CN108220393B - A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing - Google Patents
A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing Download PDFInfo
- Publication number
- CN108220393B CN108220393B CN201810075162.XA CN201810075162A CN108220393B CN 108220393 B CN108220393 B CN 108220393B CN 201810075162 A CN201810075162 A CN 201810075162A CN 108220393 B CN108220393 B CN 108220393B
- Authority
- CN
- China
- Prior art keywords
- dna
- mtdna
- mitochondrial
- product
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to genetic test fields, are related to a kind of high-throughput quickly method of detection mitochondrial gene mutation or missing.The present invention utilizes primer amplified mitochondrial DNA after extracting people's complete genome DNA, amplified production carries out interrupting reaction after purification, modified and connected sequence measuring joints after recycling target fragment and obtain DNA library, be sequenced and analyze data.Method of the present invention can detect the information such as the existing mutation of the entire mitochondrial DNA gene of human body, missing quickly, comprehensively, simultaneously, with time saving and energy saving, the characteristics of high specificity, it can not only find the presence of mitochondrial disease in time, and the database of abundant mitochondrial disease, so as to provide foundation for clinical diagnosis.
Description
Technical field
The invention belongs to genetic test fields, are related to the side of a kind of high-throughput quickly detection mitochondrial gene mutation or missing
Method.
Background technique
Mitochondria is a kind of important organelle in eukaryocyte, place is provided for the oxidative phosphorylation of cell, thin
Born of the same parents' energetic supersession, Apoptosis maintain to play a crucial role in the vital movements such as intracellular Ca2+ iron ion balance.The mankind
Mitochondrial DNA (mitochondrialDNA, mtDNA) is present in cytoplasm mitochondria, overall length 16569bp.It is closed in double-strand
Cyclic structure is closed, is divided into code area and noncoding region two parts, wherein there are 37 genes, including 22 coding transition kernels in code area
Ribosomal ribonucleic acid (tRNA), 2 encoding ribosomal ribonucleic acid (12S and 16SrRNA), 13 coding polypeptides.MtDNA sequence in the gene is tight
It is close, introne is not included between sequence.Compared with core DNA, mtDNA has a characteristic that (1) has unique matrilinear inheritance special
Property, mtDNA passes to filial generation with maternal egg cell；(2) multicopy number contains hundreds and thousands of a lines in the every individual cells of the mankind
Plastochondria, the interior copy containing 2~10 mtDNA of each mitochondria；(3) frequency of mutation of high mutation rate, mtDNA compares karyogene
10~20 times of group；(4) high heterogeneous, the mtDNA of mutation and the mtDNA of wild type can be existed simultaneously in a cytoplasm,
Play different biological functions.
According to the literature, mtDNA mutation will lead to mankind's multifactorial disease, part genetic disease and mankind aging etc.
Occur.1988 for the first time report had been acknowledged 100 kinds or more pathogenic point mutation and 200 kinds missing, insertion and reset, wherein
About 60% point mutation influences mitochondrial tRNA, and 35% influences respiratory chain polypeptide sub-units, and 5% involves mitochondria rRNA.mtDNA
Mutation makes mitochondria that can not provide enough energy by influencing Mitochondria function, reduction ATP synthesis,
Cause cell regression even necrosis occur, causes linked groups, organ dysfunction impaired, corresponding clinical symptoms occur.Common
Mitochondriopathy mainly includes mitochondriopathy with hyperlactacidemia and stroke sample breaking-out syndrome (MELAS), Leber heredity view mind
Through lesion (LHON), lafora's disease disease and ragged-red fiber disease (MERRF), the pigmentosa view of neuromyasthenia-incoordination-
Epiplotitis (NARP), matrilinear inheritance Leigh Cotard (MILS), matrilinear inheritance diabetes mellitus deafness (MIDD), PearsonShi
Syndrome, Kearns-Sayre syndrome (KSS), chronic progressive ophthalmoplegia externa (CPEO) etc..
