2.
TABLE 2 efficiency of CotA catalyzed degradation of AFM1, AFG1, zearalenol, and zearalanol
Example 7 an additive and a method for its preparation
Weighing a carrier (maltodextrin and talcum powder are mixed according to the mass ratio of 2: 1) which accounts for 90% of the total mass of the additive, and then mixing bacterial laccase CotA protein according to the proportion of 10% of the total mass of the additive to obtain the additive.
Example 8 an additive and a method for its preparation
Weighing a carrier accounting for 9% of the total mass of the additive (maltodextrin and talcum powder are mixed according to the mass ratio of 1:1), then mixing bacterial laccase CotA protein according to the mass ratio of 1% of the total mass of the additive, and finally mixing bacillus licheniformis and bacillus amyloliquefaciens mixed preparation powder according to 90% of the total mass of the additive (the mass ratio of the bacillus licheniformis to the bacillus amyloliquefaciens is 1:1), thereby obtaining the additive.
Example 9 an additive and a method for its preparation
Firstly, 70 percent of starch and 10 percent of bacillus subtilis are mixed according to the total mass of the additive, then bacterial laccase CotA protein is mixed according to the proportion of 10 percent of the total mass of the additive, and finally zearalenone lactonase is mixed according to 10 percent of the total mass of the additive to obtain the additive.
EXAMPLE 10 an additive and method of making the same
The additive is prepared by mixing maltodextrin accounting for 70% of the total mass of the additive and lactobacillus acidophilus accounting for 20% of the total mass of the additive, then mixing the solid bacterial laccase CotA protein according to the proportion of 5% of the total mass of the additive, and finally mixing the aflatoxin detoxification enzyme according to the proportion of 5% of the total mass of the additive.
Example 11
AFB1 in naturally moldy corn was treated with the additive described in example 8.
Mixing the additive with naturally mildewed corn (AFB 1-50 ppb) at a ratio of 0.1%, and digesting in vitro in animal gastrointestinal fluid for 24 hr to degrade AFB1 in naturally mildewed grain, grain or feed.
Simulated gastric fluid: accurately weighing 2g of corn containing natural mildew AFB1, adding 2mg of additive, placing into 100mL conical flask, adding 25mL of PBS (0.1M pH6.0), adjusting pH to 6.8, and mixing. Adding 1mL of prepared amylase solution, digesting for 2h at 39 ℃ and 150 r/min. 10mL of 0.2M HCl was added, the pH was adjusted to 2.0 with 1M HCl or 1M NaOH solution, 1mL of freshly prepared acidic protease (50000U/g) was added, mixed well, capped with parafilm, and shake-cultured at 39 ℃ for 6h (150 r/min).
Simulating small intestine liquid: after incubation with simulated gastric fluid for 6h, 5mL of 0.6M NaOH solution was added, the pH was adjusted to 6.8 with 1M HCl or 1M NaOH, and a freshly prepared suspension of the exogenous enzyme in the intestine (protease: amylase: lipase ═ 3:1:1) was added, sealed with parafilm, and incubated at 39 ℃ for 18h (150r/min) in a constant temperature shaker.
After the reaction, the degradation rate of AFB1 was determined to be 91.24%.
Example 11
ZEN in the industrial ethanol processing by-product DDGS was treated with the additive described in example 8.
The additive is mixed with industrial ethanol processing byproduct DDGS (ZEN 3ppm) according to a proportion of 0.1%, and the mixture is digested in vitro in simulated animal gastrointestinal fluid for 24h for degrading ZEN in DDGS.
Simulated gastric fluid: accurately weighing 2g of DDGS containing mildew, adding 2mg of additive, placing into a 100mL conical flask, adding 25mL of PBS (0.1M pH6.0), adjusting pH to 6.8, and mixing. Adding 1mL of prepared amylase solution, digesting for 2h at 39 ℃ and 150 r/min. 10mL of 0.2M HCl was added, the pH was adjusted to 2.0 with 1M HCl or 1M NaOH solution, 1mL of freshly prepared acidic protease (50000U/g) was added, mixed well, sealed with parafilm, and cultured on a shaker at 39 ℃ for 6h (150 r/min).
