CN116121437B - SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding - Google Patents

SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding Download PDF

Info

Publication number
CN116121437B
CN116121437B CN202211384412.0A CN202211384412A CN116121437B CN 116121437 B CN116121437 B CN 116121437B CN 202211384412 A CN202211384412 A CN 202211384412A CN 116121437 B CN116121437 B CN 116121437B
Authority
CN
China
Prior art keywords
snp
marker combination
mangrove
snp marker
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202211384412.0A
Other languages
Chinese (zh)
Other versions
CN116121437A (en
Inventor
柳凤
刘静萍
卢乃会
姚全胜
詹儒林
李国平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South Subtropical Crops Research Institute CATAS
Original Assignee
South Subtropical Crops Research Institute CATAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South Subtropical Crops Research Institute CATAS filed Critical South Subtropical Crops Research Institute CATAS
Priority to CN202211384412.0A priority Critical patent/CN116121437B/en
Publication of CN116121437A publication Critical patent/CN116121437A/en
Application granted granted Critical
Publication of CN116121437B publication Critical patent/CN116121437B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The application provides a Single Nucleotide Polymorphism (SNP) marker combination of a mangrove variety and application of the SNP marker combination in breeding of the mangrove variety, and relates to the technical field of molecular breeding. The SNP molecular marker combination provided by the application can avoid the influence of environmental conditions and considered subjective factors, and has important significance in the aspects of analysis of genetic diversity of germplasm resources of mangrove, variety authenticity and purity identification. The SNP marker combination can be used for the authenticity and identity authentication of the manger, and has the advantages of more applicable varieties, low cost, high efficiency and the like.

Description

SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding
Technical Field
The application relates to the technical field of molecular breeding, in particular to a SNP marker combination of a mangrove variety and application of the SNP marker combination in the breeding of the mangrove variety.
Background
The mangiferum (academic name: mangifera indica l.) is a plant of the family anacardiaceae, genus Mangifera. At present, the breeding mode of the mangiferous fruits mainly comprises introduction and domestication, seed selection of the actual seeds, artificial hybridization breeding and the like. The main cultivated varieties in the main production area are mostly excellent domesticated varieties led from abroad, and a small part of the main cultivated varieties are local breeding varieties, and China does not have autonomous breeding mange fruit varieties (Huang Guodi and the like, 2013) with stronger competitiveness, so that the method has important significance for precisely identifying and classifying the existing germplasm resources for cross breeding.
The traditional phenotype-based genetic diversity analysis method for germplasm resources is widely applied to the mange. The existing research results show that the phenotype analysis can more intuitively distinguish materials with obvious genetic differences, but is easy to judge by environmental and human subjective factors, and can cause certain influence on the research results. The molecular marking technology is not easily influenced by environmental conditions and considered subjective factors, so that the difference between materials can be accurately identified, the genetic diversity of the germplasm resources of the mangrove can be accurately reflected (Zhang Cuixian, 2014), and the molecular marking technology has important roles in aspects such as gene positioning and cloning (Zheng and the like, 2022), molecular marking assisted breeding (such as Yiming and the like, 2021), hybrid fruit authenticity identification (Yao Quansheng and the like, 2010) and the like.
With the publication of the genome data of the mangrove, the molecular marker technology of the mangrove is rapidly developed. The molecular markers currently utilized in the analysis of genetic diversity of germplasm resources of mangiferum are SRAP (Luo Shixing et al, 2018), SSR (Yao Quansheng et al, 2010), AFLP (Luo Haiyan et al, 2015), ISSR (should eastern mountain et al, 2012), CAPS (shodo, a., tarora, k., makishi, y.et al, 2013), SNP (Sherman, a., rubinstein, m., ehed, r.et al, 2015), and the like. The molecular markers can effectively distinguish germplasm resources, and provide good references for genetic relationship analysis, germplasm identification and variety breeding.
The phenotype identification period of the germplasm resources of the mangrove is long, the workload is large, and the mangrove is easily influenced by environmental conditions and artificial subjectivity. The existing ISSR, SRAP, SSR and other molecular markers have the disadvantages of complex operation, long experimental period and low flux. The art lacks a low-cost, high-efficiency and more applicable variety type of cerbera manghas germplasm identification mode.
Disclosure of Invention
In order to solve the problems, the application develops the SNP marker combination which can completely distinguish 145 parts of mangrove germplasm, can be used for the authenticity and identity authentication of the mangrove, and has the advantages of more applicable variety types, low cost, high efficiency and the like.
In order to achieve the above object, a first aspect of the present application provides a SNP marker combination of a mangrove variety, the SNP markers including at least 2 of the SNP sites shown in table 1:
TABLE 1
The second aspect of the application provides application of the SNP marker combination in the breeding of mangrove.
Preferably, the application comprises the application in the classification of the cerbera species or the identification of the authenticity of the cerbera species.
Further preferably, when the SNP marker combinations are used for classification of the mangrove fruit species, the classification is performed according to the similarity degree of the SNP marker combinations contained in the sample to be detected.
Further preferably, when the SNP marker combination is used for identifying the authenticity of the manger, comparing the SNP marker combination of the sample to be identified and the target manger, and judging that the gene of the sample to be identified is derived from the target manger breed if the similarity of the SNP marker combination of the sample to be identified reaches 90%.
The third aspect of the application provides a kit for breeding mangrove, comprising a primer group capable of amplifying the SNP marker combination of claim 1;
different bindable fluorescent marker sequences are respectively arranged in the first upstream primer and the second upstream primer.
Preferably, the fluorescent label in the bindable fluorescent label sequence is FAM or HEX. In some embodiments of the application, the first upstream primer comprises a fluorescent tag sequence that binds FAM, the sequence of which is shown in SEQ ID No. 154: GAAGGTGACCAAGTTCATGCT; the second upstream primer comprises a fluorescent marker sequence capable of binding HEX, and the sequence of the second upstream primer is shown as SEQ ID NO. 155: GAAGGTCGGAGTCAACGGATT.
Preferably, the primer set includes a primer set corresponding to a SNP marker among the primer sets shown in Table 2:
TABLE 2
Preferably, the kit further comprises fluorescent PCR detection reagents.
Further preferably, the PCT reaction system of each primer set includes: 2 XPRMS 2. Mu.L, first upstream primer 0.06. Mu.L, second upstream primer 0.06. Mu.L, universal downstream primer 0.16. Mu. L, DNA template 1. Mu.L and ultra pure water 0.72. Mu.L.
Further preferably, the PCR cycling program sequentially comprises: 94 ℃ for 15min;94℃for 20s,65℃for 1min (0.7℃decrease per cycle) and 10 cycles were repeated; repeating 35 cycles at 94℃for 20s at 57℃for 1 min; 1min at 37 ℃.
Compared with the prior art, the application has the beneficial effects that:
the application provides a group of SNP molecular marker combinations which can be used for breeding of mangrove, comprising at least two of SNP 1-SNP 51. The SNP molecular marker combination provided by the application can avoid the influence of environmental conditions and considered subjective factors, and has important significance in the aspects of analysis of genetic diversity of germplasm resources of mangrove, variety authenticity and purity identification. The SNP marker combination can be used for the authenticity and identity authentication of the mangrove.
Drawings
FIG. 1 is a flow chart of SNP marker combination screening of a mangrove variety of the application;
FIG. 2 is a genetic map constructed by 145 parts of mangrove by using the SNP marker combination pair of the application; wherein different branches represent different mango materials;
FIG. 3 is a graph showing the results of PCA analysis of 145 parts of the germplasm resources of a mango tree using the SNP marker combination of the application; wherein, the numerical value represents the number of the manger-like fruit sample.
FIG. 4 is a graph showing the results of analysis of a phylogenetic tree of germplasm to be identified and target germplasm using 30 pairs of marker combinations (MAF > 0.3) among SNP marker combinations according to the present application.
Detailed Description
The following detailed description of the present application is provided in connection with examples, which are, of course, merely exemplary of some, but not all embodiments of the application. It is intended that all other embodiments obtained by those skilled in the art based on these embodiments of the present application fall within the scope of the present application.
In the present application, "CHR" refers to a chromosome. In the present application, "POS" refers to the site location. In the present application, "REF" refers to the base of the reference site. "ALT" refers to the base that corresponds to the change.
Example 1
The screening process of the core SNP marker combinations of 51 mangiferous fruit varieties is shown in figure 1, and comprises the following steps:
SLAF-seq genome sequencing
About 0.1g of young leaf of the mangiferum is taken, total DNA of the leaf is extracted by using a CTAB method, the integrity of the DNA is detected by agarose electrophoresis, double enzyme digestion is carried out by using EcoRI-NIaIII, and after a connector is added, fragments with about 300-500bp are screened for library construction and sequencing. For specific procedures for sequencing in a library, reference is made to the method of Sun et al (Sun X, liu D, zhang X, et al SLAF-seq: an efficient method of large-scale De novo SNP discovery and genotyping using high-throughput sequencing [ J ]. PloS one,2013,8 (3): e 58700), and finally reads for sequencing in a library are obtained.
SNP detection
Sequencing reads obtained by simplified sequencing were aligned to the mangrove reference Genome using bwa software (Barchi, l., pietrella, M., venturi, l.et al, a chromoname-anchored eggplant Genome sequence reveals key events in Solanaceae resolution, sci Rep 9,11769 (2019), https:// doi.org/10.1038/s 41598-019-47985-w), and a population of SNPs was obtained using GATKs (McKenna a, hanna M, banks E, et al, the Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data [ J ], genome research,2010,20 (9): 1297-1303 and samtools [ (Li H, handmaker B, wysokerA, et al, the sequence alignment/map format and SAMtools [ J ]. Bioinformatics,2009,25 (16): SNP 8-2079. The final marker intersection obtained in both methods was used as a final marker for obtaining SNP 13,706.
Perfect SNP filtration
Screening for perfect SNPs was performed with slight modifications according to the standard of Liu et al (Liu, qian, zhang, yang, wu, barchi, zhao, sun, cui and Wen, 2019), the screening criteria being as follows: (1) a Minimum Allele Frequency (MAF) >0.4; (2) mismatch ratio <0.25; (3) a heterozygosity ratio of <0.5; (4) there are no other mutations at about 100bp each at SNP site. And finally obtaining 180 perfect SNPs through filtering.
4. Primer design and Synthesis
Primer synthesis primer design was performed using on-line software SNPPrimer, with the 5' of the X and Y primers each having a linker added for fluorescent universal primer match amplification, and the X primer having a linker sequence matched to FAM fluorescence: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 154), the Y primer adds a linker sequence that matches HEX fluorescence: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 155). The synthesized primers were then sent to Shanghai for synthesis.
5. And (5) primer screening.
Primer screening was performed using 15 mangiferous fruit samples and the SNP typing reagent PARMS was purchased from the marvelin organism. The reaction system is as follows:
TABLE 3PCR reaction System
Composition of the components Volume of
2×PARMS 2.00ul
Primer X (100. Mu. Mol.L) -1 ) 0.06ul
Primer Y (100. Mu. Mol.L) -1 ) 0.06ul
Primer C (100. Mu. Mol.L) -1 ) 0.16ul
DNA template (15 ng L) -1 ) 1.00ul
Ultrapure water 0.72ul
PCR reactions were performed using the ABI Quantum studio6 QS6 machine, the reaction procedure is shown in Table 3, and genotyping was performed using the instrument self-contained procedure after the reaction was completed. After screening, 51 sets of usable SNP primers were obtained in total (as shown in Table 2).
TABLE 4PCR thermal cycling program
Step (a) Temperature (temperature) Duration of time
1 94℃ 15min
2 94℃ 20s
3 65 ℃ (0.7 ℃ per cycle reduction) 1min
4 Returning to step 2, 10 cycles
5 94℃ 20s
6 57℃ 1min
7 Returning to step 6, 35 cycles
8 37℃ 1min
7. And (5) carrying out primer polymorphism statistics.
Genotyping was performed on 145 parts of the mangiferin material using the 51-group SNP primer set, and MAF, PIC and genetic diversity of the primers were calculated using Excel. The results are shown in Table 5.
Table 551 SNP primer pair 145 parts of mango genetic diversity analysis
From the above results, the obtained SNP marker loci (shown in Table 1) corresponding to the 51 sets of SNP markers are core SNP markers of the germplasm of a mangrove.
Example 2
The 51 SNP marker combinations obtained in example 1 are used for the identification of the resources of the mangrove species, comprising the following steps:
by using the 51 SNP markers obtained in example 1, 145 parts of mangrove fruit materials are distinguished by using the primer set shown in Table 2, the similarity degree of SNPs between every two samples is counted, a distance matrix is constructed, and group PCA analysis and evolutionary tree construction are performed by using the R program package poppr (Kamvar ZN, tabima JF, grunwald NJ.2014. Popr: an R package for genetic analysis of populations with clonal, partialy closed, and/or sexual reduction. PeerJ 2:e281 https:// doi. Org/10.7717/peerj.281). The higher the identity of the SNP marker between two samples, the closer the two samples are separated by the branch, and vice versa. In the PCA plot, the higher the identity of the SNP markers between two samples, the closer the two samples are, and vice versa.
The results are shown in fig. 2 and 3, which show that the 51 SNP markers provided by the application can be used for rapidly and effectively classifying the germplasm of the mange.
Example 3
The 51 SNP marker combinations obtained in example 1 are used for variety resource authenticity, comprising the steps of:
30 pairs of primer sets with MAF >0.3 were selected using the 51 sets of SNP markers obtained in example 1. Randomly selecting 8 parts (X1-X8) of unknown germplasm and 5 parts (X9-X13) of known germplasm to construct a virtual mixed population, and extracting total DNA of the leaf blades. And (3) using 30 SNP marker primer sets (MAF > 0.3) to carry out genetic analysis, comparison and analysis on the artificially constructed virtual mixed population and target germplasm (X1-X13, M1-M5), and when the similarity reaches more than 90%, the result is shown in figure 4, which shows that the germplasm to be identified is truly derived from the target germplasm.
The foregoing is merely a preferred embodiment of the present application and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present application, which are intended to be comprehended within the scope of the present application.

Claims (6)

1. The application of the SNP marker combination of the mangrove variety in the breeding of the mangrove is characterized by comprising the application in the classification of the mangrove variety or the identification of the authenticity of the mangrove variety; the SNP marker consists of the following SNP loci:
2. the use according to claim 1, wherein when the SNP marker combination is used for classification of mangrove fruit species, the classification is performed according to the degree of similarity of the SNP marker combination contained in the sample to be tested.
3. The use according to claim 2, wherein when the SNP marker combination is used for the authenticity identification of the manger-like fruit species, the SNP marker combination of the sample to be identified and the target manger-like fruit species is compared, and if the similarity of the two SNP marker combinations reaches 90%, the gene of the sample to be identified is judged to originate from the target manger-like fruit species.
4. A kit for breeding mangiferum, comprising a primer set capable of amplifying the SNP marker combination as set forth in claim 1;
each primer group comprises a first upstream primer, a second upstream primer and a universal downstream primer; the primer set comprises the primer set corresponding to the SNP marker in the following primer sets:
5. the kit of claim 4, wherein the kit comprises a bindable fluorescent marker sequence, wherein the fluorescent marker in the bindable fluorescent marker sequence is FAM or HEX.
6. The kit of claim 4 or 5, further comprising a fluorescent PCR detection reagent.
CN202211384412.0A 2022-11-07 2022-11-07 SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding Active CN116121437B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211384412.0A CN116121437B (en) 2022-11-07 2022-11-07 SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211384412.0A CN116121437B (en) 2022-11-07 2022-11-07 SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding

Publications (2)

Publication Number Publication Date
CN116121437A CN116121437A (en) 2023-05-16
CN116121437B true CN116121437B (en) 2023-10-13

Family

ID=86298038

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211384412.0A Active CN116121437B (en) 2022-11-07 2022-11-07 SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding

Country Status (1)

Country Link
CN (1) CN116121437B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1995320A2 (en) * 2007-05-23 2008-11-26 Syngeta Participations AG Polynucleotide markers
CN112280881A (en) * 2020-10-21 2021-01-29 浙江省农业科学院 SNP marker combination for identifying broccoli germplasm resources and varieties and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1995320A2 (en) * 2007-05-23 2008-11-26 Syngeta Participations AG Polynucleotide markers
CN112280881A (en) * 2020-10-21 2021-01-29 浙江省农业科学院 SNP marker combination for identifying broccoli germplasm resources and varieties and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
我国芒果主栽品种遗传多样性分析及指纹图谱构建;王明等;南方农业学报;46(07);1154-1159 *
部分杧果种质资源遗传多样性的SRAP和ISSR分析;张宇等;西南农业学报;第29卷(第9期);2045-2051 *

Also Published As

Publication number Publication date
CN116121437A (en) 2023-05-16

Similar Documents

Publication Publication Date Title
CN112289384A (en) Construction method and application of whole citrus genome KASP marker library
CN113564266B (en) SNP typing genetic marker combination, detection kit and application
WO2024104130A1 (en) Whole genome molecular marker development method utilizing degenerate primer amplification
CN108220473B (en) Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker
CN106520958B (en) Method for developing microsatellite marker locus and method for detecting length of microsatellite marker in microsatellite marker locus
CN116121437B (en) SNP (single nucleotide polymorphism) marker combination of mangiferin fruit variety and application of SNP marker combination in mangiferin fruit breeding
CN117089644A (en) MNP (MNP) marking site for identification of arundo donax varieties, primer composition, kit and application of MNP marking site
CN109161609B (en) SNP molecular marker of wheat leaf rust resistance gene Lr42, detection method and application
CN109913575A (en) A kind of KASP molecular labeling, kit and its application for identifying capsicum CMS fertility restorer gene
CN110305974B (en) PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof
CN108707684B (en) SNP (Single nucleotide polymorphism) marker related to millet flag leaf length and detection primer and application thereof
CN108642199B (en) SNP (Single nucleotide polymorphism) marker related to growth of millet flag leaves as well as detection primer and application thereof
CN106520955B (en) Development method of rice microsatellite marker locus and length detection method of microsatellite marker in microsatellite marker locus
CN106520961B (en) Corn microsatellite marker locus development method and length detection method of microsatellite markers in microsatellite marker locus
CN108715901B (en) SNP marker related to millet plant height character and detection primer and application thereof
CN106520959B (en) Development method of orchid microsatellite marker locus and method for detecting length of microsatellite marker in microsatellite marker locus
CN106636362B (en) Soybean microsatellite marker locus development method and microsatellite marker length detection method in microsatellite marker locus
CN115198030B (en) SSR molecular marker combination and SSR primer combination for identifying hybrid offspring of hippeastrum and application of SSR molecular marker combination and SSR primer combination
CN118006822B (en) Probe combination, detection system and application of water-saving drought-resistant rice breeding chip (WDR 6K)
CN113151493B (en) SSR (simple sequence repeat) marker primer group for oriental bees in Changbai mountain, PCR (polymerase chain reaction) identification method and application
WO2024168650A1 (en) Molecular marker combination for soybean genotyping and use thereof
CN115323060B (en) Fish nuclear gene molecular marker primer, molecular marker and molecular marker database
CN117821636B (en) SNP molecular marker of rice blast resistance gene Pib, primer set and application
CN114369676B (en) Primer combination, kit, detection method and application for detecting transgenic components of tobacco
CN106520960B (en) Sesame microsatellite marker locus development method and method for detecting length of microsatellite marker in microsatellite marker locus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant