CN111172159A

CN111172159A - Bovine mitochondrial genome capture probe kit

Info

Publication number: CN111172159A
Application number: CN202010153348.XA
Authority: CN
Inventors: 向海; 赵兴波; 张兴
Original assignee: Foshan University
Current assignee: Foshan University
Priority date: 2020-03-06
Filing date: 2020-03-06
Publication date: 2020-05-19

Abstract

The invention provides a bovine mitochondrial genome capture probe kit, which comprises a probe, wherein the probe is obtained by DNA sequence design according to bovine mitochondrial genes, the probe is constructed by mixing amplification products of all bovine animals in equal mass, performing interruption treatment on the mixed amplification products of all bovine animals by using an ultrasonic crusher, and performing PCR amplification labeling and enzyme digestion on synthesized biotin labels and phosphorylation primers. The invention can obtain the capture probe sequence of the cross-bovine mitochondrial genome with high coverage, realizes cross-species, high-throughput and accurate acquisition of the bovine mitochondrial genome, can complete capture sequencing of any mitochondrial genome in bovine by matching with commercial hybrid capture reagent, and has the advantage of convenience. The defects of time and labor waste, high cost, data waste and the like in the amplification sequencing and sequence splicing analysis in the prior art are overcome.

Description

Bovine mitochondrial genome capture probe kit

Technical Field

The invention relates to the technical field of biology, in particular to a bovine mitochondrial genome capture probe kit.

Background

Mitochondria have multiple copies in somatic cells, and therefore mitochondrial DNA in animal tissues is more easily preserved than nuclear genomic information. Based on the characteristics, the information of the animal mitochondrial genome is widely applied to a plurality of fields, such as the development of molecular markers applied to animal source component identification, customs inspection and quarantine, forensic and judicial identification, or the research of species phylogenetic relationship establishment, functional genome evolution analysis, nuclear and cytoplasmic gene interaction and the like. As technology advances, more and more scientific research and industrial applications are required to utilize more animal mitochondrial genome information, even sequences of the entire mitochondrial genome, and it is often required to obtain mitochondrial genome information of multiple closely related species simultaneously to develop larger-dimensional research or applications.

For example, patent No. CN109182328A discloses a mitochondrial DNA extraction kit and method, comprising proteinase K, suspension, lysate and eluent; however, the mitochondrial DNA extraction kit only performs sequencing by reagent matching, but cannot obtain better sequencing results. For example, CN200610169638.3 discloses a kit for detecting mutation of a maternal genetic mitochondrial deafness gene a1555G, which comprises a reagent for extracting DNA from a blood sample, a mixed solution of PCR amplification reaction reagents, a real-time fluorescent quantitative probe, and a forward primer and a reverse primer for amplifying the real-time fluorescent quantitative probe, but the detection efficiency and accuracy need to be improved.

In the prior art, a method for obtaining a mitochondrial genome sequence of a bovine animal by combining PCR amplification with Sanger sequencing can only be applicable to species with a reference sequence; for bovine mitochondrial genomes with the length of 16.5kb, 18 pairs of specially designed PCR amplification primers are generally required to be used for respective amplification sequencing and sequence splicing, and the large-population analysis is time-consuming, labor-consuming and expensive; for cross-species research or molecular identification, in order to ensure amplification efficiency and accuracy, specific amplification primers need to be designed for different species respectively, and the input cost and the technical difficulty are both greatly increased. Generally, the resequencing technology can obtain the mitochondrial genome sequence of the bovine animal in high throughput and across species, however, as the mitochondrial genome is extremely small compared with the nuclear genome, the mitochondrial genome sequence actually occupies a very small proportion in the data obtained by resequencing, thereby causing great data waste.

In the field of preparation of kits, there are many practical problems to be solved in practical application.

Disclosure of Invention

The invention provides a bovine mitochondrial genome capture probe kit to solve the problems, and in order to achieve the purpose, the invention adopts the following technical scheme:

a bovine mitochondrial genome capture probe kit comprises a probe which is obtained by DNA sequence design according to bovine mitochondrial genes, wherein the probe is constructed by mixing amplification products of each bovine with equal mass, performing interruption treatment on the mixed amplification products of each bovine by using an ultrasonic crusher, and performing PCR amplification labeling and enzyme digestion by using a synthesized biotin tag and a phosphorylation primer.

In addition, a method for capture of bovine mitochondrial genome is provided, the method comprising the steps of:

1) design of Long fragment amplification primers

Collecting a reference mitochondrial genome sequence of the bovine from an NCBI database, screening a conserved region through multiple alignment, designing a specific universal long-fragment amplification primer for the mitochondrial genome of the bovine on the conserved region by using the primer, wherein the lengths of amplification products are 8892bp and 7966bp respectively;

2) amplification of mitochondrial genome and recovery of PCR products

Respectively amplifying DNA of different bovine species by using the long-fragment amplification primers, setting a PCR program to be subjected to operations of pre-denaturation, annealing, extension and circulation, and then purifying each amplification positive product by using different agarose gel purification recovery kits for later use;

3) construction of the Probe

a. Respectively carrying out concentration detection on the products purified and recovered by the agarose gel, and then mixing the products with equal mass;

b. and (3) performing interruption treatment on proper double distilled water of the product after equal-mass mixing by using an ultrasonic crusher, wherein the interruption treatment conditions are as follows: 15s of interval is interrupted for 30s, and 7 cycles are carried out;

c. preparing a terminal repairing mixture, adding double distilled water, End Repair Buffer and End Repair Enzyme Mix into a mixing device according to the volume ratio of 8:7:5, uniformly mixing by vortex, uniformly mixing with a fragmented sample to obtain a solution, and incubating for 30min at 20 ℃ in a mixing instrument to obtain a terminal repairing mixture; and the End Repair Buffer is an End Repair Buffer (10 ×);

d. adding magnetic beads into the end repairing mixture in the step c, uniformly mixing in a vortex mode, standing at room temperature for 10min, transferring the sample onto a magnetic frame for 3-5min, removing waste liquid after the liquid is clarified, continuously adding 200 mu L of 80% alcohol solution for flushing for 30s, removing the waste liquid, repeatedly cleaning for 2 times, and opening the cover for about 2-3min to volatilize alcohol;

e. adding double distilled water, A-Tailing Buffer and A-Tailing Enzyme in a ratio of 42:5:3 into a mixing device in sequence, adding the mixture into the step d, performing vortex mixing, and incubating for 30min at 30 ℃ in a mixing instrument; and the A-labeling Buffer is A-labeling Buffer (10 ×);

f. adding 2 times of PEG/NaCl solution into the step e according to the volume ratio, uniformly mixing by vortex, standing at room temperature for 10min, transferring the sample to a magnetic frame, removing waste liquid after the liquid is clarified, continuously adding 80% alcohol solution for washing, removing the waste liquid, repeatedly washing for 2-3 times, and volatilizing alcohol to obtain a mixture A;

g. sequentially adding double distilled water, a Ligation Buffer and DNA Ligation into a mixing device according to the volume ratio of 32:10:5 to obtain a mixture B, transferring the mixture B into the cleaned mixture A in the step f, adding an Adapter accounting for 3/47 of the volume of the mixture B, and then placing the mixture in a constant-temperature mixer for incubation at 20 ℃ for 15 min; and the LigationBuffer is a Ligation Buffer (5 ×);

h. adding a proper amount of PEG/NaCl solution into the step g, uniformly mixing the mixture in a vortex mode, standing the mixture at room temperature for 10min, transferring the mixture to a magnetic frame, removing waste liquid after the liquid is clarified, continuously adding 80% alcohol solution for washing, removing the waste liquid, repeatedly washing for 2-3 times, and volatilizing alcohol; adding double distilled water for dissolving, standing at room temperature for 5-10min, transferring to magnetic rack, and collecting supernatant;

i. performing library amplification and cleaning after amplification;

j. cutting gel fragments at the position of 200-300bp under the electrophoresis condition of the amplified and cleaned product, recovering by using an OMEGA kit, and measuring the concentration;

k. carrying out amplification labeling and magnetic bead purification operations;

taking 10 XNEB Buffer and restriction enzyme according to the volume ratio of 5:1.5, supplementing double distilled water for quantification, uniformly mixing by using vortex, and placing in a PCR instrument for incubation at 37 ℃ for 1h to finish the first enzyme digestion; taking 10 XNEBBuffer and restriction enzyme according to the volume ratio of 5:1, supplementing double distilled water for quantification, and placing in a PCR instrument for incubation at 37 ℃ for 3h to finish the second enzyme digestion.

