WO2018045078A2 - Compositions and methods for the diagnosis and treatment of lymphatic system disorders - Google Patents
Compositions and methods for the diagnosis and treatment of lymphatic system disorders Download PDFInfo
- Publication number
- WO2018045078A2 WO2018045078A2 PCT/US2017/049453 US2017049453W WO2018045078A2 WO 2018045078 A2 WO2018045078 A2 WO 2018045078A2 US 2017049453 W US2017049453 W US 2017049453W WO 2018045078 A2 WO2018045078 A2 WO 2018045078A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- snv
- mtor
- inhibitors
- lymphatic
- patient
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4164—1,3-Diazoles
- A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/50—Pyridazines; Hydrogenated pyridazines
- A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5375—1,4-Oxazines, e.g. morpholine
- A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- This invention relates to the fields of genetics, personalized medicine and malformations of the lymphatic system. More specifically the invention provides new genetic targets and therapeutic treatment regimens for amelioration of symptoms associated with
- Lymphangiomatosis and other generalized lymphatic anomalies are generalized lymphatic anomalies (GLAs).
- the lymphatic system plays a pivotal role in maintaining the body fluid circulation, defending the body against disease and in absorbing dietary fats in the small intestine (1).
- lymphatic anomalies are characterized by abnormal formation of lymphatic vessels and tissue overgrowth. Patients often present with overlapping symptoms which may lead to serious pulmonary disease (2, 3). Examples of lymphatic anomalies include generalized lymphatic anomaly (GLA), lymphangiectasia, and chylous effusions (pericardial, pleural or peritoneal). Research on complex lymphatic anomalies has been hampered by the inconsistence in classification and nomenclature because of significant challenge in diagnosis (3-6). Although the molecular genetic etiology of complex lymphatic anomalies is poorly understood, congenital malformations of lymphatic system appear to have related underlying genetic etiology (7-9). Indeed, both germline and somatic mutations have been identified in genes which converge on the PI3K/mTOR and Ras/MAPK pathways (1, 8).
- PI3K/mTOR and Ras/MAPK signaling pathways have been shown to impair normal expansion and remodeling during construction of a mature lymphatic network, wherein such disruptions are associated with lymphatic disease.
- Gain of function mutations in AKT1 and PIK3CA resulting in elevated mammalian target of rapamycin complex 1 (mTORCl) activity, were identified in patients with lymphatic malformations that comprise part of a syndrome, such as Proteus syndrome (OMIM 176920), CLOVES syndrome (OMIM 612918) and Klippel-Trenaunay-Weber syndrome (OMIM 149000) (9-11).
- lymphatic disorders and lymphatic anomalies such as lymphangiomatosis/ lymphangiectasia (LAM), generalized lymphatic anomaly (GLA), and chylous effusions are lacking, as are therapeutics that target the genetic markers associated with these disorders.
- LAM lymphangiomatosis/ lymphangiectasia
- GLA generalized lymphatic anomaly
- chylous effusions are lacking, as are therapeutics that target the genetic markers associated with these disorders.
- EPHB4 knockdown studies in zebrafish confirmed that EPHB4 has a role in lymphatic vessel development and branching, a process involving mTOR signaling.
- a cohort of 13 families with either GLA or lymphangiectasia diagnosis, all of whom had at least one family member with chylous effusion were sequenced.
- a homozygous variant in PIK3R6, which encodes the regulatory subunit of PI3K complex, a heterozygous mutation in MTOR, a heterozygous mutation in PIK3R4, and a recurrent de novo gain-of-function mutation in ARAF, which is involved in Ras/MAPK pathway, an interactor of the mTOR pathway were identified.
- a method for diagnosing a lymphatic anomaly in a human patient comprises obtaining a biological sample comprising nucleic acid from the patient, assaying the nucleic acid to determine whether i) a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present or ii) an SNV in linkage disequilibrium with an SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present; and diagnosing the patient with a lymphatic anomaly if an SNV of i) or ii) is present.
- SNV single nucleotide variant
- a method for diagnosing a lymphatic anomaly in a human patient entails obtaining genotype sequence information from a human patient, assaying the nucleic acid to determine whether i) a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present or ii) an SNV in linkage disequilibrium with an SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present; and diagnosing the patient with a lymphatic anomaly if an SNV of i) or ii) is present.
- SNV single nucleotide variant
- the invention also provides a method for treating a lymphatic anomaly in a human patient.
- An exemplary method comprises obtaining a biological sample comprising nucleic acid from the patient; assaying the nucleic acid to determine whether i) a single nucleotide variant (SANV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present or ii) an SNV in linkage disequilibrium with an SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present; and administering one or more agents suitable for treatment of said lymphatic anomaly to the patient identified as having one or more SNVs of i) or ii), thereby treating the lymphatic anomaly.
- SANV single nucleotide variant
- genotype information is obtained from a patient and assayed to determine whether i) a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present or ii) an SNV in linkage disequilibrium with an SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present; and administering one or more agents suitable for treatment of said lymphatic anomaly to the patient identified as having one or more SNVs of i) or ii), thereby treating the lymphatic anomaly.
- genotype information is obtained from a patient.
- the lymphatic anomaly is characterized by abnormal formation of lymphatic vessels and/or tissue overgrowth.
- the lymphatic anomaly is lymphangiomatosis (LAM).
- the lymphatic anomaly is generalized lymphatic anomaly (GLA).
- the lymphatic anomaly can be characterized by chylous effusions, including pericardial, pleural, or peritoneal effusions.
- the diagnostic methods can further comprise generating a report identifying the SNV after detection in the biological sample.
- the methods of treatment described above can further comprise generating a report identifying suggested treatment(s) for the lymphatic anomaly based upon the SNV identified in the method.
- the diagnostic methods described herein can further comprise administering an effective amount of one or more agents suitable for treating said lymphatic anomaly to the diagnosed patient.
- the agent to be administered to patients harboring one or more lymphatic anomaly associated SNVs is selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK/ERK inhibitors, and a combination of one or more of any of said inhibitors.
- the agents or said inhibitors are listed in Tables 1 and 2.
- the one or more mTOR inhibitors, one or more PIK3K inhibitors, and/or one or more MEK/ERK inhibitors has an IC50 of less than ⁇ , less than ⁇ , less than ⁇ , less than lOOnM, less than ⁇ , or less than InM.
- the agent that inhibits mTOR signaling also has additional biological activity. These include, without limitation, inhibition of PI3K, inhibition of FK506 binding protein, inhibition of DNA-PK, inhibition of pi 10, or inhibition of p70S6K.
- the patient has one, two, three, four, or five SNVs in each of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAR.
- the patient does not have an SNV in EPHB4.
- the patient does not have an SNV in PIK3R4.
- the patient does not have an SNV in PIK3R6.
- the patient does not have an SNV in mTOR.
- the patient does not have an SNV in ARAF.
- the agents listed in Tables 1 and 2 are used in combination. These combinations include, without limitation, a) Ridaforolimus and Trametinib; b) Ridaforolimus and Selumetinib or Cobimetinib; c) BEZ235 and Selumetinib; d) Omipalisib and Selumetinib or Trametinib; e) Everolimus and Trametinib or Selumetinib; f) Sirolimus, Ridaforolimus and Selumetinib; g) Sirolimus, Ridaforolimus and Trametinib; h) Torkinib and Trametinib; i) BEZ235, Torkinib and Trametinib; and j) Sirolimus and Gedatolisib and Trametinib.
- the treatment further comprises administering systemic chemotherapy, interferon alfa, radiotherapy, and/or surgery.
- the SNV is selected from c.2334+lG>C in EPHB4; c.3481A>G:p.Sl 161G in PIK3R4; c. l393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; and c.640T>C:p.S214P in ARAF.
- the diagnostic method comprises detection of c.2334+lG>C in EPHB4. In some embodiments, the diagnostic method further comprises treating said patient with one or more agents selected from one or more mTor inhibitors, one or more PI3K inhibitor and one or more MEK/ERK inhibitors. In other embodiments, the agents are selected from Tables 1-2, thereby improving one or more of lymph structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detecting c.2334+lG>C in EPHB4 and administering at least one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- the agent is selected from Tables 1-2, thereby improving one or more of lymphatic structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detection of
- the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- agents are selected from Tables 1-2, thereby improving one or more of lymph structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detecting c.3481A>G:p.S1161G in PIK3R4 and administering one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- at least one agent is selected from Tables 1-2 for administration, thereby improving one or more of lymphatic structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detection of c.1393-7C>T in
- the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- agents from Tables 1-2 are selected, thereby improving one or more of lymph structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detecting c. l393-7C>T in PIK3R6 and administering one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- at least one agent from Tables 1-2 is administered, thereby improving one or more of lymphatic structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detection of
- the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- agents from Tables 1-2 are administered, thereby improving one or more of lymph structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detecting c.6818A>G:p.P2273L in mTOR and administering mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- at least one agent from Tables 1-2 is administered, thereby improving one or more of lymphatic structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detection of c.640T>C:p.S214P in ARAF. In some embodiments, the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination. In some embodiments, agents from Tables 1-2 are administered, thereby improving one or more of lymph structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the diagnostic method comprises detecting c.640T>C:p.S214P in ARAF and administering one or more mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination.
- at least one agent from Tables 1-2 is administered, thereby improving one or more of lymphatic structure, decreasing chylous pleural effusions, improving respiratory function, allowing tapering of concomitant medication usage, or increasing survival.
- the agent is an ERK/MEK inhibitor.
- ERK/MEK inhibitors suitable for treatment include, without limitation, from Selumetinib (AZD6244).
- PD0325901 Trametinib (GSK1120212), PD184352 (CI- 1040), Pimasertib (AS-703026), TAK-733, AZD8330, Binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, Refametinib (RDEA119, Bay 86-9766), and Cobimetinib (GDC-0973, RG7420).
- the step of assaying the nucleic acid to determine whether a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present further comprises the step of analyzing a polynucleotide sample to determine the presence of said SNV by performing a process selected from the group consisting of detection of specific hybridization, measurement of allele size, restriction fragment length polymorphism analysis, allele-specific hybridization analysis, single base primer extension reaction, and sequencing of an amplified polynucleotide.
- the biological sample comprises DNA.
- the biological sample comprises RNA.
- nucleic acids comprising said SNV(s) are obtained from an isolated cell of the human patient.
- an isolated vector encodes a nucleic acid with a SNV, wherein the SNV is selected from c.2334+lG>C in EPHB4; c.3481A>G:p.Sl 161G in PIK3R4; c. l393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; and c.640T>C:p.S214P in ARAF.
- a host cell comprises an isolated vector encoding a nucleic acid with a SNV.
- a transgenic animal comprises a host cell.
- the transgenic animal is a mouse or zebrafish.
- a method of screening for effects of an agent comprises contacting a host cell or a transgenic animal with one or more of an mTor inhibitors, one or more PI3K inhibitors and one or more MEK/ERK inhibitors alone or in combination, or an agent from Tables 1-2 is encompassed.
- the effect of an agent that is screened is caudal rescue or branching rescue in zebrafish.
- the effect of an agent that is screened is phosphorylation of mTOR.
- a method for identifying an agent that alters cellular signaling comprises providing cells expressing at least one nucleic acid comprising at least one SNV as described above, providing cells which express the cognate wild type sequences lacking the SNV; contacting both cell populations with a test agent; and
- FIG. 1 Pedigree of Family- 1 and cosegregating pattern of the EPHB4 mutation.