Simulating small intestine liquid: after incubation with simulated gastric fluid for 6h, 5mL of 0.6M NaOH solution was added, the pH was adjusted to 6.8 with 1M HCl or 1M NaOH, and a freshly prepared suspension of the exogenous enzyme in the intestine (protease: amylase: lipase ═ 3:1:1) was added, sealed with parafilm, and incubated at 39 ℃ for 18h (150r/min) in a constant temperature shaker.
The degradation rate of ZEN after the end of the reaction was determined to be 93.23%.
Sequence listing
<110> university of agriculture in China
Application of <120> bacterial laccase CotA protein in degradation of mycotoxin
<130> seqlist
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 513
<212> PRT
<213> Bacillus licheniformis
<400> 1
Met Lys Leu Glu Lys Phe Val Asp Arg Leu Pro Ile Pro Gln Val Leu
1 5 10 15
Gln Pro Gln Ser Lys Ser Lys Glu Met Thr Tyr Tyr Glu Val Thr Met
20 25 30
Lys Glu Phe Gln Gln Gln Leu His Arg Asp Leu Pro Pro Thr Arg Leu
35 40 45
Phe Gly Tyr Asn Gly Val Tyr Pro Gly Pro Thr Phe Glu Val Gln Lys
50 55 60
His Glu Lys Val Ala Val Lys Trp Leu Asn Lys Leu Pro Asp Arg His
65 70 75 80
Phe Leu Pro Val Asp His Thr Leu His Asp Asp Gly His His Glu His
85 90 95
Glu Val Lys Thr Val Val His Leu His Gly Gly Cys Thr Pro Ala Asp
100 105 110
Ser Asp Gly Tyr Pro Glu Ala Trp Tyr Thr Lys Asp Phe His Ala Lys
115 120 125
Gly Pro Phe Phe Glu Arg Glu Val Tyr Glu Tyr Pro Asn Glu Gln Asp
130 135 140
Ala Thr Ala Leu Trp Tyr His Asp His Ala Met Ala Ile Thr Arg Leu
145 150 155 160
Asn Val Tyr Ala Gly Leu Val Gly Leu Tyr Phe Ile Arg Asp Arg Glu
165 170 175
Glu Arg Ser Leu Asn Leu Pro Lys Gly Glu Tyr Glu Ile Pro Leu Leu
180 185 190
Ile Gln Asp Lys Ser Phe His Glu Asp Gly Ser Leu Phe Tyr Pro Arg
195 200 205
Gln Pro Asp Asn Pro Ser Pro Asp Leu Pro Asp Pro Ser Ile Val Pro
210 215 220
Ala Phe Cys Gly Asp Thr Ile Leu Val Asn Gly Lys Val Trp Pro Phe
225 230 235 240
Ala Glu Leu Glu Pro Arg Lys Tyr Arg Phe Arg Ile Leu Asn Ala Ser
245 250 255
Asn Thr Arg Ile Phe Glu Leu Tyr Phe Asp His Asp Ile Thr Cys His
260 265 270
Gln Ile Gly Thr Asp Gly Gly Leu Leu Gln His Pro Val Lys Val Asn
275 280 285
Glu Leu Val Ile Ala Pro Ala Glu Arg Cys Asp Ile Ile Val Asp Phe
290 295 300
Ser Arg Ala Glu Gly Lys Thr Val Thr Leu Lys Asn Arg Ile Gly Cys
305 310 315 320
Gly Gly Gln Asp Ala Asp Pro Asp Thr Asp Ala Asp Ile Met Gln Phe
325 330 335
Arg Ile Ser Lys Pro Leu Lys Gln Lys Asp Thr Ser Ser Leu Pro Arg
340 345 350
Ile Leu Arg Lys Arg Pro Phe Tyr Arg Arg His Lys Ile Asn Ala Leu
355 360 365
Arg Asn Leu Ser Leu Gly Ala Ala Val Asp Gln Tyr Gly Arg Pro Val
370 375 380
Leu Leu Leu Asn Asn Thr Lys Trp His Glu Pro Val Thr Glu Thr Pro
385 390 395 400
Ala Leu Gly Ser Thr Glu Ile Trp Ser Ile Ile Asn Ala Gly Arg Ala
405 410 415
Ile His Pro Ile His Leu His Leu Val Gln Phe Met Ile Leu Asp His
420 425 430
Arg Pro Phe Asp Ile Glu Arg Tyr Gln Glu Asn Gly Glu Leu Val Phe
435 440 445
Thr Gly Pro Ala Val Pro Pro Ala Pro Asn Glu Lys Gly Leu Lys Asp
450 455 460
Thr Val Lys Val Pro Pro Gly Ser Val Thr Arg Ile Ile Ala Thr Phe
465 470 475 480
Ala Pro Tyr Ser Gly Arg Tyr Val Trp His Cys His Ile Leu Glu His
485 490 495
Glu Asp Tyr Asp Met Met Arg Pro Leu Glu Val Thr Asp Val Arg His
500 505 510
Gln
<210> 2
<211> 1542
<212> DNA
<213> Bacillus licheniformis
<400> 2
atgaaacttg aaaaattcgt tgaccggctc cccattccgc aagtgcttca accccaaagc 60
aaaagcaagg aaatgaccta ttatgaagtc accatgaaag aatttcagca gcagcttcac 120
cgcgatctgc cgccgactcg gctgtttgga tataacggag tttatcccgg ccctaccttc 180
gaagtgcaga aacacgaaaa agtcgcagtc aagtggttaa ataagcttcc ggatcgccat 240
tttctccccg tcgaccatac gcttcacgat gacggccatc acgaacatga agtgaagacg 300
gtcgttcatt tgcacggagg ctgtacgcct gctgacagcg acggatatcc tgaggcttgg 360
tacacaaaag acttccatgc aaaaggccct ttctttgaaa gggaggtgta tgaatatccg 420
aatgagcagg atgctacagc tctttggtat catgaccatg caatggccat cacaaggctg 480
aatgtatatg cggggcttgt cggtttatat tttattcgcg acagggaaga gcgttcattg 540
aacttgccga agggagaata tgaaatcccg cttttgattc aggataaatc atttcatgaa 600
gatggttcat tgttttatcc gcggcagcct gacaaccctt cgccggatct tccggacccg 660
tcgattgttc cggctttttg cggtgatacc attttagtca acggcaaggt atggcctttc 720
gctgaactgg aaccccgaaa ataccgtttt cggatactga acgcctccaa tacgagaatc 780
tttgagctgt atttcgatca tgacatcaca tgtcatcaaa tcggcacgga cggcggtctt 840
ctgcagcatc cggtcaaagt caatgaactg gtgatcgcgc cggctgaaag gtgcgatatc 900
atcgttgatt tttcacgagc agaaggaaaa accgtgacac tgaaaaaccg gatcggctgc 960
ggcggacaag acgcagatcc cgatactgat gccgacatca tgcaattccg catctcaaaa 1020
cctttgaagc aaaaagatac aagttcattg ccgagaatat tgagaaagcg cccattttac 1080
cggagacaca agatcaatgc cctcagaaat ctgtcattgg gcgcggccgt tgaccaatat 1140
ggaagacctg ttctgctttt aaacaacaca aagtggcatg aaccggtaac cgaaacaccc 1200
gcactcggca gcactgagat ctggtcgatc atcaatgccg gaagggcgat ccatccgatc 1260
catttacatc ttgttcaatt tatgattctc gaccaccggc cgtttgatat cgagcggtat 1320
caggaaaacg gagaacttgt ttttaccggt ccggcagttc ctccggcacc gaatgaaaag 1380
gggctgaaag acaccgtcaa agtacccccg ggctcagtga cgcgcattat cgccaccttt 1440
gcgccgtaca gcggcagata tgtttggcac tgccacatcc ttgagcacga agattacgat 1500
atgatgcgcc ctcttgaagt gacagatgtt cgtcatcaat aa 1542
Claims (12)
1. An application of bacterial laccase CotA protein in the degradation of mycotoxin in feed is characterized in that,
the amino acid sequence of the bacterial laccase CotA protein is as follows: the sequence shown as SEQ ID NO. 1;
the mycotoxin is aflatoxin B1, B2, G1, G2, M1, M2, zearalenone, zearalenol or zearalanol;
the bacterial laccase CotA protein can degrade aflatoxin B1, B2, G1, G2, M1, M2, zearalenone, zearalenol and zearalanol without depending on any mediator.
2. The use according to claim 1, wherein the bacterial laccase CotA protein is derived from bacillus, which is bacillus licheniformis (c.)Bacillus licheniformis) Bacillus subtilis preparation (B)Bacillus subtilis) Bacillus amyloliquefaciens (A) and (B)Bacillus amyloliquefaciens) Bacillus pumilus (B), (B)Bacilluspumilus) Bacillus lentus (B), (B)Bacillus lentus) Or Bacillus clausii (Bacillus clausii)。
3. The use according to claim 1, wherein the source of bacterial laccase CotA protein is bacillus licheniformis (c.) (r) ((r))Bacillus licheniformis）。
4. The use as claimed in claim 1, characterized in that the nucleotide sequence encoding the bacterial laccase CotA protein is: SED ID NO. 2.
5. A feed additive is characterized by comprising bacterial laccase CotA protein and a physiologically acceptable carrier thereof, wherein the content of the bacterial laccase CotA protein is 1-10%;
the amino acid sequence of the bacterial laccase CotA protein is as follows: the sequence shown as SEQ ID NO. 1;
the bacterial laccase CotA protein can degrade aflatoxin B1, B2, G1, G2, M1, M2, zearalenone, zearalenol and zearalanol without depending on any mediator.
6. Additive according to claim 5, characterized in that said physiologically acceptable carrier is chosen from maltodextrin, limestone, cyclodextrin, wheat bran, rice bran, sucrose, starch, Na2SO4One or more of talc and PVA.
7. The supplement of claim 5, further comprising a probiotic formulation selected from the group consisting of Bacillus licheniformis, Bacillus subtilis, Bifidobacterium bifidum, enterococcus faecalis, enterococcus faecium, enterococcus lactis, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus delbrueckii subsp.
8. The additive according to claim 5, wherein the additive further comprises at least one of propionibacterium, lactobacillus buchneri and lactobacillus paracasei when used in silage or cattle feed; or the additive also contains bacillus coagulans and/or brevibacillus laterosporus when the additive is used for the feed of poultry, pigs and aquaculture animals.
9. A method for degrading mycotoxin in feed by using bacterial laccase CotA protein is characterized in that,
the amino acid sequence of the bacterial laccase CotA protein is as follows: the sequence shown as SEQ ID NO. 1;
the mycotoxin is aflatoxin B1, B2, G1, G2, M1, M2, zearalenone, zearalenol or zearalanol;
the bacterial laccase CotA protein can degrade aflatoxin B1, B2, G1, G2, M1, M2, zearalenone, zearalenol and zearalanol at the same time without depending on any mediator.
10. The method of claim 9, wherein the nucleotide sequence encoding the bacterial laccase CotA protein is: the sequence is shown as SED ID NO. 2.
11. The method of claim 9, wherein the bacterial laccase CotA protein is derived from bacillus, wherein the bacillus is bacillus licheniformis (c.)Bacillus licheniformis) Bacillus subtilis preparation (B)Bacillus subtilis) Bacillus amyloliquefaciens (A) and (B)Bacillus amyloliquefaciens) Bacillus pumilus (B), (B)Bacilluspumilus) Bacillus lentus (B.lentus) ((B.lentus))Bacillus lentus) Or Bacillus clausii (Bacillus clausii)。
12. The method of claim 9, where the source of bacterial laccase CotA protein is bacillus licheniformis (c.) (l.) (ii) (c.)Bacillus licheniformis）。
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811492897.9A CN109820132B (en) | 2018-12-07 | 2018-12-07 | Application of bacterial laccase CotA protein in degradation of mycotoxin |
| PCT/CN2019/095955 WO2020113962A1 (en) | 2018-12-07 | 2019-07-15 | Application of bacterial laccase cota protein in degradation of mycotoxins |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811492897.9A CN109820132B (en) | 2018-12-07 | 2018-12-07 | Application of bacterial laccase CotA protein in degradation of mycotoxin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109820132A CN109820132A (en) | 2019-05-31 |
| CN109820132B true CN109820132B (en) | 2022-07-12 |
Family
ID=66859550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811492897.9A Active CN109820132B (en) | 2018-12-07 | 2018-12-07 | Application of bacterial laccase CotA protein in degradation of mycotoxin |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109820132B (en) |
| WO (1) | WO2020113962A1 (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109820132B (en) * | 2018-12-07 | 2022-07-12 | 中国农业大学 | Application of bacterial laccase CotA protein in degradation of mycotoxin |
| CN110218708B (en) * | 2019-06-20 | 2021-08-27 | 天津科技大学 | Bacterial laccase and gene, preparation method and application thereof |
| CN110317758A (en) * | 2019-07-19 | 2019-10-11 | 河南广安生物科技股份有限公司 | Double toxin antidotes of a kind of broiler chicken and preparation method thereof |
| CN110408662B (en) * | 2019-07-31 | 2021-10-29 | 中国农业大学 | Method for preparing AFQ1 and epi-AFQ1 by oxidizing and catalyzing AFB1 with microbial enzyme |
| CN110637970B (en) * | 2019-09-30 | 2021-07-20 | 中国农业科学院北京畜牧兽医研究所 | Application of syringaldehyde as mediator participating in degradation of mycotoxin by laccase |
| CN111088238B (en) * | 2020-02-26 | 2022-09-13 | 福州大学 | Degraded AFB 1 Laccase and gene and application thereof |
| CN113699127B (en) * | 2021-08-05 | 2023-03-21 | 中国农业科学院北京畜牧兽医研究所 | Method for improving mycotoxin degradation rate of dye decolorizing peroxidase |
| CN114605557B (en) * | 2022-03-10 | 2023-07-11 | 华南农业大学 | Degradation aflatoxin B 1 And/or zearalenone fusion protein and preparation method and application thereof |
| CN114586920A (en) * | 2022-03-11 | 2022-06-07 | 安徽黑娃食品科技有限公司 | Sunflower degrading method by using laccaseAflatoxins B in flower seeds1Processing method of |
| CN115417507B (en) * | 2022-06-21 | 2023-10-03 | 江南大学 | Laccase capable of efficiently degrading veterinary drug antibiotic residues and application thereof |
| CN115125220B (en) * | 2022-07-07 | 2024-03-01 | 武汉轻工大学 | Laccase EcLac and application thereof, laccase gene EcLac and application thereof |
| CN115428887A (en) * | 2022-10-26 | 2022-12-06 | 中科检测技术服务(嘉兴)有限公司 | Biological degradation method for mycotoxin in grains or byproducts thereof |
| CN115779329B (en) * | 2022-11-18 | 2024-01-30 | 安徽大学 | Method for degrading aflatoxin B1 by continuous flow hydrogen peroxide and manganese peroxidase |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2099818A2 (en) * | 2006-11-29 | 2009-09-16 | Novozymes Inc. | Bacillus licheniformis chromosome |
| EP2231863B1 (en) * | 2007-12-14 | 2011-05-04 | Novozymes A/S | Process for degrading zearalenone in a feed product employing laccase |
| WO2009109607A2 (en) * | 2008-03-05 | 2009-09-11 | Novozymes A/S | Detoxification of feed products |
| CN102154148A (en) * | 2010-12-22 | 2011-08-17 | 东北林业大学 | Laccase from Bacillus licheniformis LS04 and use thereof |
| CN104388370A (en) * | 2014-11-27 | 2015-03-04 | 江南大学 | Method for efficient secretory expression of Bacillus pumilus laccase |
| CN109820132B (en) * | 2018-12-07 | 2022-07-12 | 中国农业大学 | Application of bacterial laccase CotA protein in degradation of mycotoxin |
-
2018
- 2018-12-07 CN CN201811492897.9A patent/CN109820132B/en active Active
-
2019
- 2019-07-15 WO PCT/CN2019/095955 patent/WO2020113962A1/en active Application Filing
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020113962A1 (en) | 2020-06-11 |
| CN109820132A (en) | 2019-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109820132B (en) | Application of bacterial laccase CotA protein in degradation of mycotoxin | |
| CN111073867B (en) | Dye decolorization peroxidase BsDyP and application thereof in mycotoxin detoxification | |
| CN110804570B (en) | Bacillus beijerinckii for simultaneously degrading zearalenone and aflatoxin and application thereof | |
| CN108251405B (en) | Complex enzyme and additive, application thereof and method for removing mycotoxin | |
| CN108251399B (en) | Fumonisin degrading enzyme, encoding gene, recombinant vector, cell, additive and application thereof | |
| CN108251385B (en) | Ochratoxin degrading enzyme, encoding gene, recombinant vector, cell, additive and application thereof | |
| Wei et al. | Detoxification of ochratoxin A by Lysobacter sp. CW239 and characteristics of a novel degrading gene carboxypeptidase cp4 | |
| Martín et al. | Sequencing, characterization and transcriptional analysis of the histidine decarboxylase operon of Lactobacillus buchneri | |
| JP2013540430A (en) | Amidase-containing food additive for ochratoxin detoxification | |
| Xu et al. | Molecular and biochemical characterization of a novel xylanase from Massilia sp. RBM26 isolated from the feces of Rhinopithecus bieti | |
| Xu et al. | Genome mining reveals the genes of carboxypeptidase for OTA-detoxification in Bacillus subtilis CW14 | |
| CN109402087B (en) | Novel feruloyl esterase and preparation method and application thereof | |
| Imanaka et al. | Cultivation characteristics and gene expression profiles of Aspergillus oryzae by membrane-surface liquid culture, shaking-flask culture, and agar-plate culture | |
| TWI609081B (en) | USE OF LACTONE HYDROLASE AND METHOD OF DEGRADING α-ZEARALENOL USING LACTONE HYDORLASE | |
| Ishikawa et al. | Identification, cloning, and characterization of a Sporobolomyces singularis β-galactosidase-like enzyme involved in galacto-oligosaccharide production | |
| CN107208077A (en) | Crack the purposes of the polypeptide variants, the additive comprising the polypeptide variants and the additive of fusarium toxin, and the method for cracking fusarium toxin | |
| Zhou et al. | A new α-galactosidase from symbiotic Flavobacterium sp. TN17 reveals four residues essential for α-galactosidase activity of gastrointestinal bacteria | |
| CN108251386B (en) | Vomitoxin degrading enzyme, gene thereof, preparation method and application thereof, and method for degrading vomitoxin | |
| Zhao et al. | Degradation of ochratoxin A by supernatant and ochratoxinase of Aspergillus niger W-35 isolated from cereals | |
| Kim et al. | Comparative analysis of two types of methanol dehydrogenase from Methylophaga aminisulfidivorans MPT grown on methanol | |
| CN108251387A (en) | A kind of zearalenone degrading enzyme and its gene and preparation method and application and the method for degrading zearalenone | |
| Zhao et al. | Purification and immobilization of the soluble and insoluble portions of recombinant lipase by gram-positive enhancer matrix (GEM) particles | |
| CN111394326B (en) | Vomitoxin degrading enzyme DDH and application thereof in detoxification of trichothecene toxins | |
| Shao et al. | An improved system for the surface immobilisation of proteins on Bacillus thuringiensis vegetative cells and spores through a new spore cortex-lytic enzyme anchor | |
| Liu et al. | Direct cloning of a xylanase gene from the mixed genomic DNA of rumen fungi and its expression in intestinal Lactobacillus reuteri |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |