WO2018031694A1 - Chimeric poxvirus compositions and uses thereof - Google Patents
Chimeric poxvirus compositions and uses thereof Download PDFInfo
- Publication number
- WO2018031694A1 WO2018031694A1 PCT/US2017/046163 US2017046163W WO2018031694A1 WO 2018031694 A1 WO2018031694 A1 WO 2018031694A1 US 2017046163 W US2017046163 W US 2017046163W WO 2018031694 A1 WO2018031694 A1 WO 2018031694A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus strain
- nucleic acid
- vaccinia virus
- acid sequence
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/275—Poxviridae, e.g. avipoxvirus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/74—Inducing cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24132—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24141—Use of virus, viral particle or viral elements as a vector
- C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24151—Methods of production or purification of viral material
Definitions
- a method of inhibiting cell proliferation of a cell including contacting a cell with a chimeric poxvirus as described herein.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 or SEQ ID NO:2, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 or SEQ ID NO:2, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; (iii) one or more nucleic acid binding sequences; or (iv) a detectable moiety-encoding nucleic acid sequence.
- FIG. 1 Novel chimeric orthopoxvirus isolates #33 (SEQ ID NO: l) and #17 (SEQ ID NO:3) show superior cancer cell killing capability compared to the parental individual wild-type virus strains and the control viruses GLV-lh68 and OncoVEX GFP.
- FIGS. 13A-13L A viral replication curve was performed on PANC-1, MiaPaCa-2, BxPC-3, SU.86.86, Capan-1, and AsPC-1 cancer cell lines by plating cells at 5xl0 5 cells per well in 2mL RPMI, 10% FBS, 1% Antibiotic-Antimycotic solution for 24 hours in triplicate. Media was then aspirated and #33, OncoVEX GFP, GLV-lh68, or #189 was added at a multiplicity of infection (MOI) 0.01 in 500 ⁇ . RPMI, 2.5% FBS, 1% Antibiotic-Antimycotic solution for 1 hour shaking every 20 minutes.
- MOI multiplicity of infection
- Antibiotic- Antimycotic solution for 24 hours. 20 ⁇ of the virus, either #33, #33-(SE)hNIS, #33- (H5)Emerald, OncoVEX , GLV-lh68, or #189, was then added at a multiplicity of infection (MOI) of 1, 0.1, and 0.01. A daily cell viability assay was performed by adding 20 ⁇ . of CellTiter 96 Aqueous One Solution Cell Proliferation Assay to all wells and taking a
- FIG. 19A-19B A cytotoxicity assay was performed on the LoVo cancer cell line by plating cells at 3xl0 3 per well in ⁇ F-12K media, 5% FBS, 1% Antibiotic-Antimycotic solution for 24 hours. 20 ⁇ , of the virus, either #33, #33-(SE)hNIS, #33-(H5)Emerald,
- FIG. 24 Fourteen athymic Nude-Fox ⁇ /TM female nude mice (Envigo, Indianapolis, FN) were implanted with 5 x 10 6 cells per bilateral flank tumors of HT-29. Once tumor dimensions reached approximately 200mm 3 , both tumors were injected with 50 ⁇ . of PBS (4 mice), #33 (5 mice), or #33-(H5)Fluc2 (5 mice) at approximately lxl0 A 5 PFU/dose. Net percent weight change and percent change of tumors were recorded twice weekly for 42 days.
- FIG. 26 Nineteen athymic Nude-Fox ⁇ /TM female nude mice (Envigo, Indianapolis, IN) were implanted with 5 x 10 6 bilateral flank tumors of HCT-116. Once tumor dimensions reached approximately 200mm 3 , both tumors were injected with 50 ⁇ . of PBS (2 mice), #33 (3 mice), #33-(SE)hNIS or #33-(H5)Fluc2 at approximately lxlO 5 PFU/dose. Net percent weight change and percent change of the tumors were recorded twice weekly for 42 days.
- FIG 25 shows HCT- 116 tumor percent change over time.
- FIG. 29 GFP-images across days in A549 xenograft model after single injection of 1000 PFUs of virus (#33-(H5)Emerald, GLV-lh68, or OncoVEX GFP intra-tumorally) as indicated in the right tumor.
- the indicated viruses #33, #33-(H5)Emerald, GLV-lh68, OncoVEX GFP , T-VECTM
- FIG. 36 shows PFU/g of tissue (ovaries) for each virus. Not detected (ND).
- FIG. 38 shows PFU/mL of blood for each virus injected. Not detected (ND).
- FIG. 38 The chimeric virus #33 is more potent than the parental viruses in killing lung cancer cells (A549). Cytotoxicity assay: 5000 cells were plated in each well of a 96-well plate. Next day, cells were infected with the chimeric virus #33 or the parental viruses at the indicated multiplicity of infection (MO I) or were mock-infected. Cell viability was determined using CellTiter96AQ ue0 us One Solution (Promega; Cat#G3581), 72 hours post-infection. Survival of infected cells was calculated relative to that of mock-infected cells.
- MO I multiplicity of infection
- FIG. 41 Virus titer in injected and un-injected tumors 7 days post-infection.
- A549, human lung cancer cells were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get a 5xl0 6 cells per 100 ⁇ L ⁇ .
- 100 ⁇ L ⁇ of the cell suspension was injected sub-cutaneously on each side of upper flank of athymic nude mice to generate 2 tumors per mouse.
- FIG. 42 Biod-distribution of viruses.
- A549 human lung cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get a 5xl0 6 cells per 100 ⁇ ⁇ .
- Six days after after virus injection tumors as well as normal organs were harvested. Harvested tissues were weighed, chopped in small pieces and homogenized in 1 ml PBS using the Bullet Blender Gold homogenizer.
- FIG. 43 Virus titer in the blood of injected mice. Blood was collected from the facial vein of A549 tumor-bearing mice at different time points after intra-tum oral injection of 1000 pfu of the indicted viruses. Virus in the blood samples were titered using the standard plaque assay technique. No detectable virus in urine for up to day 10 post-injection. [0061] FIG. 44. Survival of mice after virus injection. A549, human lung cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get a 5xl0 6 cells per 100 ⁇ ⁇ .
- FIG. 46B A549 cells were infected with #33 or #33-(H5) at an MOI 0.03 pfu and fold increase in the virus titer relative to input virus was determined at indicated time points.
- FIGS. 54A-54B Average tumor volume for injected and un-injected tumors.
- FIGS. 54 A and 54B show average tumor volume for injected and un-injected tumors, repectively.
- FIG. 55 Virus titers in organs 7 days post-infection.
- OVCAR8 human ovarian cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get a 5xl0 6 cells per 100 ⁇ L ⁇ .
- chimeric poxvirus compositions which combine favorable features from different virus species to create novel hybrid chimeric poxviruses, which are superior to individual wild-type viruses.
- Applicants have generated chimeric poxviruses from different genera. Chimeric orthopoxvirus and parapoxvirus isolates showed superior killing capacity in a panel of the NCI 60 cancer cell lines compared to their parental individual wild-type viruses. Additionally, taking advantage of the fact that members from different genera of the poxviridae family are antigenically distinct the potent chimeric orthopoxvirus and the potent chimeric parapoxvirus generated in this study can be potentially combined into the same treatment regimen to achieve the maximum therapeutic efficacy.
- a "siRNA,” “small interfering RNA,” “small RNA,” or “RNAi” as provided herein refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when expressed in the same cell as the gene or target gene.
- the complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity.
- exogenous refers to a molecule or substance (e.g., a compound, nucleic acid or protein) that originates from outside a given cell or organism.
- an "exogenous promoter” as referred to herein is a promoter that does not originate from the cell or organism it is expressed by.
- endogenous or endogenous promoter refers to a molecule or substance that is native to, or originates within, a given cell or organism.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- thymidine kinase gene refers to the any of the recombinant or naturally-occurring forms of the thymidine kinase gene or variants or homologs thereof that code for a thymidine kinase polypeptide capable of maintaining the activity of the thymidine kinase polypeptide (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to thymidine kinase polypeptide).
- the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100%) nucleic acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous nucleic acid portion) compared to a naturally occurring thymidine kinase gene.
- the thymidine kinase gene is substantially identical to the nucleic acid sequence corresponding to position 83422-83955 of the nucleic acid sequence identified by Accession No. DQ121394 or a variant or homolog having substantial identity thereto.
- the thymidine kinase gene includes the nucleic acid sequence of SEQ ID NO:4.
- the F14.5L gene is the nucleic acid sequence of SEQ ID NO:6. In embodiments, the F14.5L gene is mutated. In embodiments, the F14.5L gene is partially deleted. In embodiments, the F14.5L gene includes the nucleic acid sequence of SEQ ID NO:7. In embodiments, the F14.5L gene includes the nucleic acid sequence of SEQ ID NO:7.
- E9L gene refers to the any of the recombinant or naturally-occurring forms of the DNA polymerase gene or variants or homologs thereof that code for a DNA polymerase polypeptide capable of maintaining the activity of the DNA polymerase polypeptide (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%o, 99%) or 100%> activity compared to DNA polymerase polypeptide).
- the variants or homologs have at least 90%, 95%, 96%, 97%), 98%), 99%) or 100%) nucleic acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous nucleic acid portion) compared to a naturally occurring mCherry gene.
- the mCherry gene is substantially identical to the nucleic acid sequence corresponding to position 1073-1783 of the nucleic acid sequence identified by Accession No. KX446949 or a variant or homolog having substantial identity thereto.
- the mCherry gene includes the nucleic acid sequence of SEQ ID NO: 16.
- the mCherry gene is the nucleic acid sequence of SEQ ID NO: 16.
- the SE promoter includes the nucleic acid sequence of SEQ ID NO: 19. In embodiments, the SE promoter is the nucleic acid sequence of SEQ ID NO: 19.
- the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous nucleic acid portion) compared to a naturally occurring 1 IK promoter.
- the 1 IK promoter is substantially identical to the nucleic acid sequence corresponding to position 40734-40771 of the nucleic acid sequence identified by Accession No. KF 179385 or a variant or homolog having substantial identity thereto.
- the 1 IK promoter includes the nucleic acid sequence of SEQ ID NO:20.
- the 1 IK promoter is the nucleic acid sequence of SEQ ID NO:20.
- the epitope of an antibody is the region of its antigen to which the antibody binds.
- Antibodies can also be heteroconjugates, e.g., two covalently joined antibodies, or immunotoxins (see, e.g., U.S. Patent No. 4,676,980 , WO 91/00360; WO 92/200373; and EP 03089).
- Contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including
- the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture.
- contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be, for example, an antibody domain as described herein and an antibody-binding domain.
- contacting includes, for example, allowing an antibody domain as described herein to interact with an antibody-binding domain.
- cancer refers to all types of cancer, neoplasm or malignant tumors found in mammals (e.g. humans), including leukemia, carcinomas and sarcomas.
- Exemplary cancers that may be treated with a compound or method provided herein include breast cancer, colon cancer, kidney cancer, leukemia, lung cancer, melanoma, ovarian cancer, prostate cancer, pancreatic cancer, brain cancer, liver cancer, gastric cancer or a sarcoma.
- leukemia refers broadly to progressive, malignant diseases of the blood- forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or aleukemic (subleukemic).
- hemocytoblastic leukemia histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocyte leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myelocytic leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia,
- sarcoma generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance.
- Sarcomas that may be treated with a compound or method provided herein include a chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sar
- melanoma is taken to mean a tumor arising from the melanocytic system of the skin and other organs.
- Melanomas that may be treated with a compound or method provided herein include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma.
- the term "associated” or “associated with” in the context of a substance or substance activity or function associated with a disease is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
- a disease e.g., cancer, asthma, ulcerative colitis, irritable bowel syndrome, arthritis, uveitis, pyoderma gangrenosum, or erythema nodosum
- a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
- immune checkpoint proteins may inhibit (decrease) an immune response.
- inhibitory checkpoint molecules include, but are not limited to, adenosine A2A receptor (A2AR), B7-H3, B7-H4, BTLA, CTLA-4, indoleamine 2,3- di oxygenase (IDO), killer immunoglobulin-like receptors (KIR), LAG3, PD-1, TIM-3, and V- domain immunoglobulin suppressor of T-cell activation (VISTA) protein.
- A2AR adenosine A2A receptor
- B7-H3, B7-H4, BTLA CTLA-4
- IDO indoleamine 2,3- di oxygenase
- KIR killer immunoglobulin-like receptors
- LAG3, PD-1 LAG3, PD-1
- TIM-3 TIM-3
- V- domain immunoglobulin suppressor of T-cell activation (VISTA) protein V- domain immunoglobulin suppressor of T-cell activation
- the checkpoint inhibitor is an antibody. In embodiments, the checkpoint inhibitor is an antibody fragment. In embodiments, the checkpoint inhibitor is an antibody variant. In embodiments, the checkpoint inhibitor is a scFv. In embodiments, the checkpoint inhibitor is an anti-CTLA-4 antibody. In embodiments, the checkpoint inhibitor is an anti-PDl antibody. In embodiments, the checkpoint inhibitor is an anti-PD-Ll antibody. In embodiments, the checkpoint inhibitor is an anti-LAG-3 antibody. In embodiments, the checkpoint inhibitor is an anti-IgGlk antibody. In embodiments, the checkpoint inhibitor is an anti-CD25 antibody. In embodiments, the checkpoint inhibitor is an anti-IL2R antibody. In embodiments, the checkpoint inhibitor forms part of an oncolytic virus.
- Non-limiting examples of checkpoint inhibitors include ipilimumab, pembrolizumab, nivolumab, talimogene laherparepvec, durvalumab, daclizumab, avelumab, and atezolizumab.
- a "control" or “standard control” refers to a sample, measurement, or value that serves as a reference, usually a known reference, for comparison to a test sample, measurement, or value.
- a test sample can be taken from a patient suspected of having a given disease (e.g. cancer) and compared to a known normal (non-diseased) individual (e.g. a standard control subject).
- a standard control can also represent an average measurement or value gathered from a population of similar individuals (e.g. standard control subjects) that do not have a given disease (i.e. standard control population), e.g., healthy individuals with a similar medical background, same age, weight, etc.
- Standard controls are also valuable for determining the significance (e.g. statistical significance) of data. For example, if values for a given parameter are widely variant in standard controls, variation in test samples will not be considered as significant.
- diagnosis refers to a relative probability that a disease (e.g. cancer) is present in the subject.
- prognosis refers to a relative probability that a certain future outcome may occur in the subject with respect to a disease state.
- the terms “synergy”, “synergism”, “synergistic”, “combined synergistic amount”, and “synergistic therapeutic effect” refer to a measured effect of the chimeric poxviruses administered in combination where the measured effect is greater than the sum of the individual effects of each of the chimeric poxviruses administered alone as a single agent.
- a synergistic amount may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2,
- virus or "virus particle” are used according to its plain ordinary meaning within Virology and refers to a virion including the viral genome (e.g. DNA, RNA, single strand, double strand), viral capsid and associated proteins, and in the case of enveloped viruses (e.g. herpesvirus, poxvirus), an envelope including lipids and optionally components of host cell membranes, and/or viral proteins.
- viral genome e.g. DNA, RNA, single strand, double strand
- enveloped viruses e.g. herpesvirus, poxvirus
- an envelope including lipids and optionally components of host cell membranes, and/or viral proteins.
- cervidpoxvirus gammaentomopoxvirus, leporipoxvirus, suipoxvirus, molluscipoxvirus, crocodylidpoxvirus, alphaentomopoxvirus, capripoxvirus, orthopoxvirus, avipoxvirus, and parapoxvirus).
- the poxvirus is an orthopoxvirus (e.g., smallpox virus, vaccinia virus, cowpox virus, monkeypox virus), parapoxvirus (e.g., orf virus, pseudocowpox virus, bovine popular stomatitis virus), yatapoxvirus (e.g., tanapox virus, yaba monkey tumor virus) or molluscipoxvirus (e.g., molluscum contagiosum virus).
- orthopoxvirus e.g., smallpox virus, vaccinia virus, cowpox virus, monkeypox virus
- parapoxvirus e.g., orf virus, pseudocowpox virus, bovine popular stomatitis virus
- yatapoxvirus e.g., tanapox virus, yaba monkey tumor virus
- molluscipoxvirus e.g., molluscum contagiosum virus
- Rabbitpox virus strain Utrecht may refer to variants having mutated amino acid residues that modulate (e.g. increase or decrease when compared to rabbitpox virus strain Utrecht) rabbitpox virus strain Utrecht activity, expression, cellular targeting, or infectivity. Rabbitpox virus strain Utrecht may be modified as described herein. In embodiments, the rabbitpox virus strain Utrecht refers to the virus strain identified by ATCC reference number ATCC VR-1591TM, variants or homologs thereof.
- the rabbitpox virus strain Utrecht refers to the virus strain identified by Taxonomy reference number 45417, variants or homologs thereof.
- the term "vaccinia virus strain WR" is used according to its common, ordinary meaning and refers to virus strains of the same or similar names and functional fragments and homologs thereof. The term includes recombinant or naturally occurring forms of vaccinia virus strain WR or variants thereof that maintain vaccinia virus strain WR activity (e.g. within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%).
- Vaccinia virus strain WR may refer to variants having mutated amino acid residues that modulate (e.g. increase or decrease when compared to vaccinia virus strain WR) vaccinia virus strain WR activity, expression, cellular targeting, or infectivity.
- Vaccinia virus strain WR may be modified as described herein.
- the vaccinia virus strain IHD refers to the virus strain identified by ATCC reference number ATCC VR-156TM, variants or homologs thereof. In embodiments, the vaccinia virus strain IHD refers to the virus strain identified by Taxonomy reference number 10251, variants or homologs thereof.
- the term "vaccinia virus strain Elstree" is used according to its common, ordinary meaning and refers to virus strains of the same or similar names and functional fragments and homologs thereof. The term includes recombinant or naturally occurring forms of vaccinia virus strain Elstree or variants thereof that maintain vaccinia virus strain Elstree activity (e.g.
- Vaccinia virus strain CL may refer to variants having mutated amino acid residues that modulate (e.g. increase or decrease when compared to vaccinia virus strain CL) vaccinia virus strain CL activity, expression, cellular targeting, or infectivity. Vaccinia virus strain CL may be modified as described herein.
- the vaccinia vims strain CL refers to the vims strain identified by ATCC reference number ATCC VR-1774TM, variants or homologs thereof.
- vaccinia vims strain Lederle-Chorioallantoic or variants thereof whose genome has sequence identity to the vaccinia vims strain Lederle-Chorioallantoic genome (e.g. about 65%>, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the vaccinia vims strain Lederle-Chorioallantoic genome).
- Vaccinia vims strain Lederle-Chorioallantoic may refer to variants having mutated amino acid residues that modulate (e.g.
- Orf vims strain NZ2 may refer to variants having mutated amino acid residues that modulate (e.g. increase or decrease when compared to orf vims strain NZ2) orf vims strain NZ2 activity, expression, cellular targeting, or infectivity. Orf vims strain NZ2 may be modified as described herein.
- the orf vims strain NZ2 refers to the vims strain identified by ATCC reference number ATCC VR-1548TM, variants or homologs thereof.
- the orf vims strain NZ2 refers to the vims strain identified by Taxonomy reference number 10259, variants or homologs thereof.
- pseudocowpox vims strain TJS or variants thereof that maintain pseudocowpox vims strain TJS activity (e.g. within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%).
- the term includes recombinant or naturally occurring forms of pseudocowpox vims strain TJS or variants thereof whose genome has sequence identity to the pseudocowpox vims strain TJS genome (e.g. about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the pseudocowpox vims strain TJS genome).
- Pseudocowpox vims strain TJS may refer to variants having mutated amino acid residues that modulate (e.g.
- pseudocowpox vims strain TJS refers to the vims strain identified by ATCC reference number ATCC VR-634TM, variants or homologs thereof.
- cowpox virus strain Brighton is cowpox virus strain Brighton ATCC VR-302TM.
- raccoonpox virus strain Herman is raccoonpox virus strain Herman ATCC VR-838TM.
- rabbitpox virus strain Utrecht is rabbitpox virus strain Utrecht ATCC VR-1591TM.
- vaccinia virus strain WR is vaccinia virus strain WR ATCC VR-1354TM.
- vaccinia virus strain IHD is vaccinia virus strain IHD ATCC VR-156TM.
- vaccinia virus strain Elstree is vaccinia virus strain Elstree ATCC VR-1549TM.
- vaccinia virus strain CL is vaccinia virus strain CL ATCC VR-1774TM.
- vaccinia virus strain Lederle-Chorioallantoic is vaccinia virus strain Lederle-Chorioallantoic ATCC VR-118TM.
- vaccinia virus strain AS is vaccinia virus strain AS ATCC VR-2010TM.
- orf virus strain NZ2 is orf virus strain NZ2 ATCC VR-1548TM.
- pseudocowpox virus strain TJS is
- the cowpox virus strain Brighton refers to the virus strain identified by Taxonomy reference number 265872, variants or homologs thereof.
- "comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “ includes,” “including,” and the like.
- “Consisting essentially of or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 or SEQ ID NO:2, wherein the nucleic acid sequence includes nucleic acid fragments from at least two poxvirus strains selected from the group including cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the chimeric poxviruses as described herein may include transgenes.
- a transgene refers to a nucleic acid sequence that originates from outside a given cell, organism or virus.
- a transgene as provided herein is therefore not native to, or originates within a poxvirus.
- a transgene as provided may encode a protein or may be a non-coding nucleic acid sequence.
- Transgenes provided herein may include anti-cancer nucleic acid sequences (e.g., nucleic acid binding sequences and nucleic acid sequences that encode for polypeptides useful for the treatment of cancer) or detectable moiety-encoding nucleic acid sequences.
- the chimeric poxvirus described herein includes one or more anti-cancer nucleic acid sequences or a detectable moiety-encoding nucleic acid sequence. In embodiments, the chimeric poxvirus described herein includes one or more anti-cancer nucleic acid sequences and a detectable moiety-encoding nucleic acid sequence.
- the nucleic acid sequence has a sequence identity of at least 71% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 72%) to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 73% to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of at least 74% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 75% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 76% to SEQ ID NO: 1.
- the nucleic acid sequence has a sequence identity of at least 77% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 78% to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of at least 79% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 80% to SEQ ID NO: l .
- the nucleic acid sequence has a sequence identity of at least 87% to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of at least 88% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 89%> to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 90% to SEQ ID NO: 1.
- the nucleic acid sequence has a sequence identity of at least 91% to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of at least 92%) to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 93%) to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 94% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 95% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of at least 96% to SEQ ID NO: 1.
- the nucleic acid sequence has a sequence identity of 71 % to SEQ ID NO: 1
- nucleic acid sequence has a sequence identity of 72% to SEQ ID NO: l .
- sequence identity of 72% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 74% to SEQ ID NO: l .
- sequence identity of 74% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 75% to SEQ ID NO: l .
- sequence identity of 75% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 76% to SEQ ID NO: l .
- sequence identity of 76% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 77% to SEQ ID NO: l .
- sequence identity of 77% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 78% to SEQ ID NO: l .
- sequence identity of 78% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 79% to SEQ ID NO: l .
- sequence identity of 79% to SEQ ID NO: l
- nucleic acid sequence has a sequence identity of 80% to SEQ ID NO: l .
- sequence identity of 80% to SEQ ID NO: l .
- the nucleic acid sequence has a sequence identity of 81 % to SEQ ID NO: 1
- nucleic acid sequence has a sequence identity of 82% to SEQ ID NO: l .
- sequence identity of 82% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 86%> to SEQ ID NO: l .
- sequence identity of 86%> to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 87% to SEQ ID NO: l .
- sequence identity of 87% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 88%> to SEQ ID NO: l .
- sequence identity of 88%> to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 89%> to SEQ ID NO: l .
- sequence identity of 89%> to SEQ ID NO: l .
- the nucleic acid sequence has a sequence identity of 91 % to SEQ ID NO: 1
- nucleic acid sequence has a sequence identity of 93% to SEQ ID NO: l .
- sequence identity 93% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 95% to SEQ ID NO: l .
- sequence identity 95% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 96% to SEQ ID NO: l .
- sequence identity 96% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 97% to SEQ ID NO: l .
- sequence identity 97% to SEQ ID NO: l .
- nucleic acid sequence has a sequence identity of 98% to SEQ ID NO: l .
- sequence identity 98% to SEQ ID NO: l .
- nucleic acid sequence is the sequence of SEQ ID NO: l .
- the nucleic acid sequence has a sequence identity of 71 % to SEQ ID NO: 1
- nucleic acid sequence has a sequence identity of 72% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 73% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 74% to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of 76% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 77% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 78% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 79% to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of 81 % to SEQ ID NO: 1
- nucleic acid sequence has a sequence identity of 82% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of 83% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 84%> to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 85%> to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 86%> to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 89%> to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of 91 % to SEQ ID NO: 1
- nucleic acid sequence has a sequence identity of 94% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 95% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 96% to SEQ ID NO:2.
- nucleic acid sequence has a sequence identity of 98% to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of about 71% to
- the nucleic acid sequence has a sequence identity of about 72% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 73%) to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 74%) to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 75% to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of about 76% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 77% to SEQ ID NO: l .
- the nucleic acid sequence has a sequence identity of about 78% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 79% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 80% to SEQ ID NO: 1. [0175] In embodiments, the nucleic acid sequence has a sequence identity of about 81% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 82% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 83%) to SEQ ID NO: l .
- the nucleic acid sequence has a sequence identity of about 84%) to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of about 85%o to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 86%> to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 87% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 88%> to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 89%> to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of about 90% to SEQ ID NO: 1.
- the nucleic acid sequence has a sequence identity of about 97% to SEQ ID NO: l . In embodiments, the nucleic acid sequence has a sequence identity of about 98%> to SEQ ID NO: 1. In embodiments, the nucleic acid sequence has a sequence identity of about 99% to SEQ ID NO: 1.
- the nucleic acid sequence has a sequence identity of about 71% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 72% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 73%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 74%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 75%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 76% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 77% to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of about 78% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 79% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 80%> to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of about 81%> to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 82%> to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 83%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 84%o to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 85%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 86%> to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 87% to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of about 88%> to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 89%> to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 90% to SEQ ID NO:2.
- the nucleic acid sequence has a sequence identity of about 91% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 92% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 93%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 94% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 95%) to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 96% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 97% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 98% to SEQ ID NO:2. In embodiments, the nucleic acid sequence has a sequence identity of about 99% to SEQ ID NO:2.
- the nucleic acid sequence may have a sequence identity of at least 70%, and the nucleic acid sequence having at least 70% sequence identity may be contiguous.
- the nucleic acid sequence has a sequence identity of at least 70%, and the nucleic acid sequence having at least 70% sequence identity is a non-contiguous sequence.
- a "noncontiguous sequence" as provided herein refers to a sequence including one or more sequence fragments having no sequence identity to SEQ ID NO: 1 or SEQ ID NO:2.
- the non-contiguous sequence is a sequence including a first sequence fragment having at least 70% sequence identity to SEQ ID NO: 1 or SEQ ID NO:2 connected to a second sequence fragment having at least 70% sequence identity to SEQ ID NO: 1 or SEQ ID NO:2 through a sequence fragment having no sequence identity to SEQ ID NO: 1 or SEQ ID NO:2.
- the non-contiguous sequence is a sequence including a plurality of sequence fragments having at least 70% sequence identity to SEQ ID NO: 1 or SEQ ID NO:2 connected through a plurality of sequence fragments having no sequence identity to SEQ ID NO: 1 or SEQ ID NO:2.
- the chimeric poxvirus further includes a nucleotide insertion, deletion or mutation.
- the nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain HID, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and raccoonpox virus strain Herman. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and rabbitpox virus strain Utrecht. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and vaccinia virus strain WR. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and vaccinia virus strain IHD. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and vaccinia virus strain Elstree.
- the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and vaccinia virus strain CL. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and vaccinia virus strain Lederle-Chorioallantoic.
- the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and vaccinia virus strain AS. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and orf virus strain NZ2. In embodiments, the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and vaccinia virus strain WR. In embodiments, the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and vaccinia virus strain IHD. In embodiments, the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and vaccinia virus strain Elstree. In embodiments, the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and vaccinia virus strain CL. In embodiments, the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and vaccinia virus strain Lederle-Chorioallantoic. In
- the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and vaccinia virus strain AS. In embodiments, the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and orf virus strain NZ2. In embodiments, the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR and vaccinia virus strain IHD. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR and vaccinia virus strain Elstree. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR and vaccinia virus strain CL. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR and vaccinia virus strain Lederle-Chorioallantoic. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR and vaccinia virus strain AS.
- the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD and vaccinia virus strain Elstree. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD and vaccinia virus strain CL. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD and vaccinia virus strain Lederle-Chorioallantoic. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD and vaccinia virus strain AS. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD and orf virus strain NZ2. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree and vaccinia virus strain CL. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree and vaccinia virus strain Lederle-Chorioallantoic. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree and vaccinia virus strain AS. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree and orf virus strain NZ2. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL and vaccinia virus strain Lederle-Chorioallantoic. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL and vaccinia virus strain AS. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL and orf virus strain NZ2. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain AS and orf virus strain NZ2. In embodiments, the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain AS and pseudocowpox virus strain TJS. In embodiments, the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from raccoonpox virus strain Herman. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain UTD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from raccoonpox virus strain Herman.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain HID.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 80% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain UTD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic or vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from raccoonpox virus strain Herman. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Lederle-Chorioallantoic or vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 90% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic or vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from raccoonpox virus strain Herman.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain IHD.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 95% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from pseudocowpox virus strain TJS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain UfD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from cowpox virus strain Brighton. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from raccoonpox virus strain Herman.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from rabbitpox virus strain Utrecht. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain WR. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain HID.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain Elstree. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO: 1 and wherein the nucleic acid sequence includes nucleic acid fragments from vaccinia virus strain CL.
- the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from orf virus strain NZ2. In embodiments, the chimeric poxvirus includes a nucleic acid sequence having a sequence identity of at least 98% to SEQ ID NO:2 and wherein the nucleic acid sequence includes nucleic acid fragments from pseudocowpox virus strain TJS.
- the chimeric poxvirus is an oncolytic virus.
- An oncolytic virus as used herein is a virus capable of targeting and eliminating cancer cells.
- the oncolytic virus targets lung cancer cells.
- the oncolytic virus targets ovarian cancer cells.
- the oncolytic virus targets pancreatic cancer cells.
- the miRNA binding sequence forms part of the DNA polymerase gene of the chimeric poxvirus.
- the poxvirus includes a miRNA binding sequence.
- the poxvirus includes a plurality of miRNA binding sequences.
- the plurality of miRNA binding sequences are independently different.
- the plurality of miRNA binding sequences are the same.
- the miRNA binding sequence is about 22 nucleotides in length.
- the miRNA binding sequence is at least 22 nucleotides in length.
- the miRNA binding sequence is 22 nucleotides in length.
- the miRNA binding sequence is about 22 nucleotides in length.
- each of the plurality of miRNA binding sequences is at least 22 nucleotides in length. In embodiments, each of the plurality of miRNA binding sequences is about 22 nucleotides in length. In embodiments, each of the plurality of miRNA binding sequences is 22 nucleotides in length. [0207] In an aspect, provided is an isolated nucleic acid encoding a chimeric poxvirus as described herein. In embodiments, the isolated nucleic acid is SEQ ID NO: 1. In embodiments, the isolated nucleic acid is SEQ ID NO:2.
- the chimeric poxviruses provided herein including embodiments thereof may include transgenes.
- the transgenes included in the chimeric poxvirus provided herein may increase the oncolytic activity of the chimeric poxvirus compared to a chimeric poxvirus lacking said transgene.
- the transgenes may further increase the capability of the chimeric poxvirus to differentially express/replicate in cancer cells relative to healthy (non-cancer) cells.
- the nucleic acid of the chimeric poxvirus includes an anti- cancer nucleic acid sequence, a nucleic acid binding sequence, a detectable moiety-encoding nucleic acid sequence or any combination thereof.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: l or SEQ ID NO:2, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain HTD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; or (iii) a detectable moiety-encoding nucleic acid sequence.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic,and vaccinia virus strain AS; (ii) one or more anti-cancer nucleic acid sequences; or (iii) a detectable moiety-encoding nucleic acid sequence.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:2, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; or (iii) a detectable moiety-encoding nucleic acid sequence.
- anti-cancer nucleic acid sequence or “anti-cancer nucleic acid sequences” refer to nucleic acid sequences having antineoplastic properties and/or the ability to inhibit the growth or proliferation of a cancer cell and/or provide for selective expression of the chimeric poxvirus provided herein including embodiments thereof in a cancer cell relative to a healthy cell. Anti-cancer nucleic acid sequences may inhibit the progression or slow the progression of cancer temporarily or permanently. Examples of anti-cancer nucleic acid sequences include sequences encoding proteins the expression of which directly or indirectly inhibits cancer cell growth.
- an anti-cancer nucleic acid sequence as provided herein may encode a protein, which is expressed at a highler level in a cancer cell relative to a healthy cell (e.g., sodium iodide transporter)).
- an anti-cancer nucleic acid sequence may encode a polypeptide (antibody) capable of de-repressing anti-tumor immune responses (e.g., anti-PD-Ll antibodies or fragments thereof).
- the anticancer nucleic acid sequence includes a nucleic acid sequence capable of increasing
- the expression/replication of a chimeric poxvirus in a cancer cell relative to a healthy cell is decreased in a healthy cell relative to a cancer cell.
- the chimeric poxvirus including the anti-cancer nucleic acid sequence is not expressed at a detectable amount in a healthy cell.
- the anti-cancer nucleic acid sequence is a nucleic acid binding sequence.
- the anti-cancer nucleic acid sequence includes a nucleic acid binding sequence.
- nucleic acid binding sequence refers to a nucleic acid sequence capable of binding (hybridizing) to an at least partially complementary cellular nucleic acid (e.g., DNA, RNA, miRNA), wherein the cellular nucleic acid is present at an increased amount in a healthy cell relative to a cancer cell.
- the nucleic acid binding sequence provided herein may form part of the nucleic acid comprised by the chimeric poxvirus and may be operably linked to a gene of the chimeric poxvirus.
- the chimeric poxvirus gene may be targeted for degradation (hydrolysis), thereby decreasing expression/replication of the chimeric poxvirus.
- the nucleic acid binding sequence is a DNA binding sequence.
- the nucleic acid binding sequence is a RNA binding sequence.
- the nucleic acid binding sequence is a miRNA binding sequence. Therefore, in embodiments, the anti-cancer nucleic acid sequence is a nucleic acid binding sequence.
- the anti-cancer nucleic acid sequence is a DNA binding sequence.
- the anti-cancer nucleic acid sequence is a RNA binding sequence.
- the anti-cancer nucleic acid sequence is a miRNA binding sequence.
- a "detectable moiety-encoding nucleic acid sequence” as used herein refers to a nucleic acid sequence that encodes a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. Detectable moiety-encoding nucleic acid sequences may encode a fluorescent moiety. Non-limiting examples of fluorescent moieties are mCherry, Emerald, and firefly luciferase.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 or SEQ ID NO:2, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; (iii) one or more nucleic acid binding sequences; or (iv) a detectable moiety-encoding nucleic acid sequence.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic, and vaccinia virus strain AS; (ii) one or more anti-cancer nucleic acid sequences; (iii) one or more nucleic acid binding sequences; or (iv) a detectable moiety-encoding nucleic acid sequence.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:2, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti -cancer nucleic acid sequences; (iii) one or more nucleic acid binding sequences; or (iv) a detectable moiety-encoding nucleic acid sequence.
- a chimeric poxvirus including a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:3, wherein the nucleic acid sequence includes: (i) nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic, and vaccinia virus strain AS; (ii) one or more anti-cancer nucleic acid sequences; (iii) one or more nucleic acid binding sequences; or (iv) a detectable moiety-encoding nucleic acid sequence.
- the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) one or more anti-cancer nucleic acid sequences.
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Ch
- the nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the nucleic acid fragments are from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) a detectable moiety-encoding nucleic acid sequence.
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-
- the nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic and vaccinia virus strain AS.
- the nucleic acid fragments are from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; and (iii) a detectable moiety-encoding nucleic acid sequence.
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstre
- the nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the nucleic acid fragments are from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; and (iii) one or more nucleic acid binding sequences.
- the nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the nucleic acid fragments are from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- Anti-cancer nucleic acid sequences may form part of the genome of the chimeric poxvirus provided herein including embodiments thereof.
- the chimeric poxvirus genome contains genes required for poxvirus expression and replication. Genes that are required for chimeric poxvirus expression and replication are referred to herein as "essential genes.” Genes that are not required for expression and replication of the chimeric poxvirus are referred to herein as "non-essential genes.”
- Anti-cancer nucleic acid sequences may be incorporated into the chimeric poxvirus genome through insertion into genes or may be operably linked to genes.
- the gene e.g., non-essential gene
- the one or more anti-cancer nucleic acid sequences form part of a non-essential gene of the chimeric poxvirus.
- the one or more anti-cancer nucleic acid sequences are inserted into a nonessential gene of the chimeric poxvirus.
- the non-essential gene is a thymidine kinase gene.
- the non-essential gene is a J2R gene.
- the nonessential gene is a F14.5L gene.
- the PD-Ll inhibitor is an anti-PD-Ll scFv.
- the anti-PD-Ll scFv includes the sequence of SEQ ID NO: 17.
- the anti-PD-Ll scFv is the sequence of SEQ ID NO: 17.
- the sodium iodide symporter includes the sequence of SEQ ID NO: 13.
- the sodium iodide symporter is the sequence of SEQ ID NO: 13.
- a "PD-Ll " or "PD-Ll protein” as referred to herein includes any of the recombinant or naturally-occurring forms of programmed death ligand 1 (PD-Ll) also known as cluster of differentiation 274 (CD 274) or variants or homologs thereof that maintain PD-Ll activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to PD- Ll).
- the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100%) amino acid sequence identity across the whole sequence or a portion of the sequence (e.g.
- the PD-Ll protein is substantially identical to the protein identified by the UniProt reference number Q9NZQ7 or a variant or homolog having substantial identity thereto.
- a PD-L1 inhibitor inhibits PD-L1 e.g., by at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction, activity or amount of PD-L1 relative to the absence of the PD-L1 inhibitor.
- sodium iodide symporter As referred to herein include any of the recombinant or naturally-occurring forms of the sodium iodide symporter or variants or homologs thereof that maintain sodium iodide symporter activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to sodium iodide symporter). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or
- the sodium iodide symporter is substantially identical to the protein identified by the UniProt reference number Q9291 1 or a variant or homolog having substantial identity thereto.
- the sodium iodide symporter includes the sequence of SEQ ID NO: 13.
- the sodium iodide symporter is the sequence of SEQ ID NO: 13.
- the anti-cancer nucleic acid sequence (nucleic acid binding sequence) provided herein may be incorporated into the chimeric poxvirus genome such that it is placed into functional relationship (operably linked) with a specific poxvirus gene.
- the anti-cancer nucleic acid sequence (nucleic acid binding sequence) may be operably linked to a poxvirus gene if it affects the transcription or translation of the poxvirus gene.
- the anti-cancer nucleic acid sequence (nucleic acid binding sequence) and the poxvirus gene are operably linked when they are contiguous and/or in reading phase.
- the one or more anti-cancer nucleic acid sequences are operably linked to an essential gene of the chimeric poxvirus. In embodiments, the one or more anti-cancer nucleic acid sequences (one or more nucleic acid binding sequences) are operably linked to a DNA polymerase gene of the chimeric poxvirus. In embodiments, the one or more anti-cancer nucleic acid sequences (one or more nucleic acid binding sequences) are operably linked to the 3' end of a DNA polymerase gene of the chimeric poxvirus.
- the one or more anti-cancer nucleic acid sequences are a first anticancer nucleic acid sequence and a second anti-cancer nucleic acid sequence.
- the first anti-cancer nucleic acid sequence may be a first nucleic acid binding sequence and the second anti-cancer nucleic acid sequence may be a second nucleic acid binding sequence.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter and said second anti-cancer nucleic acid sequence (second nucleic acid binding sequence) encodes a miRNA binding sequence.
- the first anti-cancer nucleic acid sequence forms part of a thymidine kinase gene and the second anti-cancer nucleic acid sequence (second nucleic acid binding sequence) is operably linked to a uracil DNA glycosylase gene.
- the first anti-cancer nucleic acid sequence forms part of a thymidine kinase gene and the second anti-cancer nucleic acid sequence (second nucleic acid binding sequence) is operably linked to a DNA polymerase gene.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter and the second anti-cancer nucleic acid sequence encodes a PD-L1 inhibitor.
- the first anti-cancer nucleic acid sequence forms part of a thymidine kinase gene and the second anti-cancer nucleic acid sequence forms part of a F14.5L gene.
- the nucleic acid sequence includes: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) said detectable moiety-encoding nucleic acid sequence.
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Ch
- the detectable moiety-encoding nucleic acid sequence encodes a fluorescent moiety.
- the detectable moiety-encoding nucleic acid sequence forms part of a non-essential gene of the chimeric poxvirus.
- the non-essential gene is a thymidine kinase gene.
- the parts of the non-essential gene are deleted.
- the detectable moiety-encoding nucleic acid sequence is operably linked to a promoter.
- the promoter is a vaccinia virus early promoter.
- the promoter is a synthetic early promoter.
- the synthetic early promoter includes the sequence of SEQ ID NO: 19.
- the synthetic early promoter is the sequence of SEQ ID NO: 19.
- the promoter is a vaccinia virus late promoter.
- the promoter is a H5 promoter or an 1 IK promoter.
- the H5 promoter includes the sequence of SEQ ID NO: 18.
- the H5 promoter is the sequence of SEQ ID NO: 18.
- the 1 IK promoter includes the sequence of SEQ ID NO:20.
- the 1 IK promoter is the sequence of SEQ ID NO:20.
- the anti-cancer nucleic acid sequence encodes a miRNA binding sequence having the sequence of SEQ ID NO: 10 and is operably linked to the 3' end of a uracil DNA glycosylase gene.
- the anti-cancer nucleic acid sequence encodes a miRNA binding sequence having the sequence of SEQ ID NO: 9 and is operably linked to the 3' end of a uracil DNA glycosylase gene.
- the anti-cancer nucleic acid sequence encodes a miRNA binding sequence having the sequence of SEQ ID NO: 11 and is operably linked to the 3' end of a uracil DNA glycosylase gene.
- the anti-cancer nucleic acid sequence encodes a miRNA binding sequence having the sequence of SEQ ID NO: 9 and is operably linked to the 3' end of a DNA polymerase gene.
- the anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13 and the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the detectable moiety-encoding nucleic acid sequence encodes a fluorescent moiety having the sequence of SEQ ID NO: 15, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene, wherein the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the detectable moiety-encoding nucleic acid sequence encodes a fluorescent moiety having the sequence of SEQ ID NO: 15, is operably linked to an 1 IK promoter, and forms part of a thymidine kinase gene, wherein the 1 IK promoter has the sequence of SEQ ID NO:20.
- the detectable moiety-encoding nucleic acid sequence encodes a fluorescent moiety having the sequence of SEQ ID NO: 16, is operably linked to a H5 promoter, and forms part of a thymidine kinase gene, wherein the H5 promoter has the sequence of SEQ ID NO: 18.
- the detectable moiety-encoding nucleic acid sequence encodes a fluorescent moiety having the sequence of SEQ ID NO: 16, is operably linked to an 1 IK promoter, and forms part of a thymidine kinase gene, wherein the 1 IK promoter has the sequence of SEQ ID NO:20.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene; and the second anti-cancer nucleic acid sequence (nucleic acid binding sequence) encodes a miRNA binding sequence having the sequence of SEQ ID NO: 9, and is operably linked to the 3' end of a uracil DNA glycosylase gene, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13 and the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene; and the second anti-cancer nucleic acid sequence (nucleic acid binding sequence) encodes a miRNA binding sequence having the sequence of SEQ ID NO: 11, and is operably linked to the 3' end of a uracil DNA glycosylase gene, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13 and the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene; and the second anti-cancer nucleic acid sequence (nucleic acid binding sequence) encodes a miRNA binding sequence having the sequence of SEQ ID NO: 9, and is operably linked to the 3' end of a DNA polymerase gene, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13 and the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene; and the second anti-cancer nucleic acid sequence (nucleic acid binding sequence) encodes a miRNA binding sequence having the sequence of SEQ ID NO: 11, and is operably linked to the 3' end of a DNA polymerase gene, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13 and the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the F14.5L gene of the chimeric poxvirus has the sequence of SEQ ID NO:7.
- the anti-cancer nucleic acid sequence encodes an anti-PD-Ll scFv, is operably linked to a H5 promoter, and forms part of a F14.5L gene, wherein the anti-PD-Ll scFv has the sequence of SEQ ID NO: 17 and the H5 promoter has the sequence of SEQ ID NO: 18.
- the anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene, and the F14.5L gene has the sequence of SEQ ID NO:7, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13 and the synthetic early promoter has the sequence of SEQ ID NO: 19.
- the first anti-cancer nucleic acid sequence encodes a sodium iodide symporter, is operably linked to a synthetic early promoter, and forms part of a thymidine kinase gene; and the second anti-cancer nucleic acid sequence encodes an anti-PD-Ll scFv, is operably linked to a H5 promoter and forms part of a F14.5L gene, wherein the sodium iodide symporter has the sequence of SEQ ID NO: 13, the synthetic early promoter has the sequence of SEQ ID NO: 19, the anti-PD-Ll scFv has the sequence of SEQ ID NO: 17, and the H5 promoter has the sequence of SEQ ID NO : 18.
- a method of forming a chimeric poxvirus including: infecting a cell with at least two poxvirus strains selected from the group including cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and allowing the at least two poxvirus strains to replicate, thereby forming the chimeric poxvirus.
- poxvirus strains selected from the group including cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL,
- chimeric poxviruses including transgenes (e.g., an anti-cancer nucleic acid sequence, a nucleic acid binding sequence, a detectable moiety-encoding nucleic acid sequence) as described herein.
- transgenes e.g., an anti-cancer nucleic acid sequence, a nucleic acid binding sequence, a detectable moiety-encoding nucleic acid sequence
- the at least two poxvirus strains are each present at a multiplicity of infection of less than about 1.0. In embodiments, the at least two poxvirus strains are each present at a multiplicity of infection of less than about 0.5. In embodiments, the at least two poxvirus strains are each present at a multiplicity of infection of less than about 0.1. In embodiments, the at least two poxvirus strains are each present at a multiplicity of infection of less than about 0.05. In embodiments, the at least two poxvirus strains are each present at a multiplicity of infection of less than about 0.01.
- the chimeric poxvirus is formed by a method including: infecting a cell with at least two poxvirus strains selected from the group including cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and allowing the at least two poxvirus strains to replicate, thereby forming a chimeric poxvirus.
- poxvirus strains selected from the group including cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL,
- the cell is infected with cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic and vaccinia virus strain AS.
- the nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- the cell is infected with cowpox virus strain Brighton and raccoonpox virus strain Herman. In embodiments, the cell is infected with cowpox virus strain Brighton and rabbitpox virus strain Utrecht. In embodiments, the cell is infected with cowpox virus strain Brighton and vaccinia virus strain WR. In embodiments, the cell is infected with cowpox virus strain Brighton and vaccinia virus strain IHD. In embodiments, the cell is infected with cowpox virus strain Brighton and vaccinia virus strain Elstree. In embodiments, the cell is infected with cowpox virus strain Brighton and vaccinia virus strain CL.
- the cell is infected with cowpox virus strain Brighton and vaccinia virus strain Lederle-Chorioallantoic. In embodiments, the cell is infected with cowpox virus strain Brighton and vaccinia virus strain AS. In embodiments, the cell is infected with cowpox virus strain Brighton and orf virus strain NZ2. In embodiments, the cell is infected with cowpox virus strain Brighton and pseudocowpox virus strain TJS. [0266] In embodiments, the cell is infected with rabbitpox virus strain Utrecht and vaccinia virus strain WR. In embodiments, the cell is infected with rabbitpox virus strain Utrecht and vaccinia virus strain IHD.
- the cell is infected with rabbitpox virus strain Utrecht and vaccinia virus strain Elstree. In embodiments, the cell is infected with rabbitpox virus strain Utrecht and vaccinia virus strain CL. In embodiments, the cell is infected with rabbitpox virus strain Utrecht and vaccinia virus strain Lederle-Chorioallantoic. In
- the cell is infected with rabbitpox virus strain Utrecht and vaccinia virus strain AS. In embodiments, the cell is infected with rabbitpox virus strain Utrecht and orf virus strain NZ2. In embodiments, the cell is infected with rabbitpox virus strain Utrecht and pseudocowpox virus strain TJS.
- the cell is infected with vaccinia virus strain CL and vaccinia virus strain Lederle-Chorioallantoic. In embodiments, the cell is infected with vaccinia virus strain CL and vaccinia virus strain AS. In embodiments, the cell is infected with vaccinia virus strain CL and orf virus strain NZ2. In embodiments, the cell is infected with vaccinia virus strain CL and pseudocowpox virus strain TJS.
- the cell is infected with vaccinia virus strain AS and orf virus strain NZ2. In embodiments, the cell is infected with vaccinia virus strain AS and pseudocowpox virus strain TJS. In embodiments, the cell is infected with orf virus strain NZ2 and pseudocowpox virus strain TJS.
- the cell is cell is a kidney fibroblast. In embodiments, the cell is an epithelial cell. In embodiments, the cell is cell is a CV-1 cell. In embodiments, the cell is a cow kidney epithelial cell.
- Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like.
- compositions can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents,
- the chimeric poxvirus provided herein is combined with one or more excipients, for example, a disintegrant, a filler, a glidant, or a preservative.
- the chimeric poxvirus provided herein forms part of a capsule. Suitable capsules include both hard shell capsules or soft-shelled capsules. Any lipid-based or polymer-based colloid may be used to form the capusule. Exemplary polymers useful for colloid preparations include gelatin, plant
- polysaccharides or their derivatives such as carrageenans and modified forms of starch and cellulose, e.g., hypromellose.
- other ingredients may be added to the gelling agent solution, for example plasticizers such as glycerin and/or sorbitol to decrease the capsule's hardness, coloring agents, preservatives, disintegrants, lubricants and surface treatment.
- the chimeric poxvirus compositions can be formulated in a unit dosage form, each dosage containing, for example, from about 0.005 mg to about 2000 mg of a defined chimeric poxvirus having minimal urease activity per dose.
- unit dosage forms refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient.
- the principal active ingredient is mixed with a pharmaceutical excipient to form a solid preformulation composition containing a homogeneous mixture of a compound of the present invention.
- the active ingredient is typically dispersed evenly throughout the composition so that the composition can be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
- tablets or pills of the present invention can be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action.
- the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former.
- the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release.
- enteric layers or coatings such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
- aqueous solutions suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
- a method of treating cancer in a subject in need thereof including administering to the subject a therapeutically effective amount of a chimeric poxvirus as described herein including embodiments thereof, thereby treating cancer in the subject.
- the cancer is breast cancer, colon cancer, kidney cancer, leukemia, lung cancer, melanoma, ovarian cancer, prostate cancer, pancreatic cancer, brain cancer, liver cancer, gastric cancer or a sarcoma.
- the cancer is breast cancer.
- the cancer is colon cancer. In embodiments, the cancer is kidney cancer. In embodiments, the cancer is leukemia. In embodiments, the cancer is lung cancer. In
- the cancer is melanoma. In embodiments, the cancer is ovarian cancer. In embodiments, the cancer is prostate cancer. In embodiments, the cancer is pancreatic cancer. In embodiments, the cancer is brain cancer. In embodiments, the cancer is liver cancer. In embodiments, the cancer is gastric cancer. In embodiments, the cancer is a sarcoma. In embodiments, the cancer is triple-negative breast cancer.
- the administering includes administering a first chimeric poxvirus and a second chimeric poxvirus.
- the first chimeric poxvirus and the second chimeric poxvirus are administered at a combined synergistic amount.
- the first chimeric poxvirus and the second chimeric poxvirus are administered simultaneously.
- the first chimeric poxvirus and the second chimeric poxvirus are administered sequentially.
- the poxvirus is administered with at least 10 3 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at at least 10 4 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at at least 10 5 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at at least 10 6 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at at least 10 7 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at at least 10 8 plaque forming units (Pfu)/kg.
- the poxvirus is administered at 10 3 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at 10 4 plaque forming units (Pfu)/kg. In
- the poxvirus is administered at 10 5 plaque forming units (Pfu)/kg.
- the poxvirus is administered at 10 6 plaque forming units (Pfu)/kg.
- the poxvirus is administered at 10 7 plaque forming units (Pfu)/kg.
- the poxvirus is administered at about 10 3 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at 10 3 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at about 4 xlO 4 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at 4 xlO 4 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at about 5 xlO 4 plaque forming units (Pfu)/kg. In embodiments, the poxvirus is administered at 5 xlO 4 plaque forming units (Pfu)/kg.
- the cancer cell is a kidney cancer cell. In embodiments, the cancer cell is a leukemia cell. In embodiments, the cancer cell is a lung cancer cell. In embodiments, the cancer cell is a melanoma. In embodiments, the cancer cell is an ovarian cancer cell. In embodiments, the cancer cell is a prostate cancer cell. In embodiments, the cancer cell is a pancreatic cancer cell. In embodiments, the cancer cell is a brain cancer cell. In embodiments, the cancer cell is a liver cancer cell. In embodiments, the cancer cell is a gastric cancer cell. In embodiments, the cancer cell is sarcoma cell. In embodiments, the cancer cell is a triple-negative breast cancer cell.
- the dosage will vary with the age, condition, sex, type of disease, the extent of the disease or disorder, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art.
- the dosage can be adjusted by the individual physician in the event of any contraindications. Dosages can vary and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. For example, for the given parameter, an effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Efficacy can also be expressed as "-fold" increase or decrease.
- a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.
- the exact dose and formulation will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), and Pickar, Dosage Calculations (1999)).
- a therapeutically effective amount of the chimeric poxvirus composition described herein are administered to a subject prior to or during early onset (e.g., upon initial signs and symptoms of cancer).
- Therapeutic treatment involves administering to a subject a therapeutically effective amount of the agents described herein after diagnosis or development of disease.
- a method of treating a disease e.g., cancer in a subj ect in need thereof is provided.
- treating or “treatment of a condition, disease or disorder or symptoms associated with a condition, disease or disorder refers to an approach for obtaining beneficial or desired results, including clinical results.
- beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of condition, disorder or disease, stabilization of the state of condition, disorder or disease, prevention of development of condition, disorder or disease, prevention of spread of condition, disorder or disease, delay or slowing of condition, disorder or disease progression, delay or slowing of condition, disorder or disease onset, amelioration or palliation of the condition, disorder or disease state, and remission, whether partial or total.
- Treating can also mean prolonging survival of a subject beyond that expected in the absence of treatment. “Treating” can also mean inhibiting the progression of the condition, disorder or disease, slowing the progression of the condition, disorder or disease temporarily, although in some instances, it involves halting the progression of the condition, disorder or disease permanently.
- treatment, treat, or treating refers to a method of reducing the effects of one or more symptoms of a disease or condition characterized by expression of the protease or symptom of the disease or condition characterized by expression of the protease.
- treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%), or 100%) reduction in the severity of an established disease, condition, or symptom of the disease or condition (e.g., cancer).
- a method for treating a disease is considered to be a treatment if there is a 10%> reduction in one or more symptoms of the disease in a subject as compared to a control.
- the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%), 90%), 100%), or any percent reduction in between 10%> and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.
- references to decreasing, reducing, or inhibiting include a change of 10%>, 20%, 30%>, 40%), 50%), 60%), 70%), 80%), 90% or greater as compared to a control level and such terms can include but do not necessarily include complete elimination.
- the dosage required will depend on the route of administration, the nature of the formulation, the nature of the subject's condition, e.g., immaturity of the immune system or a gastrointestinal disorder, the subject's size, weight, surface area, age, and sex, other drugs being administered, and the judgment of the attending clinicians. Alternatively or in addition, the dosage can be expressed as Pfu/kg of dry weight.
- compositions can be administered once (or twice, three times, etc.) daily, weekly, monthly, or yearly.
- the compositions may also be administered in conjunction with other therapeutic agents.
- the compositions may also be administered in conjunction with anticancer agents.
- Other therapeutic agents will vary according to the particular disorder, but can include, for example, dietary modification, hemodialysis, therapeutic agents such as sodium benzoate, phenylacetate, arginine, or surgical remedies.
- Concurrent administration of two or more therapeutic agents does not require that the agents be administered at the same time or by the same route, as long as there is an overlap in the time period during which the agents are exerting their therapeutic effect. Simultaneous or sequential administration is contemplated, as is administration on different days or weeks.
- the compounds described herein can be used in combination with one another, with other active agents (e.g. anti-cancer agents) known to be useful in treating a disease described herein (e.g. breast cancer, colon cancer, kidney cancer, leukemia, lung cancer, melanoma, ovarian cancer, prostate cancer, pancreatic cancer, brain cancer, liver cancer, gastric cancer or a sarcoma), or with adjunctive agents that may not be effective alone, but may contribute to the efficacy of the active agent.
- the method includes administereing a therapeutic agent.
- the therapeutic agent is a checkpoint inhibitor protein.
- the therapeutic agent is ipilimumab.
- the therapeutic agent is pembrolizumab. In embodiments, the therapeutic agent is nivolumab. In embodiments, the therapeutic agent is talimogene laherparepvec. In embodiments, the therapeutic agent is durvalumab. In
- the therapeutic agent is daclizumab. In embodiments, the therapeutic agent is avelumab. In embodiments, the therapeutic agent is atezolizumab. In embodiments, the chimeric poxvirus and the therapeutic agent are administered at a combined synergistic amount. In embodiments, the chimeric poxvirus and the therapeutic agent are administered
- co-administration includes administering one active agent within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of a second active agent (e.g. anti-cancer agent).
- Co-administration includes administering two active agents simultaneously,
- co-administration can be accomplished by co-formulation, i.e., preparing a single pharmaceutical composition including both active agents.
- the active agents can be formulated separately.
- the active and/or adjunctive agents may be linked or conjugated to one another.
- Anti-cancer agent is used in accordance with its plain ordinary meaning and refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells.
- an anti-cancer agent is a chemotherapeutic.
- an anti-cancer agent is an agent identified herein having utility in methods of treating cancer.
- an anticancer agent is an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer. Examples of anti-cancer agents include, but are not limited to, MEK (e.g. MEK1, MEK2, or MEK1 and MEK2) inhibitors (e.g.
- alkylating agents e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambucil, meiphalan), ethylenimine and methylmelamines (e.g., hexamethlymelamine, thiotepa), alkyl sulfonates
- alkylating agents e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambuci
- Cytarabine purine analogs (e.g., mercaptopurine, thioguanine, pentostatin), etc.), plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel, docetaxel, etc.), topoisomerase inhibitors (e.g., irinotecan, topotecan, amsacrine, etoposide (VP16), etoposide phosphate, teniposide, etc.), antitumor antibiotics (e.g., doxorubicin, adriamycin, daunorubicin, epirubicin, actinomycin, bleomycin, mitomycin, mitoxantrone, plicamycin, etc.), platinum-based compounds or platinum containing agents (e.g.
- cisplatin oxaloplatin, carboplatin
- anthracenedione e.g., mitoxantrone
- substituted urea e.g., hydroxyurea
- methyl hydrazine derivative e.g., procarbazine
- adrenocortical suppressant e.g., mitotane
- epipodophyllotoxins e.g., etoposide
- antibiotics e.g., daunorubicin, doxorubicin, bleomycin
- enzymes e.g., L-asparaginase
- inhibitors of mitogen-activated protein kinase signaling e.g.
- adecypenol adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein- 1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense
- apurinic acid ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor;
- cryptophycin 8 cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine;
- dehydrodidemnin B deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; 9-dioxamycin;
- diphenyl spiromustine diphenyl spiromustine; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol;
- galocitabine ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene;
- isohomohalicondrin B itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor;
- leukocyte alpha interferon leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin;
- A marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol;
- mitomycin analogues mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin;
- nafarelin nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin;
- oligonucleotides onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer;
- ormaplatin osaterone; oxaliplatin; oxaunomycin; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol;
- phenazinomycin phenyl acetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins;
- pyrazoloacridine pyridoxylated hemoglobin polyoxyethylerie conjugate; raf antagonists;
- raltitrexed ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone B 1 ; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen-binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparf
- tellurapyrylium tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide;
- tetrachlorodecaoxide tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex;
- urogenital sinus-derived growth inhibitory factor urokinase receptor antagonists
- vapreotide variolin B
- vector system erythrocyte gene therapy
- velaresol veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; zinostatin
- ametantrone acetate aminoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium;
- bropirimine busulfan; cactinomycin; calusterone; caracemide; carbetimer; carboplatin;
- carmustine carubicin hydrochloride
- carzelesin cedefingol
- chlorambucil cirolemycin
- enpromate epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; trasrabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; iimofosine; interleukin II (including recombinant interleukin II, or rlL.sub.2), interferon alfa-2a; interferon alfa-2b;
- interferon alfa-nl interferon alfa-n3; interferon beta- la; interferon gamma-lb; iproplatin;
- irinotecan hydrochloride lanreotide acetate; letrozole; leuprolide acetate; liarozole
- meturedepa mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin;
- perfosfamide perfosfamide
- pipobroman piposulfan
- piroxantrone hydrochloride plicamycin
- plomestane porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin;
- puromycin hydrochloride pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; pumprazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride;
- spiromustine spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfin; teniposide; teroxirone; testolactone;
- thiamiprine thioguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate; vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin;
- zinostatin agents that arrest cells in the G2-M phases and/or modulate the formation or stability of microtubules, (e.g. Taxol.TM (i.e. paclitaxel), Taxotere.TM, compounds comprising the taxane skeleton, Erbulozole (i.e. R-55104), Dolastatin 10 (i.e. DLS-
- Discodermolide i.e. as NVP-XX-A-296
- ABT-751 Abbott, i.e. E-7010
- Altorhyrtins e.g. Altorhyrtin A and Altorhyrtin C
- Spongistatins e.g. Spongistatin 1, Spongistatin 2, Spongistatin
- Epothilones e.g. Epothilone A, Epothilone B, Epothilone C (i.e. desoxyepothilone A or dEpoA), Epothilone D (i.e.
- Epothilone E Epothilone F
- Epothilone B N-oxide Epothilone A N-oxide
- 16-aza-epothilone B Epothilone B
- 21-aminoepothilone B i.e. BMS-310705
- 21- hydroxyepothilone D i.e. Desoxyepothilone F and dEpoF
- 26-fluoroepothilone i.e. NSC-654663
- Soblidotin i.e. TZT-1027
- Vincristine sulfate i.e.
- LY- 355703 Vitilevuamide, Tubulysin A, Canadensol, Centaureidin (i.e. NSC-106969), Oncocidin Al (i.e. BTO-956 and DFME), Fijianolide B, Laulimalide, Narcosine (also known as NSC-5366), Nascapine, Hemiasterlin, Vanadocene acetyl acetonate, Monsatrol, Inanocine (i.e.
- Eleutherobins such as Desmethyleleutherobin, Desaetyleleutherobin, lsoeleutherobin A, and Z- Eleutherobin
- Caribaeoside Caribaeolin
- Halichondrin B Diazonamide A
- Taccalonolide A Diozostatin
- (-)-Phenylahistin i.e.
- NSCL-96F037 Myoseverin B, Resverastatin phosphate sodium, steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, gonadotropin-releasing hormone agonists (GnRH) such as goserelin or leuprolide, adrenocorticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, megestrol acetate,
- estrogens e.g., diethlystilbestrol, ethinyl estradiol
- antiestrogen e.g., tamoxifen
- androgens e.g., testosterone propionate, fluoxymesterone
- antiandrogen e.g., flutamide
- immunostimulants e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha-interferon, etc.
- monoclonal antibodies e.g., anti-CD20, anti-F£ER2, anti-CD52, anti- HLA-DR, and anti-VEGF monoclonal antibodies
- immunotoxins e.g., anti-CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody-pseudomonas exotoxin conjugate, etc.
- radioimmunotherapy e.g., anti-CD20 monoclonal antibody
- gefitinib IressaTM
- erlotinib TarcevaTM
- cetuximab ErbituxTM
- lapatinib TykerbTM
- panitumumab VectibixTM
- vandetanib CaprelsaTM
- afatinib/BIBW2992 CI- 1033/canertinib, neratinib/HKI-272, CP-724714, TAK-285, AST-1306, ARRY334543, ARRY- 380, AG-1478, dacomitinib/PF299804, OSI-420/desmethyl erlotinib, AZD8931, AEE788, pelitinib/EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626.
- a method of detecting cancer in a subject in need thereof including contacting a cancer cell with a chimeric poxvirus as described herein including embodiments thereof and allowing the chimeric poxvirus to replicate, thereby detecting a cancer cell.
- the chimeric poxvirus includes a detectable-moeity encoding nucleic acid sequence.
- the detectable-moeity encoding nucleic acid sequence encodes a fluorescent moiety.
- the detectable-moeity encoding nucleic acid sequence encodes mCherry.
- the detectable-moeity encoding nucleic acid sequence encodes Emerald.
- Cancer is the second leading cause of death in the United States. In recent years, great progress has been made in cancer immunotherapy, including immune checkpoint inhibitors, T cells with chimeric antigen receptors, and oncolytic viruses.
- Oncolytic viruses are naturally occurring or genetically modified viruses that infect, replicate in, and eventually kill cancer cells while leaving healthy cells unharmed (1, 2).
- a recently completed Phase III clinical trial of the oncolytic herpes simplex virus T-VEC in 436 patients with unresectable stage IIIB, IIIC or IV melanoma was reported to meet its primary end point, with a durable response rate of 16.3% in patients receiving T-VEC compared to 2.1% in patients receiving GM-CSF (3).
- Oncolytic vims constructs from at least eight different species have been tested in various phases of clinical trials, including adenovirus, herpes simplex virus-1, Newcastle disease virus, reovirus, measles virus, coxsackievirus, Seneca Valley virus, and vaccinia virus. It has become clear that oncolytic viruses are well tolerated in patients with cancer. The clinical benefits of oncolytic viruses as stand-alone treatments, however, remain limited (5).
- oncolytic viruses Due to concerns on the safety of oncolytic viruses, only highly attenuated oncolytic viruses (either naturally avirulent or attenuated through genetic engineering) have been used in both preclinical and clinical studies. Since the safety of oncolytic viruses has now been well established it is time to design and test oncolytic viruses with maximal anti-tumor potency. Oncolytic viruses with a robust oncolytic effect will release abundant tumor antigens, resulting in a strong
- Vaccinia virus the prototype member of the poxvirus family, was used as smallpox vaccine to eradicate smallpox that is estimated to have killed 500 million people just in the 19 th and 20 th centuries. It, thus, is arguably the most successful live biotherapeutic agent. The safety of vaccinia virus was well demonstrated in millions of people worldwide. Vaccinia virus is also the first oncolytic virus showing viral oncolysis in the laboratory. Vaccinia virus as an oncolytic virus has been tested in many clinical trials and has been shown to be well tolerated in patients with late-stage cancer (2).
- vaccinia virus is superior to adenovirus (6), one of the best studied oncolytic virus species and the first oncolytic virus approved for cancer treatment in China (7).
- vaccinia virus other members in the poxvirus family were also tested as oncolytic viruses, including raccoonpox virus (8), orf virus (9), and myxoma virus (10).
- Chimeric poxviruses have potential to combine favorable features from different virus species, thus, are superior to individual wild-type viruses. Since orthopoxviruses and
- parapoxviruses are antigenically distinct the potent chimeric orthopoxvirus and the potent chimeric parapoxvirus generated in this study can be potentially combined into the same treatment regimen to achieve the maximum therapeutic efficacy.
- Applicants have generated pools of chimeric orthopoxviruses and chimeric parapoxviruses.
- Several chimeric orthopoxvirus and parapoxvirus isolates showed superior killing capacity in a panel of the NCI 60 cancer cell lines compared to their parental individual wild-type viruses. [0304] Generation of chimeric virus pools and isolation of individual chimeric viruses.
- a pool of chimeric orthopoxviruses was generated by co-infecting CV-1 cells with cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, and vaccinia virus strains WR, IHD, Elstree, CL, Lederle-Chorioallantoic and AS at a multiplicity of infection (MOI) of 0.01 per virus.
- MOI multiplicity of infection
- MDBK cells were co- infected with orf virus strain NZ2 and pseudocowpox virus strain TJS at an MOI of 0.1.
- Applicants' pilot experiments indicate that CV-1 cells are susceptible to all the orthopoxviruses used in this study and that both orf virus and pseudocowpox virus infect and form plaques in MDBK cells.
- 100 chimeric orthopoxvirus plaques and 100 chimeric parapoxvirus plaques were picked from CV-1 cells infected with the chimeric orthopoxvirus pool and MDBK cells infected with the chimeric parapoxvirus pool, respectively. These two hundred plaques were further plaque-purified two more times in respective cells to yield 200 clonally purified individual chimeric virus isolates.
- Viruses #14-113 are chimeric orthopoxvirus isolates whereas viruses #114-213 are chimeric parapoxvirus isolates.
- Genomic sequencing of #33 and #189 Genomic DNAs of novel poxvims isolates #33 and #189 were isolated from purified virions and subject to next-generation sequencing using Illumina Hiseq 2500 with more than lOOOx coverage. The gaps were PCR amplified and sequenced by Sanger sequencing. 189,415 base pairs (bps) of the #33 genome were fully sequenced whereas 138,203 bps of the 189 genome were obtained. Intitial BLAST against GenBank indicated that the genomic sequences of both #33 and #189 are not identical to any genomic sequences in GenBank. #33 is more close to vaccinia virus strains than to any other orthpoxvirses.
- #189 is very close to orf virus NZ2 strain, one of the parental parapoxviruses.
- the nucleotide sequences of all ORFs identified in the orf virus NZ2 strain are identical to that in #189.
- In the inverted terminal repeat regions there are one copy of a repeat element deleted and one copy of another repeat element inserted in the #189 genome.
- both #33 and #189 represent novel unique poxvirus isolates.
- Cell lines All cancer cell lines were grown in RPMI-1640 (Mediatech, Manassas, VA). African green monkey kidney fibroblast cells (CV-1) and cow kidney epithelial cells (MDBK) were obtained from American Type Culture Collection (ATCC; Rockville, MD, USA) and grown in DMEM (Mediatech, Manassas, VA). All media were supplemented with 10% FBS (Mediatech, Manassas, VA) and 1% penicillin-streptomycin solution (Mediatech, Manassas, VA). Cells were cultured at 37 °C under 5 % C0 2 .
- Viruses cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strains WR, IHD, Elstree, CL, Lederle-Chorioallantoic and AS, orf virus strain NZ2 and pseudocowpox virus strain TJS were purchased from ATCC. All orthopoxvirus strains were grown and titrated in CV-1 cells were parapoxvirus strains were grown and titrated in MDBK cells.
- MDBK cells were co-infected with orf virus strain NZ2 and pseudocowpox virus strain TJS at an MOI of 0.1. Infected cells were harvested at 3 days after infection.
- the initial chimeric orthopoxvirus pool was further passaged for three times in CV-1 cell at an MOI of 0.1 where the initial chimeric parapoxvirus poos was further passaged for three times in MDBK cells at an MOI of 0.1.
- 100 chimeric orthopoxvirus plaques and 100 chimeric parapoxvirus plaques were picked from CV-1 cells infected with the final chimeric orthopoxvirus pool and MDBK cells infected with the final chimeric parapoxvirus pool, respectively. These two hundred plaques were further plaque-purified two more times in respective cells to yield 200 clonally purified individual chimeric virus isolates.
- NCI-60 cancer cell lines and a panel of pancreatic cancer cell line including PANC-1, MIA-PaCa2, BxPC3, FG, Capan-2 and Su.86.86 were dispensed into 96-well plates (3000 cells/well for solid tumor cell lines and 5000/well for leukemia cell lines) using an epMotion 5075 liquid handler (Eppendorf) under a sterile condition, incubated overnight at 37°C under 5% (v/v) C0 2 .
- Cells were then infected with 200 chimeric orthopoxvirus and chimeric parapoxvirus isolates, together with 11 parental virus strains and 2 control oncolytic viruses GLV-lh68 and OncoVEX GFP at an MOI of 0.01. Cell viability was determined at 96 h post infection using MTS assays (Promega). Absorbance at 490 nm was measured using an automated BMG PHERAstar plate reader (BMG Labtech). Each experiment was performed in duplicate. Cell viability for mock-infected cells was set to 100%.
- Viral Cytotoxicity in gastric cancer cell lines MKN-45, OCUM-2M and KATO-3 cells were seeded into 96-well plates at a concentration of 3,000 cells per well, and incubated overnight at 37°C under 5% (v/v) C0 2 .
- Cells were infected with #33, #189, GLV-lh68 and OncoVEX GFP at MOIs of 0.01, 0.1 and 1.
- Cell viability was monitored daily for 4 days using MTS assays. 37°C under 5% (v/v) C0 2 .
- Genomic Sequencing Genomic DNAs of #33 and # 189 were extracted from purified virions using Wizard Genomic DNA Purification kit (Promega) and fragmented by sonication. Libraries were prepared using KAPA LTP Library Preparation Kit. Sequencing was done using Illumina Hiseq 2500
- NCI-60 cancer cell lines only contain solid cancers from 8 different organs (see Table 1). To investigate if the results from the NCI-60 cancer cell lines would be reproduced in solid cancers from other organs.
- Six pancreatic cancer cell lines (BxPC3, FG, MIA PaCa-2, Capan-2, PANC-1, and SU.86.86) were infected at an MOI of 0.1 with the same viruses used in the high throughput screening in the NCI-60 cancer cell lines. Cell viability was again measured at 96 h post infection using MTS assays.
- Novel chimeric orthopoxvirus isolate #33 and chimeric parapoxvirus isolate #189 show potent cell killing in gastric cancer cell lines [0318] Based on the high throughput screening results from the NCI-60 cancer cell lines and the panel of pancreatic cancer cell lines, novel chimeric orthopoxvirus isolate #33 and chimeric parapoxvims isolate #189 were chosen for further characterization. Tumor cell killing activity of the isolates #33 and #189 were further investigated in three gastric cancer cell lines. MKN-45, OCUM-2M and KATO-3 cells were infected with #33, #189, GLV-lh68 and OncoVEX GFP at MO Is of 0.01, 0.1 and 1. Cell viability was monitored daily for 4 days using MTS assays.
- MKN- 45 and OCUM-2M cell lines were most sensitive to #33, intermediately sensitive to OncoVEX GFP, and least sensitive to GLV-lh68. While KATO-3 was most sensitive to OncoVEX GFP at the low MOI of 0.01, #33, #189, and OncoVEX GFP killed KATO-3 cells equally well at higher MOIs (0.1 and 1). KATO-3 cells were least sensitive to GLV-lh68. Overall, #33 killed gastric cancer cell lines most efficiently while GLV-lh68 kill gastric cancer cell lines lest efficiently (FIGS. 5A-5C).
- I3L Phosphoprotein binds ssDNA A2L* Late transcription factor/VLTF-3
- I5L IMV structural protein I5L IMV structural protein, VP13K A2-5L Thioredoxin-like protein
- G4L Glutaredoxin 2 membrane protein, A9L* FMV protein, role in morphogenesis virion morphogenesis
- L4R* FMV core protein VP8 DNA and A18R* DNA helicase, DNA-dependent RNA-binding protein ATPase, transcript release factor
- TNBC Triple-negative breast cancer
- Applicants describe a novel, genetically engineered parapoxvirus that efficiently kills TNBC.
- a novel chimeric parapoxvirus (HOV-189) was generated via homologous recombination and identified through high-throughput screening. Cytotoxicity was assayed in vitro in four TNBC cell lines. Viral replication was examined through standard plaque assay. Orthotopic TNBC xenografts were generated by MDA-MB-468 implantation into the second and fourth mammary fat pads of athymic nude mice, and treated with virus.
- HOV-189 demonstrated dose-dependent cytotoxicity at low multiplicity of infection (MOI), with >90% cell death six days after treatment. Significant reductions in tumor size were observed two weeks after intratumoral injection at doses as low as 10 3 PFU compared to control (P ⁇ 0.01). In addition, abscopal effect (shrinkage of non-injected remote tumors) was clearly demonstrated.
- TNBC triple-negative breast cancer
- TNBC tumor infiltrating lymphocytes
- African green monkey kidney fibroblasts (CV-1) and MDBK cells were obtained from American Type Culture Collection (Mannassus, VA) and cultured in Dulbecco's modified Eagle's medium (DMEM, Corning, Corning NY) supplemented with 10% FBS and 100 IU/ml streptomycin and penicillin. All cells were grown at 37°C in a 5% C0 2 -humidified incubator.
- MDBK cells were co-infected with orf virus strain NZ2 (ATCC) and
- pseudocowpox virus strain TJS ATCC
- Infected cells were harvested at three days after infection.
- One hundred chimeric parapoxvirus plaques were picked from MDBK cells infected with the chimeric parapoxvirus pool. These 100 plaques were further plaque-purified two more times in MDBK cells to yield 100 clonally purified individual chimeric virus isolates, which, together with its parental viruses, were subject to high throughput screening in the NCI-60 cell lines.
- the isolate HOV-189 that demonstrated the most potent tumoricidal properties against the NCI-60 cell lines was chosen for this study.
- Cytotoxicity assays Cells were seeded at 1000 cells/well for MDA-MB-231, BT549 and Hs578T and at 3000 cells/well for MDA-MB-468 in 96-well plates and incubated overnight. Cells were infected with 0.1, 1 and 10 MOI of each virus for MDA-MB-231 and with 0.01, 0.1 and 1 for MDA-MB-468, BT549 and Hs578T. Cell viability was measured in triplicate every 24 hours for one to six days using CellTiter 96 Aqueous One solution (Promega, Madison, WI) on a spectrophotometer (Tecan Spark 10M, Mannedorf, Switzerland) at 490 nm.
- HOV-189 effectively kills TNBC in vitro in a time- and dose-dependent manner.
- TNBC two cell lines of metastatic origin (MDA-MB-231 and MDA-MB-468) and two cell lines of non-metastatic origin (Hs578T and BT549) were treated with HOV-189 at MOI ranging from 0.01 to 10 over six days.
- HOV-189 most efficiently killed Hs578T (LD50 at 96 hrs: MOI 0.396) and MDA-MB-468 (LD50, MOI 0.185) with >80% cell death at six days when treated with MOI 1 (FIGS. 6A and 6C).
- MDA-MB-231 data shows that increasing the concentration of HOV-189 results in >90% cell death at MOI 10 after six days (FIG. 6D).
- HOV-189 replicates in TNBC in vitro. Viral replication was assessed in all four TNBC cell lines by standard plaque assay of infected cells collected over three days. Efficient viral replication occurred in BT549, Hs578T and MDA-MB-231 at MOI 0.01, with maximal replication occurring in the 24-48 hour time period (FIG. 7). However, HOV-189 replication in MDA-MB-468 was poor at MOI 0.01 despite demonstrating effective cytotoxicity at low MOI. Viral replication was improved by increasing concentration to MOI 10 in the MDA-MB-468 line (FIG. 7). [0339] Intratumoral HOV-189 injection effectively reduces tumor size in orthotopic TNBC xenografts without significant viral toxicity.
- Orthotopic xenografts were created by implanting MDA-MB-468 cells into the second and fourth mammary fat pads of athymic nude mice. Both tumors received a single intratumoral injection of either PBS or HOV-189 (10 3 PFU, 10 4 PFU, or 10 5 PFU). All groups treated with HOV-189 demonstrated significant reduction in relative tumor size by post-treatment day 13 compared to PBS-treated controls and this treatment effect was sustained six weeks post-injection (FIG. 8). Intratumoral injections were well tolerated without notable viral toxicity in the mice, as demonstrated by lack of significant body weight reduction in treatment groups compared to controls (FIG. 9).
- TNBC Triple-negative breast cancer
- OV herpes simplex virus
- T-VEC titaniumimogene laherparepvec
- OV oncolytic virus
- OV-mediated destruction of infected cells releases cytokines, tumor- associated antigens (TAA), damage-associated molecular pattern molecules (DAMPs) and pathogen-associated molecular pattern (PAMPs) molecules that prime both the innate and
- TNBC tumor infiltrating lymphocytes
- HOV-189 a novel chimeric parapoxvirus, has in vitro cytotoxic effects in four different TNBC cell lines, both of metastatic and non-metastatic origin.
- the virus was also detected at non-injected distant tumor sites with size stabilization of those tumors.
- HOV- 189 demonstrates the ability to travel systemically and target distant sites of disease, which may have applications in neoadjuvant therapy and also in metastatic settings.
- HOV-189 in vivo reduction of tumor size was observed with HOV-189 doses as low as 10 3 PFU per tumor. This suggests that the antitumor effect is unlikely a result of direct oncolysis from viral replication, as HOV-189 demonstrated poor in vitro replication.
- Genetic sequencing of HOV-189 reveals close relationship to one of its parent viruses, the parapoxvirus orf virus (ORFV). Previous studies of ORFV have shown that OR V treatment induces a strong immunomodulatory effect, particularly with regard to natural killer (NK) cell activation.
- NK natural killer
- ORFV In comparison to other OVs, ORFV has not been well-studied in the context of clinical therapeutics development. Much of what is known with regard to its natural disease history has been gleaned from veterinary medicine. However, there are several properties of ORFV that may be advantageous for developing it as an OV for the treatment of human cancers. Firstly, ORVF infection does not cause serious diseases in humans. 29 Secondly, ORFV infection induces a potent immune system stimulation (Thl dominated) and even inactivated viral particles retain the ability to induce an immune response. 30 ' 31 Thirdly, neutralizing antibody is rare and reinfection can occur despite antibody production against ORF.
- HOV-189 is a novel wild-type chimeric parapoxvirus effective against TNBC both in vitro and in vivo. With targeted therapies lacking for T BC treatment, HOV-189 represents a promising avenue for immunotherapeutics in this field. In terms of future directions, Applicants plan further preclinical testing in other xenograft models, as well as genetic modifications to the wild-type virus to enhance tumor selectivity and overall potency.
- TK thymidine kinase shuttle vector
- the left and right flanking sequences of the TK gene of #33 chimeric poxvirus were PCR-amplified from #33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5'- GCGCATATGATCTATGGATTACCATGGATGACAACTC-3' (SEQ ID NO:21) and 5'- CGTTTAACTCGTCTAATTAATTCTGTAC-3 ' (SEQ ID NO:22) (left flank), 5'- CAGGTAAAAGTACAGAATTAATTAGACGAGTTAAACGAGCTCGTCGACGGATCCGC TAGCGGCCGCGGAGGTAATGATATGTATCAATCGGTGTGTAG-3' (SEQ ID NO:23) and 5'- GCGGAATTCGTAATTACTTAGTAAATCCGCCGTACTAGG-3' (SEQ ID NO:24) (right flank).
- p33NC-TK contains the left and right flanking sequences of TK separated by Sacl, Sail, BamHI, Nhel and Notl, and Escherichia coli guanine phosphoribosyltransferase (gpt) gene driven by the vaccinia virus (VACV) early promoter p7.5E as a transient dominant selectable marker.
- the F14.5L shuttle vector was constructed similarly.
- the left and right flanking sequences of the F14.5L gene of #33 chimeric poxvirus were PCR-amplified from #33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5'- GCGCATATGTAGAAGAATTGATAAATATGAAACCTTTTAAG-3' (SEQ ID NO:25) and 5'- CCTCTCTAGCTTTCACTTAAACTGTATCG-3' (SEQ ID NO:26) (left flank), 5 ' - GAAT AATCGAT AC AGTTT AAGTGAAAGCT AGAGAGGAAGCTTGAGCTCGA GGATCCGCTAGCGGCCGCTGAAGAGGATGCTAGAATCAAGGAGGAGC AAG-3 ' (SEQ ID NO:27) and 5'- GCGGAATTCTCCGGGCAGTGACTTTGTAGCTCTCCCAG-3' (SEQ ID NO:28) (S
- p33NC-F14.5L contains the left and right flanking sequences of F14.5L separated by Hindlll, Sacl, Xhol, BamHI, Nhel and Notl, and Escherichia coli gpt driven by the VACV early promoter p7.5E as a transient dominant selectable marker.
- the two fragments were joined together using the method of gene splicing by overlapping extension.
- the resulting fragment was digested with Ndel and EcoRI and cloned into the same-cut plasmid pGPT to yield p33NCD4R-miR100t and p33NCD4R-miR100t-2.
- the flanking sequences of D4R in the shuttle vectors were confirmed by sequencing.
- p33NCD4R-miR100t contains 4 copies of the miR-100 target sequence fused to the 3 '-end of D4R as expected whereas p33NCD4R-miR100t-2 is a spontaneous mutant with 2 copies of the miR-100 target sequence deleted.
- Both vectors contain Escherichia coli gpt driven by the VACV early promoter p7.5E as a transient dominant selectable marker.
- the two fragments were joined together using the method of gene splicing by overlapping extension.
- the resulting fragment was digested with Ndel and EcoRI and cloned into the same-cut plasmid pGPT to yield p33NCD4R-Let7ct.
- the flanking sequences of D4R in the shuttle vector were confirmed by sequencing.
- p33NCD4R-Let7ct contains 4 copies of the Let-7c target sequence fused to the 3 '-end of D4R as expected. It contains Escherichia coli gpt driven by the VACV early promoter p7.5E as a transient dominant selectable marker.
- flanking sequences of ELL in the shuttle vector were confirmed by sequencing.
- p33NCE9L-miR100t contains 4 copies of the miR-100 target sequence fused to the 3 '-end of E9L as expected. It also contains Escherichia coli gpt driven by the VACV early promoter p7.5E as a transient dominant selectable marker.
- p33NCE9L-Let7ct contains 4 copies of the Let-7c target sequence fused to the 3 '-end of E9L as expected. It also contains Escherichia coli gpt driven by the VACV early promoter p7.5E as a transient dominant selectable marker.
- hNIS Human sodium and iodide symporter
- the PCR fragment was digested with Sacl and BamHI and cloned into the same-cut plasmid p33NC-TK to yield p33NCTK-SE-hNIS.
- the sequence of the hNIS expression cassette was confirmed by sequencing.
- Emerald (a variant of GFP) expression cassette.
- the Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD
- mCherry expression cassettes The mCherry cDNA was PCR-amplified from the plasmid pLV-mCherry (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5'- GCGGTCGACCACCATGGTGAGCAAGGGCGAGGAGGATAACATGG-3' (SEQ ID NO:53) and 5'-GCGGGATCCATAAAAATTAATTAATCACTTGTACAGCTCGTCCATGCCG CCGGTGGAGTGG-3' (SEQ ID NO: 54).
- PCR fragment was digested with Sail and BamHI and cloned into the same-cut plasmids p33NCTK-H5-Emerald and p33NCTK-l 1K- Fluc2 replacing Emerald and firefly luciferase to yield p33NCTK-H5-mCherry and
- Anti-PD-Ll single chain antibody expression cassette comprising the VACV H5 promoter, a IgK light chain leader sequence, the V H and V L chain sequences of atezolizumab separated by a (G4S)3 linker sequence, and a C-terminal FLAG tag sequence was synthesized by Integrated DNA
- the fragment was digested with Hindlll and BamHI and cloned into the same-cut plasmids p33NC-F14.5L to yield p33NCF14.5L-H5-anti-PD-Ll.
- the sequence of the anti-PD-Ll single chain antibody expression cassette was confirmed by sequencing.
- CV-1 cells were infected with parental viruses at a multiplicity of infection (MO I) of 0.1 for 1 h, then transfected with transfer vectors (Table 5) by use of jetPRLME in vitro DNA & siRNA transfection reagent (Polyplus-transfection Inc. New York, NY). Two days post infection, infected/transfected cells were harvested and the recombinant viruses were selected and plaque purified as described previously. 33
- Table 5 List of recombinant chimeric poxviruses.
- the target sequence (4-a)
- the novel chimeric poxviruses could shrink tumors with a single intratumoral injection of as low as 1000 plaque-forming units of virus without overt side effects. This is 2-5 logs lower than most oncolytic viruses under clinical testing.
- Emerald a variant of GFP
- mCherry red fluorescent protein
- firefly luciferase expression cassettes were inserted into chimeric poxviruses. Expression of these optical imaging genes is easily detectable, thus greatly aiding monitoring virus replication and spread in vivo without significantly affecting virus replication and efficacy.
- hNIS human sodium and iodine symporter
- hNIS-expressing chimeric poxviruses are safe in mice bearing tumors.
- Immune checkpoint inhibitors represent breakthrough drugs in the treatment of solid tumors, and have been approved for the treatment of melanoma, non-small cell lung carcinoma and renal cell carcinoma. These drugs require a pre-existing anti-tumor immune response.
- oncolytic viruses can overcome multiple immune pathways inducing immune tolerance.
- oncolytic viruses promote infiltration of cytotoxic CD8 T cells into infected tumors and induce the up-regulation of CTLA-4 or PD-L1 through activation of IFN- ⁇ producing cytotoxic CD8 T cells, thereby allowing anti-CTLA-4 and anti-PD-l/PD-Ll therapies to reach their maximum therapeutic potential.
- Data from several preclinical studies support combining oncolytic virotherapy with checkpoint blockade. Clinical trials evaluating the combination of the first FDA-approved oncolytic virus T-VEC with anti- CTLA-4 and anti-PD-1 antibodies are ongoing. The initial results are encouraging.
- anti-PD-Ll expression cassette will be inserted into chimeric poxviruses or chimeric poxviruses expressing hNIS.
- Applicants expect that while insertion of hNIS into oncolytic viruses will enable synergistic tumor cell-killing with radioiodine and nuclear medicine imaging of infected tumor cells, expression of immunostimulatory transgenes such as anti-PD-Ll within the same vectors will greatly augment anti-tumor immune responses while potentially decreasing off target auto-immune toxicities.
- Example 7 Targeting pancreatic cancer with oncolytic virotherapy
- a cytotoxicity assay was performed on cancer cell lines Panc-1 (FIGS. 12A-12B), MiaPaCa-2 (FIGS. 12C-12D), BxPC-3 (FIGS. 12E-12F), SU.86.86 (FIGS. 12G-12H), Capan-1 (FIGS. 12I-12J), and AsPC-1 (FIGS. 12K-12K) by plating 3xl0 3 cancer cells per well in ⁇ . RPMI 5% FBS, 1% Antibiotic-Antimycotic solution for 24 hours. 20 ⁇ . of the virus, either #33, OncoVEX GFP , GLV-lh68, or #189, was then added at a multiplicity of infection (MOI) of 1, 0.1, and 0.01.
- MOI multiplicity of infection
- a daily cell viability assay was performed by adding 20 ⁇ . of CellTiter 96 Aqueous One Solution Cell Proliferation Assay to all wells and taking a colorimetric reading after 1 hour of incubation. Experimental results were standardized to a media only and MOI 0 control. This experiment was repeated in triplicate. Statistical analysis was performed comparing #33 to other experimental groups using One-Way ANOVA at each time point. For SU.86.86, statistical analysis was performed using an unpaired t-test at each MOI.
- a viral replication curve was performed on cancer cell lines Panc-1 (FIGS. 13A-13B), MiaPaCa-2 (FIGS. 13C-13D), BxPC-3 (FIGS. 13E-13F), SU.86.86 (FIGS. 13G-13H), Capan-1 (FIGS. 13I-13J), and AsPC-1 (FIGS. 13K-13L) by plating cells at 5xl0 5 cells per well in 2mL RPMI 10% FBS, 1% Antibiotic-Antimycotic solution for 24 hours in triplicate.
- Cytotoxicity Assay A cytotoxicity assay was performed on HT-29 (FIGS. 17A-17B) and HCT-116 (FIGS. 17C-17D) cancer cell lines by plating cells at 3xl0 3 per well in l00 ⁇ L ⁇ McCoy's 5A Media, 5% FBS, 1% Antibiotic- Antimycotic solution for 24 hours. 20 ⁇ ⁇ of the virus, either #33,
- OncoVEX GFP , GLV-lh68, or #189 was then added at a multiplicity of infection (MOI) of 1, 0.1, and 0.01.
- MOI multiplicity of infection
- a daily cell viability assay was performed by adding 20 ⁇ . of CellTiter 96 Aqueous One Solution Cell Proliferation Assay to all wells and taking a colorimetric reading after 1 hour of incubation. Experimental results were standardized to a media only and MOI 0 control. This experiment was repeated in triplicate. Statistical analysis was performed comparing #33 to other experimental groups using One-Way ANOVA at each time point.
- a cytotoxicity assay was performed on SW620 (FIGS. 18A-18B), SW480 (FIGS. 18C- 18D), and COLO 320DM (FIGS. 18E-F) cancer cell lines by plating cells at 3xl0 3 per well in ⁇ . RPMI, 5% FBS, 1% Antibiotic-Antimycotic solution for 24 hours. 20 ⁇ . of the virus, either #33, OncoVEX u , GLV-lh68, or #189, was then added at a multiplicity of infection (MOI) of 1, 0.1, and 0.01.
- a daily cell viability assay was performed by adding 20uL of CellTiter 96 Aqueous One Solution Cell Proliferation Assay to all wells and taking a
- a cytotoxicity assay was performed on the LoVo (FIGS. 19A-19B) cancer cell line by plating cells at 3xl0 3 per well in ⁇ . F-12K media, 5% FBS, 1% Antibiotic-Antimycotic solution for 24 hours. 20 ⁇ . of the virus, either #33, OncoVEX GFP , GLV-lh68, or #189, was then added at a multiplicity of infection (MOI) of 1, 0.1, and 0.01.
- a daily cell viability assay was performed by adding 20 ⁇ . of CellTiter 96 Aqueous One Solution Cell Proliferation Assay to all wells and taking a colorimetric reading after 1 hour of incubation. Experimental results were standardized to a media only and MOI 0 control. This experiment was repeated in triplicate. Statistical analysis was performed comparing #33 to other experimental groups using One-Way ANOVA at each time point.
- Viral Growth Curve A viral replication curve was performed on HT-29 (FIGS. 20A-20B) and HCT-116 (FIGS. 20C-20D) cancer cell lines by plating cells at 5xl0 5 cells per well in 2mL McCoy's 5A media 10% FBS, 1% Antibiotic- Antimycotic solution for 24 hours in triplicate.
- a viral replication curve was performed on SW620 (FIGS. 21 A-21B) and SW480 (FIGS. 21C-21D) cancer cell lines by plating cells at 5xl0 5 cells per well in 2mL RPMI 10% FBS, 1%) Antibiotic-Antimycotic solution for 24 hours in triplicate. Media was then aspirated and #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEX GFP , GLV-lh68, or #189 was added at a multiplicity of infection (MOI) 0.01 in 500uL RPMI 2.5% FBS, 1% Antibiotic-Antimycotic solution for 1 hour shaking every 20 minutes.
- MOI multiplicity of infection
- TNB blocking buffer 0.1M Tris-HCl, PH7.5, 0.15 NaCl and 0.5% Blocking Reagent-Perkin Elmer, cat FP1020.
- a 1 :50 dilution of mouse anti -human sodium iodine transporter (hNIS) antibody in TNB blocking buffer was added and incubated overnight at 4°C (ab 17795).
- TNB blocking buffer 0.1M Tris-HCl, PH7.5, 0.15 NaCl and 0.5% Blocking Reagent-Perkin Elmer, cat FP1020.
- a 1 :50 dilution of mouse anti -human sodium iodine transporter (hNIS) antibody in TNB blocking buffer was added and incubated overnight at 4°C(ab 17795).
- mice Nineteen athymic Nude-Fox ⁇ /TM female nude mice (Envigo, Indianapolis, IN) were implanted with 5 x 10 6 bilateral flank tumors of HCT-116. Once tumor dimensions reached approximately 200mm 3 , both tumors were injected with 50 ⁇ . of PBS (2 mice), #33 (3 mice), #33-(SE)hNIS or #33-(H5)Fluc2 at approximately 1 ⁇ 10 ⁇ 5 PFU/dose. Net percent weight change and percent change of the tumors were recorded twice weekly for 42 days. 2 mice per group were sacrificed after 10 days and viral titration and IHC was performed on the organs. All remaining mice were sacrificed at 42 days and viral titration was performed on the mice organs.
- Example 9 Targeting lung cancer with oncolytic virotherapy
- Oncolytic virus-mediated cytotoxicities in lung cancer and lung fibroblast cells 72 h post-infection. 5000 cells of A549, H2199, or HFl fibroblasts were plated in each well of a 96- well plate. The next day, cells were infected with different viruses at the indicated multiplicity of infection (MOI; 0, 0.001, 0.01, 0.1, 1 MOI) or were mock-infected. The viruses used were #33, #33-(H5)Emerald, #189, GLV-lh68, and OncoVEX GFP . Cell viability was determined using CellTiter96AQ ue0 us One Solution (Promega; Cat#G3581), 72 hours post-infection.
- MOI multiplicity of infection
- the viruses used were #33, #33-(H5)Emerald, #189, GLV-lh68, and OncoVEX GFP .
- A549, human lung cancer cells were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 ⁇ L ⁇ .
- A549, human lung cancer cells were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 xL.
- each line represents weight of an individual mouse.
- A549, human lung cancer cells were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 xL.
- each line represents tumor volume for individual mice.
- A549 xenograft model volume of virus-injected tumors in A549 xenograft model.
- A549 human lung cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 xL.
- A549 xenograft model volume of un-injected tumors in A549 xenograft model.
- A549 human lung cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 xL.
- each line represents the average volume of un-injected tumors over time in individual treatment groups with the standard deviation.
- A549 model human lung cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 xL. 100 ⁇ _, of the cell suspension was injected subcutaneously on each side of upper flank of athymic nude mice to generate 2 tumors per mouse.
- the indicated viruses #33, #33-(H5)Emerald, GLV-lh68, OncoVEX GFP , T-VECTM
- Tumors as well as normal organs were harvested.
- Harvested tissues were weighed, chopped in small pieces and homogenized in 1 ml PBS using the Bullet Blender Gold homogenizer. Homogenates were subjected to 3 rounds of freeze-thaw cycle followed by 1 minute of sonication.
- mice Titer of viruses in the ovaries of mice (A549 model).
- FIG. 36 shows viral titer in PFU/g of tissue (ovaries) for each virus. ** D means the virus was not detected.
- Virus titer in blood 20 days post-virus injection A549, human lung cancer cells, were cultured, trysinized, washed with PBS and resuspended in 1 : 1 PBS and matrigel to get 5xl0 6 cells per 100 iL.
- T-VEC talimogene laherparepvec
- Embodiment PI A chimeric poxvirus comprising a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 or SEQ ID NO:2, wherein said nucleic acid sequence comprises nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS.
- cowpox virus strain Brighton raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL
- Embodiment P2 The chimeric poxvirus of embodiment PI, wherein said nucleic acid sequence has a sequence identity of at least 80%.
- Embodiment P3 The chimeric poxvirus of embodiment PI or P2, wherein said nucleic acid sequence has a sequence identity of at least 85%.
- Embodiment P4 The chimeric poxvirus of one of embodiments P1-P3, wherein said nucleic acid sequence has a sequence identity of at least 90%.
- Embodiment P5. The chimeric poxvirus of one of embodiments P1-P4, wherein said nucleic acid sequence has a sequence identity of at least 95%.
- Embodiment P6 The chimeric poxvirus of one of embodiments P1-P5, wherein said nucleic acid sequence has a sequence identity of at least 98%.
- Embodiment P7 The chimeric poxvirus of one of embodiments P1-P6, wherein said nucleic acid fragments are from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- Embodiment P8 The chimeric poxvirus of one of embodiments P1-P6, wherein said nucleic acid fragments are from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- Embodiment P9 The chimeric poxvirus of embodiment PI, wherein said chimeric poxvirus is formed by a method comprising: (i) infecting a cell with at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle- Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) allowing said at least two poxvirus strains to replicate, thereby forming a chimeric poxvirus.
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain
- Embodiment P10 The chimeric poxvirus of embodiment P9, wherein said cell is infected with cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- Embodiment PI 1. The chimeric poxvirus of embodiment P9, wherein said cell is infected with orf virus strain NZ2 and pseudocowpox virus strain TJS.
- Embodiment P12 The chimeric poxvirus of one of embodiments Pl-Pl 1, wherein said chimeric poxvirus is an oncolytic virus.
- Embodiment P13 The chimeric poxvirus of one of embodiments PI -PI 2, wherein said poxvirus comprises a miRNA binding sequence.
- Embodiment P14 The chimeric poxvirus of embodiment P13, wherein said miRNA binding sequence forms part of the DNA polymerase gene of said chimeric poxvirus.
- Embodiment PI 5 An isolated nucleic acid encoding a chimeric poxvirus of one of embodiments P1-P14.
- Embodiment PI 6 A pharmaceutical composition comprising a therapeutically effective amount of a chimeric poxvirus of one of embodiments P1-P14.
- Embodiment PI 7 A method of treating cancer in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of a chimeric poxvirus of one of embodiments PI -PI 4, thereby treating cancer in said subject.
- Embodiment P20 The method of embodiment PI 9, wherein said first chimeric poxvirus comprises a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: l and wherein said nucleic acid sequence comprises nucleic acid fragments from cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain HTD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- Embodiment P21 The method of embodiment P19 or P20, wherein said second chimeric poxvirus comprises a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO:2 and wherein said nucleic acid sequence comprises nucleic acid fragments from orf virus strain NZ2 and pseudocowpox virus strain TJS.
- Embodiment P22 The method of one of embodiments P19-P21, wherein said first chimeric poxvirus and said second chimeric poxvirus are administered at a combined synergistic amount.
- Embodiment P23 The method of one of embodiments P19-P22, wherein said first chimeric poxvirus and said second chimeric poxvirus are administered simultaneously.
- Embodiment P24 The method of one of embodiments P19-P22, wherein said first chimeric poxvirus and said second chimeric poxvirus are administered sequentially.
- Embodiment P25 The method of one of embodimets P19-P24, wherein said poxvirus is administered at least 10 4 plaque forming units (Pfu)/kg.
- Embodiment P26 The method of one of embodiments P19-P25, wherein said poxvirus is administered at least 10 6 plaque forming units (Pfu)/kg.
- Embodiment P27 The method of one of embodiments P19-P26, wherein said poxvirus is administered at about 10 8 plaque forming units (Pfu)/kg.
- Embodiment P28 A method of forming a chimeric poxvirus, said method
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) allowing said at least two poxvirus strains to replicate, thereby forming said chimeric poxvirus.
- poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vac
- Embodiment P29 The method of embodiment P28, wherein said at least two poxvirus strains are each present at a multiplicity of infection of less than about 1.
- Embodiment P30 The method of embodiment P28 or P29, wherein said at least two poxvirus strains are each present at a multiplicity of infection of less than about 0.1.
- Embodiment P31 The method of one of embodiments P28-P30, wherein said at least two poxvirus strains are each present at a multiplicity of infection of about 0.01.
- Embodiment P32 The method of embodiment P28, wherein said cell is infected with cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic and vaccinia virus strain AS.
- Embodiment P33 The method of embodimentP 28, wherein said cell is infected with orf virus strain NZ2 and pseudocowpox virus strain TJS.
- Embodiment P34 The method of one of embodiments P28-P33, wherein said chimeric poxvirus is an oncolytic virus.
- Embodiment P35 The method of one of embodiments P28-P34, wherein said poxvirus comprises a miRNA binding sequence.
- Embodiment P36 A method of inhibiting cell proliferation of a cell, said method comprising contacting a cell with a chimeric poxvirus of one of embodiments P1-P14.
- Embodiment P37 The method of embodiment P36, wherein said cell is a cancer cell.
- Embodiment P38 The method of embodiment P37, wherein said cancer cell is a breast cancer cell, a colon cancer cell, a kidney cancer cell, a leukemia cell, a lung cancer cell, a melanoma cell, an ovarian cancer cell, a prostate cancer cell, a pancreatic cancer cell, a brain cancer cell, a liver cancer cell, a gastric cancer cell or a sarcoma cell.
- said cancer cell is a breast cancer cell, a colon cancer cell, a kidney cancer cell, a leukemia cell, a lung cancer cell, a melanoma cell, an ovarian cancer cell, a prostate cancer cell, a pancreatic cancer cell, a brain cancer cell, a liver cancer cell, a gastric cancer cell or a sarcoma cell.
- Embodiment 1 A chimeric poxvirus comprising a nucleic acid sequence having a sequence identity of at least 70% to SEQ ID NO: 1 or SEQ ID NO:2, wherein said nucleic acid sequence comprises: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain UfD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; (ii) one or more anti-cancer nucleic acid sequences; or (iii) a detectable moiety-encoding nucleic acid sequence.
- Embodiment 2 The chimeric poxvirus of embodiment 1, wherein said nucleic acid sequence comprises: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) one or more anticancer nucleic acid sequences.
- Embodiment 3 The chimeric poxvirus of embodiment 1 or 2, wherein said one or more anti-cancer nucleic acid sequences form part of a non-essential gene of said chimeric poxvirus.
- Embodiment 4 The chimeric poxvirus of embodiment 3, wherein said nonessential gene is a thymidine kinase gene.
- Embodiment 5 The chimeric poxvirus of embodiment 3, wherein said nonessential gene is a F14.5L gene.
- Embodiment 6 The chimeric poxvirus of one of embodiments 1-5, wherein said one or more anti-cancer nucleic acid sequences independently encode a PD-L1 inhibitor or a sodium iodide symporter.
- Embodiment 9 The chimeric poxvirus of one of embodiments 1-8, wherein said one or more anti-cancer nucleic acid sequences are each operably linked to a promoter.
- Embodiment 10 The chimeric poxvirus of embodiment 9, wherein said promoter is a vaccinia virus early promoter.
- Embodiment 11 The chimeric poxvirus of embodiment 9 or 10, wherein said promoter is a synthetic early promoter.
- Embodiment 12 The chimeric poxvirus of embodiment 9, wherein said promoter is a vaccinia virus late promoter.
- Embodiment 13 The chimeric poxvirus of embodiment 9 or 12, wherein said promoter is a H5 promoter or an 1 IK promoter.
- Embodiment 14 The chimeric poxvirus of one of embodiments 1-8, wherein said one or more anti-cancer nucleic acid sequences are operably linked to an essential gene of said chimeric poxvirus.
- Embodiment 15 The chimeric poxvirus of one of embodiments 1-14, wherein said one or more anti-cancer nucleic acid sequences are operably linked to a DNA polymerase gene of said chimeric poxvirus.
- Embodiment 16 The chimeric poxvirus of one of embodiments 1-15, wherein said one or more anti-cancer nucleic acid sequences are operably linked to the 3' end of a DNA polymerase gene of said chimeric poxvirus.
- Embodiment 17 The chimeric poxvirus of one of embodiments 1-16, wherein said one or more anti-cancer nucleic acid sequences are operably linked to a uracil DNA glycosylase gene.
- Embodiment 18 The chimeric poxvirus of one of embodiments 1-17, wherein said one or more anti-cancer nucleic acid sequences are operably linked to the 3 'end of a uracil DNA glycosylase gene.
- Embodiment 19 The chimeric poxvirus of one of embodiments 1-18, wherein said one or more anti-cancer nucleic acid sequences independently encode for a miRNA binding sequence.
- Embodiment 20 The chimeric poxvirus of embodiment 19, wherein said miRNA binding sequence is a miRlOO binding sequence or a let7c binding sequence.
- Embodiment 22 The chimeric poxvirus of embodiment 21, wherein said first anticancer nucleic acid sequence encodes a sodium iodide symporter and said second anti-cancer nucleic acid sequence encodes a miRNA binding sequence.
- Embodiment 25 The chimeric poxvirus of embodiment 21, wherein said first anticancer nucleic acid sequence encodes a sodium iodide symporter and said second anti-cancer nucleic acid sequence encodes a PD-L1 inhibitor.
- Embodiment 26 The chimeric poxvirus of embodiment 25, wherein said first anticancer nucleic acid sequence forms part of a thymidine kinase gene and said second anti-cancer nucleic acid sequence forms part of a F14.5L gene.
- Embodiment 27 The chimeric poxvirus of embodiment 1, wherein said nucleic acid sequence comprises: (i) nucleic acid fragments from at least two poxvirus strains selected from the group consisting of cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, vaccinia virus strain AS, orf virus strain NZ2 and pseudocowpox virus strain TJS; and (ii) said detectable moiety-encoding nucleic acid sequence.
- Embodiment 28 The chimeric poxvirus of embodiment 27, wherein said detectable moiety-encoding nucleic acid sequence encodes a fluorescent moiety.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (19)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020197006987A KR102557818B1 (ko) | 2016-08-09 | 2017-08-09 | 키메라 폭스바이러스 조성물 및 이의 용도 |
| CN201780062335.8A CN110199018B (zh) | 2016-08-09 | 2017-08-09 | 嵌合痘病毒组合物及其用途 |
| KR1020237024342A KR20230113832A (ko) | 2016-08-09 | 2017-08-09 | 키메라 폭스바이러스 조성물 및 이의 용도 |
| CN202410528486.XA CN118834840A (zh) | 2016-08-09 | 2017-08-09 | 嵌合痘病毒组合物及其用途 |
| CA3033512A CA3033512A1 (en) | 2016-08-09 | 2017-08-09 | Chimeric poxvirus compositions and uses thereof |
| CN202410528631.4A CN118853594A (zh) | 2016-08-09 | 2017-08-09 | 嵌合痘病毒组合物及其用途 |
| RU2019106319A RU2757002C2 (ru) | 2016-08-09 | 2017-08-09 | Композиции химерного поксвируса и их применение |
| EP17840232.7A EP3497209A4 (en) | 2016-08-09 | 2017-08-09 | CHEMERICAL POXVIRUS COMPOSITIONS AND THEIR USES |
| BR112019002646-0A BR112019002646B1 (pt) | 2016-08-09 | 2017-08-09 | Composições de poxvírus quimérico e usos das mesmas |
| AU2017311380A AU2017311380A1 (en) | 2016-08-09 | 2017-08-09 | Chimeric poxvirus compositions and uses thereof |
| KR1020257014373A KR20250067190A (ko) | 2016-08-09 | 2017-08-09 | 키메라 폭스바이러스 조성물 및 이의 용도 |
| US16/324,541 US12084687B2 (en) | 2016-08-09 | 2017-08-09 | Chimeric poxvirus compositions and uses thereof |
| MX2019001672A MX2019001672A (es) | 2016-08-09 | 2017-08-09 | Composiciones de poxvirus quiméricos y usos de las mismas. |
| JP2019507161A JP7023929B2 (ja) | 2016-08-09 | 2017-08-09 | キメラポックスウイルス組成物及びその使用 |
| JP2022017693A JP7395628B2 (ja) | 2016-08-09 | 2022-02-08 | キメラポックスウイルス組成物及びその使用 |
| AU2023270200A AU2023270200B2 (en) | 2016-08-09 | 2023-11-20 | Chimeric poxvirus compositions and uses thereof |
| JP2023200433A JP7631485B2 (ja) | 2016-08-09 | 2023-11-28 | キメラポックスウイルス組成物及びその使用 |
| US18/776,109 US20250084384A1 (en) | 2016-08-09 | 2024-07-17 | Chimeric poxvirus compositions and uses thereof |
| JP2025016649A JP2025072482A (ja) | 2016-08-09 | 2025-02-04 | キメラポックスウイルス組成物及びその使用 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662372408P | 2016-08-09 | 2016-08-09 | |
| US62/372,408 | 2016-08-09 | ||
| US201762519010P | 2017-06-13 | 2017-06-13 | |
| US62/519,010 | 2017-06-13 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/324,541 A-371-Of-International US12084687B2 (en) | 2016-08-09 | 2017-08-09 | Chimeric poxvirus compositions and uses thereof |
| US18/776,109 Continuation US20250084384A1 (en) | 2016-08-09 | 2024-07-17 | Chimeric poxvirus compositions and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018031694A1 true WO2018031694A1 (en) | 2018-02-15 |
Family
ID=61163330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/046163 Ceased WO2018031694A1 (en) | 2016-08-09 | 2017-08-09 | Chimeric poxvirus compositions and uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US12084687B2 (https=) |
| EP (1) | EP3497209A4 (https=) |
| JP (4) | JP7023929B2 (https=) |
| KR (3) | KR20230113832A (https=) |
| CN (3) | CN118853594A (https=) |
| AU (2) | AU2017311380A1 (https=) |
| CA (1) | CA3033512A1 (https=) |
| MX (1) | MX2019001672A (https=) |
| RU (2) | RU2757002C2 (https=) |
| WO (1) | WO2018031694A1 (https=) |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019170820A1 (en) * | 2018-03-07 | 2019-09-12 | Transgene | Parapoxvirus vectors |
| WO2019213173A1 (en) * | 2018-04-30 | 2019-11-07 | City Of Hope | Neural stem cell compositions including chimeric poxviruses for cancer treatment |
| US10512662B2 (en) | 2016-02-25 | 2019-12-24 | Memorial Sloan Kettering Cancer Center | Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy |
| US10548930B2 (en) | 2015-04-17 | 2020-02-04 | Memorial Sloan Kettering Cancer Center | Use of MVA or MVAΔE3L as immunotherapeutic agents against solid tumors |
| US10639366B2 (en) | 2015-02-25 | 2020-05-05 | Memorial Sloan Kettering Cancer Center | Use of inactivated nonreplicating modified vaccinia virus Ankara (MVA) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors |
| US10736962B2 (en) | 2016-02-25 | 2020-08-11 | Memorial Sloan Kettering Cancer Center | Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors |
| RU2757002C2 (ru) * | 2016-08-09 | 2021-10-08 | Сити Оф Хоуп | Композиции химерного поксвируса и их применение |
| US11242509B2 (en) | 2017-05-12 | 2022-02-08 | Memorial Sloan Kettering Cancer Center | Vaccinia virus mutants useful for cancer immunotherapy |
| US11759480B2 (en) | 2017-02-28 | 2023-09-19 | Endocyte, Inc. | Compositions and methods for CAR T cell therapy |
| US11779602B2 (en) | 2018-01-22 | 2023-10-10 | Endocyte, Inc. | Methods of use for CAR T cells |
| WO2023213763A1 (en) * | 2022-05-02 | 2023-11-09 | Transgene | Poxvirus encoding a binding agent comprising an anti- pd-l1 sdab |
| WO2024038175A1 (en) | 2022-08-18 | 2024-02-22 | Transgene | Chimeric poxviruses |
| US12144850B2 (en) | 2016-04-08 | 2024-11-19 | Purdue Research Foundation | Methods and compositions for car T cell therapy |
| US12150981B2 (en) | 2012-12-20 | 2024-11-26 | Purdue Research Foundation | Chimeric antigen receptor-expressing T cells as anti-cancer therapeutics |
| US12240870B2 (en) | 2018-02-23 | 2025-03-04 | Purdue Research Foundation | Sequencing method for CAR T cell therapy |
| WO2024245722A3 (en) * | 2023-05-26 | 2025-03-13 | Probiogen Ag | Rapid selection system for the generation of recombinant enveloped viruses |
| US12252702B2 (en) | 2018-09-15 | 2025-03-18 | Memorial Sloan Kettering Cancer Center | Recombinant poxviruses for cancer immunotherapy |
| EP4162941A4 (en) * | 2020-04-30 | 2025-06-25 | Hangzhou Converd Co., Ltd. | ISOLATED RECOMBINANT ONCOLYTIC POXVIRUS WITH REGULATION AND CONTROL BY MICRONA AND USE THEREOF |
| US12364724B2 (en) | 2017-08-11 | 2025-07-22 | City Of Hope | Oncolytic virus expressing a car T cell target and uses thereof |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2614309A (en) | 2021-12-24 | 2023-07-05 | Stratosvir Ltd | Improved vaccinia virus vectors |
| WO2025184411A1 (en) | 2024-02-27 | 2025-09-04 | Calidi Biotherapeutics (Nevada), Inc. | Serum-resistant eev viruses and uses thereof |
| CN120718864B (zh) * | 2025-08-28 | 2025-11-28 | 山东农业大学 | 一种高度不成熟鸭坦布苏病毒及其培养方法和应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6352856B1 (en) * | 1998-01-16 | 2002-03-05 | Baxter Vaccine Ag | Chimeric poxvirus comprising sequences of a retroviral vector component |
| US20120308484A1 (en) | 2011-04-15 | 2012-12-06 | Szalay Aladar A | Clonal strains of attenuated vaccinia viruses and methods of use thereof |
| US20130071430A1 (en) * | 2010-04-09 | 2013-03-21 | The University Of Tokyo | Microrna-controlled recombinant vaccinia virus and use thereof |
| US20130323201A1 (en) * | 2012-05-18 | 2013-12-05 | Lyn Marie WISE | Combination Treatments and Compositions for Wound Healing |
| US20150175976A1 (en) * | 2006-10-16 | 2015-06-25 | Genelux Corporation | Modified vaccinia virus strains for use in diagnostic and therapeutic methods |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1268763A2 (en) | 2000-03-28 | 2003-01-02 | University Of Rochester | Methods of producing a library and methods of selecting polynucleotides |
| CA2501168A1 (en) * | 2002-11-25 | 2004-06-10 | Bavarian Nordic A/S | Recombinant poxvirus comprising at least two cowpox ati promoters |
| ATE420160T1 (de) * | 2003-06-18 | 2009-01-15 | Genelux Corp | Modifizierte rekombinante vacciniaviren, verwendungen davon |
| HRP20150360T1 (hr) * | 2007-11-19 | 2015-05-08 | Transgene Sa | Poksvirusni onkolitiäśki vektori |
| US10238700B2 (en) | 2014-01-02 | 2019-03-26 | Genelux Corporation | Oncolytic virus adjunct therapy with agents that increase virus infectivity |
| KR20230113832A (ko) * | 2016-08-09 | 2023-08-01 | 시티 오브 호프 | 키메라 폭스바이러스 조성물 및 이의 용도 |
-
2017
- 2017-08-09 KR KR1020237024342A patent/KR20230113832A/ko not_active Ceased
- 2017-08-09 CA CA3033512A patent/CA3033512A1/en active Pending
- 2017-08-09 CN CN202410528631.4A patent/CN118853594A/zh active Pending
- 2017-08-09 EP EP17840232.7A patent/EP3497209A4/en active Pending
- 2017-08-09 JP JP2019507161A patent/JP7023929B2/ja active Active
- 2017-08-09 US US16/324,541 patent/US12084687B2/en active Active
- 2017-08-09 CN CN201780062335.8A patent/CN110199018B/zh active Active
- 2017-08-09 KR KR1020257014373A patent/KR20250067190A/ko active Pending
- 2017-08-09 AU AU2017311380A patent/AU2017311380A1/en not_active Abandoned
- 2017-08-09 CN CN202410528486.XA patent/CN118834840A/zh active Pending
- 2017-08-09 WO PCT/US2017/046163 patent/WO2018031694A1/en not_active Ceased
- 2017-08-09 KR KR1020197006987A patent/KR102557818B1/ko active Active
- 2017-08-09 RU RU2019106319A patent/RU2757002C2/ru active
- 2017-08-09 RU RU2021128158A patent/RU2021128158A/ru unknown
- 2017-08-09 MX MX2019001672A patent/MX2019001672A/es unknown
-
2022
- 2022-02-08 JP JP2022017693A patent/JP7395628B2/ja active Active
-
2023
- 2023-11-20 AU AU2023270200A patent/AU2023270200B2/en active Active
- 2023-11-28 JP JP2023200433A patent/JP7631485B2/ja active Active
-
2024
- 2024-07-17 US US18/776,109 patent/US20250084384A1/en active Pending
-
2025
- 2025-02-04 JP JP2025016649A patent/JP2025072482A/ja active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6352856B1 (en) * | 1998-01-16 | 2002-03-05 | Baxter Vaccine Ag | Chimeric poxvirus comprising sequences of a retroviral vector component |
| US20150175976A1 (en) * | 2006-10-16 | 2015-06-25 | Genelux Corporation | Modified vaccinia virus strains for use in diagnostic and therapeutic methods |
| US20130071430A1 (en) * | 2010-04-09 | 2013-03-21 | The University Of Tokyo | Microrna-controlled recombinant vaccinia virus and use thereof |
| US20120308484A1 (en) | 2011-04-15 | 2012-12-06 | Szalay Aladar A | Clonal strains of attenuated vaccinia viruses and methods of use thereof |
| US20130323201A1 (en) * | 2012-05-18 | 2013-12-05 | Lyn Marie WISE | Combination Treatments and Compositions for Wound Healing |
Non-Patent Citations (15)
| Title |
|---|
| BLASCO ET AL.: "Dissociation of Progeny Vaccinia Virus from the Cell Membrane is Regulated by a Viral Envelope Glycoprotein: Effect of a point Mutation in the Lectin Homology Domain of the A34R Gene", JOURNAL OF VIROLOGY, vol. 67, no. 6, 1993, pages 3319 - 3325, XP002409050 |
| BLASCO R., SISLER J.R. & MOSS B.: "Dissociation of progeny vaccinia virus from the cell membrane is regulated by a viral envelope glycoprotein: effect of a point mutation in the lectin homology domain of the A34R gene.", JOURNAL OF VIROLOGY, vol. 67, no. 6, 1 June 1993 (1993-06-01), US , pages 3319 - 3325, XP002409050, ISSN: 0022-538X |
| CHAURASIYA ET AL.: "A chimeric poxvirus with J2R (thymidine kinase) deletion shows safety and anti-tumor activity in lung cancer models", CANCER GENE THERAPY, vol. 27, 17 June 2019 (2019-06-17), pages 125 - 135, XP037096068, DOI: 10.1038/s41417-019-0114-x |
| CHAURASIYA SHYAMBABU, YANG ANNIE, ZHANG ZHIFANG, LU JIANMING, VALENCIA HANNAH, KIM SANG-IN, WOO YANGHEE, WARNER SUANNE G., OLAFSEN: "A comprehensive preclinical study supporting clinical trial of oncolytic chimeric poxvirus CF33-hNIS-anti-PD-L1 to treat breast cancer", MOLECULAR THERAPY- METHODS & CLINICAL DEVELOPMENT, vol. 24, 1 March 2022 (2022-03-01), GB , pages 102 - 116, XP093080747, ISSN: 2329-0501, DOI: 10.1016/j.omtm.2021.12.002 |
| CHAURASIYA SHYAMBABU; CHEN NANHAI G.; LU JIANMING; MARTIN NIKOLAS; SHEN YINAN; KIM SANG-IN; WARNER SUSANNE G.; WOO YANGHEE; FONG Y: "A chimeric poxvirus with(thymidine kinase) deletion shows safety and anti-tumor activity in lung cancer models", CANCER GENE THERAPY, vol. 27, no. 3-4, 17 June 2019 (2019-06-17), New York, pages 125 - 135, XP037096068, ISSN: 0929-1903, DOI: 10.1038/s41417-019-0114-x |
| DATABASE Genbank [O] 10 April 2003 (2003-04-10), ESPOSITO, JJ ET AL.: "Vaccinia virus WR, complete genome", XP055463898, Database accession no. AY243312.1 * |
| DUMBELL K. R., BEDSON H. S.: "The use of ceiling temperature and reactivation in the isolation of pox virus hybrids", JOURNAL OF HYGIENE, vol. 62, no. 2, 1 June 1964 (1964-06-01), GB , pages 133 - 140, XP093080717, ISSN: 0022-1724, DOI: 10.1017/S0022172400039863 |
| FENNER ET AL.: "Genetic studies with Mammalian Poxviruses. II. Recombination between Two Strains of Vaccinia Virus in Single HeLa Cells", VIROLOGY, vol. 8, no. 4, 1959, pages 499 - 507, XP023051896, DOI: 10.1016/0042-6822(59)90051-0 |
| HANSEN ET AL.: "Recombinant viruses obtained from co-infection in vitro with a live vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus display different plaque phenotypes and loss of the transgene", VACCINE, vol. 23, 29 July 2004 (2004-07-29), pages 499 - 506, XP004629185, DOI: 10.1016/j.vaccine.2004.06.032 |
| ICHIHASHI, YASUO; MATSUMOTO, SEIICHI: "Genetic study of poxgroup viruses", UIRUSU, vol. 19, no. 4, 1969, JP , pages 155 - 163, XP009547642, ISSN: 0042-6857, DOI: 10.2222/jsv.19.155 |
| KIRN DAVID H., WANG YAOHE, LIANG WENCHUNG, CONTAG CHRISTOPHER H., THORNE STEPHEN H.: "Enhancing Poxvirus Oncolytic Effects through Increased Spread and Immune Evasion", CANCER RESEARCH, vol. 68, no. 7, 1 April 2008 (2008-04-01), US, pages 2071 - 2075, XP093080710, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-07-6515 |
| O'LEARY ET AL.: "A novel oncolytic chimeric orthopoxvirus encoding luciferase enables real-time view of colorectal cancer cell infection", MOLECULAR THERAPY: ONCOLYTICS, vol. 9, 8 June 2018 (2018-06-08), XP055659837, DOI: 10.1016/j.omto.2018.03.001 |
| SUTTER ET AL.: "Nonreplicating vaccinia vector efficiently expresses recombinant genes", PROC. NATL. ACAD. SCI. USA, vol. 89, November 1992 (1992-11-01), pages 10847 - 10851, XP002299581, DOI: 10.1073/pnas.89.22.10847 |
| SUTTER GERD ET AL: "Nonreplicating vaccinia vector efficiently expresses recombinant genes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 89, no. 22, 1 November 1992 (1992-11-01), pages 10847 - 10851, XP002299581, ISSN: 0027-8424, DOI: 10.1073/pnas.89.22.10847 |
| WOODROOFE ET AL.: "Genetic studies with mammalian poxviruses. IV. Hybridization between several different poxviruses", VIROLOGY, vol. 12, pages 272 - 282, XP023055341, DOI: 10.1016/0042-6822(60)90200-2 |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12150981B2 (en) | 2012-12-20 | 2024-11-26 | Purdue Research Foundation | Chimeric antigen receptor-expressing T cells as anti-cancer therapeutics |
| US11426460B2 (en) | 2015-02-25 | 2022-08-30 | Memorial Sloan Kettering Cancer Center | Use of inactivated nonreplicating modified vaccinia virus Ankara (MVA) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors |
| US10639366B2 (en) | 2015-02-25 | 2020-05-05 | Memorial Sloan Kettering Cancer Center | Use of inactivated nonreplicating modified vaccinia virus Ankara (MVA) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors |
| US12397029B2 (en) | 2015-04-17 | 2025-08-26 | Memorial Sloan Kettering Cancer Center | Use of MVA or MVADELTAE3L as immunotherapeutic agents against solid tumors |
| US10548930B2 (en) | 2015-04-17 | 2020-02-04 | Memorial Sloan Kettering Cancer Center | Use of MVA or MVAΔE3L as immunotherapeutic agents against solid tumors |
| US11253560B2 (en) | 2015-04-17 | 2022-02-22 | Memorial Sloan Kettering Cancer Center | Use of MVA or MVAΔE3L as immunotherapeutic agents against solid tumors |
| US10765711B2 (en) | 2016-02-25 | 2020-09-08 | Memorial Sloan Kettering Cancer Center | Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human FLT3L or GM-CSF for cancer immunotherapy |
| US12036279B2 (en) | 2016-02-25 | 2024-07-16 | Memorial Sloan Kettering Cancer Center | Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors |
| US11986503B2 (en) | 2016-02-25 | 2024-05-21 | Memorial Sloan Kettering Cancer Center | Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy |
| US10736962B2 (en) | 2016-02-25 | 2020-08-11 | Memorial Sloan Kettering Cancer Center | Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors |
| US11285209B2 (en) | 2016-02-25 | 2022-03-29 | Memorial Sloan Kettering Cancer Center | Recombinant MVA or MVAΔE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors |
| US10512662B2 (en) | 2016-02-25 | 2019-12-24 | Memorial Sloan Kettering Cancer Center | Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy |
| US11541087B2 (en) | 2016-02-25 | 2023-01-03 | Memorial Sloan Kettering Cancer Center | Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy |
| US12144850B2 (en) | 2016-04-08 | 2024-11-19 | Purdue Research Foundation | Methods and compositions for car T cell therapy |
| RU2757002C2 (ru) * | 2016-08-09 | 2021-10-08 | Сити Оф Хоуп | Композиции химерного поксвируса и их применение |
| US11759480B2 (en) | 2017-02-28 | 2023-09-19 | Endocyte, Inc. | Compositions and methods for CAR T cell therapy |
| US11850262B2 (en) | 2017-02-28 | 2023-12-26 | Purdue Research Foundation | Compositions and methods for CAR T cell therapy |
| US11242509B2 (en) | 2017-05-12 | 2022-02-08 | Memorial Sloan Kettering Cancer Center | Vaccinia virus mutants useful for cancer immunotherapy |
| US11884939B2 (en) | 2017-05-12 | 2024-01-30 | Memorial Sloan Kettering Cancer Center | Vaccinia virus mutants useful for cancer immunotherapy |
| US12364724B2 (en) | 2017-08-11 | 2025-07-22 | City Of Hope | Oncolytic virus expressing a car T cell target and uses thereof |
| US11779602B2 (en) | 2018-01-22 | 2023-10-10 | Endocyte, Inc. | Methods of use for CAR T cells |
| US12269862B2 (en) | 2018-01-22 | 2025-04-08 | Endocyte, Inc. | Methods of use for CAR T cells |
| US12240870B2 (en) | 2018-02-23 | 2025-03-04 | Purdue Research Foundation | Sequencing method for CAR T cell therapy |
| WO2019170820A1 (en) * | 2018-03-07 | 2019-09-12 | Transgene | Parapoxvirus vectors |
| JP2021516957A (ja) * | 2018-03-07 | 2021-07-15 | トランジェーヌTransgene | パラポックスウイルスベクター |
| CN112512560A (zh) * | 2018-03-07 | 2021-03-16 | 特兰斯吉恩股份有限公司 | 副痘病毒属载体 |
| US12377142B2 (en) | 2018-03-07 | 2025-08-05 | Transgene | Recombinant pseudocowpoxvirus |
| WO2019213173A1 (en) * | 2018-04-30 | 2019-11-07 | City Of Hope | Neural stem cell compositions including chimeric poxviruses for cancer treatment |
| US12252702B2 (en) | 2018-09-15 | 2025-03-18 | Memorial Sloan Kettering Cancer Center | Recombinant poxviruses for cancer immunotherapy |
| EP4162941A4 (en) * | 2020-04-30 | 2025-06-25 | Hangzhou Converd Co., Ltd. | ISOLATED RECOMBINANT ONCOLYTIC POXVIRUS WITH REGULATION AND CONTROL BY MICRONA AND USE THEREOF |
| WO2023213763A1 (en) * | 2022-05-02 | 2023-11-09 | Transgene | Poxvirus encoding a binding agent comprising an anti- pd-l1 sdab |
| WO2024038175A1 (en) | 2022-08-18 | 2024-02-22 | Transgene | Chimeric poxviruses |
| WO2024245722A3 (en) * | 2023-05-26 | 2025-03-13 | Probiogen Ag | Rapid selection system for the generation of recombinant enveloped viruses |
Also Published As
| Publication number | Publication date |
|---|---|
| JP7631485B2 (ja) | 2025-02-18 |
| JP7395628B2 (ja) | 2023-12-11 |
| CN110199018A (zh) | 2019-09-03 |
| JP2024026191A (ja) | 2024-02-28 |
| CA3033512A1 (en) | 2018-02-15 |
| RU2021128158A (ru) | 2022-04-07 |
| CN118853594A (zh) | 2024-10-29 |
| AU2017311380A1 (en) | 2019-03-28 |
| RU2757002C2 (ru) | 2021-10-08 |
| KR102557818B1 (ko) | 2023-07-20 |
| US20190218522A1 (en) | 2019-07-18 |
| BR112019002646A2 (pt) | 2019-10-08 |
| AU2023270200A1 (en) | 2024-01-25 |
| EP3497209A1 (en) | 2019-06-19 |
| EP3497209A4 (en) | 2020-07-29 |
| RU2019106319A3 (https=) | 2021-03-17 |
| CN118834840A (zh) | 2024-10-25 |
| US20250084384A1 (en) | 2025-03-13 |
| JP2022065034A (ja) | 2022-04-26 |
| MX2019001672A (es) | 2019-06-06 |
| JP2025072482A (ja) | 2025-05-09 |
| AU2023270200B2 (en) | 2026-02-05 |
| US12084687B2 (en) | 2024-09-10 |
| CN110199018B (zh) | 2024-06-07 |
| KR20230113832A (ko) | 2023-08-01 |
| RU2019106319A (ru) | 2020-09-17 |
| KR20190038626A (ko) | 2019-04-08 |
| KR20250067190A (ko) | 2025-05-14 |
| JP7023929B2 (ja) | 2022-02-22 |
| JP2019524131A (ja) | 2019-09-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2023270200B2 (en) | Chimeric poxvirus compositions and uses thereof | |
| JP6912199B2 (ja) | 免疫腫瘍溶解療法 | |
| EP2415783B1 (en) | Modified vaccinia virus strains for use in a diagnostic and therapeutic method | |
| US11279752B2 (en) | Tumor-selective CTLA-4 antagonists | |
| US11602554B2 (en) | P53-targeting vaccines and pd-1 pathway inhibitors and methods of use thereof | |
| JP2010533718A (ja) | 腫瘍溶解性ウイルス治療に付随する副作用の処置もしくは改善用医薬の製造における化学治療剤の使用 | |
| US20230227549A1 (en) | Oncolytic virus compositions and methods for the treatment of cancer | |
| Li et al. | Oncolytic virotherapy for ovarian cancer | |
| JP2022520220A (ja) | 組換えワクシニアウイルスおよびその使用方法 | |
| WO2022174103A2 (en) | Monoclonal antibodies specific for human ror1 | |
| JP2021106576A (ja) | 変異体腫瘍溶解性ワクシニアウイルスおよびその使用法 | |
| US12589112B2 (en) | Oncolytic virus compositions including IL-15 complex and methods for the treatment of cancer | |
| US20210052660A1 (en) | Neural stem cell compositions including chimeric poxviruses for cancer treatment | |
| JP6524208B2 (ja) | 新たな医薬及びその使用 | |
| US20200199681A1 (en) | Mda-7 cancer therapies and methods of detecting biomolecules | |
| US20250186520A1 (en) | Oncolytic virus compositions and methods for the treatment of cancer | |
| JP2025522951A (ja) | 腫瘍溶解性ワクシニアウイルスおよび組換えウイルスならびにその使用方法 | |
| BR112019002646B1 (pt) | Composições de poxvírus quimérico e usos das mesmas | |
| WO2020163553A1 (en) | Mda-7/il-24 for cancer treatment and methods of monitoring same | |
| WO2021231982A1 (en) | Smc1a antibodies and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17840232 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3033512 Country of ref document: CA Ref document number: 2019507161 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20197006987 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2017840232 Country of ref document: EP Effective date: 20190311 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019002646 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2017311380 Country of ref document: AU Date of ref document: 20170809 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112019002646 Country of ref document: BR Free format text: APRESENTE DOCUMENTO DE CESSAO INFORMANDO O NUMERO DA PRIORIDADE REIVINDICADA (US 62/519,010 DE 13.06.2017), UMA VEZ QUE NA CESSAO APRESENTADA NAO E INFORMADO O NUMERO DESTA PRIORIDADE. |
|
| ENP | Entry into the national phase |
Ref document number: 112019002646 Country of ref document: BR Kind code of ref document: A2 Effective date: 20190208 |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 1020257014373 Country of ref document: KR |