WO2017193832A1 - Mitochondrial genomic library based on high-throughput sequencing and method for constructing the library - Google Patents

Abstract

A mitochondrial genomic library based on high-throughput sequencing and a method for constructing the library. The method comprises the following steps: S1. performing a one-step PCR amplification of total mitochondrial DNA from total DNA; S2. fragmenting the total mitochondrial DNA to obtain a DNA fragment; S3. performing end repair on the DNA fragment to obtain a blunt-end DNA fragment; S4. A-tailing a 3' end of the blunt-end DNA fragment to obtain an A-tailed DNA fragment; S5. adding a linker on the 3' end of the A-tailed DNA fragment to obtain a DNA fragment with linkers; S6. performing LM-PCR on the DNA fragment with linkers; and S7. performing PCR on an LM-PCR product. The method for constructing the mitochondrial genomic library performs PCR amplification on total DNA to obtain total mitochondrial DNA, thereby ensuring accurate amplification of a human mitochondrial genome and improving the accuracy and precision of mutation detection by preventing contamination or mixing of a homologous sequence from a human genome.

Description

Mitochondrial genomic library based on high-throughput sequencing and construction method thereof Technical field

The invention relates to the field of gene detection, in particular to a mitochondrial genome library based on high-throughput sequencing and a construction method thereof.

Background technique

Mitochondria are organelles that produce energy in cells. Mitochondrial DNA is a genetic material in mitochondria and is a double-stranded ring. There may be one or several mitochondrial DNA molecules in one mitochondria. Human mitochondrial DNA (mtDNA) contains 37 genes, of which 22 genes encode transfer ribonucleic acid (tRNA), 2 genes encode ribosomal ribonucleic acid (12S and 16SrRNA), and 13 genes encode polypeptides. These mitochondrial genome genes are essential for mitochondria to produce functional proteins, and mitochondrial ribosomes are ribosomes present in the mitochondrial matrix responsible for translational work in the mitochondria.

Mitochondrial diseases are diseases caused by abnormal function of mitochondria. Mitochondrial diseases are often caused by mutations in mitochondrial DNA. These gene mutations may be on mtDNA or on nuclear genes. For mitochondrial genome analysis in patients with mitochondrial disease, it is found that the related gene mutation is an ideal genetic diagnosis method. Due to the large number of genes involved in mitochondrial diseases, only a few common mitochondrial gene loci can be selected for mutation and deletion screening in the clinic. The positive rate is very low, and most patients have difficulty obtaining accurate cause diagnosis.

High-throughput sequencing technology, also known as second-generation sequencing, next-generation sequencing, deep sequencing, or massively parallel sequencing, is a revolutionary change to traditional sequencing, sequencing hundreds of thousands to millions of DNA molecules at a time. . The core idea is Sequencing by Synthesis, which determines the sequence of DNA by capturing the newly synthesized ends of the markers. High-throughput sequencing makes it possible to perform detailed analysis of the transcriptome and genome of a species. At present, there are three main types of sequencing platforms: illumina company Hiseq platform, life technologies company PGM level Taiwan and Roche's 454 platform.

High-throughput sequencing technology is extremely important in research and clinical applications due to its ultra-high sequencing capabilities. However, although second-generation sequencing greatly reduces the cost of DNA analysis, the sample preparation process is still cumbersome and has become an obstacle to its widespread application in the future. Therefore, a lot of research has been done on its DNA library construction method in order to simplify the preparation steps of the sample.

The Chinese Patent Application Publication No. CN 104894651 A discloses a high-throughput sequencing library construction method for microinitial DNA and a high-throughput sequencing library constructed thereby. The method comprises the following steps: step S1, physically interrupting the sample DNA to obtain fragmented DNA; step S2, performing end repair on the fragmented DNA and adding A to obtain repair DNA; and step S3, using the connection enhancer to repair the DNA. The linker is ligated to obtain a linker fragment; in step S4, the linker fragment is amplified to obtain a high-throughput sequencing library; the linker enhancer is DMSO, ethanol, ethylene glycol or glycerol. After the step S3 and before the step S4, the constructing method further comprises the step of magnetic bead purification of the tapped fragment. The ligation fragment is subjected to stepwise amplification and the step of magnetic bead purification is added after each amplification. The step S4 includes: amplifying the band-joined fragment by 4 to 7 cycles to obtain a first amplified fragment; and performing 0.95 to 1.20 times of volume of the first amplified fragment to purify the magnetic bead to obtain a first expansion. Amplifying the purified fragment; amplifying the first amplified purified fragment for 6 to 9 cycles to obtain a second amplified fragment; and purifying the second amplified fragment by 0.95 to 1.20 times the volume of the magnetic bead to obtain a second Amplifying the purified fragment; and sorting the second amplified purified fragment with 0.7 to 0.85 volumes of magnetic beads to obtain the high-throughput sequencing library. In the invention, the purification of the magnetic beads is carried out separately and the amount of the magnetic beads is different, and the purification operation is complicated.

Summary of the invention

In view of the above, it is necessary to address the above problems, and the present invention provides a mitochondrial genomic library based on high-throughput sequencing and a method for constructing the same.

In order to achieve the above object, the present invention adopts the following technical solutions:

A method for constructing a mitochondrial genomic library based on high-throughput sequencing, comprising the following steps:

S1, amplification of mitochondrial full-length DNA by one-step PCR from total DNA;

S2, breaking the mitochondrial full-length DNA to obtain a DNA fragment;

S3, performing end repair on the DNA fragment to obtain a blunt-ended DNA fragment;

S4, adding A to the 3' end of the blunt-ended DNA fragment to obtain a DNA fragment with A added;

S5, adding a linker at the 3' end of the DNA fragment added with A to obtain a DNA fragment to which a linker is added;

S6, performing pre-LM-PCR on the DNA fragment of the adaptor;

S7, post-PCR is performed on the LM-PCR product.

Preferably, the step S1 is specifically: extracting whole blood DNA, and using the template as a template to PCR-amplify the mitochondrial full-length DNA.

More preferably, the specific sequence of the primer pair used in step S1 is Primer F: ccgcacaagagtgctactctcctc, Primer R: gatattgatttcacggaggatggtg.

Preferably, the PCR reaction system in the step S1 is as follows:

Preferably, the procedure of the PCR reaction in the step S1 is as follows:

Lid: 105 ° C, Wait, Auto; Block: 95 ° C, 2 min;

95 ° C, 20 sec; 68 ° C, 18 min; 30 cycles;

72 ° C, 20 min; 4 ° C, hold.

Preferably, the reaction system of the pre-LM-PCR is as follows:

Preferably, the reaction conditions of the pre-LM-PCR are as follows: 98 ° C 45 sec; 98 ° C 15 sec, 60 ° C 30 sec, 72 ° C 30 sec, 9 cycles; 72 ° C 1 min; 4 ° C.

Preferably, the system of the post PCR reaction is as follows:

Preferably, the conditions of the post-PCR reaction are as follows: 98 ° C 45 sec; 98 ° C 15 sec, 60 ° C 30 sec, 72 ° C 30 sec, 14 cycles; 72 ° C 1 min; 4 ° C.

Preferably, said steps S3-S7 comprise a purification step.

Preferably, the purification step is: adding the corresponding reaction solution to the sample and mixing, incubating at room temperature for 10 minutes, and fully combining the DNA with the magnetic beads; placing the tube on the magnetic stand until the solution becomes clear, discarding the supernatant, and The tube is kept on the magnetic stand, add 80% alcohol, incubate at room temperature for more than 30 seconds, absorb the alcohol, keep the tube on the magnetic stand, add 80% alcohol, incubate for 30 seconds at room temperature, absorb alcohol; dry.

More preferably, when it is necessary to separate the DNA from the magnetic beads, after purification, the tube is taken out from the magnetic stand, and 10 mM Tris-HCl, pH 8.0, is added, and the mixture is incubated at room temperature for 2 minutes.

A mitochondrial genomic library based on high-throughput sequencing was constructed by the above-described mitochondrial genomic library construction method.

Compared with the prior art, the present invention has the following beneficial effects:

The mitochondrial genomic library construction method of the present invention can obtain the mitochondrial full-length DNA by one-step PCR amplification from total DNA, which can ensure the accurate amplification of the human mitochondrial genome, and is not contaminated by homologous sequences in the human genome to make the mutation detection more sensitive and accurate. And save time; different sequences can be introduced for high-throughput sequencing by performing pre-LM-PCR; a sufficient amount of DNA can be obtained by performing post-PCR for subsequent high-throughput sequencing.

The mitochondrial genomic library construction method of the invention is purified by terminal repair, addition of A, addition of linker, pre-LM-PCR and post-PCR, and the DNA is not separated from the magnetic beads after end repair and addition of A, which simplifies the operation steps and saves the operation. time.

The high-throughput sequencing of the mitochondrial DNA library constructed by the present invention is carried out for bioinformatic analysis to obtain the mitochondrial genomic DNA sequence of the test sample, and different mutation types can be detected and quantified. Because high-throughput sequencing has high sensitivity to common and rare variants, most of the disease-related variants in the exon region of the coding region of mitochondria can be found. The sensitivity of mutation detection can be increased by increasing the depth of sequencing. At 5000x coverage depth, more sequence information is obtained for statistical analysis, and the sensitivity can be achieved from 0.1 to 1%.

DRAWINGS

Figure 1 is an electropherogram of the PCR product in step S1.

Figure 2 is a fragmentation electrophoresis pattern in step S2.

Figure 3 is an electrophoresis pattern of the purified LM-PCR product in step S6.

Figure 4 is an electrophoresis pattern of the purified PCR product in step S7.

detailed description

The invention will be further described with reference to the drawings and specific embodiments. Unless otherwise specified, the reagents, equipment or methods used in the present invention are those skilled in the art. Well-known, no longer repeat here.

The formulations of the following reagents used in the present invention are as follows:

End Repair Master Mix (20 μl):

Water 8μl

10×KAPA End Repair Buffer 7μl

KAPA End Repair Enzyme Mix 5μl.

Add A reaction mixture (A-Tailing Master Mix, 50 μl):

Water 42μl

10×KAPA A-Tailing Buffer 5μl

KAPA A-Tailing Enzyme 3μl.

Ligation Master Mix (55 μl):

Water 30μl

5×KAPA Ligation Buffer 10μl

KAPA T4 DNA Ligase 5 μl.

Example 1

A method for mitochondrial genome detection and analysis based on high-throughput sequencing, comprising the following steps:

S1, PCR amplification of mitochondrial full-length DNA

DNA was extracted from 300 μl of whole blood according to a conventional method, and 2 μl of the DNA sample was subjected to concentration determination on a NanoDrop. The measured DNA concentration requires an OD260/OD280 ratio between 1.8 and 2.0, and an OD260/OD230 ratio between 1.8 and 2.2. The above two ratios can determine the purity of the extracted DNA. If it is outside the above range, it can be considered that the purity of the extracted DNA does not meet the requirements and needs to be re-extracted or re-purified. Further diluted to a concentration of 50 ng/μl with DNA lysis buffer according to the measured concentration.

The mitochondrial full-length DNA was amplified by one-step PCR using the diluted whole blood DNA as a template. The PCR reaction system is shown in Table 1.

Table 1, PCR reaction system

The primer pair used in this example was designed by the inventors according to the disclosed mitochondrial sequence, and the mitochondrial full-length DNA can be amplified, and the specific sequence is as follows:

Primer F (SEQ ID NO: 1): ccgcacaagagtgctactctcctc,

Primer R (SEQ ID NO: 2): gatattgatttcacggaggatggtg.

The procedure for the above PCR reaction is as follows:

Lid: 105 ° C, Wait, Auto; Block: 95 ° C, 2 min.

95 ° C, 20 sec; 68 ° C, 18 min; 30 cycles.

72 ° C, 20 min; 4 ° C, hold.

2 μl of the obtained PCR product and 3 μl of the dye were mixed, and electrophoresis was carried out using a 1% agarose gel, and the electrophoresis conditions were 100 v for 60 min. The result is shown in Figure 1. Lane 1 is a molecular size marker, lanes 2 and 3 are mitochondrial amplification of different samples, approximately 16 kb in size, and lane 4 is a negative control.

S2, fragment broken

The amplified genomic DNA was disrupted with a Q800R sonicator. Specific steps are as follows:

Add pure water to the cup probe cup and have no titanium probe. Transfer 40 μl of the amplified product into a 0.5 ml centrifuge tube, attach it to the sample holder, and gently bounce off the bubbles at the bottom. Sample Place the holder into the cup probe and add pure water to the cup probe again until the level of pure water is flush with the DNA level in the tube.

Open the Q800R's circulating condensate system in advance and set the temperature at 3 °C. Set the interrupt program on the host: Pulse on 20sec; Pulse off 30sec; Time 20min; Amplitude 40%. When the temperature drops to the set temperature of 3 °C, the interrupting program can be turned on. After the program is run, the samples in the microtubes are stored frozen. After all samples have been interrupted, turn off the circulating condensate system and shut down the engine.

1 μl of each sample was taken and detected by 1.5% agarose gel electrophoresis. Finally, the fragment length of each sample should be below 500 bp, and the peak value at 350 bp was acceptable. The result is shown in Figure 2. The first lane is a molecular size marker, and the second and third lanes are DNA interrupts for different samples. The fragment size is below 500 bp and the peak is about 350 bp.

S3, end repair

50 μl of DNA fragment was taken from each sample, and 20 μl of the end-repair reaction solution was added in a total volume of 70 μl. Incubate at 20 ° C for 30 min on a thermocycler (amplifier) and purify immediately after completion.

The specific method of purification was as follows: 120 μl of Agencourt ^R AMPure ^R XP reagent was added to each sample in a total volume of 190 μl. Use a pipette to repeatedly pipe up and down and mix well. Incubate for 10 minutes at room temperature to allow the DNA to bind well to the magnetic beads. Place the tube on the magnetic stand until the solution becomes clear and carefully discard the supernatant. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate for 30 seconds at room temperature and carefully remove the alcohol. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate at room temperature for more than 30 seconds, carefully remove the alcohol. This step should be as clean as possible, but care should be taken not to remove the magnetic beads from the bottom. Dry at room temperature. Take the tube out of the magnetic stand.

S4, plus A

To each tube containing the repair DNA-magnetic beads, 50 μl of the A-addition reaction mixture was added in a total volume of 50 μl. The pipette is repeatedly sucked up and down, and the sample is thoroughly mixed. The thermocycler (amplifier) was incubated at 30 ° C for 30 min and purified immediately after completion.

The specific method of purification was as follows: 90 μl of PEG/NaclSPRI ^R Solution was added to each sample in a total volume of 140 μl. Use a pipette to repeatedly pipe up and down and mix well. Incubate for 10 minutes at room temperature to allow the DNA to bind well to the magnetic beads. Place the tube on the magnetic stand until the solution becomes clear and carefully discard the supernatant. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate for 30 seconds at room temperature and carefully remove the alcohol. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate at room temperature for more than 30 seconds, carefully remove the alcohol. This step should be as clean as possible, but care should be taken not to remove the magnetic beads from the bottom. Dry at room temperature.

S5, add connector

Add the following reaction solution to each DNA sample tube to which A is added:

Use a pipette to repeatedly pipe up and down, and mix the sample thoroughly. The thermocycler (amplifier) was incubated at 20 ° C for 15 min, and the subsequent purification step was performed immediately after the end. The specific method of purification is as follows:

50 μl of a total volume of 100 μl of PEG/Nacl SPRI ^R Solution was added to each sample. Use a pipette to repeatedly pipe up and down and mix well. Incubate for 10 minutes at room temperature to allow the DNA to bind well to the magnetic beads. Place the tube on the magnetic stand until the solution becomes clear and carefully discard the supernatant. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate for 30 seconds at room temperature and carefully remove the alcohol. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate at room temperature for more than 30 seconds, carefully remove the alcohol. This step should be as clean as possible, but care should be taken not to remove the magnetic beads from the bottom. Dry at room temperature. Take the tube out of the magnetic stand. 50 μl of 10 mM Tris-HCl (pH 8.0) was added and incubated for 2 minutes at room temperature to separate the DNA from the magnetic beads. Transfer all of the supernatant to a new tube and continue with the rest.

S6, pre-LM-PCR

The reaction system and reaction conditions of the pre-LM-PCR are shown in Tables 2 and 3.

Table 2. Reaction system of pre-LM-PCR

Reagent	Dosage
2×KAPA HiFiHotStartReadyMix	25μl
Pre-LM-PCR Primers 1&2, 5μM	5μl
Adapter-ligated Sample Library	20μl
total capacity	50μl

Table 3. Reaction conditions of pre-LM-PCR

Samples were stored at 4 ° C or -20 ° C for 72 hours or directly subjected to subsequent purification experiments. The specific method for purification of the pre-LM-PCR product is:

50 μl of Agencourt ^R AMPure ^R XP reagent was added to each sample in a total volume of 100 μl. Use a pipette to repeatedly pipe up and down and mix well. Incubate for 10 minutes at room temperature to allow the DNA to bind well to the magnetic beads. Place the tube on the magnetic stand until the solution becomes clear and carefully discard the supernatant. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate for 30 seconds at room temperature and carefully remove the alcohol. Leave the tube on the magnetic stand and add 200 μl of 80% alcohol. Incubate at room temperature for more than 30 seconds, carefully remove the alcohol. This step should be as clean as possible, but care should be taken not to remove the magnetic beads from the bottom. Dry at room temperature. Take the tube out of the magnetic stand. 50 μl of 10 mM Tris-HCl (pH 8.0) was added and incubated for 2 minutes at room temperature to separate the DNA from the magnetic beads.

The amplified DNA concentration and fragment size were determined by 1.5% gel electrophoresis, Nanodrop and Qubit. As shown in Fig. 3, the first lane is a molecular size marker, and the second and third lanes are for pre-LM-PCR of different samples, and the fragment size is about 400 bp. The DNA concentrations of the two samples in lanes 2 and 3 after amplification by Qubit assay were 34.2 ng/μl and 42.2 ng/μl, respectively.

S7, post PCR

The post PCR reaction system and reaction conditions are shown in Tables 4 and 5.

Table 4, post PCR reaction system

DNA bound to magnetic beads (bead-bound captured DNA)	20μl
KAPA HiFiHotStartReadyMix	25μl
Post-LM-PCR Primer 1&2 (5μM)	5μl
total capacity	50μl

Table 5, post PCR reaction conditions

Samples were stored at 4 ° C or -20 ° C for 72 hours or directly subjected to subsequent purification experiments. The method of purification after PCR is:

Turn Agencourt ^R AMPure ^R XP reagent several times to mix thoroughly. 90 μl of Agencourt ^R AMPure ^R XP reagent was added to each sample tube and vortexed for 2 seconds. Leave at room temperature for 15 min. Centrifuge instantaneously, then place the sample in a magnetic stand and let stand until the liquid becomes clear. Carefully remove the solution, taking care not to remove the magnetic beads from the bottom. Do not remove the sample tube from the magnetic plate, add 200 μl of 80% alcohol directly to the tube, let stand for 1 min, and then aspirate the liquid. Repeat this step once. Place the tube in the heater at 37 ± 0.5 ° C for 5 min or until the alcohol in the tube has completely evaporated. The magnetic beads were dissolved with 52 μl of NF water. The pipette was blown 10 times at room temperature for 2 min. Place the tube back into the magnetic plate until the solution becomes clear. Each sample was directly transferred from 50 μl to a 1.5 ml centrifuge tube.

The amplified DNA concentration and fragment size were determined by 1.5% gel electrophoresis, Qubit and qPCR. After multiplex PCR, a 68 bp addenda will be added to the product at this time. Care should be taken to see if the peaks appear consistent. The gel electrophoresis pattern is shown in Fig. 4. The first lane is a molecular size marker, and the second and third lanes are post-PCR for different samples, and the peak value is about 400 bp. The following table shows the DNA concentrations after amplification by Qubit and qPCR assays as shown in Table 6.

Table 6. Qubit and qPCR for DNA concentration after amplification

Sample number	1031	1037
Qubit measurement value (ng/μl)	2.54	2.62
qPCR measurement (nM)	12.2	9.8

The high-throughput sequencing of the mitochondrial DNA library constructed by the present invention is carried out for bioinformatic analysis to obtain the mitochondrial genomic DNA sequence of the test sample, and different mutation types can be detected and quantified. Because high-throughput sequencing has high sensitivity to common and rare variants, most of the disease-related variants in the exon region of the coding region of mitochondria can be found. The sensitivity of mutation detection can be increased by increasing the depth of sequencing. At 5000x coverage depth, more sequence information is obtained for statistical analysis, and the sensitivity can be achieved from 0.1 to 1%.

The above-mentioned embodiments are merely illustrative of several embodiments of the present invention, and the description thereof is more specific and detailed, but is not to be construed as limiting the scope of the invention. It should be noted that a number of variations and modifications may be made by those skilled in the art without departing from the spirit and scope of the invention. Therefore, the scope of the invention should be determined by the appended claims.

Claims (10)

1. A method for constructing a mitochondrial genomic library based on high-throughput sequencing, comprising the steps of:

   S1, one-step PCR amplification of mitochondrial full-length DNA from total DNA;

   S2, breaking the mitochondrial full-length DNA to obtain a DNA fragment;

   S3, performing end repair on the DNA fragment to obtain a blunt-ended DNA fragment;

   S4, adding A to the 3' end of the blunt-ended DNA fragment to obtain a DNA fragment with A added;

   S5, adding a linker at the 3' end of the DNA fragment added with A to obtain a DNA fragment to which a linker is added;

   S6, performing pre-LM-PCR on the DNA fragment of the adaptor;

   S7, post-PCR is performed on the LM-PCR product.
2. The mitochondrial genomic library construction method according to claim 1, wherein the step S1 is specifically: extracting whole blood DNA, and using the template as a template to PCR-amplify mitochondrial full-length DNA.
3. The mitochondrial genomic library construction method according to claim 2, wherein the specific sequence of the primer pair used in the step S1 is Primer F: ccgcacaagagtgctactctcctc, and Primer R: gatattgatttcacggaggatggtg.
4. The method for constructing a mitochondrial genomic library according to claim 2, wherein the PCR reaction system in the step S1 is as follows:

   
5. The method for constructing a mitochondrial genomic library according to claim 4, wherein the procedure of the PCR reaction in the step S1 is as follows:

   Lid: 105 ° C, Wait, Auto; Block: 95 ° C, 2 min;

   95 ° C, 20 sec; 68 ° C, 18 min; 30 cycles;

   72 ° C, 20 min; 4 ° C, hold.
6. The method for constructing a mitochondrial genomic library according to claim 1, wherein the reaction system of the pre-LM-PCR in step S6 is as follows:

   
7. The method for constructing a mitochondrial genomic library according to claim 6, wherein the reaction conditions of the pre-LM-PCR in step S6 are as follows: 98 ° C 45 sec; 98 ° C 15 sec, 60 ° C 30 sec, 72 ° C 30 sec, 9 cycles; 72 ° C 1 min. ; 4 ° C.
8. The method for constructing a mitochondrial genomic library according to claim 1, wherein the system of the post PCR reaction in step S7 is as follows:

   

   The conditions of the post-PCR reaction were as follows: 98 ° C 45 sec; 98 ° C 15 sec, 60 ° C 30 sec, 72 ° C 30 sec, 14 cycles; 72 ° C 1 min; 4 ° C.
9. The mitochondrial genomic library construction method according to claim 1, wherein the steps S3-S7 comprise a purification step.
10. A mitochondrial genomic library based on high-throughput sequencing, characterized by The mitochondrial genomic library construction method described in claim 1 was constructed.

Images