- the open circles denote unaffected females and the open squares denoted unaffected males; the solid figures indicate affected subjects.
- EPHB4 genotypes are noted beneath the symbol for each subject from whom DNA was available for testing.
- FIG. 1 A schematic diagram of the role played by EPHB4 in vessel development.
- FIG. 3A 293T cells were transiently transfected with wild type EPHB4 alone, mutant EPHB4 alone, or the mixtures of the wild type and mutant in the indicated ratios. Lysates were separated by SDS-PAGE and blotted for phosphotyrosine (pTyr, top) or EPHB4 (bottom).
- Fig. 3B A375 cells were transfected with wild type EPHB4, mutant EPHB4, or left untransfected. Cells were stimulated with either plate-bound Ephrin B2 Fc or human IgGl as a control. Cells were lysed, and transfected proteins were immunoprecipitated. Immunoprecipitations were blotted for phosphotyrosine (top) or EPHB4 (middle). Whole cell lysates were blotted for EPHB4 to demonstrate equal expression (bottom).
- Morpholino mediated knock-down of ephb4a (Fig. 5B) induces expansion and fusion of the caudal vasculature on 2.5 dpf (arrowheads) compared to control (Fig. 5 A).
- Fig. 5B Morpholino mediated knock-down of ephb4a
- Fig. 5B induces expansion and fusion of the caudal vasculature on 2.5 dpf (arrowheads) compared to control (Fig
- FIG. 5C shows that on 4dpf the zebrafish vascular system consists of intersomitic blood vessels that project in dorso-ventral direction (arrow) as well as thinner lymphatic vessels (arrowheads).
- the lymphatic parachordal line runs horizontally along the trunk (downward arrowhead) while the intersegmental lymphatic vessels project downwards (upward arrowhead).
- Fig. 5D shows that ephb4a knock down induces misguided vessels that resemble blood vessels (arrows) and lymphatic vessels (arrowheads). (Figs. 5C and 5D are merged from 2 neighboring confocal scans) Fig.
- FIG. 5E shows defects in the caudal plexus are detected in 52% of ephb4a morpholino injected larvae at 2.5 dpf, and mis- branching vasculature is present in 46% on day 4. Rapamycin can significantly reduce the number of animals with defect on 2.5 dpf (Fig. 5F) and 4 dpf (Fig. 5G). Fig. 5H shows that BEZ- 235 similarly rescues the branching defect on day 4.
- FIGS. 6A-6F pik3r6 knock-down induces mTOR signaling dependent mis-branching intersomitic vessels.
- Figs.6A (control) and 6B (pik3r6 morpholino) show morpholino mediated knock-down of pik3r6 induces mis-branching of vessels that resemble blood vessels (arrows) and lymphatic vessels (arrowheads) (panels are merged from 2 neighboring confocal scans). Trunk vessels defects could be induced by morpholinos targeting exon 4 (Fig. 6C) and ex on 13 (Fig. 6D). Both rapamycin (Fig. 6E) and BEZ-235 (Fig. 6F) significantly reduced the number of larvae with vessel defects.
- FIGS. 7A-7D Morpholino mediated pik3r4 knock down induces mis-guided intersomitic vessels. Control injected larvae show normal vessel architecture at 4dpf (Fig. 7A), while pik3r4 knock down induces mis-branching in vessels resembling blood (arrowheads) or lymphatic (arrows) vessels (Figs. 7B-7C). Fig. 7D shows that defects were detected in only 5% of control- injected larvae but in 16% of pik3r4 morpholino injected larvae.
- Figures 8A-8B Overactive mTORCl contributes to mis-branching phenotypes and mTOR inhibitors rescue the phenotype. Fig.
- FIG. 8A shows lysates from zebrafish larvae treated with either PIK3R6 morpholino or control morpholino, and untreated or treated with rapamycin or BEZ235 were separated by SDS-PAGE and blotted for phosphor-mTOR S2448 or phosphor-p70S6K T389. Blotting for beta-actin was used as a loading control.
- Fig. 8B shows that lysates from zebrafish larvae treated with either EPFIB4 morpholino or control morpholino, and untreated or treated with rapamycin were separated by SDS-PAGE and blotted for phosphor-mTOR S2448 or phosphor-p70S6K T389.
- FIG. 9 Western blotting analysis of the wild-type FIEK293T cells or EPFIB4 mutant cells by gene-editing. Cells containing the EPFIB4 splice-altering mutation displayed higher P-p70S6K levels than wild type cells. Blotting for beta-actin was used as a loading control.
- mTOR P2273L mutant shows increased protein kinase activity.
- Western blotting analysis of the HeLa cells transfected with flag-tagged vector, wild-type mTOR and P2273L- mTOR mutant. Activation is reflected by increased phosphorylation of p70S6K. e.v. empty vector. Blotting for beta-actin was used as a loading control.
- FIG. 11 A ARAF S214P mutation increased MAPKs activity, and overexpression of human ARAF mutant in zebrafish resulted in vasculature defects.
- FIG. 11 A Cell lysates from HEK293T cells were transfected with FLAG-tagged wild type ARAF or S214P-ARAF mutant. Immunoprecipitation was performed using the anti-FLAG (M2) antibody, followed by Western blot using the antibodies indicated. Aliquots of the cell lysates were analyzed by Western blot. Activation was reflected by increased phosphorylation of ERKs through
- Tg(flil :ARAF-V2a-mCherry) line was generated using Tol2 gateway kit. Briefly, human S214P mutant or wild type ARAF cDNA was injected with a transposon donor plasmid containing Tol2 construct with a fill promoter.
- Transient mosaic expression was visualized by mCherry linked to ARAF by an autocatalytic V2a protein cleavage site.
- FIG. 11C and Fig. 1 ID Expression of human ARAF induced enlarged caudal vessels.
- Fig. 1 IE The enlarged caudal vessels defect was detected in 21% of transgenic expression of human ARAF S214P but not wild type at 2 dpf (*** P ⁇ 0.001).
- Fig. 1 IF and Fig. 11G mTORCl inhibitor Rapamycin (Fig 1 IF) and BEZ235 targeting both PI3K and mTORCl (Fig 11G) had no therapeutic effect on transient transgenic zebrafish (n.s., not significant).
- FIG. 12 LGA-associated mutation A-RafS214P impaired migratory properties of endothelial cells.
- Cell migration was determined using Millipore Transwell chambers. Hy926 cells expressing A-Raf wt or A-Raf-S214P (300 ⁇ , 2x 10 5 cells/ml) were seeded in the upper chambers of Transwell plates and 400 ⁇ of DMEM with 10% FBS was added to the lower chambers. The plates were then placed in an incubator at 37°C with 5% C0 2 for 24 hours. After incubation, the cells remaining in the upper chamber were carefully removed, and the Transwell membrane was fixed with 4% PFA and stained with 0.5% crystal violet. The amount of crystal violet was determined by Optical Density after treatment with 1% SDS solution. The data suggest that selumetinib may partially restore angiogenesis.
- SEQ ID table provides information on sequences used in this application.
- c.3481A>G:p.Sl 161G in PIK3R4, c. l393-7C>T in PIK3R6, c.6818A>G:p.P2273L in mTOR, and c.640T>C:p.S214P in ARAF may be referred to as "lymphatic anomaly-related SNVs" or "lymphatic anomaly-associated mutations" in this application.
- the present disclosure encompasses methods for diagnosing lymphatic anomalies wherein a patient is diagnosed with lymphatic anomalies if they have at least one SNV in EPFIB4, PIK3R3, PIK3R6, and mTOR as compared to a negative control, or have at least one SNV in linkage disequilibrium with at least one SNV in EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF.
- the disclosure also encompasses methods for treating lymphatic anomalies in patients having at least one SNV in EPHB4, PIK3R3, PIK3R6, and mTOR with at least one mTOR inhibitor, at least one PIK3K inhibitor, and/or at least one MEK inhibitor (e.g., at least one agent listed in Tables 1-2).
- a compound "selected from the group consisting of refers to one or more of the compounds in the list that follows, including mixtures (i.e., combinations) of two or more of the compounds.
- an isolated, or biologically pure molecule is a compound that has been removed from its natural milieu. As such, "isolated" and
- biologically pure do not necessarily reflect the extent to which the compound has been purified.
- An isolated compound of the present invention can be obtained from its natural source, can be produced using laboratory synthetic techniques or can be produced by any such chemical synthetic route.
- lymphatic anomaly refers to a disease or disorder characterized by abnormal formation of lymphatic vessels and tissue overgrowth.
- Non-limiting examples of lymphatic anomalies include "Lymphangiomatosis” or “lymphangiectasia” (referred to collectively herein as LAM), lymphangiomas, generalized lymphatic anomaly (GLA), and chylous effusions, generalized lymphangioma, systemic cystic angiomatosis, multiple lymphangiectasias, generalized lymphatic malformation, diffuse lymphatic malformation, Kaposiform LAM and Gorham-Stout disease (GSD), a rare vascular disorder of lymphatic origin characterized by progressive bone osteolysis.
- lymphangiomas are classified into several types. These include (1) Simplex, which is made up of capillary sized, thin-walled lymphatic channels. This type usually affects the skin (lymphangioma circumscriptum); (2) Cystic lymphangioma (or cystic hygroma): this may range in size from a few millimeters to several centimeters, seen in a young age, commonly in the neck or the axilla; (3) Cavernosum: this type is made up of dilated lymphatic channels, often with fibrous adventitial coats. This is the type which usually affects organs in the thorax, abdomen, and bones. Each of these lymphangiomas are encompassed in the invention.
- SNV single nucleotide variation
- a "lymphatic anomaly-associated-SNV or -specific marker” is an SNV that is associated with an increased risk of developing a lymphatic anomaly, and is not found in patients who do not have this disease.
- markers may include, but are not limited to, nucleic acids, proteins encoded thereby, or other small molecules.
- genetic alteration refers to a change from the wild-type or reference sequence of one or more nucleic acid molecules. Genetic alterations include without limitation, SNVs and SNPs, copy number variations (CNVs), base pair substitutions, additions, and deletions of at least one nucleotide from a nucleic acid molecule of a known sequence.
- Linkage describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome, and is measured by percent recombination (also called recombination fraction, or ⁇ ) between the two genes, alleles, loci or genetic markers.
- the recombination fraction will be zero, indicating that the disease and the disease-causing gene are always co-inherited.
- the causative mutation is the polymorphism being tested for linkage with the disease, no recombination will be observed.
- “Centimorgan” is a unit of genetic distance signifying linkage between two genetic markers, alleles, genes or loci, corresponding to a probability of recombination between the two markers or loci of 1% for any meiotic event.
- Linkage disequilibrium or "allelic association” means the preferential association of a particular allele, locus, gene or genetic marker with a specific allele, locus, gene or genetic marker at a nearby chromosomal location more frequently than expected by chance for any particular allele frequency in the population.
- solid matrix refers to any format, such as beads,
- microparticles a microarray, the surface of a microtitration well or a test tube, a dipstick or a filter.
- the material of the matrix may be polystyrene, cellulose, latex, nitrocellulose, nylon, polyacrylamide, dextran or agarose.
- a solid matrix can comprise nucleic acids immobilized thereon such that they are not removable from the matrix in solution.
- Target nucleic acid refers to a previously defined region of a nucleic acid present in a complex nucleic acid mixture wherein the defined wild-type region contains at least one known nucleotide variation, which may or may not be associated with a lymphatic anomaly.
- the nucleic acid molecule may be isolated from a natural source by cDNA cloning or subtractive hybridization or synthesized manually. The nucleic acid molecule may be synthesized manually by the triester synthetic method or by using an automated DNA
- the term "isolated nucleic acid" when applied to DNA refers to a DNA molecule that is separated from sequences with which it is immediately contiguous (in the 5' and 3' directions) in the naturally occurring genome of the organism from which it was derived.
- the "isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryote or eukaryote.
- An "isolated nucleic acid molecule” may also comprise a cDNA molecule.
- An isolated nucleic acid molecule inserted into a vector is also sometimes referred to herein as a recombinant nucleic acid molecule.
- isolated nucleic acid primarily refers to an RNA molecule encoded by an isolated DNA molecule as defined above.
- the term may refer to an RNA molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues), such that it exists in a "substantially pure” form.
- enriched in reference to nucleic acid it is meant that the specific DNA or RNA sequence constitutes a significantly higher fraction (2- to5-fold) of the total DNA or RNA present in the cells or solution of interest than in normal cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other DNA or RNA present, or by a preferential increase in the amount of the specific DNA or RNA sequence, or by a combination of the two. However, it should be noted that “enriched” does not imply that there are no other DNA or RNA sequences present, just that the relative amount of the sequence of interest has been significantly increased.
- nucleotide sequence be in purified form.
- purified in reference to nucleic acid does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively purer than in the natural environment.
- complementary describes two nucleotides that can form multiple favorable interactions with one another.
- adenine is complementary to thymine as they can form two hydrogen bonds.
- guanine and cytosine are complementary since they can form three hydrogen bonds.
- a "complement" of this nucleic acid molecule would be a molecule containing adenine in the place of thymine, thymine in the place of adenine, cytosine in the place of guanine, and guanine in the place of cytosine.
- the complement can contain a nucleic acid sequence that forms optimal interactions with the parent nucleic acid molecule, such a complement can bind with high affinity to its parent molecule.
- the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under predetermined conditions generally used in the art (sometimes termed "substantially
- the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence.
- specific hybridization can refer to a sequence which hybridizes to any lymphatic anomaly-specific marker nucleic acid, but does not hybridize to other nucleotides.
- markers include, for example the lymphatic anomaly-specific markers shown in the Tables contained herein.
- T m 81.5"C + 16.6Log [Na+] + 0.41(% G+C) - 0.63 (% formamide) - 600/#bp in duplex
- the T m is 57 ° C.
- the T m of a DNA duplex decreases by 1 - 1.5 ° C with every 1% decrease in homology.
- targets with greater than about 75%) sequence identity would be observed using a hybridization temperature of 42 ° C.
- the stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25°C below the calculated T m of the hybrid.
- Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12-20°C below the T m of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA at 42°C, and washed in 2X SSC and 0.5% SDS at 55°C for 15 minutes.
- a high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA at 42°C, and washed in IX SSC and 0.5% SDS at 65°C for 15 minutes.
- a very high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA at 42°C, and washed in 0.1X SSC and 0.5% SDS at 65°C for 15 minutes.
- oligonucleotide is defined as a nucleic acid molecule comprised of two or more ribo- or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide. Oligonucleotides, which include probes and primers, can be any length from 3 nucleotides to the full length of the nucleic acid molecule, and explicitly include every possible number of contiguous nucleic acids from 3 through the full length of the polynucleotide. Preferably, oligonucleotides are at least about 10 nucleotides in length, more preferably at least 15 nucleotides in length, more preferably at least about 20 nucleotides in length.
- probe refers to an oligonucleotide, polynucleotide or nucleic acid, either RNA or DNA, whether occurring naturally as in a purified restriction enzyme digest or produced synthetically, which is capable of annealing with or specifically hybridizing to a nucleic acid with sequences complementary to the probe.
- a probe may be either single- stranded or double-stranded. The exact length of the probe will depend upon many factors, including temperature, source of probe and use of the method.
- the oligonucleotide probe in certain cases nucleic acids associated with a specified rs number associated with a single nucleotide polymorphism available in the dbSNP database, typically contains 15-25, 15-35, 20-50, or 100 or more nucleotides, although it may contain fewer nucleotides, provided the site of the SNV is included in the probe.
- the probes herein are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize" or anneal with their respective target strands under a set of pre-determined conditions.
- the probe sequence need not reflect the exact complementary sequence of the target.
- a non-complementary nucleotide fragment may be attached to the 5' or 3' end of the probe, with the remainder of the probe sequence being complementary to the target strand.
- non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically.
- primer refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis.
- suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH
- the primer may be extended at its 3' terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product.
- the primer may vary in length depending on the particular conditions and requirement of the application.
- the oligonucleotide primer is typically 15-25, 15-40, 20-50, etc. or more nucleotides in length.
- the primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able to anneal with the desired template strand in a manner sufficient to provide the 3 ' hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template. For example, a
- non-complementary nucleotide sequence may be attached to the 5' end of an otherwise complementary primer.
- non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient
- RNA refers to a molecule involved in the RNA interference process for a sequence-specific post-transcriptional gene silencing or gene knockdown by providing small interfering RNAs (siRNAs) that has homology with the sequence of the targeted gene.
- small interfering RNAs can be synthesized in vitro or generated by ribonuclease III cleavage from longer dsRNA and are the mediators of sequence-specific mRNA degradation.
- the siRNAs of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
- the siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
- RNA molecules or synthesis reagents include Applied Biosystems (Foster City, CA, USA), Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, 111., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).
- Specific siRNA constructs for inhibiting Lymphangiomatosis mRNA may be between 15-35 nucleotides in length, and more typically about 21 nucleotides in length.
- vector relates to a single- or double-stranded circular nucleic acid molecule that can be infected, transfected or transformed into cells and replicate independently or within the host cell genome.
- a circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes.
- restriction enzymes An assortment of vectors, restriction enzymes, and the knowledge of the nucleotide sequences that are targeted by restriction enzymes are readily available to those skilled in the art, and include any replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element.
- a nucleic acid molecule of the invention can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
- restriction enzymes When cloning a genetic region containing a duplication or a deletion, the skilled artisan is well aware that flanking sequences upstream and downstream of the affected region of a suitable length (e.g., between 50-100 or more nucleotides) would be employed in the cloning process.
- flanking sequences upstream and downstream of the affected region of a suitable length e.g., between 50-100 or more nucleotides
- transformation refers to methods of inserting a nucleic acid and/or an expression construct into a cell or host organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt, an electric field, or detergent, to render the host cell outer membrane or wall permeable to nucleic acid molecules of interest, microinjection, PEG-fusion, and the like.
- promoter element describes a nucleotide sequence that is incorporated into a vector that, once inside an appropriate cell, can facilitate transcription factor and/or polymerase binding and subsequent transcription of portions of the vector DNA into mRNA.
- the promoter element of the present invention precedes the 5' end of the lymphatic anomaly-specific marker nucleic acid molecule such that the latter is transcribed into mRNA.
- Host cell machinery then translates mRNA into a polypeptide.
- Promoter elements may drive constitutive or inducible expression of a coding region of interest.
- nucleic acid vector can contain nucleic acid elements other than the promoter element and the lymphatic anomaly-specific marker encoding nucleic acid.
- nucleic acid elements include, but are not limited to, origins of replication, ribosomal binding sites, nucleic acid sequences encoding drug resistance enzymes or amino acid metabolic enzymes, and nucleic acid sequences encoding secretion signals, localization signals, or signals useful for polypeptide purification.
- a “replicon” is any genetic element, for example, a plasmid, cosmid, bacmid, plastid, phage or virus, that is capable of replication largely under its own control.
- a replicon may be either RNA or DNA and may be single- or double-stranded.
- an "expression operon” refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.
- transcriptional and translational control sequences such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.
- reporter As used herein, the terms “reporter,” “reporter system,” “reporter gene,” or “reporter gene product” shall mean an operative genetic system in which a nucleic acid comprises a gene that encodes a product that when expressed produces a reporter signal that is readily measurable, e.g., by biological assay, immunoassay, radio immunoassay, or by colorimetric, fluorogenic, chemiluminescent or other methods.
- the nucleic acid may be either RNA or DNA, linear or circular, single- or double-stranded, antisense or sense polarity, and is operatively linked to the necessary control elements for the expression of the reporter gene product.
- the required control elements will vary according to the nature of the reporter system and whether the reporter gene is in the form of DNA or RNA, but may include, but not be limited to, such elements as promoters, enhancers, translational control sequences, poly A addition signals, transcriptional termination signals and the like.
- the introduced nucleic acid may or may not be integrated (covalently linked) into nucleic acid of the recipient cell or organism.
- the introduced nucleic acid may be maintained as an episomal element or independent replicon such as a plasmid.
- the introduced nucleic acid may become integrated into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism and further passed on or inherited to progeny cells or organisms of the recipient cell or organism.
- the introduced nucleic acid may exist in the recipient cell or host organism only transiently.
- selectable marker gene refers to a gene that when expressed confers a selectable phenotype, such as antibiotic resistance, on a transformed cell.
- operably linked means that the regulatory sequences necessary for expression of the coding sequence are placed in the DNA molecule in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of transcription units and other transcription control elements (e.g., enhancers) in an expression vector.
- recombinant organism or “transgenic organism” refer to organisms which have a new combination of genes or nucleic acid molecules. A new combination of genes or nucleic acid molecules can be introduced into an organism using a wide array of nucleic acid manipulation techniques available to those skilled in the art.
- the term "organism” relates to any living being comprised of a least one cell. An organism can be as simple as one eukaryotic cell or as complex as a mammal. Therefore, the phrase "a recombinant organism” encompasses a recombinant cell, as well as eukaryotic and prokaryotic organism.
- Example transgenic organisms include zebrafish or mice.
- isolated protein or “isolated and purified protein” is sometimes used herein. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein that has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in “substantially pure” form. "Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, addition of stabilizers, or compounding into, for example, immunogenic
- a “specific binding pair” comprises a specific binding member (sbm) and a binding partner (bp) which have a particular specificity for each other and which in normal conditions bind to each other in preference to other molecules.
- specific binding pairs are antigens and antibodies, ligands and receptors and complementary nucleotide sequences. The skilled person is aware of many other examples. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a large molecule. In embodiments in which the specific binding pair comprises nucleic acid sequences, they will be of a length to hybridize to each other under conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 nucleotides long.
- Sample or “patient sample” or “biological sample” generally refers to a sample which may be tested for a particular molecule, preferably a lymphatic anomaly-specific marker molecule, such as a marker shown in the tables provided below. Samples may include but are not limited to cells, body fluids, including blood, serum, plasma, urine, lymph, saliva, tears, pleural fluid and the like.
- Genotype sequence information generally refers to any information related to the sequence of a subject's DNA or RNA. Genotype sequence information comprises whole genome, whole exome sequencing, exome sequencing, or targeted sequencing of areas of interest within the genome of a subject. Genotype sequence information may also include generation of data on the presence or absence of specific SNVs, such as those found herein to be associated with lymphatic anomalies. In addition, genotype sequence information would include use of probes to detect the presence of and/or expression of one or more lymphatic anomaly-associated SNVs. Examples of how probes may be used to obtain genotype sequence information include, but are not limited to: (1) in situ hybridization; (2) southern hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR).
- PCR polymerase chain reactions
- agent and “test compound” are used interchangeably herein and denote a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues.
- Biological macromolecules include siRNA, shRNA, antisense oligonucleotides, peptides, peptide/DNA complexes, and any nucleic acid based molecule which exhibits the capacity to modulate the activity of the SNV containing nucleic acids described herein or their encoded proteins.
- Example agents include at least one mTOR inhibitor, at least one PIK3K inhibitor, and/or at least one MEK inhibitor.
- Example agents also include those listed in Tables 1-2. Agents are evaluated for potential biological activity by inclusion in screening assays described herein below.
- Treatment covers any administration or application of a therapeutic for disease in a mammal, including a human, and includes inhibiting the disease or progression of the disease, inhibiting or slowing the disease or its progression, arresting its development, partially or fully relieving the disease, preventing the onset of the disease, or preventing a recurrence of symptoms of the disease.
- Example treatments include administration at least one mTOR inhibitor, at least one PIK3K inhibitor, and/or at least one MEK inhibitor (e.g., at least one of the agents listed in Tables 1-2) at efficacious doses.
- inhibitors refer to a decrease or cessation of any event (such as protein ligand binding) or to a decrease or cessation of any phenotypic characteristic or to the decrease or cessation in the incidence, degree, or likelihood of that characteristic.
- To “reduce” or “inhibit” is to decrease, reduce or arrest an activity, function, and/or amount as compared to a reference. It is not necessary that the inhibition or reduction be complete.
- “reduce” or “inhibit” refers to the ability to cause an overall decrease of 20% or greater.
- “reduce” or “inhibit” refers to the ability to cause an overall decrease of 50% or greater.
- “reduce” or “inhibit” refers to the ability to cause an overall decrease of 75%, 85%, 90%, 95%, or greater.
- inhibitor refers to an agent that slows down or prevents a particular chemical reaction, signaling pathway or other process, or that reduces the activity of a particular reactant, catalyst, or enzyme.
- patient and “subject” are used interchangeably to mean a mammal, including human.
- mTOR refers to the mammalian target of rapamycin encoded by mTOR. mTOR may associate in complexes with other proteins to enable critical cellular functions.
- mTORC refers to the mammalian target of rapamycin complex 1, also known as mechanistic target to rapamycin complex 1, which is a protein complex that functions to activate translation of proteins.
- mTORC 1 comprises mTOR, regulatory-associated protein of mTOR (Raptor), mammalian lethal with SEC 13 protein 8 (MLST8), PRAS40, and DEPTOR.
- the mTORC2 complex comprises mTOR, rapamycin-insensitive companion of mTOR (RICTOR), GPL, mammalian stress-activated protein kinase interacting protein 1 (mSINl), Protor 1/2, DEPTOR, TTI1, and TEL2.
- mTORC rapamycin-insensitive companion of mTOR
- GPL GPL
- Protor 1/2 Protor 1/2
- DEPTOR TTI1, and TEL2
- TEL2 mammalian stress-activated protein kinase interacting protein 1
- Any complex of proteins comprising mTOR may be referred herein as an mTORC.
- mTOR signaling would refer to the activity of mTOR, mTORC 1, and MTORC2, along with other proteins that are known to interact in complexes with these proteins.
- mTORC inhibitor refers to a class of agents that inhibit the mechanistic target of rapamycin (mTOR), which is a serine/threonine-specific protein kinase that belongs to the family of phosphatidylinositol-3 kinase (PI3K) related kinases (PIKKs). mTOR regulates cellular metabolism, growth, and proliferation by forming and signaling through two protein
- rapalogs rapamycin and its analogs.
- PIK3K or "PI3K” are used interchangeably herein to refer to
- phosphatidylinositol-4,5-bisphosphate 3-kinase also called phosphatidylinositide 3- kinases, phosphatidylinositol-3-kinases, PI 3-kinases, PI(3)Ks, PI-3Ks.
- PI3K(s) are a family of enzymes involved in cellular functions such as cell growth, proliferation, differentiation, motility, survival and intracellular trafficking, which in turn are involved in cancer.
- PDKs are signal transducer enzymes which regulate intracellular enzymes capable of phosphorylating the 3 position hydroxyl group of the inositol ring of phosphatidylinositol (Ptdlns).
- PIK3K inhibitor refers to a class of agents that function by inhibiting one or more of the phosphoinositide 3-kinase enzymes, which are part of the PBK/AKT/mTOR pathway, an important signaling pathway for many cellular functions such as growth control, metabolism and translation initiation. Within this pathway there are many components, inhibition of which may result in tumor suppression. These anti-cancer drugs are examples of targeted therapy. There are a number of different classes and isoforms of PDKs.
- Class 1 PBKs have a catalytic subunit known as pi 10, with four types (isoforms) - pi 10 alpha, pi 10 beta, pi 10 gamma and pi 10 delta.
- MEK refers to the MAPK/ERK pathway (also known as the Ras-Raf-MEK-
- ERK pathway which comprise a chain of proteins in the cell that communicate a signal from a receptor on the surface of the cell to the DNA in the nucleus of the cell.
- the signal starts when a signaling molecule binds to the receptor on the cell surface and ends when the DNA in the nucleus expresses a protein and produces some change in the cell, such as cell division.
- the pathway includes many proteins, including MAPK (mitogen-activated protein kinases, originally called ERK, extracellular signal-regulated kinases), which communicate by adding phosphate groups to a neighboring protein, which acts as an "on” or "off switch.
- MEK inhibitor refers to an agent that inhibits the mitogen-activated protein kinase enzymes MEKl, MEK2, and/or ERK. They can be used to affect the MAPK/ERK pathway which is often overactive in some cancers.
- cellular signaling would comprise mTOR signaling as well as any other signal transduction pathway process that governs cells homeostasis or activity.
- patients with lymphatic anomalies are diagnosed based on the presence of an SNV after obtaining genotype sequence information from a biological sample obtained from a patient. In some embodiments, patients with lymphatic anomalies are diagnosed based on detecting the presence of one or more SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or an SNV in linkage disequilibrium with an SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF associated with lymphatic anomaly, after obtaining genotype sequence information from a biological sample obtained from a patient.
- this one or more SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is c.2334+lG>C in EPHB4; c.3481A>G:p.Sl 161G in PIK3R4; c. l393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; or c.640T>C:p.S214P in ARAF.
- a report identifying the SNV(s) present in a particular subject may be generated from experimental data.
- a report identifying suggested treatment(s) for the lymphatic anomaly may be generated based upon the data on SNV(s) identified using genotype sequence information.
- diagnosis based on detecting the presence of one or more SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or an SNV in linkage disequilibrium with an SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and
- ARAF after obtaining genotype sequence information from a biological sample obtained from a patient guides the choice of treatment for the patient.
- diagnosis based on detecting the presence of one or more SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or an SNV in linkage disequilibrium with an SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, after obtaining genotype sequence information from a biological sample obtained from a patient does not guide or impact the choice of treatment for the patient.
- diagnosis of a lymphatic anomaly is made solely based on clinical presentation, scanning results, and/or family history. In some embodiments, diagnosis of a lymphatic anomaly is made without testing for genetic sequence information. In some embodiments, diagnosis of a lymphatic anomaly is made based on clinical presentation together with genetic sequence information.
- lymphatic anomaly-related SNVs disclosed in this invention can be used in a number of ways to diagnose lymphatic anomalies.
- nucleic acids comprising lymphatic anomaly-associated SNVs may be used as probes to detect the presence of and/or expression of lymphatic anomaly-specific markers.
- lymphatic anomaly-associated marker nucleic acids may be utilized as probes for such assays include, but are not limited to: (1) in situ hybridization; (2) Southern
- hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR).
- PCR polymerase chain reactions
- assays for detecting lymphatic anomaly-associated SNVs, or the proteins encoded thereby may be conducted on any type of biological sample, including but not limited to body fluids (including blood, urine, serum, gastric lavage), any type of cell (such as brain cells, white blood cells, mononuclear cells) or body tissue.
- body fluids including blood, urine, serum, gastric lavage
- any type of cell such as brain cells, white blood cells, mononuclear cells
- Lymphatic anomaly-associated SNV-containing nucleic acids vectors expressing the same, lymphatic anomaly-associated SNV-containing marker proteins and anti -lymphatic anomaly-specific marker antibodies can be used to detect lymphatic anomaly-associated SNVs in body tissue, cells, or fluid, and alter lymphatic anomaly-associated SNV-containing marker protein expression for purposes of detecting and diagnosing lymphatic anomalies.
- the method may comprise detecting lymphatic anomaly-associated SNVs, the lymphatic anomaly-associated SNV containing nucleic acid in the sample will initially be amplified, e.g. using PCR, to increase the amount of the templates as compared to other sequences present in the sample. This allows the target sequences to be detected with a high degree of sensitivity if they are present in the sample. This initial step may be avoided by using highly sensitive array techniques that are becoming increasingly important in the art.
- new detection technologies can overcome this limitation and enable analysis of small samples containing as little as ⁇ g of total RNA.
- RLS Resonance Light Scattering
- PWG planar wave guide technology
- any of the aforementioned techniques may be used to detect or quantify lymphatic anomaly-associated SNV marker expression and accordingly and to diagnose lymphatic anomalies or a risk of development thereof.
- the invention comprises administering one or more mTOR inhibitors, one or more PIK3K inhibitors, and/or one or more MEK inhibitors (e.g., one or more of the agents of Tables 1-2) to a patient having a lymphatic anomaly.
- the patient with a lymphatic anomaly to be treated has been diagnosed based on symptoms and a positive family history of lymphatic anomalies.
- a variety of scanning technologies such as plain film radiography, bone scanning, computed tomography, magnetic resonance imaging, and lymphoscintigraphy are used together with clinical presentation to diagnose a lymphatic anomaly.
- a biopsy is performed to diagnose a lymphatic anomaly.
- a lymphatic anomaly is diagnosed based on lymph vessel overgrowth.
- a lymphatic anomaly is diagnosed based on abnormal formation of lymphatic vessels.
- a lymphatic anomaly is diagnosed based on chylous effusions, including pericardial, pleural, or peritoneal effusions.
- the patient with a lymphatic anomaly to be treated has been diagnosed according to the diagnostic methods described herein.
- one or more mTOR inhibitors, one or more PIK3K inhibitors, and/or one or more MEK inhibitors are useful in the preparation of a medicament to treat lymphatic anomalies.
- the one or more agent(s) may be formulated with a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other material well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
- the precise nature of the carrier or other material may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, aerosolized, intramuscular, and intraperitoneal routes. In vitro systems or transgenic organisms comprising lymphatic anomaly-associated mutations may be used to select a particular agent for treatment of humans.
- Agents useful for treatment include, but are not limited to, the agents of Tables 1 and 2. Some agents are listed on both Table 1 and 2, and the fact that they are not listed on both tables should be given no meaning.
- Table 2 provides agents that can be used alone, or in combination with any of the agents in Table 1 or in Table 2 to treat lymphatic anomalies.
- suitable agents targeting the genes disclosed herein can be administered in combination in order to provide therapeutic benefit to the patient. Such agents should be administered in an effective dose.
- mTOR inhibitors can be used alone or in combination with additional mTOR inhibitors.
- PIK3K inhibitors can be used alone, or in combination with any of the PIK3K inhibitors listed above.
- MEK inhibitors can used alone or in combination with other MEK/ERK inhibitors.
- treatment entails administration of an mTOR inhibitor together with PIK3K inhibitor.
- mTOR and MEK/ERK inhibitors are combined to provide therapeutic benefit to the patient.
- PIK3K and MEK/ERK inhibitor are combined to ameliorate symptoms of disease.
- an effective therapy comprises administration of a MEK/ERK inhibitor.
- the combinatorial therapies described above can act in an additive fashion.
- the combined agents act synergistically to alleviate symptoms.
- a biological sample, and/or genotyping information may be obtained from a patient. Genetic information gleaned from nucleic acids present in the sample would then be assessed for the presence or absence of the lymphatic anomaly-associated SNV for example. The presence of these mutations indicating the presence of a lymphatic anomaly risk or disease, along with the simultaneous identification of the genes affected, provides the clinician with guidance as to which therapeutic agents are appropriate.
- the total treatment dose or doses can be administered to a subject as a single dose or can be administered using a fractionated treatment protocol, in which multiple/separate doses are administered over a more prolonged period of time, for example, over the period of a day to allow administration of a daily dosage or over a longer period of time to administer a dose over a desired period of time.
- a fractionated treatment protocol in which multiple/separate doses are administered over a more prolonged period of time, for example, over the period of a day to allow administration of a daily dosage or over a longer period of time to administer a dose over a desired period of time.
- the amount of lymphatic anomaly agent required to obtain an effective dose in a subject depends on many factors, including the age, weight and general health of the subject, as well as the route of administration and the number of treatments to be administered. In view of these factors, the skilled artisan would adjust the particular dose so as to obtain an effective dose for treating an individual having a lymphatic anomaly.
- lymphatic anomaly therapeutic agent(s) will depend on the mode of administration, and the weight of the individual being treated.
- the dosages described herein are generally those for an average adult but can be adjusted for the treatment of children.
- the dose will generally range from about 0.001 mg to about 1000 mg.
- lymphatic anomaly therapeutic agents can be particularly useful when administered in combination, for example, with a conventional agent for treating such a disease.
- a conventional agent for treating such a disease The skilled artisan would administer lymphatic anomaly therapeutic agent(s), alone or in combination and would monitor the effectiveness of such treatment using routine methods such as pulmonary, bowel, thyroid, or inflammatory function determination, radiologicor immunologic assays, or, where indicated, histopathologic methods.
- Other agents for the treatment of lymphatic anomaly include systemic chemotherapy, interferon alfa therapy, radiotherapy, or surgery, to alleviate the symptoms underlying the disease.
- Administration of the pharmaceutical preparation is preferably in an "effective amount" this being sufficient to show benefit to the individual. This amount prevents, alleviates, abates, or otherwise reduces the severity of lymphatic anomaly symptoms in a patient.
- Treatment of patients having lymphatic anomaly with an efficacious amount of an mTOR inhibitor, a PIK3K inhibitor, and/or a MEK inhibitor may produce improvements in lymph structure, decreased chylous pleural effusions, improved respiratory function, tapering of concomitant medication usage, or increased survival.
- the pharmaceutical preparation is formulated in dosage unit form for ease of administration and uniformity of dosage.
- Dosage unit form refers to a physically discrete unit of the pharmaceutical preparation appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art.
- Dosage units may be proportionately increased or decreased based on the weight of the patient. Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.
- compositions that are useful in the methods of the invention may be administered systemically in parenteral, oral solid and liquid formulations, subcutaneously, intradermally, intramuscularly, sublingually, topically, auricularly (OTIC), buccally,
- compositions may contain pharmaceutically- acceptable carriers and other ingredients known to enhance and facilitate drug administration.
- pharmaceutically- acceptable carriers e.g., aqueous suspensions of aluminum and magnesium hydroxides, and/or other pharmaceutically acceptable carriers, such as saline.
- nanoparticles such as nanoparticles, liposomes, resealed erythrocytes, and immunologically based systems may also be used to deliver/administer the appropriate agent to a patient according to the methods of the invention.
- nanoparticles to deliver such agents, as well as cell membrane permeable peptide carriers that can be used are described in Crombez et al., Biochemical Society Transactions v35:p44 (2007).
- Administration of agent(s) useful for treating a lymphatic anomaly may be done following successfully detecting or quantifying lymphatic anomaly-associated SNV marker expression and accordingly, diagnosing a lymphatic anomaly or a risk of development thereof. Detecting or quantifying lymphatic anomaly-associated SNV marker expression may guide the selection of the specific agent used for treatment. Detecting or quantifying lymphatic anomaly- associated SNV marker expression may indicate that a particular treatment is not appropriate for a given subject.
- treatment for a lymphatic anomaly may be done based on clinical diagnosis of disease and treatment may be initiated in the absence of detecting or quantifying genetic sequence information. In other embodiments, treatment for a lymphatic anomaly may be done based on clinical diagnosis of disease and treatment may be initiated in the absence of detecting or quantifying lymphatic anomaly-associated SNV marker expression.
- treatment for a lymphatic anomaly may be done based on clinical diagnosis of disease and treatment may be initiated when lymphatic anomaly-associated SNV marker expression is not different from controls.
- treatment is administered in patients who do not have an SNV in EPHB4, PIK3R4, PIK3R6, mTOR, or ARAR
- two or more agents from Tables 1-2 are administered. In some embodiments, three or more agents from Tables 1-2 are administered.
- the agent(s) that are administered have a profile of inhibition of mTOR, mTORCl, and mTORC2.
- the activity of mTOR, mTORCl, and mTORC2 may be termed "mTOR signaling.” Inhibition of mTOR, mTORCl, and mTORC2 may be referred to as inhibition of mTOR signaling.
- this agent(s) with a profile of inhibition of mTOR, mTORCl, or mTORC2 is not included in Tables 1-2, but has an in vitro or cell-free profile of inhibition of mTOR, mTORCl, or mTORC2.
- the inhibitor of mTOR signaling, mTOR inhibitor, mTORCl inhibitor, or mTORC2 inhibitor has an IC50 of less than ⁇ , less than 10 ⁇ , less than ⁇ , less than lOOnM, less than lOnM, or less than InM.
- the agent(s) is selective for inhibition of mTOR, mTORCl, and/or mTORC2 over other targets. In some embodiments, the agent(s) is not selective for inhibition of mTOR, mTORCl, and/or mTORC2 over other targets. In some embodiments, the agent(s) inhibit mTOR, mTORCl, and/or mTORC2 and also have other measurable biologic effects.
- the agent(s) is an ATP-competitive mTOR inhibitor. In some embodiments, the agent(s) is a mTOR inhibitor that is not ATP-competitive. In some
- the agent is a dual mTORCl/C2 inhibitor.
- the agent(s) is an inhibitor of phosphoinositide 3-kinase (PI3K).
- the agent(s) is an inhibitor of PI3K and mTOR, mTORCl, or mTORC2.
- the agent(s) is an inhibitor of PI3K without inhibition of mTOR, mTORCl, or mTORC2.
- the PI3K inhibitor has an IC50 of less than ⁇ , less than ⁇ , less than ⁇ , less than ⁇ , less than ⁇ , or less than InM.
- the agent(s) is an inhibitor of peptidyl-prolyl cis-trans isomerase, the gene product of FKB12. In some embodiments, the agent is an inhibitor of FK506 binding. In some embodiments, the agent(s) is an inhibitor of peptidyl-prolyl cis-trans isomerase or the gene product of FKB12 and mTOR, mTORCl, or mTORC2. In some embodiments, the agent(s) is an inhibitor of peptidyl-prolyl cis-trans isomerase or the gene product of FKB12 without inhibition of mTOR, mTORCl, or mTORC2.
- the inhibitor of peptidyl-prolyl cis- trans isomerase or the gene product of FKB12 has an IC50 of less than ⁇ , less than ⁇ , less than ⁇ , less than lOOnM, less than lOnM, or less than InM.
- the agent(s) is an inhibitor of DNA-activated protein kinase (DNA-PK). In some embodiments, the agent(s) is an inhibitor of DNA-PK and mTOR, mTORCl, or mTORC2. In some embodiments, the agent(s) is an inhibitor of DNA-PK without inhibition of mTOR, mTORCl, or mTORC2. In some embodiments, the inhibitor of DNA-PK has an IC50 of less than ⁇ , less than ⁇ , less than ⁇ , less than lOOnM, less than lOnM, or less than InM.
- DNA-PK DNA-activated protein kinase
- the agent(s) is an inhibitor of phosphatidylinositol-4,5- bisphosphate 3-kinase, also known as pi 10.
- the agent(s) is an inhibitor of one or more subunits of pi 10 ( ⁇ , ⁇ , ⁇ , ⁇ , etc.).
- the agent(s) is an inhibitor of pi 10 and mTOR, mTORCl, or mTORC2.
- the agent(s) is an inhibitor of pi 10 without inhibition of mTOR, mTORCl, or mTORC2.
- the inhibitor of pi 10 has an IC50 of less than ⁇ , less than 10 ⁇ , less than ⁇ , less than lOOnM, less than lOnM, or less than InM.
- the agent(s) is an inhibitor of P70S6 kinase (P70S6K). In some embodiments, the agent(s) is an inhibitor of P70S6K and mTOR, mTORCl, or mTORC2. In some embodiments, the agent(s) is an inhibitor of P70S6K without inhibition of mTOR, mTORCl, or mTORC2. In some embodiments, the inhibitor of P70S6K has an IC50 of less than ⁇ , less than ⁇ , less than ⁇ , less than lOOnM, less than lOnM, or less than InM. In some embodiments, the inhibitor is an MEK1/2 inhibitor which inhibits the mitogen- activated protein kinase enzymes MEK1 and/or MEK2. They can be used to affect
- the agent(s) is rapamycin or BEZ-235 (dactolisib).
- Rapamycin an mTOR inhibitor
- sirolimus is also known as sirolimus.
- BEZ-235 also known as dactolisib or NVP- BEZ235, is a compound with known activity against pi 10, PI3K, and mTOR.
- the agent to be administered in the treatment methods is selected from Rapamycin (Sirolimus), Everolimus (RADOOl), AZD8055, Temsirolimus (CCI-779, NSC 683864), KU-0063794, MHY1485, BEZ235 (NVP-BEZ235, Dactolisib), PI- 103, Torkinib (PP242), Tacrolimus (FK506), Ridaforolimus (Deforolimus, MK-8669), INK 128 (MLN0128), Voxtalisib (SAR245409, XL765), Torin 1, Omipalisib (GSK2126458, GSK458) , OSI-027, PF- 04691502, Apitolisib (GDC-0980, RG7422), GSK1059615, Gedatolisib (PF-05212384, PKI- 587), WYE-354, AZD2014, Torin
- the agent to be administered is an MEK inhibitor selected from Selumetinib (AZD6244).
- Combinations of the agents described above should have efficacy for the treatment of lymphatic anomalies.
- the combinations below can act additively or synergistically to treat LAM.
- the combinations for administration are selected from 1) Ridaforolimus and Trametinib; 2) Ridaforolimus and Selumetinib or Cobimetinib; 3) BEZ235 and Selumetinib; 4) Omipalisib and Selumetinib or Trametinib; 5) Everolimus and Trametinib or Selumetinib; 6) Sirolimus, Ridaforolimus and Selumetinib; 7) Sirolimus, Ridaforolimus and Trametinib; 8) Torkinib and Trametinib; 9) BEZ235, Torkinib and Trametinib; and 10) Sirolimus and Gedatolisib and Trametinib.
- treatment with an agent(s) listed herein is used in combination with one or more of systemic chemotherapy, interferon alfa, radiotherapy, and/or surgery.
- SNVs identified herein have been associated with the etiology of lymphatic anomaly, methods for identifying agents that modulate the activity of the genes and their encoded products containing such SNVs should result in the generation of efficacious therapeutic agents for the treatment of this condition.
- the chromosomal regions described herein contain protein coding regions which provide suitable targets for the rational design of therapeutic agents which modulate their activity. Small peptide molecules corresponding to these regions may be used to advantage in the design of therapeutic agents which effectively modulate the activity of the encoded proteins.
- candidate drugs can be screened from large libraries of synthetic or natural compounds.
- One example is an FDA approved library of compounds that can be used by humans.
- compound libraries are commercially available from a number of companies including but not limited to Maybridge Chemical Co.
- pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Several commercial libraries can be used in the screens.
- polypeptides or fragments employed in drug screening assays may either be free in solution, affixed to a solid support or within a cell.
- One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant
- polynucleotides expressing the polypeptide or fragment preferably in competitive binding assays.
- Such cells either in viable or fixed form, can be used for standard binding assays.
- One may determine, for example, formation of complexes between the polypeptide or fragment and the agent being tested, or examine the degree to which the formation of a complex between the polypeptide or fragment and a known substrate is interfered with by the agent being tested.
- a further technique for drug screening involves the use of host eukaryotic cell lines, cells (such as endothelial cells) or whole animal models (e.g., transgenic mice or zebrafish) which have a nonfunctional or altered lymphatic anomaly-associated gene.
- the transgenic organism comprises cells that have mutation of c.2334+lG>C in EPHB4;
- These host cell lines, cells or transgenic animals are defective at the polypeptide level.
- the host cell lines or cells are grown in the presence of drug compound. For example, in a zebra fish model, the rescue of caudal and or D/V vessel structure can be assessed. Additionally, induction of phosphorylation by mTOR in a host cell line may be assessed.
- An example method of drug screening would be a method for identifying an agent that alters cellular signaling, such as an agent listed in Tables 1-2.
- This method would comprise providing cells expressing at least one nucleic acid comprising at least one lymphatic anomaly- associated SNV; providing cells which express the cognate wild type sequences corresponding to the lymphatic anomaly-associated SNV; contacting the cells expressing at least one lymphatic anomaly-associated SNV and cells expressing the cognate wild type sequence with a test agent; and analyzing whether said agent alters cellular signaling.
- Host cells expressing the lymphatic anomaly-associated SNVs of the present invention or functional fragments thereof provide a system in which to screen potential compounds or agents for the ability to modulate the development of lymphatic anomalies.
- the nucleic acid molecules of the invention may be used to create recombinant cell lines for use in assays to identify agents which modulate aspects of aberrant mTOR signaling associated with lymphatic anomalies and aberrant vessel formation. Also provided herein are methods to screen for compounds capable of modulating the function of proteins encoded by SNV-containing nucleic acids.
- phage display libraries engineered to express fragment of the polypeptides encoded by the SNV containing nucleic acids on the phage surface. Such libraries are then contacted with a combinatorial chemical library under conditions wherein binding affinity between the expressed peptide and the components of the chemical library may be detected.
- US Patents 6,057,098 and 5,965,456 provide methods and apparatus for performing such assays.
- lymphatic anomaly-associated altered nucleic acids enables the production of strains of laboratory mice carrying the altered nucleic acids of the invention.
- These lymphatic anomaly-associated altered nucleic acids may be c.2334+lG>C in EPHB4; c.3481A>G:p.Sl 161G in PIK3R4; c. l393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; and/or c.640T>C:p.S214P in ARAF.
- Transgenic mice expressing the lymphatic anomaly-associated mutations of the invention provide a model system in which to examine the role of the protein encoded by the mutated nucleic acid in the development and progression towards lymphatic anomalies.
- Methods of introducing transgenes in laboratory mice are known to those of skill in the art. Three common methods include: 1. integration of retroviral vectors encoding the foreign gene of interest into an early embryo; 2. injection of DNA into the pronucleus of a newly fertilized egg; and 3. the incorporation of genetically manipulated embryonic stem cells into an early embryo. Production of the transgenic mice described above will facilitate the molecular elucidation of the role that a target protein plays in various processes associated with the lymphatic anomaly phenotypes. Such mice provide an in vivo screening tool to study putative therapeutic drugs in a whole animal model and are encompassed by the present invention.
- transgenic animal is any animal containing one or more cells bearing genetic information altered or received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by targeted recombination or microinjection or infection with recombinant virus.
- transgenic animal is not meant to encompass classical cross-breeding or in vitro fertilization, but rather is meant to encompass animals in which one or more cells are altered by or receive a recombinant DNA molecule.
- This molecule may be specifically targeted to a defined genetic locus, be randomly integrated within a chromosome, or it may be extrachromosomally replicating DNA.
- the term "germ cell line transgenic animal” refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability to transfer the genetic information to offspring. If such offspring, in fact, possess some or all of that alteration or genetic information, then they, too, are transgenic animals.
- the alteration of genetic information may be foreign to the species of animal to which the recipient belongs, or foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene. Such altered or foreign genetic information would encompass the introduction of altered lymphatic anomaly-associated nucleotide sequences.
- the DNA used for altering a target gene may be obtained by a wide variety of techniques that include, but are not limited to, isolation from genomic sources, preparation of cDNAs from isolated mRNA templates, direct synthesis, or a combination thereof.
- ES cells may be obtained from pre-implantation embryos cultured in vitro (Evans et al., (1981) Nature 292: 154-156; Bradley et al., (1984) Nature 309:255-258; Gossler et al., (1986) Proc. Natl. Acad. Sci. 83 :9065-9069).
- Transgenes can be efficiently introduced into the ES cells by standard techniques such as DNA transfection or by retrovirus-mediated transduction.
- the resultant transformed ES cells can thereafter be combined with blastocysts from a non-human animal.
- the introduced ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
- One approach to the problem of determining the contributions of individual genes and their expression products is to use isolated, mutation-containing lymphatic anomaly-associated genes as insertional cassettes to selectively inactivate a wild-type gene in totipotent ES cells (such as those described above) and then generate transgenic mice.
- the use of gene-targeted ES cells in the generation of gene-targeted transgenic mice was described, and is reviewed elsewhere (Frohman et al., (1989) Cell 56: 145-147; Bradley et al., (1992) Bio/Technology 10:534-539).
- Non-homologous recombinants are selected against by using the Herpes Simplex virus thymidine kinase (HSV-TK) gene and selecting against its nonhomologous insertion with effective herpes drugs such as gancyclovir (GANC) or (l-(2-deoxy-2-fluoro-B-D
- mutated lymphatic anomaly-associated nucleic acid as a targeted insertional cassette provides means to detect a successful insertion as visualized, for example, by acquisition of immunoreactivity to an antibody immunologically specific for the polypeptide encoded by EPHB4 nucleic acid and, therefore, facilitates screening/selection of ES cells with the desired genotype.
- a knock-in animal is one in which the endogenous murine gene, for example, has been replaced with human lymphatic anomaly-associated gene of the invention. Such knock-in animals provide an ideal model system for studying the development of lymphatic anomalies.
- a mutated lymphatic anomaly-associated nucleic acid, fragment thereof, or a lymphatic anomaly-associated fusion protein can be targeted in a "tissue specific manner" or "cell type specific manner" using a vector in which nucleic acid sequences encoding all or a portion of lymphatic anomaly-associated nucleic acid are operably linked to regulatory sequences (e.g., promoters and/or enhancers) that direct expression of the encoded protein in a particular tissue or cell type.
- regulatory sequences e.g., promoters and/or enhancers
- Such regulatory elements may be used to advantage for both in vitro and in vivo applications. Promoters for directing tissue specific proteins are well known in the art and described herein.
- the transgene may be under the control of an inducible promoter which may function in a tissue specific or "whole body" manner.
- the nucleic acid sequence encoding the lymphatic anomaly-associated mutant of the invention may be operably linked to a variety of different promoter sequences for expression in transgenic animals.
- promoters include, but are not limited to a prion gene promoter such as a hamster or mouse Thy-1 promoter; a PGK promoter; or a CMV promoter for the expression of transgenes in desired cell types.
- Transgenic mice into which a nucleic acid containing the mutated lymphatic anomaly-associated nucleic acid or its encoded protein have been introduced are useful, for example, to develop screening methods to screen therapeutic agents to identify those capable of modulating the development of lymphatic anomalies.
- lymphatic anomaly-associated SNV-containing nucleic acids, vectors expressing the same, lymphatic anomaly-associated SNV-containing marker proteins and anti -lymphatic anomaly-specific marker antibodies are products capable of detecting SNVs c.2334+lG>C in EPHB4, c.3481A>G:p.Sl 161G in PIK3R4, c. l393-7C>T in PIK3R6, c.6818A>G:p.P2273L in mTOR, or c.640T>C:p.S214P in ARAF.
- Detection products may be labeled such that they can be detected.
- kits Any products useful in detecting the lymphatic-anomaly-associated SNVs can be incorporated into a kit. Any products useful in treating lymphatic anomalies can be incorporated into a kit. Kits containing such detection and therapeutic products are encompassed.
- the kit may contain one or more of a lymphatic anomaly-associated SNV specific marker polynucleotide or one or a collection of such markers immobilized on a solid support, gene chip, an
- oligonucleotide a polypeptide, a peptide, an antibody, a label, a marker, a reporter, a
- ES whole exome sequencing
- the proband in family 1 is a 24-year-old man with a lifelong history of complex lymphatic disease manifesting primarily as a right-sided chylous effusion.
- the diagnosis of pulmonary lymphangiomatosis was previously confirmed by histopathological evidence on an open lung biopsy at 4 months of age.
- a lymphangiogram evidenced no normal lymphatic valves.
- Retrograde flow of lymph was found, which included suspicion of flow into (rather than out of) lungs.
- lymphatic channels were dysfunctional and the flow was abnormal after injection of lymph nodes with gadolinium.
- Exomic sequencing was performed on the proband (i.e., affected individuals) and healthy sister, both parents, unaffected maternal aunt, as well as affected maternal grandfather, who provided the most effective baseline data. All missense, nonsense, splice-altering, and coding indel mutations were examined that matched the autosomal dominant inheritance model of the family. Results were filtered to exclude synonymous variants, variants with minor allele frequency (MAF) greater than 0.5%, and variants previously identified in controls by our in- house exome variant database. Relevant candidates were taken forward for manual curation.
- proband i.e., affected individuals
- healthy sister both parents, unaffected maternal aunt, as well as affected maternal grandfather
- EPFIB4 is expressed on valves in lymphatic-collecting vessels, and the affected individuals in the proband have lymphangiography demonstrating retrograde flow suggestive of absent or dysfunctional valves.
- the c.2334+lG>C mutation was absent from the 1000 Genomes Project, COSMIC, ESP6500SI and ExAC 61,000 exomes v0.3 release.
- RNA-seq with skin biopsies obtained from the lead proband demonstrated that the EPHB4 splice-altering mutation creates a cryptic splice donor that causes the retention of the intervening 12 bp of the intron and leads to nonframeshift 4 amino acids insertion in the highly conserved catalytic loop of protein kinase domain, which was also confirmed by standard Sanger sequencing (data not shown).
- RT- PCR confirmed two bands in EBV transformed lymphoblastoid cell lines (LCLs) generated from the proband and mother and showed skin from unaffected controls had higher expression level for wild type of EPHB4 (data not shown).
- LCLs EBV transformed lymphoblastoid cell lines
- Protein immunoblot for EPHB4 in healthy family members and patient-derived LCLs showed a band of predicted size (120kD) in all samples, with a more prominent band in controls (date not shown).
- EPHB4 encodes for Ephrin B-type receptor 4, which is a receptor tyrosine kinase and recognizes Ephrin B2 (EFNB2) as a specific ligand.
- the EF B2/EPHB4 pathway has previously been shown to impact venous and lymphatic cell fate determination.
- Figure 2 provides a schematic overview of signaling pathways that give rise to the arterial phenotype, the venous phenotype and the lymphatic phenotype, and highlights the role of EPFIB4 in development of the venous phenotype.
- PIK3R4 phosphoinositide-3 -kinase regulatory subunit 4
- PIK3R6 homozygous splicing mutation in phosphoinositide-3 - Kinase Regulatory Subunit 6
- mTOR phosphoinositide-3 -kinase regulatory Subunit 6
- PIK3R4, PIK3R6, MTOR, and EPHB4a are related in that they converge on the same physiological PI3K/AKT/mTOR pathway.
- this pathway provides an ideal target for therapeutics that may have efficacy for the treatment of lymphatic anomalies.
- Table 3 provides a summary of these data.
- the family with the mutation described above in EPHB4 at c.2334+lG>C was designated as family-1.
- family-2 exonic sequencing revealed a homozygous variant, c.1393-7C>T, in PIK3R6 in the proband with both parents being heterozygous.
- PIK3R6 encodes the regulatory subunit (p84) that pairs with the catalytic subunit pi 10 to form a Class IB PI3K complex.
- families 3 and 4 a very rare missense mutation, c.6818A>G:p.P2273L, in MTOR, and a novel missense mutation, c.3481A>G:p.Sl 161G, in PIR3R4, respectively were identified.
- EPHB4 c.2334+lG>C mutation in EPHB4 affects the catalytic activity of the gene product.
- a plasmid containing the EPHB4 coding sequence was obtained from GE Dharmacon (cat# MHS6278-202833446, Lafayette, CO). The discovered 12 base pair insertion was made via the Quikchange II mutagenesis kit (Agilent, Santa Clara, CA) using primers SEQ ID NO: 1 and SEQ ID NO: 2. The coding sequence was amplified by PCR using forward primer SEQ ID NO: 3 and reverse primer SEQ ID NO: 4 and ligated into the EcoRI and NotI sites of pBabe+CMV Puro.
- a FLAG tag was inserted into the coding sequence following the signal peptide via the Q5 Mutagenesis kit (NEB, Ipswich, MA) using the forward primer SEQ ID NO: 5 and the reverse primer SEQ ID NO: 6. All sequences were confirmed by Sanger sequencing.
- HEK239T cells and the A375 melanoma cell line were obtained from ATCC (Manassas, Virginia). Transfections were performed using Fugene HD (Promega, Madison, WI), with 3 ⁇ g DNA and 9 ⁇ of the transfection reagent, according to manufacturer's protocols.
- Ephrin-B2-Fc 6-well plates (not tissue culture treated, Thermo Scientific) were coated overnight at 37°C with either Ephrin-B2-Fc (cat# 7397-EB,
- IgGl IgGl kappa from human myeloma plasma (cat# 15154, Sigma) at 5 ⁇ g/mL in 50 mM sodium carbonate solution (pH 9.6).
- the plates were washed with PBS, blocked with 1% BSA in PBS for 30 minutes at 4°C, and washed again with PBS.
- Transfected cells were removed from their plates using 10 mM EDTA in DMEM, washed and resuspended in serum free
- IPs FLAG immunoprecipitations
- IPs were performed using Anti-FLAG M2 Affinity Gel (cat# A2220, Sigma, St. Louis, MO). IPs and lysates were run on NuPAGE 4-12% Bis-Tris gels and blotted with anti-phosphotyrosine - 4G10- Biotin (cat# 16-103, EMD Millipore, Billerica MA) and anti-EPHB4 (cat# AF3038, R&D Systems, Minneapolis, MN).
- mRNA knock down approach was taken using morpholino antisense oligonucleotides in zebrafish that inhibit the same splice junction of exon 13 as identified in the patients by using tg(flil :GFP) line.
- the morpholino sequence targeting exon 13 was CGAGAGCAGTATTTACCAGTGAGCT (SEQ ID NO: 15) and was used at a concentration of 0.8 mM.
- concentration used was 0.25 mM and for pik3r6 exl3 del, the concentration was 0.5 mM.
- RT-PCR analysis showed efficient knockdown by -66% ( Figure 4).
- Fig. 5E shows quantification (labeled as "mis-branching", 6 experiments, 259 animals, P ⁇ 3.9E-08). The morphology and lateral branching shows that these aberrant branches have lymphatic character.
- Amplification of ephb4a cDNA derived from the Morphants (MOs) revealed that specifically targeting the 13th exon resulted in aberrant splicing with either a small or larger insertion.
- Sanger sequencing showed that the smaller band was a 30 bp in-frame insertion (encoding VNTALVLSIL), while the larger band was due to the retention of the intron between exon 13 and 14 presumably resulting in a premature stop codon.
- zebrafish exposed to morpholino antisense oligonucleotides to inhibit the same splice junction of exon 13 of EPHB4 were treated with mTORCl inhibitors rapamycin (1 ⁇ ) and BEZ-235 (100 nM).
- Treatment with rapamycin from 24 hpf to 56 hpf showed a significant rescue of the defects in the caudal vascular plexus from 44% (control, without treatment) to 29% (6 experiments, 321 animals, P ⁇ 0.01), as shown in Fig. 5F.
- Rapamycin also rescued the intersomitic vessel mis-branching when treating from 2.5 dpf to 4 dpf (47%) [control, without treatment] vs. 20%>) (Fig. 5G, 6 experiments, 136 animals, P ⁇ 0.00007).
- BEZ-235 also rescued the mis-branching from 45% (control) to 15% (Fig. 5H, 2 experiments, 41 animals, P ⁇ 0.037).
- rapamycin and BEZ-235 could also inhibit the mis-branching phenotype induced by the pik3r6 exon 4 morpholino. Indeed, both drugs showed they could reverse the functional process resulting in vascular normalization. Rapamycin reduced the number of animals with aberrant branches from 47% to 21% (Fig. 6E, 4 experiments, 190 animals, P ⁇ 0.003) BEZ-235 reduced mis-branching animals from 56% to 23% (Fig. 6F, 4 experiments, 103 animals, P ⁇ 0.008).
- a morpholino was designed against the splice junction site of exon 3.
- the morpholino induced mis-branching in 16% of injected larvae that either affected intersomitic blood vessels or lymphatic vessels (evaluated by morphology and position of the vessel) compared to control that had 5% mis-branching (Figs. 7A-7D; 2 experiments; 198 animals; P ⁇ 0.05).
- zebrafish larvae were lysed between 4.5 and 5 dpf, and the lysates were analyzed for mTORCl signaling by Western blots. Trunk sections of zebrafish larvae 4.5-5 dpf were lysed in radioimmunoprecipitation assay (RIP A) buffer supplemented with protease inhibitors (Complete protease inhibitor cocktail tablets, Roche, Mannheim, Germany). Approximately 5 micrograms of protein were separated on NuPAGE 4-12% Bis-Tris gels run with MOPS SDS running buffer (Life Technologies, Carlsbad, CA).
- RIP A radioimmunoprecipitation assay
- Western blotting was performed using the following antibodies: p-p70 S6 Kinase T389 (cat# 9205 S, Cell Signaling, Danvers, MA), Phospho-mTOR Ser2448 (cat# 5536P, Cell Signaling), HIF1 (cat# LS-C287203, LSBio, Seattle, WA), beta-actin (cat# AC-15, Santa Cruz Biotechnology, Santa Cruz, CA).
- Both PIK3R6 (Fig. 8 A) and EPHB4 MOs (Fig. 8B) showed activated mTORCl signaling as detected by phosphorylation of both mTOR and its downstream target p70S6K.
- the activation of mTORCl by either morpholino was inhibited by treatment of the developing larvae with rapamycin.
- Activation by the PIK3R6 morpholino was also inhibited by BEZ235, a dual PI-3- kinase and mTOR inhibitor.
- BEZ235 a dual PI-3- kinase and mTOR inhibitor.
- a cellular model for the EPHB4 mutation was developed using CRISPR.
- the exon 12 to 14 region of EPHB4 cDNA was amplified by PCR and directly sequenced to confirm the knock-in.
- the pSpCas9(BB)-2A-Puro vector containing the specific target sequence for EPFIB4 locus (gRNA-EPFIB4) was co-transfected with a single-stranded donor oligonucleotides (ssODN) into 293T cells using the Lipofectamine 2000 transfection reagent per manufacturer's instructions.
- ssODN contains a single base mismatch to the genomic sequence to recreate the EPFIB4 mutation and 4 or 3 synonymous or non-coding changes respectively.
- pSpCas9(BB)-2A-Puro (PX459) V2.0 was purchased from Addgene (Plasmid ID#62988).
- gRNAs guide RNAs used in this study (SEQ ID NO:7 for EPHB4) is present immediately upstream of a Protospacer Adjacent Motif (PAM) and were designed using the gRNA designer from MIT (http://crispr.mit.edu/).
- PAM Protospacer Adjacent Motif
- hEPHB4-F SEQ ID NO: 8
- hEPHB4-R SEQ ID NO: 9
- hPIK3R6-F SEQ ID NO: 10
- the synthesized ssODNs 180 bases, SEQ ID NO. : 12) were purchased from IDT.
- pcDNA3 -FLAG mTOR wt containing the human wild-type mTOR cDNA with a FLAG tag at the N-terminal (TD# 26603) was obtained from Addgene.
- This expression vector carrying the wild-type mTOR cDNA was used to generate P2273L mTOR mutant with a Q5 Site-Directed Mutagenesis Kit (NEB, Ipswich, MA) according to the instructions of the manufacturer.
- the primers were designed using a template specific mutagenic primer design program.
- the primer sequences were SEQ ID NO: 13 and SEQ ID NO: 14.
- HeLa cells were obtained from American Type Culture Collection (ATCC) and grown at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). HeLa cells were transiently transfected with an empty vector (e.v.), wild-type (wt) or P2273L mutant mTOR expression vectors using the Lipofectamine 2000 transfection reagent per manufacturer's instructions (Invitrogen Life Technologies, CA). Medium was changed 24 h after transfection.
- DMEM Dulbecco's modified Eagle's medium
- FBS fetal bovine serum
- Cell lysates were collected in a 1.5 mL microfuge tube disrupted by vortex and incubated on ice for 5 min. Cell lysates were then centrifuged at 12,000 rpm for 5 min at 4 °C. The supernatants were collected and protein concentrations were measured using a Bradford protein assay kit (Bio-Rad Laboratories, Hercules CA). This cell lysate was used for Western blotting. Western blotting was performed using 10-30 ⁇ g of cell lysates resolved on SDS/PAGE and transferred to a PVDF membrane (Millipore Co., Bedford, MA).
- the membrane was blocked with 5% skim milk/TBS containing 0.1% Tween 20 (TBST) for 1 hour at room temperature and the membrane was then sliced based on the molecular weights.
- Membranes were incubated lh at room temperature (RT) or overnight at 4°C with primary antibodies, including anti-EPHB4, anti- phospho-p70S6K (Cat # 9234, Cell Signaling Technology, Danvers, MA), anti-FLAG (Cat # 2972, Cell Signaling Technology, Danvers MA), or anti-P-actin (Cat # SC-1616R, Santa Cruz Biotechnology) antibodies.
- the mTOR mutant, P2273L resulted in increased phosphorylation of p70S6K (P- p70S6K), as compared with wild-type mTOR or empty vector (e.v.) ( Figure 10), indicative of an enhanced signaling and consistent with a gain-of-function mutation.
- a 12 year old male with severe GLA who had required multiple surgeries to drain and cauterize his chest was found to have the above described ARAF mutation. He had previously been treated with Rapamycin for six months with no effects and continued to have progressive chylus requiring surgery. He subsequently required multiple chest surgeries and was running out of options when the ARAF mutation was identified and therapy with a ERK inhibitor was authorized. Subsequently, he was started on Trametinib (the only MEK inhibitor approved in children and with comparable effects to those of selumetinib and cobimetinib), 1 mg daily and followed monthly for response. His lung function test, which showed severe restrictive lung diseases before, improved overall by 45% (FVC, FEV1) after one month therapy with
- Trametinib was begun. He had no side effects from the Trametinib therapy except possibly some dry skin around his wrists. He also was feeling well, was less winded, and was eating better following Trametinib treatment. Following treatment, he was able to climb a flight of stairs without stopping and shoot hoops outside, neither of which he could do before. Following therapy, his pulse oxygen was normal with the lowest being recorded in the morning (95%) and he went without use of oxygen. His CT chest scan was essentially unchanged following two months on therapy suggesting his disease had not progressed (pulmonary function tests are much more sensitive in measuring response to therapy than are radiographic measures).
- the data presented in this application identify a novel splice-altering mutation in EPHB4 that was identified for the first time in six patients with complex lymphatic anomalies, including GLA and venous stasis, and resulted in increased mTORCl activity.
- a recurrent ARAF mutation was also found in the conserved phosphorylation site with presumable gain-of-function effect.
- ARAF activation in turn upregulates ring finger and FYVE- like domain containing E3 ubiquitin protein ligase (RFFL), leading to polyubiquitylation and destabilization of proline rich 5 like (PRR5L), a component of mTORC2 and suppressor of protein kinase C (PKC) phosphorylation, to achieve persistent PKC activation which leads to cell pro-growth and pro-migration.
- RFFL E3 ubiquitin protein ligase
- PRR5L proline rich 5 like
- PKC protein kinase C
- Lymphatic and other vascular malformative/overgrowth disorders are caused by somatic mutations in PIK3CA. J Pediatr 166: 1048-1054 el 041-1045
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3034786A CA3034786A1 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| US16/327,060 US11401553B2 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| DK17847498.7T DK3506899T3 (da) | 2016-08-31 | 2017-08-30 | Præparater og fremgangsmåder til diagnosticering og behandling af lymfesystemlidelser |
| AU2017319507A AU2017319507B2 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| JP2019511562A JP7202287B2 (ja) | 2016-08-31 | 2017-08-30 | リンパ系疾患の診断及び治療のための組成物及び方法 |
| EP21214113.9A EP4023769A1 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| EP17847498.7A EP3506899B1 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| ES17847498T ES2906333T3 (es) | 2016-08-31 | 2017-08-30 | Composiciones y procedimientos para el diagnóstico y tratamiento de trastornos del sistema linfático |
| US17/815,647 US12509729B2 (en) | 2016-08-31 | 2022-07-28 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| JP2022206535A JP2023052057A (ja) | 2016-08-31 | 2022-12-23 | リンパ系疾患の診断及び治療のための組成物及び方法 |
| AU2024201122A AU2024201122A1 (en) | 2016-08-31 | 2024-02-21 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| JP2024169918A JP2025016454A (ja) | 2016-08-31 | 2024-09-30 | リンパ系疾患の診断及び治療のための組成物及び方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662382147P | 2016-08-31 | 2016-08-31 | |
| US62/382,147 | 2016-08-31 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/327,060 A-371-Of-International US11401553B2 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| US17/815,647 Continuation US12509729B2 (en) | 2016-08-31 | 2022-07-28 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2018045078A2 true WO2018045078A2 (en) | 2018-03-08 |
| WO2018045078A3 WO2018045078A3 (en) | 2019-04-25 |
Family
ID=61309356
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/049453 Ceased WO2018045078A2 (en) | 2016-08-31 | 2017-08-30 | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US11401553B2 (https=) |
| EP (2) | EP4023769A1 (https=) |
| JP (3) | JP7202287B2 (https=) |
| AU (2) | AU2017319507B2 (https=) |
| CA (1) | CA3034786A1 (https=) |
| DK (1) | DK3506899T3 (https=) |
| ES (1) | ES2906333T3 (https=) |
| WO (1) | WO2018045078A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020051580A1 (en) * | 2018-09-07 | 2020-03-12 | The Children's Hospital Of Philadelphia | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| US12070468B2 (en) * | 2020-05-14 | 2024-08-27 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for the treatment and prevention of vascular malformations |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021231814A1 (en) * | 2020-05-14 | 2021-11-18 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for the treatment and prevention of vascular malformations |
| WO2023229605A1 (en) * | 2022-05-27 | 2023-11-30 | Avalo Therapeutics, Inc. | Methods and treatment for complex lymphatic malformations |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9212416D0 (en) | 1992-06-11 | 1992-07-22 | Medical Res Council | Reversible binding substances |
| US6057098A (en) | 1997-04-04 | 2000-05-02 | Biosite Diagnostics, Inc. | Polyvalent display libraries |
| US20080131887A1 (en) * | 2006-11-30 | 2008-06-05 | Stephan Dietrich A | Genetic Analysis Systems and Methods |
| US9018912B2 (en) | 2011-05-17 | 2015-04-28 | Inphi Corporation | System and method for managing parallel-connected battery cells |
| US10835513B2 (en) | 2013-06-28 | 2020-11-17 | The Regents Of The University Of California | Methods and treatments for the learning and memory deficits associated with Noonan syndrome |
| US10307370B2 (en) | 2013-10-08 | 2019-06-04 | AI Therapeutics, Inc. | Rapamycin for the treatment of lymphangioleiomyomatosis |
| JP6678583B2 (ja) | 2013-12-20 | 2020-04-22 | バイオメッド バレー ディスカバリーズ,インコーポレイティド | 2型mek阻害剤およびerk阻害剤の組み合わせを用いるがん処置 |
| JP6429306B2 (ja) * | 2014-03-26 | 2018-11-28 | 国立大学法人東北大学 | Cfc症候群モデルマウスの作製とその治療法の確立 |
| WO2018126192A1 (en) | 2016-12-30 | 2018-07-05 | Children's Medical Center Corporation | Map2k1 (mek1) as a therapeutic target for arteriovenous malformations and associated disorders |
-
2017
- 2017-08-30 DK DK17847498.7T patent/DK3506899T3/da active
- 2017-08-30 EP EP21214113.9A patent/EP4023769A1/en active Pending
- 2017-08-30 CA CA3034786A patent/CA3034786A1/en active Pending
- 2017-08-30 WO PCT/US2017/049453 patent/WO2018045078A2/en not_active Ceased
- 2017-08-30 US US16/327,060 patent/US11401553B2/en active Active
- 2017-08-30 AU AU2017319507A patent/AU2017319507B2/en active Active
- 2017-08-30 JP JP2019511562A patent/JP7202287B2/ja active Active
- 2017-08-30 ES ES17847498T patent/ES2906333T3/es active Active
- 2017-08-30 EP EP17847498.7A patent/EP3506899B1/en active Active
-
2022
- 2022-07-28 US US17/815,647 patent/US12509729B2/en active Active
- 2022-12-23 JP JP2022206535A patent/JP2023052057A/ja not_active Withdrawn
-
2024
- 2024-02-21 AU AU2024201122A patent/AU2024201122A1/en active Pending
- 2024-09-30 JP JP2024169918A patent/JP2025016454A/ja active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020051580A1 (en) * | 2018-09-07 | 2020-03-12 | The Children's Hospital Of Philadelphia | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| CN112996542A (zh) * | 2018-09-07 | 2021-06-18 | 费城儿童医院 | 用于淋巴系统病症的诊断和治疗的组合物和方法 |
| JP2022500020A (ja) * | 2018-09-07 | 2022-01-04 | ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィアThe Children’S Hospital Of Philadelphia | リンパ系疾患の診断および治療のための組成物および方法 |
| JP7565264B2 (ja) | 2018-09-07 | 2024-10-10 | ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィア | リンパ系疾患の診断および治療のための組成物および方法 |
| AU2019336798B2 (en) * | 2018-09-07 | 2025-07-17 | The Children's Hospital Of Philadelphia | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| US12365946B2 (en) | 2018-09-07 | 2025-07-22 | The Children's Hospital Of Philadelphia | Compositions and methods for the diagnosis and treatment of lymphatic system disorders |
| US12070468B2 (en) * | 2020-05-14 | 2024-08-27 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for the treatment and prevention of vascular malformations |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2019533987A (ja) | 2019-11-28 |
| EP3506899A2 (en) | 2019-07-10 |
| US12509729B2 (en) | 2025-12-30 |
| EP4023769A1 (en) | 2022-07-06 |
| JP2023052057A (ja) | 2023-04-11 |
| AU2017319507A1 (en) | 2019-03-14 |
| JP7202287B2 (ja) | 2023-01-11 |
| DK3506899T3 (da) | 2022-03-07 |
| EP3506899A4 (en) | 2020-05-20 |
| US11401553B2 (en) | 2022-08-02 |
| ES2906333T3 (es) | 2022-04-18 |
| JP2025016454A (ja) | 2025-02-04 |
| AU2024201122A1 (en) | 2024-03-14 |
| US20230048706A1 (en) | 2023-02-16 |
| WO2018045078A3 (en) | 2019-04-25 |
| CA3034786A1 (en) | 2018-03-08 |
| EP3506899B1 (en) | 2021-12-15 |
| AU2017319507B2 (en) | 2023-11-23 |
| US20200056238A1 (en) | 2020-02-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12509729B2 (en) | Compositions and methods for the diagnosis and treatment of lymphatic system disorders | |
| JP6815372B2 (ja) | 疾患危険因子を同定する方法 | |
| US9279158B2 (en) | Compositions and methods useful for the treatment and diagnosis of inflammatory bowel disease | |
| JP2025020109A (ja) | リンパ系疾患の診断および治療のための組成物および方法 | |
| JP2011083279A (ja) | 皮膚炎症性疾患の診断方法 | |
| Talbot et al. | Sonic hedgehog medulloblastomas are dependent on Netrin-1 for survival | |
| US20140377379A1 (en) | Method for prognosing the age-at-onset of huntington's disease | |
| HK40079819A (en) | Compositions and methods for the diagnosis and treatment of lymphatic system disorders | |
| US7807362B2 (en) | Diagnosis of attention deficit hyperactivity disorder | |
| HK40064127A (en) | Compositions and methods for the diagnosis and treatment of lymphatic system disorders | |
| WO2026006238A1 (en) | Long non-coding rna and n6-methyladenosine in tyrosine kinase inhibitor resistance | |
| Arcaroli | Genetic variation involving IRAK-1 and EC-SOD in sepsis induced acute lung injury |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17847498 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 3034786 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019511562 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2017319507 Country of ref document: AU Date of ref document: 20170830 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2017847498 Country of ref document: EP Effective date: 20190401 |