Optionally, the bovine mitochondrial genome of the bovine animal has a full length of 15-17 kb.

Optionally, the primers include an F primer and an R primer.

Optionally, the F primer sequence comprises

CAGCGCAATCCTATTYAAGAGTCCATATCG sequence and

ATGAGGCATAATYATAACCAGCTCAATYTGC sequence.

Optionally, the R primer sequence comprises

CTWGCTAGTAGTCATCARGTGGCTATTAGTG and

TCCGGTCTGAACTCAGATCACGTAGGACT sequence.

Compared with the prior art, the invention has the beneficial technical effects that:

1. the invention designs a specific cattle animal mitochondrial genome universal long-fragment amplification primer on a conserved region by carrying out multiple comparison and screening on cattle multi-species mitochondrial genome sequences.

2. The invention carries out PCR amplification on the total DNA of a plurality of species by using a designed universal long-fragment primer, recovers long-fragment amplification products of each species, randomly breaks the long-fragment amplification products after equal mixing, and obtains a high-coverage capture probe sequence of the mitochondrial genome of the cross-bovine animal through the procedures of library amplification, biotin tag addition and the like.

3. The invention can complete the capture sequencing of any mitochondrial genome in the genus Bos by matching the obtained probe sequence with a commercial hybridization capture reagent, realizes the cross-species, high-flux and accurate acquisition of the mitochondrial genome of the animal belonging to the genus Bos, can complete the capture sequencing of any mitochondrial genome in the genus Bos by matching with the commercial hybridization capture reagent, and has the advantage of convenience.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to embodiments thereof; it should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention relates to a bovine mitochondrial genome capture probe kit, which integrates the following embodiments:

it should be noted that the reagents used in the examples are as follows:

2 × A9 LongHiFi PCR MasterMix: beijing aldley organisms; agarose gel purification recovery kit: beijing aldley organisms; KAPA Hyper Prep Kit: KAPA, Inc., USA; KAPA HTP Library preparation kit: KAPA, Inc., USA;

probes and Reagents Kit: IDT corporation of America;

gel Extraction Kit: omega, USA; phusion super fidelity DNA polymerase: NEB corporation, USA; btsl restriction enzyme: NEB corporation, USA; NEB Buffer: NEB corporation, USA; phusion PCR kit: NEB corporation, usa. Therefore, the English reagent name related in the invention can be processed in the invention, and is not described in detail.

Example 1:

1) design of Long fragment amplification primers

Collecting a reference mitochondrial genome sequence of the bovine animal from an NCBI database, and screening a conserved region through multiple alignment, wherein the total length of the bovine mitochondrial genome of the bovine animal is 15-17 kb; specific bovine mitochondrial genome universal long fragment amplification primers are designed on a conserved region by using primers, the lengths of amplification products are 8892bp and 7966bp respectively, the primers comprise an F primer and an R primer, and the sequence of the F primer comprises

CAGCGCAATCCTATTYAAGAGTCCATATCG sequence and

ATGAGGCATAATYATAACCAGCTCAATYTGC sequence; the R primer sequence

Including CTWGCTAGTAGTCATCARGTGGCTATTAGTG and

TCCGGTCTGAACTCAGATCACGTAGGACT sequence;

2) amplification of mitochondrial genome and recovery of PCR products

3) construction of the Probe

c. preparing a terminal repairing mixture, adding double distilled water, End Repair Buffer (10 x) and End Repair Enzyme Mix into a mixing device according to the volume ratio of 8:7:5, uniformly mixing by vortex, uniformly mixing with a fragmented sample to obtain a solution, and placing the solution in a mixing instrument to incubate for 30min at 20 ℃ to obtain a terminal repairing mixture;

d. adding magnetic beads into the end repairing mixture in the step c, uniformly mixing in a vortex mode, standing at room temperature for 10min, transferring the sample to a magnetic frame for about 3min, removing waste liquid after the liquid is clarified, continuously adding 200 mu L of 80% alcohol solution to flush for 30s, removing the waste liquid, repeatedly cleaning for 2 times, and opening the cover for about 2-3min to volatilize alcohol;

e. adding double distilled water, A-Tailing Buffer (10 x) and A-Tailing Enzyme in a ratio of 42:5:3 into a mixing device in sequence, adding the mixture into the step d, performing vortex mixing, and incubating for 30min at 30 ℃ in a mixing instrument;

g. sequentially adding double distilled water, a Ligation Buffer (5 x) and DNA Ligation into a mixing device according to the volume ratio of 32:10:5 to obtain a mixture B, transferring the mixture B into the cleaned mixture A in the step f, adding an Adapter accounting for 3/47 of the volume of the mixture B, and then placing the mixture in a constant-temperature mixer for incubation at 20 ℃ for 15 min;

i. performing library amplification and cleaning after amplification;

And the long fragment PCR amplification system in this example is shown in Table 1 below:

TABLE 1

Composition (I)	Adding amount of
		F primer	0.5μM
R primer	0.5μM
		2×A9 LongHiFi PCR MasterMix	25μL
DNA	20ng
		ddH2O	Make up to 50 μ L

In the embodiment, by carrying out multiple comparison and screening on the mitochondrial genome sequences of multiple species of the bovine, and designing the specific universal long-fragment amplification primer for the mitochondrial genome of the bovine on the conserved region, cross-species, high-throughput and accurate acquisition of the mitochondrial genome of the bovine can be effectively realized, and any species of mitochondrial genome in the bovine can be captured and sequenced by matching with a commercial hybrid capture reagent, so that the method has the advantage of convenience.

Example 2:

a bovine mitochondrial genome capture probe kit comprises a probe which is obtained by DNA sequence design according to bovine mitochondrial genes, and the probe construction comprises the steps of mixing amplification products of all bovine animals in equal mass, breaking the mixed amplification products of all bovine animals by using an ultrasonic breaker, performing PCR amplification labeling by using a synthesized biotin tag and a phosphorylation primer, and performing enzyme digestion.

(1) mitochondrial genome amplification and Sanger sequencing

Collecting a reference mitochondrial genome sequence of the bovine animal from an NCBI database, and screening a conserved region through multiple alignment, wherein the total length of the bovine mitochondrial genome of the bovine animal is 16.5 kb; specific cattle animal mitochondrial genome universal long-fragment amplification primers are designed on the conserved region by using the primers, the lengths of amplification products are 8892bp and 7966bp respectively, and the long-fragment amplification primers are used for carrying out PCR amplification on DNA of four cattle animals. Purifying the amplified positive products by using an agarose gel purification recovery kit, and sequencing the recovered products by Sanger to obtain a mitochondrial genome complete sequence;

(2) high throughput sequencing library construction

In order to ensure the quality of the library and the uniformity of the sample, 4 whole genome libraries are respectively constructed from four cattle in the embodiment, KAPA Hyper Prep Kit is used, and the experimental steps are optimized according to an operation manual, and the specific steps are as follows:

1) pretreatment: performing concentration quantification by using the Qubit3.0 to determine the initial addition amount of the DNA sample;

2) pretreatment: calculating the required DNA volume by starting amount, filling up to 53. mu.L system using ddH2O, and breaking treatment with ultrasonicator, and the program is set to break 15s interval for 30s, 7 cycles;

3) end repair and addition of A-Tailing: taking 50 mu L of fragmented DNA samples into a PCR tube, adding 7 mu L of EndRepiair & A-labeling Buffer and 3 mu L of End Repiair & A-labeling Enzyme Mix, uniformly mixing by vortex, placing in a PCR instrument, setting the program as incubating at 20 ℃ for 30min, then incubating at 65 ℃ for 30min, and finally storing at 4 ℃;

4) connecting a joint: putting 60 mu L of the reaction solution in the previous step into a 1.5mL tube, adding 2.5 mu L of Adapter stock, 7.5 mu L of PCR-grade water, 30 mu L of Ligation Buffer and 10 mu L of DNA Ligase, blowing and uniformly mixing to obtain 110 mu L of solution, and placing the solution in a constant-temperature mixer for incubation at 20 ℃ for 15 min;

5) cleaning after connection: adding 0.8 multiplied KAPA Pure Beads into the reaction liquid in the previous step to obtain a mixed sample, uniformly mixing in a vortex mode, standing at room temperature for 10min, transferring the sample to a magnetic frame for about 3min, removing waste liquid after the liquid is clarified, continuously adding 200 mu L of 80% alcohol solution to flush for 30s, removing the waste liquid, repeatedly cleaning for 2 times, uncovering for about 2-3min to volatilize alcohol, but not drying magnetic Beads too much;

6) dissolving: taking off the centrifuge tube from the magnetic frame, adding 25 μ L of double distilled water for dissolving, standing at room temperature for 5min, transferring to the magnetic frame, and taking the supernatant in a new 1.5mL centrifuge tube after about 2 min;

7) library amplification: 25 μ L of KAPA HiFi HotStart Ready Mix (2 ×), 5 μ L of KAPALibrary Amplification Primer Mix (10 ×) and 20 μ L of Adapter-ligated library DNA were mixed in a PCR tube and amplified, respectively, according to the following PCR reaction program: pre-reacting at 98 deg.C for 45s, denaturing at 98 deg.C for 15s, annealing at 60 deg.C for 30s, extending at 72 deg.C for 30s, incubating at 72 deg.C for 1min, and storing at 4 deg.C for 7 cycles;

8) and (3) cleaning after amplification: continuously adding 1 multiplied KAPA Pure Beads into a PCR tube after library amplification, uniformly mixing by vortex, standing at room temperature for 10min, transferring a sample to a magnetic frame for about 3min, removing waste liquid after the liquid is clarified, continuously adding 200 mu L of 80% alcohol solution to wash for 30s, removing the waste liquid, repeatedly cleaning for 2 times, opening a tube cover to air for about 2-3min, volatilizing alcohol, taking down a centrifuge tube from the magnetic frame, adding 25 mu L of double distilled water to dissolve, standing at room temperature for 5min, then moving to the magnetic frame, and taking supernatant into a new 1.5mL centrifuge tube after about 2 min;

9) cutting and recycling the rubber: gel fragments were excised at approximately 350-550bp positions after running the product from the previous step, recovered using an OMEGA kit and assayed using Qubit 3.0.

(3) Hybrid Capture

The constructed libraries of four bovine species were mixed in equal amounts, and the mixed libraries were captured using a bovine hybrid probe, requiring equal quality of probe and library, in this example using Hybridization capture of DNA library usage

The tests and Reagents Kit, the experimental operation was adjusted according to the manual, as follows:

a) respectively concentrating the probe and the library to be dry powder by using a vacuum centrifugal concentrator;

b) adding 8.5. mu.L Hybridization Buffer (2X), 2.7. mu.L Hybridization Buffer Enhancer and 1.8. mu.L nucleic-Free Water to a 1.5mL centrifuge tube containing the library powder, vortexing and mixing, and adding 5. mu.L double distilled Water to a 1.5mL centrifuge tube containing the probe powder to dissolve;

c) transferring the library mixture to a 0.2mL tube, and placing the tube in a PCR instrument for denaturing DNA at 95 ℃ for 10 min;

d) adding 4 mu L of probe into the PCR tube of the previous reaction, mixing uniformly, reacting for 4 hours at 65 ℃ in a PCR instrument, and setting the temperature of a hot cover to be 75 ℃;

e) preparing an elution buffer: 500 muL of 1 xBead Wash Buffer, 300 muL of 1 xWash Buffer I, 200 muL of 1 xWash Buffer II, 200 muL of 1 xWash Buffer III and 400 muL of 1 xStringent Wash Buffer are required to be configured and obtained according to the corresponding proportion of Buffer dilution in the corresponding kit respectively; wherein 100 mu L of Wash Buffer I and 400 mu L of Stringent Wash Buffer are placed in a mixing machine for preservation at 65 ℃, and 200 mu L of Wash Buffer I is preserved at room temperature (15-25 ℃);

f) preparing magnetic beads: firstly, the first step is to

M-270Streptavidin beads are placed on a vertical mixer to be balanced for at least 30min, and are taken down and mixed evenly for 15s in a vortex mode; then 100 mu L of magnetic beads are put into a 1.5mL centrifuge tube, the centrifuge tube is placed on a magnetic frame to separate the magnetic beads from the liquid, and the liquid is removed; add 200. mu.L of 1 xBead Wash Buffer, after vortex oscillation for 10s, putting the magnetic beads on the magnetic frame again to separate the magnetic beads from the liquid, removing the liquid, and washing again; adding 100 mu L of 1 xBead Wash Buffer into a centrifuge tube, uniformly mixing, transferring the solution into a 0.2mL tube, placing the tube in a magnetic frame, and removing the liquid after the magnetic beads are adsorbed;

g) combining: firstly, transferring a reaction product treated at 65 ℃ for 4 hours into a magnetic bead tube prepared in the last step, uniformly blowing and stirring, placing the reaction product in a PCR instrument for reacting for 45min at 65 ℃, taking out the reaction product every 12min, and shaking for 1 time, wherein each time lasts for 3 s;

h) washing at 65 ℃: adding 100 mu L of Wash Buffer I stored at 65 ℃ into the product in the previous step, uniformly mixing by vortex, transferring into a new 1.5mL centrifuge tube, placing on a magnetic frame, separating magnetic beads from liquid, and removing the liquid; adding 200 μ L of Stringent Wash Buffer stored at 65 deg.C, gently blowing, mixing, incubating at 65 deg.C for 5min, placing on a magnetic frame, separating magnetic beads from liquid, removing liquid, and washing with Stringent Wash Buffer once again;

i) washing at room temperature: adding 200 mu L of Wash Buffer I stored at room temperature into the reactant in the previous step, uniformly mixing for 2min by vortex, placing the mixture on a magnetic frame to separate magnetic beads from liquid, and removing the liquid; adding 200 mu L of Wash Buffer II stored at room temperature into the reactant in the previous step, uniformly mixing for 1min by vortex, placing the mixture on a magnetic frame to separate magnetic beads from liquid, and removing the liquid; adding 200 mu L of 1 × Wash Buffer III stored at room temperature into the reactant in the previous step, uniformly mixing by vortex for 30s, placing the mixture in a magnetic frame to separate magnetic beads from liquid, and removing the liquid;

j) magnetic bead resuspension: taking down the centrifugal tube from the magnetic frame, adding 20 mu L of double distilled water into the tube, and uniformly mixing by vortex;

k) PCR enrichment: to this solution, 25. mu.L of 2 XKAPA HiFi HotStart ReadyMix, 2.5. mu.L of 10. mu.M were added

P5 primer、2.5μL 10μM

Putting the P7 primer and 20 mu L of mixed solution with the magnetic beads into a 0.2mL tube, and uniformly mixing by vortex oscillation; the PCR program is pre-reaction at 98 ℃ and 45 DEG Cs, denaturation at 98 ℃ for 15s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, incubation at 72 ℃ for 1min, storage at 4 ℃ for 6 cycles, and hot cover temperature of 105 ℃;

l) purification: add 80. mu.L (1.6X)

XP beads are added into the PCR product, evenly mixed by vortex, placed for a few minutes at room temperature and then transferred to a magnetic frame, and the liquid is removed;

m) elution: the PCR tube was removed from the magnetic stand and 22. mu.L of

Adding Buffer EB into a tube, uniformly mixing by vortex, placing for a few minutes, transferring the mixture to a magnetic frame, and transferring the supernatant into a new 1.5mL centrifuge tube;

n) concentration detection: detecting whether the position of the strip is correct or not by electrophoresis, and measuring the concentration by using the Qubit 3.0;

o) sequencing: the product was sent to the genealogical gene for sequencing using Illumina Hiseq X-Ten sequencer.

(4) Data analysis

A) Raw data processing

DNA library capture was followed by sequencing using the Illumina Hiseq X-ten platform and raw off-machine data was stored in fastq format. The quality of the raw data was checked using FastQC software, statistics were taken of Q20, Q30, GC content, sequence length distribution, etc. And (3) performing data quality control by using Clip & Merge software, deleting reads which contain joints, have the quality of less than 30 and are shorter than 20bp, and fusing the reads.

B) Sequencing data alignment

Since mitochondrial DNA is circular DNA, the use of circular mapper is more favorable for splicing of mitochondrial genomes. The sequences were aligned with default parameters using JN817298(Bos indicus), KU891851(Bos grunniens), MF614103(Bos frontalis), V00654(Bos taurus), AB074968(Bos taurus), KM233417(Bos mutus), FJ997262(Bos javanius) as reference sequences, respectively. The repetitive sequences resulting from the amplification were deleted using the Dedup software. The QualiMap software was used to count endogenous DNA content, coverage, alignment mass distribution, base ratio of reads aligned to the reference sequence, etc.

C) Capture effect and accuracy analysis

Based on the mitochondrial sequences obtained by PCR amplification and Sanger sequencing, it is believed that the differential sites in the mitochondrial genome obtained by capture sequencing are caused by sequencing errors. And counting the number of correct sites in the capture sequencing to obtain the accuracy of the capture sequencing.

Test results

PCR product Sanger sequencing results:

and performing Sanger sequencing on the PCR products to respectively obtain the complete sequences of mitochondrial genomes of the common cattle, the domesticated yaks, the tumor cattle and the gayal cattle. The mitochondrial genome sequences obtained by the four samples through Sanger sequencing are subjected to multiple comparison, the difference between every two bovine animal species is 2-8%, and the comprehensive difference between the four species is about 10%, so that the important significance of developing the cross-species mitochondrial genome capture probe for bovine animals is further proved.

2. And (3) capturing a result:

catching 4 libraries of which the libraries are mixed in equal amount by using a hybrid probe, purifying the captured products, and identifying the captured products by agarose gel electrophoresis, wherein the result shows that a zone segment with the distribution of about 400-600bp is not a single zone; the concentration was measured using Qubit3.0 and the concentration of the capture product of the bovine probe was 51.7 ng/. mu.L. The product was sent to the genealogical gene for sequencing using IlluminaHiseq X-Ten sequencer.

3. Specificity of Probe for capturing DNA of Single species

Taking the gayal sequence as an example. The gayal sequence is split from the capture sequence of the mixed library and is compared with 7 reference sequences of 6 bovine animals. The result shows that when the gayal sequence MF614103(Bos fronttails) is selected as the reference sequence, all indexes are optimal, especially when the coverage degree is 5 x, only the sequence MF614103 can reach 100%, and the bovine mitochondrial genome capture probe has stronger specificity when capturing single species DNA. The specific results of the probe capturing the gayal DNA are shown in table 2.

TABLE 2

4. Probe capture effect and accuracy

Selecting the sequence of the same kind as the tested sample as a reference sequence to carry out sequencing data comparison analysis, and mainly analyzing the following indexes: (1) coverage degree: namely the proportion of the mitochondrial genome which can be covered by sequencing reads; (2) the accuracy is as follows: and analyzing the consistency of the mitochondrial sequences obtained by the capture sequencing and the Sanger sequencing by taking the sequence obtained by combining the PCR amplification with the Sanger sequencing as a standard. The results are shown in Table 3.

TABLE 3

Reference genome	Sample name	Average sequencing depth	Coverage of greater than 5 × (%)	Accuracy (%)
					V00654(Bos taurus)	Common cattle	368.26	100	100％
JN817298(Bos indicus)	Tumor cattle	240.92	99.47	100％
					KU891851(Bos grunniens)	Domestic yak	291.06	100	100％
MF614103(Bos frontalis)	Gayal	242.63	100	100％

As can be seen from the analysis in Table 2, the constructed hybrid probe capture can be intuitively and clearly seen, the complete sequence of the bovine mitochondrial genome can be captured, and compared with the Sanger sequencing result, the sequencing accuracy is 100%, and the visible probe has higher capture efficiency and higher accuracy.

In combination, the method can effectively complete the capture sequencing of any mitochondrial genome in the bovine, realizes the cross-species, high-throughput and accurate acquisition of the mitochondrial genome of the bovine animal, can complete the capture sequencing of any mitochondrial genome in the bovine by matching with a commercial hybridization capture reagent, and has the advantage of convenience.

Although the invention has been described above with reference to various embodiments, it should be understood that many changes and modifications may be made without departing from the scope of the invention. That is, the methods, systems, and devices discussed above are examples. Various configurations may omit, substitute, or add various procedures or components as appropriate. For example, in alternative configurations, the methods may be performed in an order different than that described, and/or various components may be added, omitted, and/or combined. Moreover, features described with respect to certain configurations may be combined in various other configurations, as different aspects and elements of the configurations may be combined in a similar manner. Further, elements therein may be updated as technology evolves, i.e., many elements are examples and do not limit the scope of the disclosure or claims.

It is intended that the foregoing detailed description be regarded as illustrative rather than limiting, and that it be understood that it is the following claims, including all equivalents, that are intended to define the spirit and scope of this invention. The above examples are to be construed as merely illustrative and not limitative of the remainder of the disclosure. After reading the description of the invention, the skilled person can make various changes or modifications to the invention, and these equivalent changes and modifications also fall into the scope of the invention defined by the claims.

Claims

1. A bovine mitochondrial genome capture probe kit is characterized by comprising the construction of a probe, wherein the probe is obtained by DNA sequence design according to bovine mitochondrial genes, and the construction of the probe comprises the equal-mass mixing of amplification products of each bovine; breaking the amplification products of the mixed bovine animals by using an ultrasonic crusher; and carrying out PCR amplification marking and enzyme digestion on the synthesized biotin label and the phosphorylation primer.

2. A method for capture of the mitochondrial genome of bovine animals comprising performing capture and sequencing analysis using the probe of claim 1.

3. Method according to claim 2, characterized in that it comprises the following steps:

1) design of Long fragment amplification primers

2) amplification of mitochondrial genome and recovery of PCR products

3) construction of the Probe

b. adding proper double distilled water into the product after equal mass mixing, and performing interruption treatment by using an ultrasonic crusher, wherein the interruption treatment conditions are as follows: 15s of interval is interrupted for 30s, and 7 cycles are carried out;

c. preparing a terminal repairing mixture, adding double distilled water, End Repair Buffer and End Repair Enzyme Mix into a mixing device according to the volume ratio of 8:7:5, uniformly mixing by vortex, uniformly mixing with a fragmented sample to obtain a solution, and incubating for 30min at 20 ℃ in a mixing instrument to obtain a terminal repairing mixture;

d. adding magnetic beads into the terminal repairing mixture in the step c, uniformly mixing in a vortex mode, standing at room temperature for 10min, transferring the sample onto a magnetic frame for 3-5min, removing waste liquid after the liquid is clarified, continuously adding 80% alcohol solution to wash for 30s, removing the waste liquid, repeatedly cleaning for 2 times, and opening a cover for 2-3min to volatilize alcohol;

e. adding the double distilled water, the A-lacing Buffer and the A-lacing Enzyme into a mixing device in sequence according to the volume ratio of 42:5:3, adding the mixture into the step d, uniformly mixing the mixture in a vortex manner, and incubating the mixture for 30min at the temperature of 30 ℃ in a uniformly mixing instrument;

g. sequentially adding double distilled water, a Ligation Buffer and DNA Ligation into a mixing device according to the volume ratio of 32:10:5 to obtain a mixture B, transferring the mixture B into the cleaned mixture A in the step f, adding an Adapter accounting for 3/47 of the volume of the mixture B, and then placing the mixture in a constant-temperature mixer for incubation at 20 ℃ for 15 min;

i. performing library amplification and cleaning after amplification;

j. cutting agarose gel fragments at the position of 200-300bp under the electrophoresis condition of the amplified and cleaned product, recovering by using an OMEGA kit, and measuring the concentration;

4. The method of claim 3, wherein the bovine mitochondrial genome of the bovine animal has a full length of 15-17 kb.

5. The method of claim 3, wherein the primers comprise an F primer and an R primer.

6. The method of claim 5, wherein the F primer sequence comprises CAGCGCAATCCTATTYAAGAGTCCATATCG and ATGAGGCATAATYATAACCAGCTCAATYTGC sequences.

7. The method of claim 5, wherein the R primer sequences comprise CTWGCTAGTAGTCATCARGTGGCTATTAGTG and TCCGGTCTGAACTCAGATCACGTAGGACT sequences.