At present clinically to the detection of mtDNA, it is focusing only on and a small number of common chondriogen sites is mutated and is lacked
Screening is lost, as to mitochondrial encephalomyopathy with hyperlactacidemia and stroke sample breaking-out syndrome (MELAS) common mutations A3243G
Screening, positive rate is low, and Most patients are difficult to obtain accurate etiological diagnosis.Currently used detection method mainly includes
Sanger sequencing and high throughput sequencing technologies (NGS).Wherein Sanger PCR sequencing PCR can survey mitochondrial DNA full-length genome
Sequence, and then detection and analysis mitochondrial gene mutation site.But Sanger sequencing also have certain defect, such as sequencing at
This height, background are high, detection sensitivity is low, can not carry out simultaneously great amount of samples processing, can not be applied on a large scale in clinical diagnosis
Deng.
Chinese invention patent CN103614482A discloses the side based on high-throughput gene sequencing Non-invasive detection mitochondrial DNA
Method is to extract Stomatocyte total genomic dna as sample；Chinese invention patent CN105087767A discloses mitochondria base
Because of group detection method and primer, a kind of primer sets for forensic identification sample are provided, for detecting the few sample of genome amount
The full length sequence of this mitochondrial DNA, the detection for sample micro in medical jurisprudence；Chinese invention patent CN106755456A is public
Primer combination and kit of the cloth for the detection of mitochondria full-length genome, it is entire to carry out PCR amplifications using 6 pairs of specific primers
Then mitochondrial genomes detect mitochondria full-length genome with Sanger sequencing technologies with auxiliary diagnosis since mtDNA mutation is led
The mitochondriopathy of cause.
Summary of the invention
The purpose of the invention is to provide a kind of high-throughput quickly method of detection mitochondrial gene mutation or missing,
The information such as the existing mutation of the entire mitochondrial DNA gene of human body, missing can be detected quickly, comprehensively, simultaneously, and there is time saving province
The characteristics of power, high specificity, can find the presence of mitochondrial disease in time, provide foundation for clinical diagnosis, enrich mitochondria
The database of disease.
In order to reach the purpose of the present invention, adopt the following technical scheme that
A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing, the detection method specifically include following step
It is rapid:
(1) target fragment obtains: according to people's complete genome DNA extracts kit (Life technologies) specification
DNA is extracted, using the MtDNA specific primer of design, using the mitochondrial DNA of extraction as template, pcr amplification reaction is carried out and obtains
The laggard Break Row of mitochondrial DNA amplification product purification is reacted, obtains the purpose piece of particular size by mitochondrial DNA amplification product
Section；
It is 20 μ l total systems, specifically 2X Phanta that wherein the reaction system of the PCR amplification, which includes: PCR,
10 μ l, dNTP mix of MaxBuffer, 1 μ l, Phanta Max Super-Fidelity DNA Polymerase, 1 μ l,
Another reaction of mtDNA1F (10uM) uses mtDNA2R with another reaction of mtDNA2F (10uM) 2 μ l, mtDNA1R (10uM)
(10uM) 2 μ l, ddH23 μ l of O, 1 μ l of DNA profiling (10-100ng)；PCR amplification program is: 95 DEG C of initial denaturation 3min；Then into
Row 30 recycle, 95 DEG C of denaturation 15s in each circulation, then 63 DEG C of annealing 30s, then 72 DEG C of extension 420s；Finally at 72 DEG C
Extend 300s.
(2) DNA library is established: carrying out phosphorylation reparation to target fragment end, and 3 ' ends plus A base is being added to be sequenced to obtain the final product
Product；It is isolated and purified to sequencing product plus the laggard row agarose gel electrophoresis of sequence measuring joints, recycling target DNA fragments are formed
DNA library；
Preferably, in the step (2) sequencing product the preparation method comprises the following steps: take new nuclease free centrifuge tube, press
Reagent, End Prep Enzyme Mix, 3 μ L is added in following system；End Repair Reaction Buffer (10X), 6.5 μ
L；PCR product, 55.5 μ L；Pipettor piping and druming mixes, and is then reacted according to following PCR cycle condition: 20 DEG C, 30s；65
DEG C, 30s；4 DEG C, Forever.
(3) target DNA fragments are sequenced: target DNA fragments in DNA library being carried out PCR amplification, use Agilent 2100
Biological analyser carries out the detection of DNA fragmentation size and concentration, and concentration and clip size are sequenced after meeting the requirements.
Preferably, the MtDNA specific primer includes two pairs of primers, and wherein mtDNA 1F sequence is
TCCCCACATCAAGCCCGAATGATATTTC；MtDNA 1R sequence is ATTCCGGATAGGCCGAGAAAGTGTTGT；mtDNA
2F sequence is ATTTCACTATCATATTCATCGGCGTAAAT；MTDNA 2R sequence is
GGGACGGATCGGAGAATTGTGTAGGCGAAT。
Preferably, the size of the Insert Fragment is 300-500bp.Sequencing product adds sequence measuring joints in the step 2)
It will sequencing product 25ul, DNA Adapter2.5ul, PEG6000 5ul and T4DNA Ligase 2.5ul mixing in operation.
The present invention is to provide the chondriogen detections based on NGS technology, are related to molecular biosciences and bioinformatics, this
Method is sample using people's complete genome DNA, devises two pairs of specific primers, carries out PCR amplification, builds library and sequencing,
The mitochondria whole genome sequence of proper manners sheet is obtained, accurate human mitochondrion sequence information is obtained.This method experimental design is rigorous,
Clear process is detected using advanced NGS technology, and testing result is accurate and reliable, high degree of automation, can quickly obtain
Human mitochondrion whole genome sequence information, meets the needs of clinically relevant disease detection, can find mitochondria correlation disease comprehensively
Disease, facilitates early prevention, the diagnosing and treating of mitochondrial disease, while also enriching clinical database.
Detailed description of the invention
Fig. 1 is chondriogen PCR products electrophoresis map of the present invention.
Fig. 2 is the library quality inspection figure of chondriogen PCR product of the present invention.
Specific embodiment
With reference to the accompanying drawing with specific implementation example, technical solution of the present invention is described in further detail.But this
Invention is not limited to following embodiment.
A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing of embodiment
The high-throughput quickly method of detection mitochondrial gene mutation or missing of the invention, specific step is as follows for experimental implementation:
1. people's complete genome DNA sample is extracted, in strict accordance with people's complete genome DNA extracts kit (Life
Technologies) specification extracts DNA.Particular content is as follows:
Key instrument:
Main agents:
Concrete operation step:
1) take appropriate group be woven in be fully ground in liquid nitrogen environment after transfer to 1.5mL centrifuge tube, 1mLTrizol is added,
It mixes well immediately；
2) group of mixing is woven in and is placed at room temperature for 10min, make sufficiently to crack；
3) 200 μ L chloroforms are added, mixing, 4 DEG C of centrifugations, 12000rpm10min fullys shake；
4) upper strata aqueous phase is taken, isometric phenol is added: chloroform (25:24) mixes well, 4 DEG C of centrifugations,
12000rpm10min；
5) upper strata aqueous phase is taken, isometric chloroform is added, mixes well, 4 DEG C of centrifugations, 12000rpm10min；
6) upper strata aqueous phase is taken, isometric isopropanol is added, -20 DEG C stand 1 hour, 4 DEG C of centrifugations, 12000rpm10min；
7) supernatant is abandoned, 1mL75% ethyl alcohol is added, washing precipitating, 4 DEG C are centrifuged, and 8000rpm5min abandons supernatant；
8) previous step is repeated
9) of short duration centrifugation, pipettor blot ethyl alcohol, are dried in vacuo 2-4min；
10) add 20-50 μ L RNase-Free Water, room-temperature dissolution 10min, brief centrifugation after mixing；
11) -80 DEG C of preservations.
2. designing 2 pairs of mtDNA specific primers.
First pair of mtDNA specific primer sequence are as follows: mtDNA 1F:TCCCCACATCAAGCCCGAATGATATTTC；
MtDNA 1R:ATTCCGGATAGGCCGAGAAAGTGTTGT.
Second pair of mtDNA specific primer sequence are as follows: mtDNA 2F:ATTTCACTATCATATTCATCGGCGTAAAT；
MtDNA 2R:GGGACGGATCGGAGAATTGTGTAGGCGAAT.
3. utilizing designed primer amplification mtDNA, PCR product after being expanded.
The reaction system of above-mentioned PCR amplification is as shown in table 1:
The reaction system of 1 PCR amplification of table
| Reagent | Dosage |
| 2X Phanta Max Buffer | 10μl |
| dNTP mix | 1μl |
| Phanta Max Super‐Fidelity DNA Polymerase | 1μl |
| MtDNA2F (10uM) is used in another reaction of mtDNA1F (10uM) | 2μl |
| MtDNA2R (10uM) is used in another reaction of mtDNA1R (10uM) | 2μl |
| ddH2O | 3μl |
| DNA profiling (10-100ng) | 1μl |
| Total system | 20μl |
The response procedures of above-mentioned PCR amplification are as shown in table 2:
The response procedures of 2 PCR amplification of table
4.PCR expand after, obtain PCR product 1 and PCR product 2, take respectively 2 μ l PCR products 1 and PCR product 2 into
The analysis of 1% agarose gel electrophoresis of row, DNA cloning product agarose gel electrophoresis results are as shown in Figure 1.
5. a pair above-mentioned mitochondrial DNA purifies, DNA purification process can according to purification process known in the field into
Row.
6. taking the PCR product mixing after purification of 2 equivalent of PCR product 1 and PCR product, mixing sample is interrupted to segment
Size is 300-500bp, the target fragment of size needed for recycling.
7. the sample having no progeny of fighting each other carries out end and repairs phosphorylation, 3 ' ends plus A base are then carried out.Concrete operations are as follows:
1) new nuclease free centrifuge tube is taken, reagent is added by following system, pipettor piping and druming mixes.
2) it is reacted by following PCR cycle condition:
20℃ 30s
65℃ 30s
4℃ Forever
8. then adding sequence measuring joints to above-mentioned product.The present invention be illumina company connector, it is specific with such as
Under:
| Above-mentioned product | 25ul |
| DNA Adapter | 2.5ul |
| PEG6000 | 5ul |
| T4DNA Ligase | 2.5ul |
9. then carrying out agarose gel electrophoresis to the sample of connection after the reaction was completed to isolate and purify, 300-500bp is recycled
Sample segment.
10.PCR expands sample obtained by previous step, and library amount is made to meet above confidential ask.
11. carrying out library quality inspection using 2100 biological analyser of Agilent, QPCR is quantitative, DNA fragmentation size and concentration
Machine testing could be gone up after each Indexs measure is qualified.Library quality inspection figure is as shown in Figure 2.
12. DNA derived above is sequenced by Illumina HiSeq2000, sequencing data is obtained, carries out data analysis.
As a result as follows:
(1) comparison rate of resulting gene and the Matrix attachment region of people is 94.36%, the reads and mankind's line not compared
The comparison rate of mitochondrial genes group is 91.19%；
(2) 100x assembles result and human mitochondrion compares situation: by 24 scaffold, (genome de novo is sequenced, and leads to
After crossing reads splicing acquisition Contigs, need to construct the library 454Paired-end or the library Illumina Mate-pair toward contact,
To obtain the sequence at a certain size both ends segment (such as 3Kb, 6Kb, 10Kb, 20Kb).Based on these sequences, can determine
Ordinal relation between Contig, Contigs known to these sequencings form Scaffold.) compared with human mitochondrion
Right, only 1 scaffold does not compare (C27,381bp)；
(3) as a result, 37643 scaffold have been obtained, concrete condition is as shown in table 3 for whole reads assembling:
3 reads of table assembles result
(4) by remove people's Matrix attachment region after reads be compared with human mitochondrion, calculate mitochondria coverage and
The depth in each site, table 4 indicate that depth is more than or equal to the base position of some value and the coverage of corresponding mitochondria.
4 depth of table is more than or equal to the base position of some value and the coverage of corresponding mitochondria
| Depth >= | Bases Count | Coverage |
| 10 | 16569 | 100% |
| 50 | 16568 | 99.99% |
| 100 | 16559 | 99.94% |
| 200 | 16543 | 99.84% |
| 500 | 15220 | 91.86% |
Claims (5)
1. a kind of high-throughput quickly method of detection mitochondrial gene mutation or missing, the detection method specifically include following step
It is rapid:
1) DNA is extracted according to people's complete genome DNA extracts kit specification, using two pairs of mtDNA specific primers of design,
Using the mitochondrial DNA of extraction as template, carries out PCR amplification and obtain mitochondrial DNA amplification product 1 and mitochondrial DNA amplification product
2, mitochondrial DNA amplification product 1 and mitochondrial DNA amplification product 2 are mixed and carry out interrupting reaction after purification, makes to interrupt rear DNA
Master tape size concentrates on Insert Fragment size, the target fragment of size needed for then recycling；
2) phosphorylation reparation is carried out to product end after interrupting reaction, and is adding 3 ' ends plus A base that product is sequenced to obtain the final product；To sequencing
Product is isolated and purified plus the laggard row agarose gel electrophoresis of sequence measuring joints, and recycling target DNA fragments form DNA library；
3) target DNA fragments in DNA library are subjected to PCR amplification, carry out DNA fragmentation size and concentration using Agilent 2100
Detection, concentration and clip size are sequenced after meeting the requirements, obtain sequencing data and carry out data analysis；
The reaction system of the PCR amplification includes: that PCR is 20 μ l total systems, specifically
10 μ l, dNTP mix of 2X Phanta Max Buffer, 1 μ l,
1 μ l of Phanta Max Super-Fidelity DNA Polymerase,
The 2 μ l of mtDNA 1F or mtDNA 2F of 10uM,
The 2 μ l of mtDNA 1R or mtDNA 2R of 10uM,
ddH2The 1 μ l of DNA profiling of O 3 μ l, 10-100ng；
Wherein mtDNA 1F sequence are as follows: TCCCCACATCAAGCCCGAATGATATTTC；
MtDNA 1R sequence is ATTCCGGATAGGCCGAGAAAGTGTTGT；
MtDNA 2F sequence is ATTTCACTATCATATTCATCGGCGTAAAT；
MtDNA 2R sequence is GGGACGGATCGGAGAATTGTGTAGGCGAAT；
The detection is NGS detection, and DNA sequencing is sequenced by Illumina HiSeq2000.
2. the high-throughput quickly method of detection mitochondrial gene mutation or missing according to claim 1, which is characterized in that
In the step 2) sequencing product the preparation method comprises the following steps: take nuclease free centrifuge tube, examination is added by following system
Agent, End Prep Enzyme Mix, 3 μ L；10X End Repair Reaction Buffer, 6.5 μ L；PCR product, 55.5 μ
L；Pipettor piping and druming mixes, and is then reacted according to following PCR cycle condition: 20 DEG C, 30s；65 DEG C, 30s；4 DEG C,
Forever。
3. the high-throughput quickly method of detection mitochondrial gene mutation or missing according to claim 1, which is characterized in that
People's process for extracting complete genome DNA in the step 1) are as follows:
1) take appropriate group be woven in be fully ground in liquid nitrogen environment after transfer to 1.5mL centrifuge tube, 1mL Trizol is added, immediately
It mixes well；The group of mixing is woven in and is placed at room temperature for 10min, makes sufficiently to crack；200 μ L chloroforms are added, fully shake mixing, 4
DEG C centrifugation, 12000rpm 10min；
2) take upper strata aqueous phase, isometric phenol is added: chloroform=25:24 mixes well, 4 DEG C of centrifugations, 12000rpm 10min；
Upper strata aqueous phase is taken, isometric chloroform is added, mixes well, 4 DEG C of centrifugations, 12000rpm 10min；Take upper strata aqueous phase, the bodies such as addition
Product isopropanol, -20 DEG C stand 1 hour, 4 DEG C of centrifugations, 12000rpm 10min；
3) supernatant is abandoned, 1mL75% ethyl alcohol is added, washing precipitating, 4 DEG C are centrifuged, and 8000rpm 5min abandons supernatant, repetitive operation 1
It is secondary；Of short duration centrifugation, pipettor blot ethyl alcohol, are dried in vacuo 2-4min；Add 20-50 μ L RNase-Free Water, room-temperature dissolution
10min, brief centrifugation after mixing；- 80 DEG C of preservations.
4. the high-throughput quickly method of detection mitochondrial gene mutation or missing according to claim 1, which is characterized in that
The size of the Insert Fragment is 300-500bp.
5. the high-throughput quickly method of detection mitochondrial gene mutation or missing according to claim 1, which is characterized in that
In the step 2) sequencing product add in the operation of sequence measuring joints will sequencing 25 μ l of product, 2.5 μ l of DNA Adapter,
5 μ l and T4DNA Ligase of PEG6000,2.5 μ l mixing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810075162.XA CN108220393B (en) | 2018-01-26 | 2018-01-26 | A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810075162.XA CN108220393B (en) | 2018-01-26 | 2018-01-26 | A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220393A CN108220393A (en) | 2018-06-29 |
| CN108220393B true CN108220393B (en) | 2019-01-08 |
Family
ID=62668965
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810075162.XA Active CN108220393B (en) | 2018-01-26 | 2018-01-26 | A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220393B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949942B (en) * | 2018-07-17 | 2020-08-11 | 浙江大学 | Mitochondrial whole genome sequencing method based on high-throughput sequencing |
| CN109280700B (en) * | 2018-09-17 | 2022-04-12 | 上海海洋大学 | Method for accurately determining Eriocheir sinensis mitochondrial whole genome sequence |
| CN111378732B (en) * | 2018-12-27 | 2022-08-23 | 北京希望组生物科技有限公司 | Mitochondrial genome sequencing primer, kit and method |
| CN111621552B (en) * | 2019-06-13 | 2022-05-06 | 中国科学院广州生物医药与健康研究院 | Method and system for detecting mtDNA mutation |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105907748B (en) * | 2016-05-10 | 2017-10-13 | 广州嘉检医学检测有限公司 | A kind of mitochondrial genomes library and its construction method based on high-flux sequence |
-
2018
- 2018-01-26 CN CN201810075162.XA patent/CN108220393B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220393A (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108220393B (en) | A kind of high-throughput quickly method of detection mitochondrial gene mutation or missing | |
| AU2021202149B2 (en) | Detecting repeat expansions with short read sequencing data | |
| CN107541791A (en) | Construction method, kit and the application in plasma DNA DNA methylation assay library | |
| CN105132407B (en) | A kind of cast-off cells DNA low frequencies mutation enrichment sequence measurement | |
| CN108085395A (en) | Primer sets, kit and the method for cervical carcinoma polygenes DNA methylation assay based on high-flux sequence | |
| CN110656157B (en) | Quality control product for tracing high-throughput sequencing sample and design and use method thereof | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN109082466A (en) | A kind of multiple gene detection kit and its application method detecting CACNA1S gene pleiomorphism | |
| CN103981256B (en) | Salmonella CRISPR (clustered regularlay interspaced short palindromic repeats) sequencing typing method | |
| CN107475403A (en) | The analysis method of the method for detection Circulating tumor DNA, kit and its sequencing result from peripheral blood dissociative DNA | |
| CN110387438A (en) | Multi-primers, kit and method for enterovirus high-flux sequence | |
| CN107937618A (en) | The droplet numeral RT PCR detection primers of A types Senecan virus and probe and its application | |
| CN104694629A (en) | Kit for detecting hereditary deafness susceptibility gene mutation | |
| CN107893126B (en) | For identifying the SSR molecular marker and application of Polygonatum germ plasm resource | |
| CN110004222A (en) | A kind of multiple gene detection kit and its application method for antipsychotics medication guide | |
| CN106755395A (en) | The mutational site of XI type osteogenesis imperfecta Disease-causing genes FKBP10 and its application | |
| CN108048600A (en) | A kind of fluorescent quantitative PCR detection method of infectious bovine rhinotrachetis virus | |
| CN111295713B (en) | Method for quantifying nucleic acid using stable isotope-labeled nucleic acid as internal standard and use thereof | |
| CN102191308A (en) | Wild ginseng and cultivated ginseng multiple polymerase chain reaction (PCR) test kit and identification method | |
| CN106086193A (en) | A kind of method analyzing mixing sample DNA based on INDEL SNP linkage relationship | |
| CN106754903A (en) | The primer pair and method of a kind of whole genome amplification for human mitochondrial | |
| CN109680101A (en) | A kind of rapid detection method for distinguishing the strong and weak poison of H7N9 subtype avian influenza virus | |
| CN110305974A (en) | The PCR analysis primer and its analysis method of common mouse metallothionein-Ⅰ are distinguished based on five SNP sites of detection | |
| CN107475351B (en) | Screening method of high-contribution pathogenic gene of rheumatoid arthritis | |
| CN109517819A (en) | A kind of detection probe, method and kit modified for detecting multiple target point gene mutation, methylation modification and/or methylolation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |