WO2017214202A1 - Thermostable polymerase inhibitor compositions and methods - Google Patents
Thermostable polymerase inhibitor compositions and methods Download PDFInfo
- Publication number
- WO2017214202A1 WO2017214202A1 PCT/US2017/036225 US2017036225W WO2017214202A1 WO 2017214202 A1 WO2017214202 A1 WO 2017214202A1 US 2017036225 W US2017036225 W US 2017036225W WO 2017214202 A1 WO2017214202 A1 WO 2017214202A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aptamer
- sequence
- seq
- polymerase
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/532—Closed or circular
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
- C12N2320/52—Methods for regulating/modulating their activity modulating the physical stability, e.g. GC-content
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/205—Aptamer
Definitions
- This disclosure relates generally to nucleic acid inhibitors of
- thermostable polymerase activity compositions comprising the inhibitors, and methods of their use.
- the nucleic acid inhibitors can adapt a secondary structure to reversibly inhibit thermostable polymerases, wherein the inhibitory activity is temperature dependent.
- the inhibitors are useful for methods and assays which include nucleic acid synthesis by the thermostable polymerase wherein the methods and assays benefit from utilizing a hot start method.
- thermostable polymerase activity at lower temperatures where such mispriming is more likely to occur.
- the inhibitory activity is removed and the thermostable polymerase extends primer(s) bound to substrate nucleic acid molecules.
- This method of reversibly inhibiting a thermophilic DNA polymerase to prevent primer extension at lower temperatures is referred to as "hot-start.”
- Hot start may be accomplished by various physical, chemical, or biochemical methods.
- a physical hot start the DNA polymerase or one or more reaction components that are essential for DNA polymerase activity is not allowed to contact the sample DNA until all the components required for the reaction are at a high temperature (Horton, R.M. et al. , Biotechniques, 16;42-43, 1994).
- Chemical hot start refers to a method which involves use of a DNA polymerase which is inactivated chemically but reversibly, such that the polymerase is inhibited at ambient temperatures and most active at higher temperatures (U.S. Pat. Nos. 5,773,258 and 6, 183,998).
- Another way of implementing a hot start is to combine the DNA polymerase enzyme with an anti- DNA polymerase antibody before adding it to the reagent.
- the antibody inhibits the polymerase activity at ambient temperature but at the high polymerase reaction temperature, the antibody is denatured and dissociates from the polymerase, allowing activation of the polymerase (Sharkey et al.,
- thermophilic DNA polymerase Another method for inhibiting thermophilic DNA polymerase at ambient temperatures involves the use of a nucleic acid aptamer which binds to and inhibits the DNA polymerase (US Patent No. 6, 183,967).
- Aptamers are nucleic acid molecules having specific binding affinity to molecules through interactions other than classic Watson-Crick base pairing.
- Various aptamers have been selected and designed to exhibit specificity and affinity for thermostable polymerases and have been shown to be capable of reversibly inhibiting the polymerases.
- aptamers are designed to bind and inhibit a thermostable polymerase at ambient temperatures. A subsequent increase in temperature results in the dissociation of the aptamer from the thermostable polymerase to allow primer extension and/or nucleic acid amplification at high reaction temperatures.
- aptamers that bind and inhibit the polymerase in the appropriate temperature range, such as the temperature range for optimal polymerase activity, but which also dissociate from the polymerase at temperatures which allow optimal thermostable polymerase activity at temperatures when selected primers are hybridized to a target nucleic acid substrate.
- aptamers which can form a secondary structure and which can reduce generation of nonspecific polymerase products in various assays which rely on thermostable polymerase activity but which can dissociate from the polymerase to facilitate target product generation and detection.
- an aptamer comprises in a 5' to 3' direction: a first nucleotide sequence comprising
- TAT AATTG CAAAATAA (SEQ ID NO: 1 ) or a variant thereof or
- TTATTTTGCAATTATA SEQ ID NO:2 or a variant thereof
- a second nucleotide sequence comprising TTCTTAGCGTTT (SEQ ID NO:3) or a variant thereof
- a third nucleotide sequence comprising SEQ ID NO:1 or a variant thereof or SEQ ID NO:2 or a variant thereof
- a fourth nucleotide sequence comprising SEQ ID NO:3 or a variant thereof, wherein the first sequence is complementary to the second sequence.
- the aptamer has a secondary structure wherein the first and third nucleotide sequences hybridize at temperatures below about 45°C, 42°C, 40°C, 39°C , or 38°C to form a stem and each of the second and third nucleotide sequences remain single stranded to form a loop, wherein the stem is positioned between the loops formed by the second and third nucleotide sequences.
- a covalent bond is present between the 5' end of the first sequence and the 3' end of the fourth sequence.
- the covalent bond is a phosphodiester bond.
- the variant of SEQ ID NO: 1 comprises 1 , 2, 3 or 4 nucleotide substitutions and the third nucleotide sequence is complementary to the variant of SEQ ID NO:2 wherein there are no mismatches between SEQ ID NO: 1 and SEQ ID NO:2.
- the variant of SEQ I D NO:2 comprises 1 , 2, 3 or 4 nucleotide substitutions and the first nucleotide sequence is complementary to the variant of SEQ ID NO:2 wherein there are no mismatches between SEQ ID NO: 1 and SEQ ID NO:2.
- each of the first sequence and the third sequence is 14-18, 15-16 or 16-17 nucleotides in length. In still other words, each of the first sequence and the third sequence is 14-18, 15-16 or 16-17 nucleotides in length. In still other words
- each of the first sequence and the third sequence is 14, 15, 16, 17 or 18 nucleotides in length. In a particular embodiment, each of the first sequence and the third sequence is 16 nucleotides in length.
- the first sequence comprises SEQ ID NO: 1 and the second sequence comprises SEQ ID NO:2. In still other embodiments, the first sequence consists of SEQ ID NO: 1 and the second sequence consists of SEQ ID NO:2.
- the first sequence is selected from the group consisting of SEQ ID NO: 1 1 -41 or a variant thereof, wherein the variant comprises 1 , 2, 3 or 4 nucleotide substitutions.
- the third sequence is the same length as the first sequence, and the third sequence is complementary to the first sequence, wherein there are no mismatches between the first sequence and the third sequence.
- the first sequence is selected from the group consisting of SEQ I D NO: 1 1 -41 .
- the second sequence is identical to the fourth sequence along the entire length of the second and fourth sequences.
- each of the second and fourth sequences is 12 nucleotides in length.
- the second sequence comprises SEQ ID NO:3 and the fourth sequence comprises SEQ ID NO:3. In other embodiments, the second sequence consists of SEQ ID NO:3 and the fourth sequence consists of SEQ ID NO:3.
- the aptamer does not have a 5' end or a 3' end.
- the aptamer comprises a 5' end and a 3' end, wherein there is no covalent bond between 2 nucleotides within the first sequence or within the second sequence. In other embodiments, there is no covalent bond between nucleotides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 1 1 , 1 1 and 12, 12 and 13, 13 and 14, 14 and 15 or 15 and 16 of SEQ ID NO: 1 or of SEQ ID NO:2.
- the first sequence comprises SEQ ID NO: 1 and the third sequence comprises SEQ I D NO:2, and there is no phosphodiester bond between nucleotides 8 and 9 of SEQ I D NO: 1 .
- the first sequence comprises SEQ ID NO:2 and the third sequence comprises SEQ ID NO: 1 , and there is no phosphodiester bond between nucleotides 8 and 9 of SEQ ID NO:2.
- the first and third sequences of the aptamer are hybridized to each other in a double stranded configuration.
- the first and third sequences of the aptamer are hybridized to each other in a double stranded configuration when the aptamer is in a solution at 25°C or at 37°C.
- the solution has a pH of about 6 to 8.
- both the second sequence and the fourth sequence are in a single stranded configuration. In other embodiments, both the second sequence and the fourth sequence are in a single stranded configuration when the aptamer is in a solution at 25°C or at 37°C. In still other embodiments, the solution has a pH of about 6 to 8.
- the aptamer has a melting temperature ranging from about 40°C to 50°C, 45°C to 65°C, 45°C to 60°C, 45°C to 55°C, 45°C to 50°C, 50°C to 65°C or 50°C to 60°C.
- the aptamer comprises a sequence selected from the group consisting of SEQ ID NO:42-53 or a variant thereof wherein the variant comprises 1 , 2, 3 or 4 nucleotide substitutions.
- the variant comprises 1 , 2, 3 or 4 nucleotide substitutions.
- the aptamer comprises a sequence selected from the group consisting of SEQ ID NO:42-53. In still other embodiments, the aptamer has a 5' end and a 3' end.
- the 5' end of the aptamer comprises a phosphate group.
- the 3' end of the aptamer comprises a phosphate group.
- the 5' and the 3' end each comprise a phosphate group.
- the 3' end of the aptamer is linked to a 3' capping moiety.
- the 5' end of the aptamer is linked to a 5' capping moiety.
- the 3' end of the aptamer is linked to the 5' capping moiety and the 3' end of the aptamer is linked to the 5' capping moiety.
- the 5' capping moiety is selected from the group consisting of an amine group and an inverted deoxythymidine cap.
- the 3' capping moiety linked to the 3' end is selected from the group consisting of a phosphate, an inverted deoxythymidine cap and a propanediol spacer (C3).
- the aptamer comprises
- G-C3 (SEQ ID NO: 106);
- G-C3 (SEQ ID NO: 1 10); or
- an aptamer comprising in a 5' to 3' direction a first polynucleotide comprising SEQ ID NO:4 or a variant thereof or SEQ I D NO:5 or a variant thereof, a second polynucleotide comprising SEQ ID NO:3 or a variant thereof, a third polynucleotide comprising SEQ ID NO:5 or a variant thereof or SEQ ID NO:4 or a variant thereof, and a fourth polynucleotide comprising SEQ I D NO:3 or a variant thereof or SEQ ID NO:5 or a variant thereof, wherein each of the second and fourth sequences are 14-18 nucleotides in length, are equal in length, and are complementary to each other along their entire length; and wherein the aptamer comprises a 5' end and a 3' end.
- each of the second and fourth polynucleotides do not anneal to another region of the aptamer and each of the second and fourth polynucleotides form a first and a second loop.
- the stem is positioned between the first and second loops.
- the 3' end of the fourth sequence is covalently bound to the 5' end of the first sequence and there is no phosphodiester bond between 2 nucleotides within the fourth sequence.
- the 3' end of the fourth sequence is covalently bound to the 5' end of the first sequence and there is no phosphodiester bond between the last nucleotide of the third sequence and the first nucleotide of the fourth sequence.
- the first polynucleotide comprises the sequence selected from the group consisting of SEQ ID Nos:54-77.
- polynucleotide are the same length. In still other embodiments, there is no mismatch between the first polynucleotide and the third polynucleotide.
- the first sequence is identical to the third sequence along the entire length of the first and third sequences.
- each of the first and third sequences is 12 nucleotides in length.
- the first sequence comprises SEQ ID NO:3 and the third sequence comprises SEQ I D NO:3. In other embodiments, the first sequence consists of SEQ I D NO:3 and the third sequence consists of SEQ ID NO:3.
- the aptamer comprises a sequence selected from the group consisting of SEQ ID NOs:82-105.
- the 5' end of the aptamer comprises a phosphate group.
- the 3' end of the aptamer comprises a phosphate group.
- the 5' and the 3' end each comprise a phosphate group.
- the 3' end of the aptamer is linked to a 3' capping moiety.
- the 5' end of the aptamer is linked to a 5' capping moiety.
- the 3' end of the aptamer is linked to the 5' capping moiety and the 3' end of the aptamer is linked to the 5' capping moiety.
- the 5' capping moiety is selected from the group consisting of an amine group and an inverted deoxythymidine cap.
- the 3' capping moiety linked to the 3' end is selected from the group consisting of a phosphate, an inverted deoxythymidine cap and a propanediol spacer (C3).
- composition comprising a thermostable polymerase and an aptamer according to any of the foregoing aspects and embodiments, wherein the aptamer inhibits the activity of the polymerase.
- the molar ratio of aptamer: polymerase in the composition ranges from about 1 : 1 to 20: 1 , 2: 1 to 15: 1 , 5: 1 to 20: 1 , 10: 1 to 20: 1 , 12:1 to 18:1, 14:1 to 16:1, 1:1 to 10:1, 5:1 to 10:1, or 12:1 to 18:1.
- the molar ratio of aptamer: polymerase in the composition is about 1:1, 2:1, 4:1, 5:1, 8:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1 or 20:1.
- the polymerase is selected from the group consisting of Thermus aquaticus, Thermus thermophilus, or Thermus maritima.
- composition further comprises
- deoxyribonucleotide triphosphates and a divalent metal cation.
- the composition further comprises a forward primer.
- the composition comprises both the forward primer and a reverse primer.
- the forward and/or reverse primer is specific for a target nucleic acid.
- the composition is a dried composition.
- the composition is a liquid composition.
- a method for extending a primer comprises mixing the primer with a thermostable polymerase and an aptamer according to any of the foregoing aspects and embodiments to form a reaction mixture.
- the primer is specific for a target nucleic acid sequence.
- the method further comprises adding a reverse primer. In other embodiments, the reverse primer is specific for the target nucleic acid sequence.
- the method further comprises adding to the reaction mixture deoxyribonucleotide triphosphates and a divalent metal cation.
- the aptamer inhibits, reduces or eliminates the polymerase activity at a temperature below 45°C, 40°C, 37°C, 35°C, 32°C, or 30°C.
- kits comprising a composition comprising an aptamer according to any of the foregoing aspects and
- thermostable polymerase
- the kit further comprises a forward and a reverse primer, each of which is specific for a target nucleic acid sequence.
- the kit comprises primers and at least one probe for detecting and/or determining a sequence of the target nucleic acid sequence.
- the composition further comprises a forward oligonucleotide primer which is specific for the target nucleic acid sequence.
- the composition further comprises a reverse oligonucleotide primer, which is specific for the target nucleic acid sequence.
- the kit further comprises a reverse transcriptase.
- the composition further comprises a reverse transcriptase.
- the composition is a dried composition.
- the composition is a liquid composition.
- FIGS. 1 A and 1 B illustrate a closed aptamer having no 5' and 3' ends (1A) and an oligonucleotide sequence which can be synthesized to generate the closed aptamer shown in FIG. 1 A (1 B).
- FIGS. 2A and 2B illustrate an aptamer having a 5' end (underlined C) and a 3' end (boxed G) (FIG. 2A) and an oligonucleotide sequence (FIG. 2B) which can be synthesized to generate the open aptamer shown in FIG. 2A.
- FIG. 2A illustrates an open aptamer having the predicted structure of a stem between two loops, there is no covalent bond between the 5'C and the 3'G.
- FIGS. 3A and 3B illustrate a hairpin aptamer having a 3' overhang (FIG. 3A) and an oligonucleotide sequence (FIG. 3B) which can be synthesized to generate the open predicted hairpin aptamer shown in FIG. 3A.
- the underline indicates the two portions of a loop sequence comprising TTCTTAGCGTTT (SEQ ID NO:3) wherein the absence of a covalent bond (e.g., phosphodiester bond) between two nucleotides within SEQ ID NO:3 allows formation of a predicted hairpin structure at ambient temperatures.
- TTCTTAGCGTTT SEQ ID NO:3
- FIGS. 4A and 4B illustrate results of real time PCR reactions (Example 4) for the detection of 2 target sequences in genomic DNA. Reactions were run in the absence (FIG. 4A) and presence (FIG. 4B) of aptamers according to the present disclosure. The increase in fluorescence signifies the generation of the PCR products.
- FIGS. 5A and 5B illustrate post-PCR melt curve analysis (Example 4) of real time PCR reactions shown in FIGS. 4A and 4B.
- Melt curve analysis of PCR products generated in the absence (FIG. 5A) and presence (FIG. 5B) shows that the presence of aptamer according to the present disclosure results in the generation of greater quantities of the target amplicons and lower quantities of non-specific products.
- nucleic acid or “polynucleotide” refers to
- deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, or non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- nucleic acids containing known nucleotide analogs or modified backbone residues or linkages which are synthetic, naturally occurring, or non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
- thermoostable polymerase or “thermophilic polymerase” refers to an enzyme that is relatively stable to heat when compared, for example, to nucleotide polymerases from E. coli, and which catalyzes the template-dependent polymerization of nucleoside triphosphates.
- a "thermostable polymerase,” will, e.g., retain enzymatic activity for polymerization and exonuclease activities when subjected to the repeated heating and cooling cycles used in PCR.
- thermostable nucleic acid polymerase has optimal activity at a temperature above 45°C, or at a temperature ranging from 40°C to 80°C and more preferably from 55°C to 75°C.
- a representative thermostable polymerase enzyme isolated from Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a method for using it in conventional PCR is described in Saiki et al., 1988, Science 239:487.
- Other thermostable DNA polymerases include, but are not limited to, DNA polymerases from thermophilic Eubacteria or Archaebacteria, for example, T. thermophilus, T. bockianus, T. flavus, T.
- Reverse transcriptases functional between 55-60° C. include, but are not limited to, MmLV reverse transcriptase, AMV reverse transcriptase, RSV reverse transcriptase, HIV-1 reverse transcriptase, and HIV-2 reverse transcriptase.
- aptamer refers to a nucleic acid that has a specific binding affinity for a target molecule, such as a protein. Like all nucleic acids, a particular nucleic acid ligand may be described by a linear sequence of nucleotides (A, U, T, C and G), typically 30-75 nucleotides long.
- Aptamers may also be described in terms of regions of predicted secondary structure wherein a single strand portion of the aptamer is complementary to another single strand portion of the same aptamer and thereby can hybridize (anneal) to each other to form a duplex which is referred to herein as a "stem,” and portions of the aptamer which are predicted not to hybridize with other portions of the same aptamer are referred to herein as "loops.” Generally, each end of a loop is linked to an end of a stem thereby providing a loop configuration.
- capping moiety refers to a moiety attached to the 3' or 5' end of an aptamer or other nucleic acid that changes the stability of the nucleic acid, prevents polymerase elongation of the nucleic acid, and/or increases the efficiency of nucleic acid dimer formation.
- cap structure is meant chemical modifications, which have been incorporated into the ends of oligonucleotide
- a suitable 5'-cap can be one selected from the group comprising inverted abasic residue; 4',5'-methylene nucleotide; l -(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 1 ,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3', 4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3
- a suitable 3'-cap can be selected from a group comprising, 4',5'-methylene nucleotide; l -(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; 1 ,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1 ,2-aminododecyl phosphate; hydroxypropyl phosphate; 1 ,5- anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3', 4'- seco nucleotide
- a "variant" of a first nucleic acid sequence refers to a second nucleic acid sequence that has one or more nucleotide substitutions relative to the first nucleic acid sequence.
- Primers annealed to the template nucleic acid can be extended by covalent bonding of nucleotide monomers during amplification or polymerization of a nucleic acid molecule catalyzed by the thermostable polymerases.
- primers are from 12 to 35 nucleotides in length and are preferably from 15 to 20 nucleotides in length.
- Primers are designed from known parts of the template, one complementary to each strand of the double strand of the template nucleic acid molecule, lying on opposite sides of the region to be synthesized. Primers can be designed and synthetically prepared as is well known in the art.
- forward primer means a primer complementary to a strand of a nucleic acid sequence aligned in a 3' to 5' direction.
- reverse primer has a complementary sequence to the other strand of the nucleic acid sequence.
- Tempolate refers to a double-stranded or single- stranded nucleic acid molecule, which serves a substrate for nucleic acid synthesis.
- denaturation of its strands to form a first and a second strand is performed before these molecules may be used as substrates for nucleic acid synthesis.
- a primer, complementary to a portion of a single-stranded nucleic acid molecule serving as the temple template is hybridized under appropriate conditions and an appropriate polymerase may then synthesize a molecule complementary to the template or a portion thereof. The newly synthesized molecule may be equal or shorter in length than the original template.
- a “target” or “target nucleic acid” refers to a single or double stranded polynucleotide sequence sought to be copied or amplified in a reaction which includes a polymerase and an oligonucleotide primer.
- hybridize refers to the binding, duplexing, or hybridizing of a nucleic acid molecule preferentially to a particular nucleotide sequence. Hybridization generally involves the formation of hydrogen bonds between two single strands of a polynucleotide.
- complementary refers to the capacity for precise pairing between two nucleotides; i.e., if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding (e.g., via standard Watson-Crick base pairing and Hoogsteen-type hydrogen bonding) with a nucleotide of another nucleic acid to form a canonical base pair, then the two nucleic acids are considered to be complementary to one another at that position.
- Complementarity between two single-stranded nucleic acid molecules may be "partial.” Complementarity is “complete,” fully,” or “100%” when there are no mismatches between the two single-stranded nucleotide sequences. "100% complementarity along the full length of the sequences" indicates that there are no mismatches between two nucleic acid strands which can hybridize and which are of identical length.
- oligonucleotide refers to a sequence of nucleotide monomers, each bound to an adjacent nucleotide monomer by a covalent bond.
- An "oligonucleotide” may also include a non-nucleotide subunit or a nucleotide analog within the sequence of nucleotide monomers wherein the non-nucleotide subunit or nucleotide analog is bound to an adjacent subunit, analog or nucleotide by a covalent bond, bound by means of a covalent bond.
- oligonucleotide is a phosphodiester bond.
- the term "dried” herein refers to a composition which has a water content of less than about 10%, 8%, 5%, 4%, 3%, 2%, 1 % or 0.5%.
- PCR polymerase chain reaction
- PCR involves repeatedly performing a "cycle” of three steps: “melting,” in which the temperature is adjusted such that the DNA dissociates to single strands, “annealing,” in which the temperature is adjusted such that oligonucleotide primers are permitted to match their complementary base sequence using base pair recognition to form a duplex at one end of the span of polynucleotide to be amplified; and “extension” or “synthesis,” which may occur at the same temperature as annealing, or in which the temperature is adjusted to a slightly higher and more optimum temperature, such that oligonucleotides that have formed a duplex are elongated with a DNA polymerase.
- This cycle is then repeated until the desired amount of amplified polynucleotide is obtained.
- Methods for PCR amplification are taught, for example, in U.S. Pat. Nos. 4,683,195 and 4,683,202.
- Specificity in primer extension or PCR amplification refers to the generation of a single, “specific” PCR product with the size and sequence predicted from the sequences of the primers and the genomic or transcribed region of nucleic acid to which the primers were designed to anneal in a base- complementary manner.
- “Nonspecific” PCR product has a size or sequence different from such prediction.
- a "target nucleic acid” is that genomic or transcribed region of nucleic acid, the ends of which are base-complementary (with proper orientation) to primers included in a complete set of PCR reagents.
- a primer refers to a nucleic acid sequence, which is complementary to a known portion of a target nucleic acid sequence and which is necessary to initiate synthesis by DNA polymerase.
- "Proper orientation” is for the two primers to anneal to opposite strands of double- stranded target nucleic acid with their 3' ends pointing toward one another. Such primers are said to target the genomic or transcribed sequence to the ends of which they are base-complementary.
- Oligonucleotide refers to a synthetic or natural molecule comprising a covalently linked sequence of nucleotides which are joined by a phosphodiester bond between the 3' position of the pentose of one nucleotide and the 5' position of the pentose of the adjacent nucleotide.
- Primer extension assay refers to an in vitro method wherein a primer hybridized to a complementary sequence part of a single-stranded nucleic acid template molecule is extended by sequential covalent bonding of nucleotides to the 3' end of the primer forming a new DNA molecule complementary to the DNA template molecule.
- the primer extension method transforms a single-stranded nucleic acid template into a partially or completely double-stranded nucleic acid molecule.
- the primer extension method as used herein is a single step nucleic synthesis process without amplification of the copy number of the template nucleic acid molecule.
- modulate refers to a change in the activity of pyruvate dehydrogenase kinase (PDK).
- modulation or regulation may cause an increase or a decrease in protein activity, binding characteristics, or any other biological, functional or immunological properties of the PDK.
- thermostable polymerases for use in reactions which require primer extension by the polymerase.
- reversible inhibitors are aptamers, nucleic acids which are designed to adopt a secondary structure comprising a stem and a loop.
- the aptamers are useful in reactions and assays that benefit from incorporating hot start and can improve the sensitivity and specificity of nucleic acid synthesis.
- the aptamer has a "dumbbell" structure (see, e.g., FIGS. 1A and 2A).
- the dumbbell aptamer can exist as a "closed" structure which has no 5' or 3' terminus (illustrated in FIG. 1 A) due to ligation of the 5' and 3' ends of a synthesized oligonucleotide.
- a closed dumbbell aptamer can be generated by synthesizing a linear oligonucleotide having the sequences provided herein, allowing annealing to form the predicted dumbbell structure, then ligating the 5' and 3'.
- the dumbbell aptamer is synthesized in a way to create 5' and 3' termini that are positioned adjacent to one another within the stem of the folded aptamer.
- FIGS. 1 B and 2B An example of a linear oligonucleotide which is predicted to fold into an aptamer with a stem and two loops is provided in FIGS. 1 B and 2B, where 5' and 3' portions of the linear oligonucleotide hybridize to an internal complementary sequence in the same oligonucleotide to form a stem structure in which the 5' and 3' ends of the linear oligonucleotide are adjacent to one another.
- FIG. 1 A shows an aptamer structure formed from the oligonucleotide sequence shown in FIG. 1 B wherein the 5' and 3' ends of the oligonucleotide of FIG. 1 B are ligated together.
- FIG. 1 A shows an aptamer structure formed from the oligonucleotide sequence shown in FIG. 1 B wherein the 5' and 3' ends of the oligonucleotide of FIG. 1 B are ligated together.
- FIG. 1 A shows an apta
- FIG. 2A shows an aptamer structure formed from the sequence shown in FIG. 2B wherein the 5' and 3' ends of the oligonucleotide are not ligated together, leaving the aptamer with a 5' end and a 3' end wherein the 5' and 3' ends are adjacent to one another within the predicted stem structure.
- an aptamer in which a linear oligonucleotide can fold and anneal (hybridize) to comprise a first polynucleotide sequence comprising one strand of the stem (e.g.,
- TTATTTTGCAATTATA (SEQ ID NO:2, written right to left in the illustration) in FIG. 1A)
- a second polynucleotide sequence which does not anneal to portions of the aptamer e.g. , TTCTTAGCGTTT (SEQ ID NO:3) to form a loop
- a third polynucleotide sequence which is complementary to SEQ ID NO: 1 and anneals to SEQ ID NO: 1 in the appropriate conditions and temperature to form the stem e.g., TATAATTGCAAAATAA (SEQ ID NO: 1 )
- TTCTTAGCGTTT SEQ ID NO:3
- FIGS. 2A and 2B illustrate an "open" aptamer wherein the 5' and 3' ends are not ligated, i.e., the aptamer has a 5' end and a 3' end.
- the nucleotides at the 5' and 3' ends are adjacent to one another within the stem of the predicted aptamer secondary structure.
- an "open" aptamer wherein the 5' and 3' ends are not ligated, i.e., the aptamer has a 5' end and a 3' end.
- the nucleotides at the 5' and 3' ends are adjacent to one another within the stem of the predicted aptamer secondary structure.
- oligonucleotide is synthesized and modified at its 3' end.
- the 3' end is attached to a propanediol spacer (C3), preventing ligation of the 5' and 3' ends to form a closed aptamer.
- C3 propanediol spacer
- 5' and 3' portions of the oligonucleotide can hybridize to the internal complementary sequence of the oligonucleotide as illustrated in FIG. 2A.
- the two loops (second and fourth polynucleotide sequences as described above and illustrated in FIGS. 1 A and 2A) of the dumbbell aptamer can be identical to each other or can be minor variants of one another wherein a first loop differs from a second loop by 1 or 1 nucleotides.
- the loops comprise the polynucleotide sequence TTCTTAGCGTTT (SEQ ID NO:3) or a variant thereof wherein the variant contains 1 or 2 nucleotide substitutions within SEQ I D NO:3.
- Acceptable substitutions in the SEQ ID NO:3 are those which do not affect the reversible inhibitory activity of the aptamer by more than about 5% or 10% relative the aptamer in which the loop sequences each have SEQ I D NO:3.
- the stem which is positioned between the two loops of the aptamer is a double-stranded structure (formed by hybridization or annealing of the first and third polynucleotide sequences as described above and illustrated in FIG. 1A) which is about 12 to 18 base pairs in length, however, the length of the stem can vary with the understanding that the variation may affect the temperature at which an aptamer dissociates from and no longer inhibits the polymerase activity. It is advantageous to have aptamers which vary with respect to the temperature at which they dissociate from the polymerase. Accordingly, the aptamers of the present disclosure include those that comprise a stem which is 12 to 16, 14 to 18,
- the stem is comprised of two single-stranded oligonucleotides of equal length such that the presently described aptamers are polynucleotides which comprise two single-strand oligonucleotide sequences which are 12 to 16, 14 to 18, 14 to 17, 14 to 16, 15 to 16, 15 to 17, or
- the two oligonucleotide sequences are hybridized via hydrogen bonds and no mismatches are present in the resultant stem of the aptamer.
- the 3' end of one single stranded stem oligonucleotide sequence is covalently bonded to the 5' end of one of the two loops while the 3' end of the second single stranded stem oligonucleotide sequence is covalently bonded to the 5' end of the second of the two loops.
- the aptamers comprising two loops as presently described can be in a closed or open form.
- the closed form there are no free ends of the aptamer polynucleotide. So, while the sequence maintains a 5' to 3' orientation as is well known in the art, the aptamer does not comprise a 5' end (e.g., 5' phosphate) or a 3' end (e.g., 3' hydroxyl). Instead, every nucleotide in the aptamer is bound to the adjacent neighbor by a covalent bond.
- the covalent bond is a phosphodiester bond.
- every covalent bond linking the nucleotide monomers in the aptamer is a phosphodiester bond.
- one strand of the aptamer stem comprises a non-nucleotide linking moiety such as a linker comprising DMT-ethane diol phosphoroamidite (C-2 spacer).
- the stem structure in the aptamer lacks a covalent bond between two of the nucleotides in only one of the strands of the stem.
- the aptamer has a 5' end and a 3' end. As all nucleotides in the stem can remain hybridized to the opposite, fully
- the 5' and 3' ends remain adjacent to one-another when the aptamer is folded into its predicted secondary structure (see, e.g., FIG. 1A).
- the 5' end comprises a phosphate group while the 3' end comprises a hydroxyl group.
- the 5' end, the 3' end or both ends are linked to a capping moiety.
- the capping moiety may function to stabilize the aptamer and/or to prevent polymerization initiated at the 3' end of the aptamer.
- the lack of a covalent bond and/or the presence of a capping moiety may disrupt hydrogen bond(s) between nucleotides closest to the 5' and/or 3' end but this will not necessarily affect the inhibitory activity of the aptamer.
- a linear oligonucleotide is synthesized in a 3' to 5' direction using routine chemical synthesis methods.
- the desired aptamer sequence is first synthesized then denatured by heating and slowly cooled to room
- the synthesized oligonucleotide can be denatured in a 5 mM HEPES-KOH buffer at pH 7.5 with 50 ml_ of a salt such as KCI at a temperature of about 95°C then slowly cooled (about 45 minutes to 1 hour) to room temperature.
- a salt such as KCI
- Ligation of the 5' and 3' ends can be achieved by chemical or enzymatic means (see, e.g. , Example 1 ) after synthesis, denaturation and annealing of the oligonucleotide as described above.
- Enzymatic ligation can be achieved through the use of T4 ligase wherein the 5' end of the synthesized oligonucleotide is phosphorylated and incubated with T4 ligase under appropriate conditions.
- Chemical ligation can be performed using, e.g. cyanogen bromide, or other methods routine in the art.
- an oligonucleotide synthesized then first modified to place an amino group at the 5' end of the oligonucleotide.
- the 5'-modified oligonucleotide is then incubated with imidazole-HCI (pH 6.0) and 16.7 mg EDC (1 -Ethyl-e-(3-dimethylaminopropyl)carbodiimide) to ligate the 5' and 3' ends together, forming an aptamer with the predicted structure of 2 loops and a stem wherein every nucleotide within the aptamer is covalently bonded to 2 adjacent nucleotides.
- the desired aptamer sequence can be chemically synthesized above wherein the first and last nucleotides in the synthetic oligonucleotide are the nucleotides which will be adjacent to one-another within a single strand of the stem structure (as described above and shown in FIGS. 2A and 2B) but lacking a covalent bond (e.g.
- the 5' end lacks a phosphate group.
- the synthetic oligonucleotide will fold under appropriate conditions to have a predicted secondary structure with two loops separated by a stem in which there is a 5' end adjacent to a 3' end in one strand of the stem.
- the 5'-phosphate end can be attached to a capping moiety such as an amino group or other relevant capping moiety as described herein.
- the 3'- hydroxyl of the oligonucleotide can be attached to a capping moiety such as a propanediol spacer C3 or other relevant capping moiety as described herein (see Example 3).
- the aptamer can comprise a 5' cap, a 3' cap or both a 5' cap and a 3' cap.
- the presence of a 5' cap and/or 3' cap can inhibit ligation of the two ends of the oligonucleotide and can also inhibit polymerization of the oligonucleotide.
- Aptamers which can bind to a polymerase and inhibit the polymerase activity as described above were designed to have 2 loops comprising the sequence TTCTTAGCGTTT (SEQ ID NO:3) as was determined by Yakimovich et al. (2003, Biochem (Moscow), 68:228-235) as being responsible for binding to the polymerase and effecting inhibition of polymerase activity when bound.
- the loop sequence of SEQ I D NO:3 has 1 or 2 nucleotide substitutions. The two loops are separated by a stem comprising two
- the aptamer structure an example of which is shown in FIG. 1 , has two loops separated by a stem. While an exemplary single strand sequence of a stem is TATAATTGCAAAATAA (SEQ I D NO: 1 ) and its complement is TTATTTTG CAATT ATA (SEQ ID NO:2), it is contemplated that there may be 1 , 2 or 3 base pair substitutions within the stem. Importantly, a substitution in one strand is always coupled with a
- the stem sequence such as that comprised of SEQ I D NO: 1 paired with SEQ ID NO:2, is AT-rich.
- the stem sequence is 12-18 base pairs in length wherein at least 14, 15, or 16 of those base pairs are A-T base pairs.
- the stem positioned between the two loops is 16 base pairs in length and comprises 14 A-T base pairs and two G-C base pairs. The two G-C base pairs can be adjacent to one another.
- the aptamer can lack a covalent bond between two nucleotides present in one of the strands within the stem portion.
- the stem strand comprising SEQ ID NO: 1 and SEQ ID NO:2 or variants thereof can lack a covalent bond between nucleotides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 1 1 , 1 1 and 12, 12 and 13, 13 and 14, 14 and 15 or 15 and 16 of SEQ ID NO: 1 or SEQ I D NO:2.
- the aptamer which lacks a covalent bond between the 2 nucleotides comprises a single 5' terminus and a single 3' terminus.
- an aptamer comprising a single 5' terminus and a single 3' terminus can be chemically synthesized as a single-stranded oligonucleotide comprising the entire sequence of the aptamer.
- the synthesized single strand oligonucleotide comprises a 5' portion of a first stem sequence comprising SEQ ID NO: 1 or a variant thereof, a first loop sequence comprising SEQ ID NO:3 or a variant thereof, a second stem sequence comprising SEQ ID NO:2 or a variant thereof, a second loop sequence or a variant thereof and the remaining 3' portion of the first stem sequence comprising SEQ ID NO: 1 or a variant thereof.
- the lack of a covalent bond between 2 adjacent nucleotides in one strand of a predicted stem structure may allow flexibility, such as a bend, thereby facilitating interaction of each of the two predicted loop structures with the active site of the polymerase.
- the presence of two loops connected via a stem in the predicted dumbbell structure may increase the local concentration of the aptamer loops, leading to more efficient binding of the aptamer to the polymerase at lower temperatures such as about 25°C to 30°C. Accordingly, less aptamer may be needed in a reaction mixture to provide the desired hot start functionality.
- dumbbell aptamer which comprises free 5' and 3' ends (lacks a covalent bond between two nucleotides of one strand of the stem), the aptamer is still able to inhibit polymerase activity of a thermostable polymerase at temperatures at or below about 30°C. Variations in the open dumbbell aptamer sequence can affect the temperature below which polymerase activity is inhibited. In some embodiments, an open dumbbell aptamer inhibits polymerase activity at or below about 32°C, 35°C, 38°C, or 40°C. Particularly advantageous is the complete loss of polymerase activity inhibition by these open aptamer compositions at temperatures above 40°C, 45°C, 50°C or 55°C.
- Table 1 below provides exemplary first and third sequences as described above with respect to aptamers which anneal to form a predicted dumbbell structure, wherein the first and third polynucleotide sequences of an aptamer are complementary to each other and can anneal to form the predicted stem structure. It is understood that each 5' and 3' end of the first and third sequences below is ligated to one end of a loop structure. It is also understood that in some embodiments, one of the first and third polynucleotide sequences may lack a phosphodiester bond between two of the nucleotides within the first or third sequence.
- any of these sequences predicted to form on strand of the predicted stem may have a nucleotide substitution at 1 , 2 3 or 4 positions in the sequence. Accordingly, the opposite strand which is predicted to anneal to this strand has a fully complementary sequence. Table 1
- Table 2 below provides exemplary oligonucleotide sequences which can be synthesized and which are predicted to fold into an aptamer having two loops and a stem.
- the bolded nucleotides represent portions of a stem sequence which, when the oligonucleotide is folded as predicted, hybridizes to a second stem sequence indicated by the underlined portion.
- the aptamer is designed to form a hairpin structure wherein the aptamer is predicted to comprise a single stem having two single strands which are complementary and terminating in a single loop.
- the single stem in the predicted hairpin structure as described herein comprises a first polynucleotide sequence which is annealed to a third
- polynucleotide sequence wherein the first and third polynucleotide sequences are complementary and are equal in length.
- the 3' end of the first polynucleotide sequence is covalently bound to the 5' end of a second polynucleotide sequence which is predicted to form a single stranded loop in the predicted hairpin aptamer, and the 3' end of the second polynucleotide sequence is covalently bound to the 5' end of the third polynucleotide sequence.
- Table 3 below provides some exemplary oligonucleotide sequences for the first and/or third polynucleotide sequences in the hairpin aptamer.
- the second polynucleotide sequence which is predicted to form a loop comprises TTCTTAGCGTTT (SEQ ID NO:3).
- the hairpin aptamers have 5' and/or 3' overhangs which represent a full or partial sequence of SEQ ID NO:3 or a variant thereof.
- An example of a hairpin aptamer according to the present disclosure is provided in FIGS. 3A and 3B.
- the underlined portion of FIG. 3A indicates the sequence of SEQ ID NO:3.
- the hairpin aptamer of FIG. 3A has an overhang comprising a 3' portion of SEQ I D NO:3.
- 3A illustrates a hairpin aptamer in which a 3' portion of SEQ ID NO:3 (GTTT) is ligated to the 5' nucleotide of a stem strand comprising the sequence TTATTTTAAAATTATA (SEQ ID NO:58) and the remaining 5' portion of SEQ ID NO:3 is ligated to the 3' nucleotide of a second stem strand comprising the sequence
- the oligonucleotide of SEQ ID NO:90 (FIG. 3B) is predicted to fold into a hairpin structure as described in FIG. 3A.
- oligonucleotides can be chemically synthesized based on the sequences shown in Table 4 below.
- the underlined bases indicate the 3' and 5' portions of SEQ ID NO:3 (cut loop).
- the bolded bases indicate stem sequences which are fully complementary to one another and which are predicted to hybridize when the aptamer is folded into a hairpin structure.
- SEQ ID NO:79 illustrates a hairpin structure in which the 3' overhang represents the full loop sequence of SEQ I D NO:3 while SEQ ID NO:80 illustrates a hairpin structure in which the 5' overhang represents the full loop sequence of SEQ ID NO:3.
- SEQ ID NO:84 is an example of a hairpin aptamer with a 3' overhang in which a 5' portion of a sequence consisting of SEQ ID NO:3 is covalently linked to the 3' end of one stem sequence, the remaining 3' portion of the sequence consisting of SEQ ID NO:3 is covalently linked to the 5' end of the complementary stem sequence, and there is no covalent (e.g. , phosphodiester) bond between nucleotides 7 and 8 of the sequence consisting of SEQ ID NO:3.
- covalent e.g. , phosphodiester
- Also contemplated is a method for reversibly inhibiting polymerase activity comprising incubating an aptamer as described herein with a
- thermostable polymerase The aptamers of the present disclosure were designed to bind to a thermostable polymerase and inhibit the polymerase activity of that polymerase at lower temperatures, then dissociate from the polymerase as the reaction temperature is raised.
- the thermostable polymerase is selected from but not limited to DNA polymerases from thermophilic Eubacteria or Archaebacteria, including but not limited to, Thermus aquaticus, T. thermophilus, T. bockianus, T. flavus, T. rubber, Thermococcus litoralis, Pyroccocus furiousus, P. wosei, Pyrococcus spec. KGD, Thermatoga maritime, Thermoplasma acidophilus, and Sulfolobus spec.
- thermophilic Eubacteria or Archaebacteria including but not limited to, Thermus aquaticus, T. thermophilus, T. bockianus, T. flavus, T. rubber, Thermoc
- the polymerase may be a reverse transcriptase functional between 55-60° C, including but not limited to, MmLV reverse transcriptase, AMV reverse transcriptase, RSV reverse transcriptase, HIV-1 reverse transcriptase, and HIV-2 reverse transcriptase.
- the ability of the aptamer to bind to and inhibit, then dissociate from the polymerase depends in part upon its secondary structure in the reaction mixture.
- Aptamers of the present disclosure have melting temperatures ranging from about 45°C to 70°C.
- the closed (ligated) dumbbell aptamers have higher melting temperatures, ranging from about 60°C to 70°C, 60°C to 65°C or 65°C to 70°C, while the open dumbbell aptamers lacking a phosphodiester bond in one strand of the stem have a melting temperature ranging from about 45°C to 55°C, 45°C to 50°C, 50°C to 55°C, or 48°C to 53°C.
- Melting temperatures are determined in some embodiments at an aptamer concentration of about 8 ⁇ in a buffered solution having a pH of about 8.
- the buffered solution in some embodiments comprises 3 mM MgCI 2 , 15 KCI, 25 mM HEPES, pH 8.0.
- Melting temperatures for each aptamer can be measured using a UV-Vis-NI R spectrophotometer (see, e.g., Example 2).
- aptamers that inhibit, reduce or eliminate thermostable polymerase activity at temperatures below about 50°C, 45°C, 44°C, 43°C, 42°C, 41 °C, 40°C, 39°C or 38°C.
- the aptamer and polymerase are in a solution having a pH of about 6-8, 6-9, 7-8, 7-9, or 8-9.
- thermostable polymerase activity The ability of an aptamer to inhibit, reduce or eliminate the polymerase activity of a thermostable polymerase can be measured and quantified using an assay which measures the polymerase activity in the presence or absence of the aptamer at varying temperatures. It is understood that several alternative methods may be used to measure the ability of an aptamer to inhibit polymerase activity in a temperature-dependent way, only some of which are briefly described here.
- thermostable polymerase One method for measuring the inhibitory effects of an aptamer on the activity of a thermostable polymerase is exemplified in Example 3 below and further described in Nikiforov et al. , 201 1 , Analytical Biochemistry, 412: 229-236. Specifically, a hairpin template is provided in which a fluorescent label (e.g.
- fluorescein (FAM; 5'-Dimethoxytrityloxy-5-[N-((3',6'-dipivaloylfluoresceinyl)- aminohexyl)-3-acrylimido]-2'-deoxyUridine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite) dT residue) is incorporated near the 3' end (e.g., 2, 3, 4 or 5 bases away from the 3' end of the oligonucleotide substrate).
- FAM fluorescein
- a polymerase preparation is added wherein the polymerase is in the presence or absence of the inhibitor aptamer.
- a polymerase preparation is added wherein the polymerase is in the presence or absence of the inhibitor aptamer.
- about 0.8 ⁇ polymerase is mixed with 8 ⁇ aptamer (1 : 10 ratio).
- the polymerase/aptamer ratio is about 1 :5 to 1 : 15 or about 1 :5 or 1 : 15.
- the reaction After addition of polymerase to the PCR reaction mix containing the labeled hairpin substrate, the reaction is heated from about 25°C to 75°C and the FAM signal is measure using a standard dissociation curve program (e.g., Mx3005P, Agilent Technologies) to determine the FAM signal.
- a standard dissociation curve program e.g., Mx3005P, Agilent Technologies
- thermostable polymerase activity in the presence and absence of an aptamer involves use of an oligonucleotide substrate for the polymerase which forms a hairpin structure having a stem and a loop, wherein the stem has a long single-stranded portion which terminates at the 3' end.
- a quencher e.g., ⁇ , ⁇ '-tetramethyl-rhodamine, TAMRA
- a fluorescent dye e.g. , carboxyfluorescein, FAM
- the fluorescence of the dye is quenched through resonance energy transfer by the quencher when the aptamer substrate is in its predicted folded structure until a oligonucleotide primer is added and allowed to anneal to the 3' end of the stem single-stranded portion and is extended to synthesize the complementary strand by the polymerase, resulting in opening of the loop and spatial separation of the quencher and dye.
- the polymerase and aptamer are mixed in an appropriate solution of reagents at least including nucleotide triphosphates, a divalent metal cation, an appropriate buffer and primer and fluorescence is measured over time, with fluorescence increasing at a rate proportional to the polymerase activity.
- IC 50 values for each aptamer can be determined over a range of temperatures.
- a third alternative method for measuring the ability of an aptamer as described herein to inhibit a thermostable polymerase in a temperature- dependent manner is by using a template oligonucleotide DNA molecule which is labeled at its 5' end with 32 ⁇ - ⁇ - ⁇ and which forms a hairpin wherein a 5' portion (e.g., 12-24 nucleotides) of the oligonucleotide is single-stranded followed by a double-stranded stem and small loop.
- a 5' portion e.g., 12-24 nucleotides
- thermostable polymerase is incubated with varying concentrations of an aptamer as described herein, then added to the substrate and standard PCR reaction mixture and the PCR reaction is allowed to proceed for a set period of time (e.g., 45 min. to 1 hour) at different temperatures (e.g. , 25°C to 75°C), stopped by the addition of EDTA, and then resolved using polyacrylamide gel electrophoresis.
- Standard phosphorimager detection and quantitation methods can be used to determine polymerase activity level as only when the polymerase is active (not inhibited by the aptamer at a given temperature) will the 3' end of the hairpin substrate be extended to form a longer product which is radio-labeled and detected.
- an IC 50 for each aptamer at a given temperature can be determined by quantitation and analysis.
- an aptamer according to the present disclosure dissociates from a thermostable polymerase when a reaction mixture containing the aptamer and the polymerase is raised to a temperature of at least about 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, or 80°C.
- a loss of inhibition of the polymerase is a likely indication of aptamer dissociation from the polymerase, in other
- a reversibly inhibitory aptamer of the present disclosure does not inhibit thermostable polymerase activity when the reaction mixture containing the aptamer and the polymerase is raised to a temperature of at least about 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, or 80°C. It is understood that the temperature above which an aptamer no long inhibits polymerase activity depends on the sequence, composition and inherent structure of the aptamer in solution with the polymerase. Accordingly, any aptamer sequence as described herein may be further characterized or defined by its lack of polymerase activity inhibition at or above a specified temperature.
- any aptamer sequence and predicted structure as described herein may be further characterized or defined by its ability to inhibit polymerase activity at or below a specified temperature.
- the aptamer inhibits the polymerase by 95%-100%, 98% to 100% or by about 100% relative to polymerase activity in the absence of the aptamer at or below a temperature of about 25°C, 30°C, or 35°C.
- a temperature of the mixture containing the aptamer and the polymerase is raised, there will be a corresponding loss of inhibition.
- Experimental studies suggest that a transition from about 95% to 100% of polymerase activity to loss of substantially all inhibition can occur over a termpature range of about 4°C to 10°C, or 5°C to 7°C.
- Inhibition of polymerase activity by an aptamer as described herein can also be affected by the concentration of the aptamer and polymerase in a mixture or by the ratio of aptamer: polymerase.
- the aptamer is effective in inhibiting polymerase activity when the aptamer is present in the mixture at a concentration of about 100 nM to 1000 nM, 100 nM to 500 nM, 25 nM to 750 nM, for 500 nM to 1000 nM.
- the aptamers described are useful for reversibly inhibiting thermostable polymerases including DNA polymerases, RNA
- aptamers provided herein to inhibit polymerase activity at ambient temperatures or at temperatures lower than temperatures which are optimal for polymerase activity is advantageous for at least the reason that there will be a decrease in or elimination of non-specific products generated at these lower temperatures.
- use of the aptamers can reduce generation of non-specific products and increase production of the target amplicon(s).
- aptamers of the present disclosure have the ability to reversibly inhibit thermostable polymerases at ambient temperatures or temperatures below the optimal temperatures for various thermostable polymerases. These aptamers thus can readily be applied to any applications wherein a thermostable nucleotide polymerase is used and wherein it is desirable to have the polymerase activity turned off at a lower temperature but then be able to regain its activity at a higher temperature (hot start).
- Such applications include but are not limited to standard PCR, reverse transcriptase PCR, in-situ PCR, quantitative PCR, and minisequencing or other reactions involving primer extension in which a thermostable polymerase present and a hot-start method is advantageous.
- the increased sensitivity and specificity provided by the disclosed compositions is useful during the amplification and analysis of DNA and RNA in medical genetics research and diagnosis, pathogen detection, forensic analysis, and animal and plant genetics applications.
- the methods and compositions of the present disclosure are useful in any polynucleotide synthesis reaction that requires thermostable polymerase to cycle anywhere between 40°C and 80°C.
- Examples 4 and 5 below describe PCR experiments performed using Taq polymerase in the presence or absence of an aptamer according to the present disclosure. These studies demonstrate the ability of the aptamers described herein to both decrease generation of non-specific amplification products as well as increase quantities of target amplicons in the reaction mix.
- Example 4 describes a biplex PCR reaction containing genomic DNA and 2 primer pairs for amplification of two target sequences. Prior to initiating a PCR reaction by addition of the thermostable polymerase, 4 units of Taq polymerase was incubated with 200 nM prior to adding the Taq to the PCR master mix.
- Example 2 an unligated (open) dumbbell aptamer was used which was shown (Example 2) to have a melting temperature of about 42°C. Detection and analysis of fluorescence signals as well as gel analysis of the PCR products show effects on both non-specific product generation and on the quantity of target amplicon production. It is contemplated that any of the aptamers described herein which have melting temperatures below the optimal temperature of the thermostable polymerase in the reaction mix can enhance target amplicon generation and detection. [0134]
- Example 5 explores varying ratios of aptamenthermostable polymerase on non-specific product and target amplicon generation. Ratios ranging from about 2.5: 1 to 15: 1 were tested. While all ratios resulting in generation of the desired product, the 15: 1 ratio was most effective in reducing non-specific product generation while maintaining levels of target amplicon generation.
- contemplated herein are methods which involve using a thermostable polymerase to extend a primer which is annealed to a nucleotide template or substrate molecule.
- a primer which is annealed to a nucleotide template or substrate molecule.
- nucleotides e.g., the deoxyribonucleotides, dATP, dGTP, dCTP, dTTP
- a divalent metal cation such as Mg 2+ or Mn 2+
- a buffer and at least one primer.
- the inhibitors described herein may be used in combination with other hot-start technologies such as antibody-based hot start.
- other hot-start technologies such as antibody-based hot start.
- two or more aptamers which dissociate from a polymerase at different temperatures may be combined in a single reaction.
- a target nucleic acid sequence is copied or amplified, then detected using an automated sample handling and/or analysis platform.
- an automated sample handling and/or analysis platform In some embodiments, commercially available automated analysis platforms are utilized.
- the GeneXpert® system (Cepheid, Sunnyvale, Calif.) is utilized.
- the present disclosure is not limited to a particular detection method or analysis platform.
- One of skill in the art recognizes that any number of platforms and methods may be utilized.
- the GeneXpert® utilizes a self-contained, single use cartridge. Sample extraction, amplification, and detection may all be carried out within this self- contained "laboratory in a cartridge.” (See e.g., U.S. Pat. Nos. 5,958,349, 6,403,037, 6,440,725, 6,783,736, 6,818, 185; each of which is herein incorporated by reference in its entirety.)
- Components of the cartridge include, but are not limited to, processing chambers containing reagents, filters, and capture technologies useful to extract, purify, and amplify target nucleic acids.
- a valve enables fluid transfer from chamber to chamber and contains nucleic acids lysis and filtration components.
- An optical window enables real-time optical detection.
- a reaction tube enables very rapid thermal cycling.
- the GenXpert® system includes a plurality of modules for scalability.
- Each module includes a plurality of cartridges, along with sample handling and analysis components.
- the sample is added to the cartridge, the sample is contacted with lysis buffer and released DNA is bound to a DNA-binding substrate such as a silica or glass substrate.
- a DNA-binding substrate such as a silica or glass substrate.
- the sample supernatant is then removed and the DNA eluted in an elution buffer such as a Tris/EDTA buffer.
- the eluate may then be processed in the cartridge to detect target genes as described herein.
- the eluate is used to reconstitute at least some of the PCR reagents, which are present in the cartridge as lyophilized particles.
- PCR is used to amplify and detect the presence of the target nucleic acid sequence and/or a nucleic acid sequence that indicates genomic copy number.
- the PCR uses Taq polymerase with hot start function imparted by use of an aptamer as provided herein.
- Kits for detecting a nucleic acid target sequence present in solid, semi- solid, or liquid biological samples are also provided.
- the kit includes a reagent mix comprising a thermostable polymerase and an aptamer as described herein that can reversibly inhibit activity of the polymerase.
- the kit can be used for detection, quantifying or sequencing any target nucleic acid.
- the kit includes one or more oligonucleotide primers (e.g., a forward and/or reverse primer) that specifically hybridize to a specified target nucleic acid and may also include labeled primers and/or probes as is routine in the art.
- kits may include instructions for obtaining biological samples and contacting them with sample buffer, for mixing the samples with sample buffer, placing labels on the apparatus and recording relevant test data; for shipping the apparatus, and the like.
- the kits may include instructions for reading and interpreting the results of an assay.
- the kits may further comprise reference samples that may be used to compare test results with the specimen samples.
- Aptamers as described herein were synthesized using standard oligonucleotide synthesis methods. Oligonucleotide synthesis was performed on a MerMade 12 DNA Synthesizer (BioAutomation). Standard phosphoramidite synthesis cycles were used, and coupling time was increased to 360 seconds for modified phosphoramidites. Cleavage from the solid support and deprotection was carried in concentrated aqueous ammonia at RT for 24 hrs. HPLC analyses were done on an Agilent 1 100 instrument equipped with a quaternary pump, autosampler, and diode array detector.
- Oligonucleotides were analyzed using reversed-phase HPLC (RP HPLC) on a C18 Gemini column (4.6 mmX250 mm, 5 urn, Phenomenex) eluting with a linear gradient of acetonitrile/0.1 M
- Dimethoxytrityloxy)-2,2-(dicarboxymethylamido)propyl-1 -0-succinoyl-long chain alkylamino-CPG) (Glen Research Cat. No. 10-1901 ; U.S. Pat. No. 5,959,090 and EP Pat. No. EP0816368) and (3-(4,4'-Dimethoxytrityloxy)-2,2- dicarboxyethyl]propyl-(2-cyanoethyl)-(N, N-diisopropyl)-phosphoramidite) (Glen Research Cat. No. 20-2903; U.S. Pat. No. 5,959,090).
- Modification of the 5' end with an amino group was achieved using 5'-Amino-dT-CE Phosphoramidite (Glen Research Cat. No. 10-1932), (5'-monomethoxytritylamino-2'-deoxyThymidine,3'- [(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite).
- Modification of the 3' end with a propanediol spacer CPG (-C3) was achieved using ((1 -Dimethoxytrityloxy- propanediol-3-succinoyl)-long chain alkylamino-CPG) (Cat. No. 20-2913).
- oligonucleotides synthesized as above were ligated either enzymatically or chemically.
- 1 mL of 16 ⁇ 5'-phosphate-modified oligonucleotide in a 50 mM KCI solution was heated to 95°C for 5 min in a heating block and slowly cooled to room
- oligonucleotide 900 ⁇ _ of the annealed oligonucleotide was mixed with 100 ⁇ _ T4 ligation buffer, then with 10 ⁇ _ T4 ligase (New England BioLabs) and left overnight at 16°C. Ligated aptamer was purified by RP-HPLC method.
- UV-melt curve analysis was performed for various aptamers generated according to Example 1 above. Oligonucleotides were prepared at a
- TTTTTTTGCAGGTGACAGGCGCGAAGCGCCTGTCACCXGC (SEQ ID NO: 6), wherein X denotes a fluorescein dT residue is used in the assay.
- 2 ⁇ _ of 2 mM dATP is added, and the FAM signal is monitored while the reaction mixture is heated from 25 C to 74 C using the standard dissociation curve program (Mx3005P, Agilent).
- the assays measure the reversible inhibition activity of the aptamers whereby polymerase activity is regained upon heating of the reaction mixture. The temperature at which inhibition is lost depends on the sequence and structure of the aptamer.
- AAAAGGCATTCCTGAAGCTGACAGCATTC (SEQ ID NO:7, forward primer 1 ) and GAGAGAGTAGCGCGAGCACAGCTA (SEQ I D NO:8, reverse primer 1 ); and AAAACCTGCCTTCTGCGTGAGATTCT (SEQ I D NO:9, forward primer 2) and CTGTACGAAAAGACCACAGGGCCCAT (SEQ ID NO: 10, reverse primer 2).
- the PCR master mix prepared at room temperature, contained 100 ⁇ dNTPs, 5 mM MgCI 2 , 25 mM HEPES, pH 8.5, X1 EvaGreen® (1X concentration), human genomic DNA (1000 copies/reaction), 0.30% Tween 20, and 1 mg/mL BSA. 4 u Taq DNA polymerase (GMP Taq, Roche Diagnostics) was added to each reaction from a 0.25 u/ ⁇ . preparation.
- An aptamer comprising
- G-C3 (SEQ I D NO: 106) was added to selected reactions at a concentration of 200 nM. The reactions were initiated by the addition of Taq or Taq plus aptamer. Where aptamer was included in the reaction, the Taq and aptamer were premixed at room temperature just prior to addition to the PCR master mix.
- the Stratagene Mx3005P 96 well-plate system (Agilent Technologies) was used to run and analyze the PCR reactions. Cycling conditions were as follows: 95°C for 100 s, 45 cycles of 95°C for 8 s and 68°C for 30 s, then 95°C for 10 s, 60°C for 30 s, concluding with melt curve analysis at 60°C to 95°C over a 20 min period.
- aptamers can reversibly inhibit polymerase activity at temperatures below the optimal reaction temperature for the polymerase.
- aptamer:Taq T. aquaticus DNA polymerase
- Xpert® C. difficile/Ep ⁇ Assay Cepheid
- AptamerTaq ratios of 2.5: 1 , 5: 1 , 10: 1 and 15: 1 were tested. Eight replicates were run for each condition. At the end of the GeneXpert® runs, amplicon was collected from the PCR tubes of the cartridges and evaluated in an Agilent DNA 1000 chip via the 2100 Agilent Bioanalyzer (Agilent Technologies). Only the 1x LoD (equivalent to 92 CFU/test) samples were selected to be evaluated in duplicates in the Agilent system.
- Amplicon lengths for the targets of interest are as follow: 81 bp for toxin B ⁇ tcdE), 91 bp for tcdC deletion nt 1 17, 133 bp for SPC (sample-processing control) and 143 bp for binary toxin (cdt).
- Non-specific bands at 210 bp were observed in all reaction mixtures tested but were the faintest for the 15: 1 AptamerTaq ratio.
- the non-specific bands at 210 and 400 bp were the most prominent for the 2.5: 1 AptamerTaq ratio (data not shown).
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3026646A CA3026646A1 (en) | 2016-06-07 | 2017-06-06 | Thermostable polymerase inhibitor compositions and methods |
| CN201780045522.5A CN109477111B (zh) | 2016-06-07 | 2017-06-06 | 热稳定聚合酶抑制剂组合物和方法 |
| US16/305,858 US11299739B2 (en) | 2016-06-07 | 2017-06-06 | Thermostable polymerase inhibitor compositions and methods |
| AU2017277304A AU2017277304B2 (en) | 2016-06-07 | 2017-06-06 | Thermostable polymerase inhibitor compositions and methods |
| EP17734553.5A EP3464596B1 (en) | 2016-06-07 | 2017-06-06 | Thermostable polymerase inhibitor compositions and methods |
| JP2018563880A JP7106461B2 (ja) | 2016-06-07 | 2017-06-06 | 熱安定性ポリメラーゼ阻害剤組成物及び方法 |
| US17/687,473 US12385045B2 (en) | 2016-06-07 | 2022-03-04 | Thermostable polymerase inhibitor compositions and methods |
| JP2022040199A JP7420850B2 (ja) | 2016-06-07 | 2022-03-15 | 熱安定性ポリメラーゼ阻害剤組成物及び方法 |
| US19/295,912 US20250369000A1 (en) | 2016-06-07 | 2025-08-11 | Thermostable polymerase inhibitor compositions and methods |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662347004P | 2016-06-07 | 2016-06-07 | |
| US62/347,004 | 2016-06-07 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/305,858 A-371-Of-International US11299739B2 (en) | 2016-06-07 | 2017-06-06 | Thermostable polymerase inhibitor compositions and methods |
| US17/687,473 Continuation US12385045B2 (en) | 2016-06-07 | 2022-03-04 | Thermostable polymerase inhibitor compositions and methods |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017214202A1 true WO2017214202A1 (en) | 2017-12-14 |
Family
ID=59258348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/036225 Ceased WO2017214202A1 (en) | 2016-06-07 | 2017-06-06 | Thermostable polymerase inhibitor compositions and methods |
Country Status (7)
| Country | Link |
|---|---|
| US (3) | US11299739B2 (https=) |
| EP (1) | EP3464596B1 (https=) |
| JP (2) | JP7106461B2 (https=) |
| CN (1) | CN109477111B (https=) |
| AU (1) | AU2017277304B2 (https=) |
| CA (1) | CA3026646A1 (https=) |
| WO (1) | WO2017214202A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112567038A (zh) * | 2018-07-24 | 2021-03-26 | 旗舰创业创新第六有限责任公司 | 包含环状多核糖核苷酸的组合物及其用途 |
| EP3818170A4 (en) * | 2018-07-02 | 2022-03-09 | Swift Biosciences, Inc. | Temperature controlled dna polymerase inhibitors |
| US12385045B2 (en) | 2016-06-07 | 2025-08-12 | Cepheid | Thermostable polymerase inhibitor compositions and methods |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114990126B (zh) * | 2022-08-03 | 2022-11-18 | 珠海宝锐生物科技有限公司 | 特异性结合Bst DNA聚合酶大片段活性位点的核酸适配体及应用 |
| CN116004776A (zh) * | 2022-08-30 | 2023-04-25 | 上海伯杰医疗科技股份有限公司 | 一管式RT-qPCR全预混反应试剂、应用及RT-qPCR方法 |
Citations (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4889818A (en) | 1986-08-22 | 1989-12-26 | Cetus Corporation | Purified thermostable enzyme |
| EP0816368A1 (en) | 1996-07-02 | 1998-01-07 | Glen Research Corporation | Chemical phoshorylation of oligonucleotides and reactants used therefor |
| US5773258A (en) | 1995-08-25 | 1998-06-30 | Roche Molecular Systems, Inc. | Nucleic acid amplification using a reversibly inactivated thermostable enzyme |
| US5958349A (en) | 1997-02-28 | 1999-09-28 | Cepheid | Reaction vessel for heat-exchanging chemical processes |
| US5998203A (en) | 1996-04-16 | 1999-12-07 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids containing 5'-and/or 3'-cap structures |
| WO2000052207A1 (en) * | 1999-03-01 | 2000-09-08 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand inhibitors to dna polymerases |
| US6183998B1 (en) | 1998-05-29 | 2001-02-06 | Qiagen Gmbh Max-Volmer-Strasse 4 | Method for reversible modification of thermostable enzymes |
| US6403037B1 (en) | 2000-02-04 | 2002-06-11 | Cepheid | Reaction vessel and temperature control system |
| US6440725B1 (en) | 1997-12-24 | 2002-08-27 | Cepheid | Integrated fluid manipulation cartridge |
| US6783736B1 (en) | 1999-05-28 | 2004-08-31 | Cepheid | Cartridge for analyzing a fluid sample |
| US6818185B1 (en) | 1999-05-28 | 2004-11-16 | Cepheid | Cartridge for conducting a chemical reaction |
| WO2015091720A1 (en) * | 2013-12-20 | 2015-06-25 | Roche Diagnostics Gmbh | An improved oligonucleotide inhibitor of dna polymerases |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5874557A (en) | 1990-06-11 | 1999-02-23 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand inhibitors to DNA polymerases |
| US6582908B2 (en) * | 1990-12-06 | 2003-06-24 | Affymetrix, Inc. | Oligonucleotides |
| US6667165B2 (en) | 2001-11-13 | 2003-12-23 | Eppendorf Ag | Method and compositions for reversible inhibition of thermostable polymerases |
| AU2004227353B2 (en) | 2003-04-01 | 2010-02-25 | Luminex Corporation | Polymerase inhibitor and method of using same |
| WO2006086669A2 (en) * | 2005-02-09 | 2006-08-17 | California Institute Of Technology | Aptamer regulated nucleic acids and uses thereof |
| US8530194B2 (en) | 2005-09-26 | 2013-09-10 | Allelogic Biosciences Corporation | Oligonucleotides as temperature-sensitive inhibitors for DNA polymerases |
| US20070212704A1 (en) * | 2005-10-03 | 2007-09-13 | Applera Corporation | Compositions, methods, and kits for amplifying nucleic acids |
| US8071338B2 (en) * | 2007-08-08 | 2011-12-06 | Roche Molecular Systems, Inc. | Suppression of amplification using an oligonucleotide and a polymerase significantly lacking 5′-3′ nuclease activity |
| EP2292781A1 (en) * | 2009-08-17 | 2011-03-09 | Genethon | Baculovirus-based production of biopharmaceuticals free of contaminating baculoviral virions |
| KR101719285B1 (ko) * | 2014-11-04 | 2017-03-23 | 한국과학기술원 | 표적 물질에 의해 조절되는 핵산 중합효소 활성을 이용한 생체물질의 검출 및 정량 방법 |
| JP7106461B2 (ja) | 2016-06-07 | 2022-07-26 | セファイド | 熱安定性ポリメラーゼ阻害剤組成物及び方法 |
| US10724083B1 (en) * | 2017-12-06 | 2020-07-28 | Cepheid | Inhibition of nucleic acid polymerases by endonuclease V-cleavable oligonucleotide ligands |
| US10724017B1 (en) * | 2017-12-06 | 2020-07-28 | Cepheid | Inhibition of DNA polymerases by uracil-DNA glycosylase-cleavable oligonucleotide ligands |
| US10689629B1 (en) * | 2017-12-06 | 2020-06-23 | Cepheid | Inhibition of nucleic acid polymerases by endonuclease V-cleavable circular oligonucleotide ligands |
-
2017
- 2017-06-06 JP JP2018563880A patent/JP7106461B2/ja active Active
- 2017-06-06 CA CA3026646A patent/CA3026646A1/en active Pending
- 2017-06-06 AU AU2017277304A patent/AU2017277304B2/en active Active
- 2017-06-06 WO PCT/US2017/036225 patent/WO2017214202A1/en not_active Ceased
- 2017-06-06 CN CN201780045522.5A patent/CN109477111B/zh active Active
- 2017-06-06 US US16/305,858 patent/US11299739B2/en active Active
- 2017-06-06 EP EP17734553.5A patent/EP3464596B1/en active Active
-
2022
- 2022-03-04 US US17/687,473 patent/US12385045B2/en active Active
- 2022-03-15 JP JP2022040199A patent/JP7420850B2/ja active Active
-
2025
- 2025-08-11 US US19/295,912 patent/US20250369000A1/en active Pending
Patent Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683202B1 (https=) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4683195B1 (https=) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4889818A (en) | 1986-08-22 | 1989-12-26 | Cetus Corporation | Purified thermostable enzyme |
| US6183967B1 (en) | 1995-06-07 | 2001-02-06 | Nexstar Pharmaceuticals | Nucleic acid ligand inhibitors to DNA polymerases |
| US5773258A (en) | 1995-08-25 | 1998-06-30 | Roche Molecular Systems, Inc. | Nucleic acid amplification using a reversibly inactivated thermostable enzyme |
| US5998203A (en) | 1996-04-16 | 1999-12-07 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids containing 5'-and/or 3'-cap structures |
| EP0816368A1 (en) | 1996-07-02 | 1998-01-07 | Glen Research Corporation | Chemical phoshorylation of oligonucleotides and reactants used therefor |
| US5959090A (en) | 1996-07-02 | 1999-09-28 | Glen Research Corporation | Chemical phosphorylation of oligonucleotides and reactants used therefor |
| US5958349A (en) | 1997-02-28 | 1999-09-28 | Cepheid | Reaction vessel for heat-exchanging chemical processes |
| US6440725B1 (en) | 1997-12-24 | 2002-08-27 | Cepheid | Integrated fluid manipulation cartridge |
| US6183998B1 (en) | 1998-05-29 | 2001-02-06 | Qiagen Gmbh Max-Volmer-Strasse 4 | Method for reversible modification of thermostable enzymes |
| WO2000052207A1 (en) * | 1999-03-01 | 2000-09-08 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand inhibitors to dna polymerases |
| US6783736B1 (en) | 1999-05-28 | 2004-08-31 | Cepheid | Cartridge for analyzing a fluid sample |
| US6818185B1 (en) | 1999-05-28 | 2004-11-16 | Cepheid | Cartridge for conducting a chemical reaction |
| US6403037B1 (en) | 2000-02-04 | 2002-06-11 | Cepheid | Reaction vessel and temperature control system |
| WO2015091720A1 (en) * | 2013-12-20 | 2015-06-25 | Roche Diagnostics Gmbh | An improved oligonucleotide inhibitor of dna polymerases |
Non-Patent Citations (18)
| Title |
|---|
| "Remington: The Science and Practice of Pharmacy" |
| A.L. LEHNINGER: "Biochemistry", WORTH PUBLISHERS, INC. |
| BEAUCAGE; IYER, TETRAHEDRON, vol. 49, 1993, pages 1925 |
| DI GIUSTO D A ET AL: "Construction, stability, and activity of multivalent circular anticoagulant aptamers", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 279, no. 45, 5 November 2004 (2004-11-05), pages 46483 - 46489, XP002600154, ISSN: 0021-9258, [retrieved on 20040818], DOI: 10.1074/JBC.M408037200 * |
| FREDRICK M. AUSUBEL ET AL.: "Short Protocols in Molecular Biology", 1995, JOHN WILEY AND SONS |
| HORTON, R.M. ET AL., BIOTECHNIQUES, vol. 16, 1994, pages 42 - 43 |
| J. GRIFFITH HARDMAN; L. L. LIMBIRD; A. GILMAN: "Goodman & Gilman The Pharmacological Basis of Therapeutics" |
| J. MARCH: "Advanced Organic Chemistry", MCGRAW HILL |
| JOSEPH SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| KELLOGG ET AL., BIOTECHNIQUES, vol. 16, 1994, pages 1134 - 1137 |
| MORRISON; BOYD: "Organic Chemistry", ALLYN AND BACON, INC. |
| NIKIFOROV ET AL., ANALYTICAL BIOCHEMISTRY, vol. 412, 2011, pages 229 - 236 |
| NIKIFOROV T., ANALYTICAL BIOCHEMISTRY, vol. 412, 2011, pages 229 - 236 |
| SAIKI ET AL., SCIENCE, vol. 239, 1988, pages 487 |
| SHARKEY ET AL., BIO/TECHNOLOGY, vol. 12, 1994, pages 506 - 509 |
| SUMMERER; MARX, ANGEW CHEM INT, vol. 41, 2002, pages 3620 - 3622 |
| YAKIMOVICH ET AL., BIOCHEM (MOSCOW, vol. 68, 2003, pages 228 - 235 |
| YAKIMOVICH O Y ET AL: "Influence of DNA aptamer structure on the specificity of binding to Taq DNA polymerase", BIOCHEMIS, MAIK NAUKA - INTERPERIODICA, RU, vol. 68, no. 2, 1 February 2003 (2003-02-01), pages 228 - 235, XP008113189, ISSN: 0006-2979, DOI: 10.1023/A:1022609714768 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12385045B2 (en) | 2016-06-07 | 2025-08-12 | Cepheid | Thermostable polymerase inhibitor compositions and methods |
| EP3818170A4 (en) * | 2018-07-02 | 2022-03-09 | Swift Biosciences, Inc. | Temperature controlled dna polymerase inhibitors |
| CN112567038A (zh) * | 2018-07-24 | 2021-03-26 | 旗舰创业创新第六有限责任公司 | 包含环状多核糖核苷酸的组合物及其用途 |
| EP3827084A4 (en) * | 2018-07-24 | 2023-03-15 | Flagship Pioneering Innovations VI, LLC | COMPOSITIONS WITH CIRCULAR POLYRIBONUCLEOTIDS AND USES THEREOF |
| KR102950624B1 (ko) | 2018-07-24 | 2026-04-10 | 플래그쉽 파이어니어링 이노베이션스 브이아이, 엘엘씨 | 원형 폴리리보뉴클레오티드를 포함하는 조성물 및 이의 용도 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3464596A1 (en) | 2019-04-10 |
| JP7420850B2 (ja) | 2024-01-23 |
| JP2019520815A (ja) | 2019-07-25 |
| EP3464596B1 (en) | 2025-07-30 |
| US12385045B2 (en) | 2025-08-12 |
| AU2017277304A1 (en) | 2018-12-20 |
| AU2017277304B2 (en) | 2023-07-20 |
| US11299739B2 (en) | 2022-04-12 |
| CA3026646A1 (en) | 2017-12-14 |
| US20190316132A1 (en) | 2019-10-17 |
| JP2022088455A (ja) | 2022-06-14 |
| JP7106461B2 (ja) | 2022-07-26 |
| CN109477111B (zh) | 2023-12-15 |
| CN109477111A (zh) | 2019-03-15 |
| US20250369000A1 (en) | 2025-12-04 |
| US20220389427A1 (en) | 2022-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12385045B2 (en) | Thermostable polymerase inhibitor compositions and methods | |
| EP1576188B1 (en) | Methods for using riboprimers for strand displacement replication of target sequences | |
| EP3350732B1 (en) | Method for preparing a next generation sequencing (ngs) library from a ribonucleic acid (rna) sample and kit for practicing the same | |
| AU2013203624B2 (en) | Isothermal amplification of nucleic acid using a mixture of randomized primers and specific primers | |
| CA2778449C (en) | Amplification primers with non-standard bases for increased reaction specificity | |
| US20110117559A1 (en) | Small rna detection assays | |
| AU2944200A (en) | Method for amplifying nucleic acid sequence | |
| WO2011163249A2 (en) | Compositions, kits, and methods for synthesis and/or detection of nucleic acids | |
| CA2788821A1 (en) | Isothermal amplification of nucleic acid using primers comprising a randomized sequence and specific primers and uses thereof | |
| JP2009528283A (ja) | マグネシウム封鎖によるpcrホットスタート | |
| US10077468B2 (en) | PCR primer capable of reducing non-specific amplification and PCR method using the PCR primer | |
| US20110212451A1 (en) | Rna detection method | |
| US20230227833A1 (en) | Nucleic acid ligand and use thereof | |
| WO2005111209A1 (ja) | 高速dnaポリメラーゼを用いた高速pcr | |
| JP7191115B2 (ja) | エンドヌクレアーゼ媒介移動平衡(EM-SEq)による核酸の増幅のための方法 | |
| CN115595322A (zh) | 一种核酸聚合酶底物类似物的混合物及其应用 | |
| US20080131891A1 (en) | Biochemical Reagents And Their Uses | |
| KR20220084141A (ko) | 열 반응성 접합체 | |
| HK1142362A1 (en) | Polyanion for improved nucleic acid amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17734553 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3026646 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2018563880 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2017277304 Country of ref document: AU Date of ref document: 20170606 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2017734553 Country of ref document: EP Effective date: 20190107 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2017734553 Country of ref document: EP |